Wang - Molecular Basis of Genetic Diseases

Molecular basis of

Genetic diseases

Dr Tao Wang

1.014 A V Hill Building

Wednesday 26th 2011, 10:00

E-mail: [email protected]

Molecular Basis of Genetic Diseases

Types of mutations affecting genes

e.g., mutation at regulatory region of a gene,

mutation affecting the protein product, frame

shift, splicing, etc.

Epigenetic changes affecting genes

Independent of DNA sequence change

Determinants of phenotypic expression

Genotype-phenotype correlation

Basic types of mutations Mis-sense mutation

Single nucleotide change leads to amino acid change

Example: CGC (Arg) TGC (Cys)

Nonsense mutation

Single nucleotide change introduce a stop cordon

Example: TGC (Cys) TGA (STOP)

Synonymous substitution

No amino acid change

Example: CGC (Arg) CGA (Arg)

Deletions, insertions

Trinucleotide expansion

CAGCAGCAGCAGCAGCAGCAGCAG

Over view of

Transcription and translation

Gene variations affecting any of the above process can give rise to disease phenotype by

generating abnormal polypeptides/proteins quantitatively or qualitatively.

How can a mutation cause the clinical phenotype?

Loss-of-function mutation A mutation that results in reduced or abolished protein function

e.g., thalassemia, Duchenne muscular dystrophy, fragile X syndrome

Gain-of-function mutation A mutation that results in an abnormal activity on a protein

e.g., Huntingtons disease, T-ALL

Dominant negative effect Mutant product interfere with the function of the normal product in

a heterozygote

A special case of loss-of-function

e.g., COL1A1 or COL1A2 mutation

Loss-of-function mutation (I) -- Regulatory Mutations

Haemophilia B (OMIM 306900): Promoter mutations in human factor IX gene

Bowen D J Mol Path 2002;55:1-18

2002 by BMJ Publishing Group Ltd and Association of Clinical Pathologists

Factor IX promoter region has:

Binding sites for transcription factors LF-A1/HNF4 and C/EBP

- Mutations in this region cause

Haemophilia B Leyden

Androgen response element (ARE)

- Hormonally regulated

- Amelioration effect at puberty

- Haemophilia B Brandenburg

causes lifelong haemophilia B

Autosomal recessive

Point mutation or deletion results in reduced rate of synthesis or no synthesis of one of the globin chains that make up haemoglobin.

Too few globins synthesized

Loss-of-function mutation (II) -- Protein Products - Quantitative

Hemoglobins:

Embryonic: z2e2 , a2e2, z2g2 Fetal: a2g2 (HbF) Adult : a2d2 (HbA2)

a2b2 (HbA)

from embryo to adult

z a2 a1

e Gg Ag d b

Developmental expression of globin chains

Thalassemia (OMIM 613985)

Loss-of-function mutation (III) -- Protein Products - Qualitative

Autosomal recessive

Red blood cells abnormal, rigid, sickle shape, decreases cells' flexibility

Mutation: single nucleotide change in the -globin gene

GAG (glutamic acid) to GTG (valine)

Abnormal function of globin

A qualitative problem

Sickle cell disease (OMIM 603903)

Loss-of-function mutation (IV) -- Large deletions

Two typical conditions:

Duchenne muscular dystrophy (DMD)

Becker muscular dystrophy (BMD)

Caused by mutation in dystrophin gene (DMD)

Introduce Frame shift

Duchenne muscular dystrophy (DMD) (OMIM 310200)

X-linked recessive; female carriers usually OK

Affects ~1 in 3,000 boys

Clinical:

Mainly affecting young boys (3-5 years)

progressive muscle weakness

OK up to age 10, wheelchair in teens, steady decline, die

in 20s (respiratory and cardiac involvement)

No effective treatment.

