Embed Size (px)
Citation preview
University of Groningen
Critical factors in vitrification-based cryopreservation of precision-cut liver slicesGuan, Na
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2013
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Guan, N. (2013). Critical factors in vitrification-based cryopreservation of precision-cut liver slices.Groningen: s.n.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 08-10-2020
Chapter 4
The Effect of Hypothermic in Situ
Liver Perfusion with TransSend W
on the Toxicity of Cryoprotectant
Agents in Precision-Cut Liver Slice
Na Guan
Marina H. de Jager
Petra Štěrbová
Sylvia A. Blomsma
Gregory M. Fahy
Geny M. M. Groothuis,
Inge A. M. de Graaf
Submitted for Publication
Chapter 4
80
Abstract
Precision cut liver slices (PCLS) are widely used as ex vivo model in studying
pathology, and drug metabolism and toxicity because they contain all liver cell types in
their original tissue architecture. Successful cryopreservation of PCLS would greatly
facilitate their use and commercial standardization. However, toxicity of the
cryoprotectants (CPA), especially for vitrification (vitrification solution (VS)), needed to
prevent ice crystal formation, appeared to be a major obstacle especially for vitrification-
based cryopreservation. Although hypothermic in-situ organ perfusion is beneficial for
organ and tissue cold storage before transplantation, its application in cryopreservation of
PCLS has not yet been studied. In the present study, we examined if hypothermic liver
perfusion with TransSend W, a tissue preservation solution, could improve the condition of
rat PCLS and reduce the vulnerability of not only the hepatocytes but also the non-
parenchymal cells (NPC) (Kupffer cells, stellate cells and endothelial cells) to the CPA
toxicity. Three CPAs (Sol Y, Sol Z and M22) were used. Perfusion appeared to improve the
viability of slices exposed to CPA as indicated by ATP and LDH content relative to control
slices although morphology did not show a clear difference. M22 appeared the most toxic,
whereas Sol Y and Sol Z showed low toxicity (ATP= 90% of control).
Immunohistochemical staining of cell specific markers for the different NPC cell types
showed that perfusion reduced the loss of marker expression that was induced by exposure
to the CPA solutions Sol Z and M22 but not Sol Y, in Kupffer cells and endothelial cells
but the beneficial effect was not observed in stellate cells. Perfusion also protected against
the reduction of phase I and phase II metabolism in slices exposed to CPA and even
restored it to control values for slices exposed to Sol Y and Sol Z. The protective effect of
hypothermic perfusion could not be ascribed to an increased glutathione content but was
possibly due to a down-regulation of stress-related genes. The differential response of NPC
and hepatocytes to CPA toxicity highlights the heterogeneous properties of the various cell
types in the liver slices and emphasizes the need for further investigations in the responses
of the NPC during cryopreservation. In conclusion, in-situ hypothermic liver perfusion with
TransSend W proved to be beneficial toward CPA-induced injury in PCLS, which might be
an important step for successful cryopreservation of PCLS.
Keywords: cryoprotective agents; cryoprotectant toxicity; tissue banking; cryopreservation;
vitrification; hypothermic perfusion, precision-cut liver slices
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
81
4
Introduction
Precision-cut liver slices (PCLS) are increasingly used as an in vitro model to study
drug metabolism and toxicity [1-3]. However, the availability of PCLS especially of human
liver is limited and hampered by the irregular and low availability of human liver tissue for
research. Cryopreservation of PCLS would strongly improve their application possibilities
in ADME-tox studies. However, intracellular ice formation (IIF) which occurs during
cryopreservation is strongly correlated to cell death and should be avoided to increase the
survival rate of the slices after cryopreservation [4]. Vitrification-based cryopreservation
(glass formation without ice formation), appeared to improve the post-cryopreservation
viability by preventing mechanical damage from ice crystal formation [5].
