University of Huddersfield Repository - Semantic Scholar ?· Prof Jennifer Southgate, Jack Birch Unit…

  • View
    212

  • Download
    0

Embed Size (px)

Transcript

UniversityofHuddersfieldRepository

Baker,SimonC.,Shabir,Saqib,Georgopoulos,NikolaosT.andSouthgate,Jennifer

KetamineInducedApoptosisinNormalHumanUrothelialCells

OriginalCitation

Baker,SimonC.,Shabir,Saqib,Georgopoulos,NikolaosT.andSouthgate,Jennifer(2016)KetamineInducedApoptosisinNormalHumanUrothelialCells.TheAmericanJournalofPathology,186(5).pp.12671277.ISSN00029440

Thisversionisavailableathttp://eprints.hud.ac.uk/27956/

TheUniversityRepositoryisadigitalcollectionoftheresearchoutputoftheUniversity,availableonOpenAccess.CopyrightandMoralRightsfortheitemsonthissiteareretainedbytheindividualauthorand/orothercopyrightowners.Usersmayaccessfullitemsfreeofcharge;copiesoffulltextitemsgenerallycanbereproduced,displayedorperformedandgiventothirdpartiesinanyformatormediumforpersonalresearchorstudy,educationalornotforprofitpurposeswithoutpriorpermissionorcharge,provided:

Theauthors,titleandfullbibliographicdetailsiscreditedinanycopy; Ahyperlinkand/orURLisincludedfortheoriginalmetadatapage;and Thecontentisnotchangedinanyway.

Formoreinformation,includingourpolicyandsubmissionprocedure,pleasecontacttheRepositoryTeamat:E.mailbox@hud.ac.uk.

http://eprints.hud.ac.uk/

1

Ketamineinducedapoptosis innormalhumanurothelial cells:adirect,NmethylD

aspartatereceptorindependentpathwaycharacterisedbymitochondrialstress.

SimonCharlesBaker1, Saqib Shabir1,Nikolaos TheodorosGeorgopoulos2 and Jennifer

Southgate1,*

40CharRunningHead:Ketamineinducedapoptosisinhumanurothelium

Affiliation1JackBirchUnitofMolecularCarcinogenesis,DepartmentofBiology,UniversityofYork,

UnitedKingdom

2Department of Biological Sciences, School of Applied Sciences, University of

Huddersfield,UnitedKingdom

ContactInformationforCorrespondingAuthor*

Prof Jennifer Southgate, Jack BirchUnit ofMolecular Carcinogenesis, Department of

Biology,UniversityofYork,YorkYO105DD,UnitedKingdom

Tel:+44(0)1904328705

Fax+44(0)1904328704

Email:jennifer.southgate@york.ac.uk

TextPages=29;Figures=7;SupplementalFigures=0;Tables=0;FundingSourcesarelisted

inAcknowledgments.

Keywords:bladder;cystitis,NMDA;norketamine,urothelium,drugabuse

2

Abstract

Recreational abuse of ketamine has been associated with the emergence of a new

bladder pain syndrome, ketamineinduced cystitis, characterised by chronic

inflammation and urothelial ulceration. This study investigated the direct effects of

ketamineonnormalhumanurotheliummaintainedinorgancultureorasfinitecelllines

invitro.

Exposureofurothelium toketamine resulted inapoptosis,with cytochrome c release

from mitochondria and significant subsequent caspase 9 and 3/7 activation. The

anaestheticmodeofaction for ketamine ismediated primarily through Nmethyl D

aspartate receptor (NMDAR) antagonism; however, NHU cellswere unresponsive to

NMDARagonistsorantagonistsandnoexpressionofNMDARtranscriptwasdetected.

Exposuretononcytotoxicconcentrationsofketamine(1mM)inducedrapidreleaseof

ATP,whichactivatedpurinergicP2Yreceptorsandstimulatedtheinositoltrisphosphate

receptor toprovoke transient releaseofcalcium from theendoplasmic reticulum into

the cytosol. Ketamine concentrations >1mMwere cytotoxic andprovoked a larger

amplitude increase incytosolic [Ca2+]thatwasunresolved. Thesustainedelevation in

cytosolic[Ca2+]wasassociatedwithpathologicalmitochondrialoxygenconsumptionand

ATPdeficiency.

Damage to theurinarybarrier initiatesbladderpainand inketamineinduced cystitis,

lossofurotheliumfromlargeareasofthebladderwallisareportedfeature.Thisstudy

offersfirstevidenceforamechanismofdirecttoxicityofketaminetourothelialcellsby

activatingtheintrinsicapoptoticpathway.

3

Introduction

The phencyclidinederivative ketamine is an NmethylDaspartate (NMDA) receptor

antagonist,1whichisusedasarapidonset,shortdurationanaestheticandanalgesicin

clinicalandveterinarypractice.Intheclinicalsetting,ketamineisparticularlyusedasan

anaestheticinpaediatricandasthmaticcases,andforpalliativecare. Recreationaluse

of ketamine, which has been increasing since the 1980s, is based around its

phencyclidinelike effects whereby it induces hallucinations, stimulates outofbody

experiencesandincreasesempathyandinsight(reviewed2).