Becker muscular dystrophy (BMD) (OMIM 300376)

X-linked recessive

Affects ~1 in 20,000 men

Same clinical picture as Duchenne dystrophy, but symptoms very variable and occurs much later

Can have normal lifespan

Dystrophin anchors the contractile machinery to the sarcolemma

Burton & Davies Cell 108 : 5-8; 2002

Duchenne vs. Becker dystrophy

deletions in DMD, mis-sense mutations in BMD?

large deletions in DMD, small ones in BMD?

deletion of an essential part of the gene in DMD, other parts in BMD?

no correlation with size of deletion

deletions overlap;

in some cases a BMD deletion encompasses 1 or more DMD deletions

65% deletions in both DMD and BMD

----------- --------------- Delete exon 2 ---------------- -----------

CATCATCA TCATCATCAT CATCATCAT CATCATCAT

CATCATCATCATCATCATCATCATCATCATCATCAT mRNA

His - His - His - His - His - His - His - His - His - His - His - His protein

DNA 1 2 3 4

CATCATCATTCATCATCATCATCATCAT

His - His - His - Ser - Ser - Ser - Ser - Ser - Ser

mRNA

protein

DNA TCATCATCAT CATCATCAT CATCATCAT

1 3 4

Frame shift

-------------------------- Delete exon 3 ---------------------------

CATCATCA CATCATCAT

CATCATCATCATCATCACATCATCAT.

His - His - His - His - His - His - Ile - Ile -

mRNA

protein

DNA CATCATCAT

1 2 4

Frame shift




DNA 1 2 3 4

----------------------- Delete exons 2 and 3 ----------------------

CATCATCATCATCATCAT

His - His - His - His - His - His

mRNA

protein

DNA CATCATCAT CATCATCAT

1 4

In frame




DNA 1 2 3 4

Deletions of exons that

create a frameshift completely

abolish synthesis of dystrophin

in males

Deletions that leave the

reading frame intact result in

synthesis of a smaller but

partially functional protein

Gene sequence is 99.3% intron - so most deletion breakpoints

are in introns & remove one or more complete exons

consequence is

Duchenne dystrophy

consequence is

Becker dystrophy

Dystrophin gene deletions

T-cell acute lymphoblastic leukemia (T-ALL) (OMIM 190198)

NOTCH1 mutation in over 50% of patients

Activating mutations

Gain-of-function mutation

Gain-of-function Notch1 mutations in T-ALL

Annual Reviews

Two mutational hot spots are present within the extracellular heterodimerization Domain (HD) and the C-terminal PEST domain.

HD mutations cause ligand-independent generation of activated Notch1 (ICN1); PEST mutations sustain ICN1 activity.

Trinucleotide Repeats Expansion

Two examples:

Huntingtons disease

Gain-of-function mutation

Fragile X syndrome

Loss-of-function mutation

Huntington Disease (OMIM 143100)

Autosomal dominant

Late onset (typically 40s) Neurodegenerative disorder

Involuntary movements

Memory loss

Apathy

Changes in personality and mood

depression and anxiety, Seizures

Molecular basis of HD

Genotype-phenotype correlations:

Huntingtin gene

(CAG)n

8-29 normal

29-35 premutation

>37 pathological mutation

>60 Juvenile HD

Exon 1

QQQQQQQQQQ

Molecular mechanisms involved in pathogenesis of PolyQ diseases

Everett C M , Wood N W Brain 2004;127:2385-2405

Using HD as an example:

Fragile-X Syndrome (OMIM 309550)

Borderline to severe mental retardation

~20% autistic

Characteristic long face, large ears in adult men

Macro orchidism in 80-90%

Incidence ca. 1 in 4,000 males

The Fragile-X chromosome

Marker X seen in a proportion of cells under special

culture conditions

Molecular basis of Fragile-X

7-60 normal

60-230 premutation

>230 full mutation

(CGG)n

5UTR 3UTR

NKS RGG

NE

S

FMR1 gene

Function of the FMR1 gene

Wild type FMRP function: CGG expended FMRP:

AAAAA

AAAAA

AAAAA

AAAAA

AAAAA

AAAAA

FMRP with a point mutation (1304N):

How does mutant FMRP1 leads to Fragile-X?