To achieve successful vitrification, high concentrations of cryoprotectants (CPA) also
called vitrifcation solution (VSs) containing both permeating CPAs and non-permeating
CPAs are needed to prevent ice formation [6, 7]. In general, these CPAs are quite toxic to
the tissues, organs and cells at the concentration used for vitrification. Therefore strategies
such as reducing the toxicity by combining CPAs with different mechanisms of toxicity
(cryoprotectant toxicity neutralization [8]), by loading the tissue with CPA at lower
temperature [6] and by reducing the exposure time to the maximal concentration of CPA
during CPA loading [9]. By applying these strategies, the CPAs M22 and VM3 were
introduced and their toxicity appeared to be low in kidney slices with more than 90% and
80% recovery of ion transport function, respectively [10]. However, our previous data
indicated that these CPAs were still toxic in rat PCLS and decreased the ATP content by ca.
40% even when all strategies mentioned above were applied [11].
In-situ hypothermic perfusion is the initial step for organ transplantation to flush out
blood cells and was successful to prolong the time for hypothermic preservation and to
improve post-operation viability and functions of the transplanted organs [12, 13]. In
general, the function of such an hypothermic organ preservation solution is to minimize the
damage due to formation of free radicals, maintain ionic balance, minimize cell and tissue
swelling, and stimulate recovery upon rewarming [14, 15]. Hypothermic perfusion with
TransSend B containing among others the two nonpermeable components, polyglycerol and
lactose and the anti-oxidants glutathione and chlorpromazine was shown to be effective as
cold flush/cold storage solution for preservation of kidney tissue and protection from
damage due to ischemia [16]. After hypothermic kidney perfusion with TransSend B M22
was found to be barely toxic in kidney slices [7, 10] whereas M22 appeared to be toxic in
our rat PCLS experiments in which in-situ hypothermic perfusion was absent [11]. So far,
in-situ liver perfusion with polyglycerol and lactose containing perfusion solutions as a
strategy to protect against CPA toxicity in rat PCLS has not been investigated.
Based on the hypothesis that in situ perfusion, by improving the liver condition prior
to CPA exposure, could protect against CPA toxicity, in the present study, we investigated
the effect of hypothermic in-situ perfusion with a modified version of the TransSend
Chapter 4
82
solution that was designed for liver preservation TransSend W (Table 1). We investigated
the effect of perfusion on the viability and functionality of precision-cut liver slices
(PCLS), and on the expression of several genes known to be involved in inflammation and
injury of cells. Moreover, using the same parameters, we determined the effect of perfusion
with TransSend W on the susceptibility of PCLS to the toxicity of cryoprotectant agents.
Three different CPAs (M22, Sol Y and Sol Z) (table 2) were used, which differ in
composition with respect to the content of polyvinylpyrrolidone (PVP and N-
methylformamide. In addition to the overall response of the PCLS with respect to viability
(morphology, LDH and ATP) and redox state (glutathione and reduced glutathione) we
paid special attention to the response of the different cell types in the liver slices
(hepatocytes, Kupffer cells, stellate cells and endothelial cells), by analyzing the
metabolism of 7-ethoxycoumarin (by hepatocytes), the NO production as a reaction to LPS
(mediated by Kupffer cells) and the immunohistochemical expression of ED2 (Kupffer
cells), RECA-1 (endothelial cells) and desmin (stellate cells).
Materials and Methods
Chemicals and Reagents
D-glucose monohydrate and NaHCO3 were obtained from Sigma-Aldrich (St Louis,
MO, USA). Gentamicin and William’s medium E (WME) supplemented with Glutamax I
were purchased from Gibco (Paisley, UK). TransSend W solution (Table 1), and premixed
concentrated CPAs (M22, Sol Y and Sol Z) and LM5 (Table 2) were a gift from 21st
Century Medicine, Fontana, California, USA and are commercially available. SYBR Green
and Taq Master Mixes were purchased from Applied Biosystems, Warrington, UK and
Eurogentech, respectively. All primers were purchased from Sigma Genosys. University of
Wisconsin preservation solution (UW) was from Du Pont Critical Care, Waukegab II, USA.
All other chemicals were of the highest purity and are commercially available.