Theemergenceofupperandlowerurinarytractdamageresultingfromketamineabuse

was reported originally as case studies in 2007, where symptoms of urinary

frequency/urgency,nocturia,haematuriaandsuprapubicpainwereaccompaniedbya

thickened,contractedandinflamedbladder.3,4

Thesloughingofthebladderepithelium(urothelium)observedbyhistologyinketamine

cystitis patients is suggestive of a direct toxicity against the urothelium,5 but no

mechanismhasyetbeenestablished. KetaminehasbeenclassifiedasanNmethylD

aspartatereceptor(NMDAR)antagonist1andinvitrostudieswithcorticalneuronsfrom

rats6 andmonkeys7 have identified the NMDAR as amediator of ketamineinduced

apoptosis.NMDARsubunitshavebeenreportedtobeexpressedintheurinarytractof

rats,8whichsuggeststhisasapotentialmechanism inhumanurothelium. Theaimof

this studywas to identifyamechanism for thedirect toxicityofketamineonnormal

(nonimmortalised)humanurothelial(NHU)cells inordertoenhanceunderstandingof

theclinicalpathology.

4

MaterialsandMethods

ChemicalsandReagents

Racemicketaminehydrochloridesalt(withoutpreservatives)wassolubleincellculture

medium at 10 mM and was 0.2 m filtersterilised prior to use. Unless specified

otherwise,allchemicalswereofanalyticalortissueculturegrade,asappropriate,and

wereobtainedfromSigmaAldrichCompanyLtd.(Gillingham,UK).

Due to thehigh concentrationsofketamineused in this study (and recreationally), it

wasimportanttoassesstheeffectsofketamine(0.1mMto10mM)ontheosmolalityof

culturemedium.Nochangeinosmolalityofcompletekeratinocyteserumfreemedium

(KSFMc)wasobservedat ketamine concentrations

5

Organ cultures were established from human ureteric tissue and maintained in

DMEM:RPMI1640(50:50mix)supplementedwith5%fetalbovineserum.Following72

hoursexposureto3mMketamine,uretericorganculturesfrom6donorswerefixed in

10% formalin for 24 hours, dehydrated through graded alcohols and embedded in

paraffinwaxforhistologicalevaluation.

HistologicalEvaluationofOrganCultures

Dewaxed, 5 m tissue sections were either stained with haematoxylin and eosin

(followingstandardmethods)or immunoperoxidaselabelledusingtheM30Cytodeath

antibodytocleavedcytokeratin18(Roche).

For immunoperoxidase labelling, blocking steps were included to neutralise

endogeneousperoxidaseandavidinbindingactivities.Heatmediatedantigenretrieval

wasperformedbymicrowaveboilingfor10minineither10mMcitricacidbuffer(pH6)

or1mMEDTAbuffer (pH8). Afterovernight incubation inprimaryantibody (diluted

1:100)at4C,slideswerewashed,incubatedinbiotinylatedsecondaryantibodiesanda

streptavidinbiotin horseradish peroxidase complex (Dako Cytomation) and visualised

using a diaminobenzidine substrate reaction (SigmaAldrich). Sections were

counterstainedwithhaematoxylin,dehydratedandmountedinDPX(CellPath).

QuantificationofcellnumberbyAlamarBlueassay

AlamarBlue(AbDSerotec)diluted1:10withKSFMcwasaddedtocellsgrownin96well

plates.After4hoursincubationat37C,theabsorbancewasmeasuredat570nmand

6

630nm.ThereductionoftheAlamarBluedyeisproportionaltomitochondrialenzyme

activityandcanbeusedasaproxyforviablecellnumber.10

CalciumImaging

NHU cells were seeded at 5x104 cells/cm2 onto collagencoated (0.1mg/ml rattail

collagen, Becton Dickinson) glass coverslips andmaintained for 24 hours. Prior to

imaging, cultures werewashed with HEPESbuffered saline solution (HBSS; 138mM

NaCl,5mMKCl,0.3mMKH2PO4,4mMNaHCO3,0.3mMNaHPO4,1mMMgCl2,2mM

CaCl2and10mMHEPESpH7.4)andthenloadedwith5Mfluo4(AM)and5Mfura

red(AM)inHBSwith0.02%pluronicacidfor25minutes.Cultureswerewashedtwicein

HBS and the coverslips placed in a perfusion chamber (Warner Instruments) on the

stageofaRevolutionXDspinningdiscconfocalmicroscope(Andor).Thechamberwas

perfusedwithanautomatedpump(Scientifica)ataflowrateof1.5ml/minandimages

recordedatarateof1/sec.

In some experiments, to differentiate exogenous from intrinsic calcium stores, cells

werepreincubatedfor10minutesinCa2+freeHBSS(138mMNaCl,5mMKCl,0.3mM

KH2PO4,4mMNaHCO3,0.3mMNaHPO4,1mMMgCl2,5mMEGTAand10mMHEPES

pH7.4)andexperimentswereperformedinthecalciumfreebuffer.

Changesintheintensityofthefuraredandfluo4fluorescentsignalweremeasuredin

allthecellsinthefieldofviewusingAndoriQsoftware,whichwasusedtorecordand

exportrawdataovertime.Thedatawas imported inOrigin8.6(Origin labs,Microcal)

andtheratiooffluorescencecalculatedtoindicatethechangeinintracellular[Ca2+].

7

ReverseTranscribedPolymeraseChainReaction(RTPCR)

RNAwasextractedinTrizolreagent(Fisher),anycontaminatingDNAwasdigestedusing

DNAfree (Ambion) and cDNA was synthesised using Oligo(dT)1218 primers

(Invitrogen).RTPCRwasperformedusingSureStartTaqpolymerase(Stratagene)anda

thermal cycler (PCR Express, Hybaid). With the following annealing temperatures,

primers were designed to amplify GRIN1 (5GCATCCTCGGGCTGCAGCTC3 and 5

AGCGGCCCGGTCTTCCAGAT3,61C),GRIN2A(5GTGGTCTATCAACGGGCAGT3and5

AGGT