Repeat is in 5 untranslated region of FMR1

Full expansion triggers methylation of the DNA through histone deacetylation

Methylation switches off expression of the gene

Loss of FMRP1 is the underlying mechanism of Fragile-X Syndrome.

Unique properties of dynamic mutations

Anticipation A phenomenon whereby the symptoms of a

genetic disorder become apparent at an earlier age and severer as it is passed on to the next generation.

Repeat unstable, tend to expend

The size of expansion is often correlated with the severity of symptoms and/or with onset at younger age

Dominant negative effect Osteogenesis imperfecta Type III (OMIM 259420):

Mutations in COL1A1 or COL1A2 genes

Bones fracture easily, deformity, Loose joints

Respiratory problems

Short stature, spinal curvature and sometimes barrel-shaped rib cage

Poor muscle tone in arms and legs

Discolouration of the sclera

Early loss of hearing possible

Self-assembly of collagen fibres

Mutations with the most drastic effect on protein synthesis are not the one that produce the most severe phenotypes. The mutant protein has dominant negative effect on the triple helix assembly.

Epigenetic Changes Affecting Gene Expression

Heritable (cell to daughter cell, or through a pedigree )

changes in the gene expression that do not depend on

a DNA sequence change.

Mechanisms: DNA methylation

Histone modification and Chromatin structure

RNA silencing by non-coding RNAs

Examples: Genomic imprinting: AS, PWS

X-chromosome inactivation

Chromatin structure - open vs closed

Berger Curr Opin Genet Dev 12 142-148 ; 2002

slow development

unusual movements

sever learning difficulties epilepsy happy face (Happy Puppet

Syndrome) poor communication skills and

little or absent speech

Angelman syndrome (AS) (OMIM 105830)

Prader-Willi syndrome (PWS) (OMIM 176270)

marked hypotonia: low muscle tone

short stature excessive appetite

obesity

immature physical development

learning disabilities emotional instability

almond shaped eyes with thin, down-turned lips

nearly always left-handed

Both cases had Deletion of proximal portion of chromosome 15 (15q11)

FISH (Fluorescent In-Situ Hybridization) test for deletions

15q11 deletions

Maternal deletion

Angelman

Paternal deletion

Prader-Willi

Reason: Genomic imprinting A phenomenon that gene expression of a small number of genes (~80) in mammals

depends on parental origin.


Nature of the mutation Mutation type

Mutation position Different mutations in the same gene can lead to more- or less-severe

phenotypes depending on the effects of the mutations on the expression of the gene or on the function of the protein product

Genetic background Heterogeneity in genetic background

Environmental influences Lifestyle, diet, and living environment may affect the disease

phenotype

Genetic background

The background genes may influence the disease phenotype Two individuals within a family may have the same mutated gene,

however, they will certainly (unless they are identical twins) have a lot of genes that are not similar

Genetic variants (polymorphisms) in the same gene may influence the disease phenotype Example: polymorphism H558R has mutation-specific effects on

SCN5A-related Sick Sinus Syndrome (SSS)

Polymorphism modulate disease phenotype

Loss-of-function defect of D1275N in SCN5A was rescued by R558 through enhancing cell surface targeting and improving steady-state activation of the mutant channels.

Whole-cell current recordings by patch clamping:

J Gui et al, J Cardiovasc Electrophysiol. 2010,;21(5):564-73.

Summary

Types of mutation affecting gene function

Los-of-function mutation Thalassemia, Duchenne muscular dystrophy, fragile X syndrome

Gain-of-function mutation Huntingtons disease, T-ALL

Dominant negative effect Osteogenesis imperfecta Type III

Epigenetic mechanisms in genetic diseases

PWS, AS

Genotype-phenotype correlations

Documents

Wang - Molecular Basis of Genetic Diseases