Animals
Male Wistar rats (HsdCpb:WU) (300–350 g) were purchased from Charles River
(Maastricht, The Netherlands). The rats were housed under a 12-h light/dark cycle in a
temperature- and humidity-controlled room with food (Harlan chow no. 2018, Horst, The
Netherlands) and tap water ad libitum. The animal experimental protocol was approved by
the Animal Ethical Committee of the University of Groningen.
Preparation of rat PCLS
Rats were anesthetized with isoflurane/O2. For the perfusion experiments the liver was
perfused with 30 mL ice-cold TransSend W perfusion medium (Table 1) in situ via the vena
cava before the liver was removed. The liver was stored in ice-cold TransSend W until
slicing. For the control experiments the livers were removed without perfusion and stored
in ice-cold UW solution until slicing. PCLS were prepared as described previously [1]. In
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
83
4
brief, cylindrical cores of 5 mm diameter were made by drilling a hollow drill bit into the
liver. These cores were sliced with a Krumdieck tissue slicer (Alabama R&D, Munford,
AL, USA) in ice-cold, oxygenated Krebs-Henseleit buffer. PCLS (5 mm diameter, 200-300
µm thick and 5 mg wet weight) from the perfused livers were stored in ice-cold TransSend
W solution until use and those from the non-perfused liver were stored in ice cold UW .
Table 1 Composition of TransSend W preservation solution
mM g/liter
Polyglycerol 49.40 13.00
GSH 3.25 1.00
glycine 3.25 0.24
Chlorpromazine HCl N/A 0.0032
Glucose 63.05 11.36
α Lactose*H20 29.25 10.54
Na Acetate 1.30 0.18
AdenineHCl 0.65 0.11
NaCl 26.00 1.52
K2HPO4*3H20 4.55 1.04
CaCl2*2H2O 0.65 0.10
MgCl2*6H2O 0.65 0.13
Waymouth MB 752/1 N/A 35% of usual
Osmolarity: 293 mOsm ; pH: 7.4
Step-wise method for CPA loading and unloading
For CPA loading/unloading, 100% CPA working solutions (Table 2) were diluted
using LM5 to create the loading step solutions and unloading step solutions of increasing
respectively decreasing concentrations while sucrose was included in all the unloading
solutions at a final concentration of 300 mM [11]., Eight concentration steps were used to
load and unload the slices. To load the slices with the CPAs, about 10-20 slices were placed
in a beaker and exposed in 4 steps of 15-min to the CPA solutions with increasing
concentration: 25%, 50%, 75% and 100% of the working solution. After that, slices were
immersed in the CPAs at decreasing concentrations of 75%, 50% and 25% working
solution with 300 mM sucrose followed by solely LM5 with sucrose in 4 steps of 10 min on
ice for unloading. During all steps, the beakers were placed on melting ice and gently
shaken [7].
Chapter 4
84
Incubation and viability testing
After the different treatments, slices were incubated in 12-well plates (Greiner Bio-
One, the Netherlands) under humidified carbogen (95% O2, 5% CO2) at 37oC with gentle
shaking at 90 rpm/min. Each well contained 1 slice in 1.3 mL WME with 25 mM D-
glucose and 50 µg/mL gentamicin. After incubation for 3 or 24 hours, slices were collected
for the determination of viability and functionality. Incubation of control slices (not
exposed to CPAs) was started directly after slice preparation.
Table 2 Composition of 100% working solutions of CPA solutions
Cryoprotectant Solution Sol Y Sol Z M22
Me2SO (g/L) 223.1 223.1 223.1
Formamide (g/L) 128.6 128.6 128.6
Ethylene glycol (g/L) 168.4 168.4 168.4
N-Methylformamide (g/L) — — 30
3-Methoxy,1,2-propanediol (g/L) 40 40 40
PVP K12 (g/L) — — 28
Sucrose (g/L) — 20 —
Supercool X-1000* (g/L) 10 10 10
Supercool Z-1000* (g/L) 20 20 20
5X LM5-- (mL/L)# 200 200 200
Total CPA Molarity 8.83 8.89 9.35
*Ice blocker #The 1X LM5 carrier solution contained 90 mM glucose, 45 mM mannitol, 45 mM lactose, 28.2 mM
KCl, 7.2 mM K2HPO4, 5 mM reduced glutathione, 1 mM adenine HCl, 10 mM NaHCO3.
Determination of functionality and viability of PCLS
ATP Determination
The ATP content of PCLS was determined as a viability parameter in PCLS as
described before [11]. For ATP determination, slices were collected individually in 1 mL
70% ethanol with 2 mM EDTA (pH 10.9), snap-frozen in liquid nitrogen and stored at -80 oC until analysis. After homogenization for 45 s using a Mini-BeadBeater-8 (BioSpec,
Bartlesville, OK, USA), the slices were centrifuged at 16,100 g for 5 min and the ATP
level in the supernatant was determined using the ATP Bioluminescence assay kit CLS II
(Roche diagnostics, Mannheim, Germany) in a black 96-well plate Lucy1 luminometer
(Anthos, Durham, NC, USA) according to the manufacturer’s protocol. The amount of
luminescence as a measure of ATP content was measured using a Packard LumiCount®
Luminescence Microplate Reader (Packard, United Kingdom).
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
85
4
Histomorphology
Slices were prepared for the examination of histological integrity as follows: after
fixation in 4% buffered formaldehyde in phosphate-buffered saline solution for at least 12
hours at 4oC, slices were dehydrated in a graded alcohol series and Histosolve (Thermo
Scientific, Pittsburgh, USA). Subsequently, slices were vertically embedded in paraffin and
cross-sectioned at 4-µm thickness. The sections were stained with hematoxyline and eosin
(H&E).
LDH leakage
The leakage of the enzyme lactate dehydrogenase (LDH), from liver slices in the
culture medium was measured on a Hitachi Automatic Analyzer (Roche Diagnostics,
Mannheim, Germany), according to a routine laboratory procedure. Samples of the medium
were collected after 3 h of slice incubation, snap-frozen and stored at -80oC until analysis.
To measure the total LDH content in fresh liver slices, three liver slices were collected after
1 hour incubation and homogenized in 1.3 mL culture medium. The homogenate was
centrifuged and stored at -80oC until analysis.
Nitrate/nitrite (NOx) formation
The functionality of the Kupffer cells was determined after incubation of PCLS with
LPS (final concentration 40 µg/ml) for 8 and 24 hours. The NOx production was assessed
by determining NO2¯ and NO3¯ levels in the culture medium using Griess reagent according
to Moshage et al. [17]. In brief, the nitrate in the sample was first reduced to nitrite in
presence of NADPH (Roche, Basel, Switzerland), nitrate reductase (Roche, Basel,
Switzerland), and flavin adenine dinucleotide (FAD) (Roche, Basel, Switzerland) at 37°C
for 30 min. Then 2.2 µl 0.5 M Na-pyruvate (Sigma) and 0.55 µl lactate dehydrogenase (5
mg/ml) Roche, Basel, Switzerland) in serum-free WME were added to degrade NADPH.
After incubation at 37°C for 10min, 5 µl 30% ZnSO4 was added to precipitate the enzymes,
and samples were centrifuged at 2000 g for 5 min. 100 µL of the supernatant was then
transferred to a new plate and the total amount of nitrite was measured at 550 nm after
formation of the red-violet diazo dye after adding 50 µL 1 % sulfanylamide in 5% H3PO4
(Sigma) and 50 µL 0.1% naphthylethylenediamine (Sigma) at room temperature for 15 min
using a linear standard curve of potassium nitrite. Assays were performed in duplicate.
Immunohistochemical staining of non-parenchymal liver cells
The presence of non-parenchymal liver cells in the slices was determined by
immunohistochemical staining after 3 h of incubation. For this purpose, slices were
embedded in Tissue-Tek after incubation and frozen in isopentane (-80oC). The frozen
sample blocks were kept at - 80oC until cryosectioning. Four µm thick tissue sections were
cut using a cryostat (Leica CM 3050) at -20oC, placed on Super-Frost plus slides (Menzel-
Chapter 4
86
Glaser, Braunchweig, Germany) and air-dried. The sections were stored at -20oC until
further use.
For immunohistochemical staining of Kupffer cells (ED2), endothelial cells (RECA-1)
and stellate cells (desmin), sections were fixed in acetone for 10 min at room temperature
and then rehydrated in PBS for 5 min. Then, sections were incubated with primary mouse
antibodies against ED2 (1:100; Serotec, Oxford, UK), RECA-1 (1:1000; Serotec, Oxford,
UK) and desmin (1:400; sigma, Saint Louis, USA) for 1 h at room temperature. After
washing with PBS, the sections were incubated with 0.75% H2O2 solution in PBS for 30
min to block endogenous peroxidase. Then the sections were incubated with the secondary
antibody, RAMPO (rabbit anti-mouse immunoglobulin labeled with horseradish peroxidase
1: 100) (Dako Cytomation, Denmark) and the tertiary antibody GARPO 1:100) (Goat anti-
rabbit immunoglobulin labeled with horseradish peroxidase) (Dako Cytomation, Denmark)
for 30 min sequentially with intermittent washings in PBS. Thereafter the sections were
stained with AEC (3-amino-9-ethylcarbazole) solution and counterstained with
haematoxylin for 1 min. The sections were embedded in Kaiser’s glycerin gelatin (Merck,
Darmstadt, Germany) after washing under tap water for 5 min. The stained area in the
digital photomicrographs was quantified using Cell^D imaging software (Olympus)
according to the standard procedure and is presented as % positive area per field.
Metabolism of 7-ethoxycoumarin
The phase I and phase II metabolic activity of PCLS were evaluated by measuring
metabolite formation from 7-ethoxycoumarin (7-EC) (Fluka Chemie, Buchs, Switzerland).
Liver slices were incubated with 500 µM 7-EC at 37oC for 3 hours, and the medium
samples were stored at -20oC until analysis. The hydrolysis of 7-EC to 7-hydroxycoumarine
(7-HC) by Cytochrome P450 mediated phase I reaction, the conjugation of 7-HC to 7-HC-
glucuronide (7-HC-Gluc) and 7-HC-sulfate (7-HC-Sulf) as products of phase II metabolism
were measured in the culture medium using an HPLC method as described before [18].
Glutathione content (GSH+GSSG) of PCLS
After 3 hour incubation, the liver slices were washed in 0.9% NaCl solution, collected
individually into Eppendorf tubes, immediately frozen in liquid nitrogen and stored at -
80°C until analysis. The slices were homogenized in 400 µL ice cold 50 mM Tris-HCl/ 1
mM EDTA buffer (pH 7.4) using a mini bead beater for 45 s and then centrifuged for 3 min
at 16,100 g at 4°C and the supernatant was used to determine the levels of reduced and total
glutathione. To determine the content of reduced glutathione 150 µl of the supernatant was
mixed with 15 µL 50% TCA and kept on ice until the next step. Then the mixture was
centrifuged at 161,00 g for 5 min and 50 µl of the supernatant was pipetted on a clear 96-
well plate. To assess the level of total glutathione, first oxidized glutathione (GSSG) in
another 150 µL aliquot of the supernatant of the slice homogenate was reduced by
glutathione reductase in the presence of 6 µM of NADPH and incubated at 37°C for 15
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
87
4
min. Thereafter 15 µl 50% TCA of 0 °C was added. Subsequently the sample was
centrifuged at 2,000 g for 5 min and 50 µl of the supernatant was transferred on clear 96-
well plate. To all samples, 200 µL 5,5´-dithio-bis(2-nitrobenzoic acid) was added and
absorbance was measured at 405 nm using a spectrophotometer. A linear standard curve of
reduced glutathione (Sigma-Aldrich) was used.
Gene expression
Three slices from the same experiment were collected after incubation and total RNA
was isolated with the RNAeasy mini kit (Qiagen, Hilden, Germany) according to
manufacturer’s instructions. RNA concentration and quality were measured using a
Nanodrop ND100 spectrometer (Wilmington, DE USA). The ratio of absorbance at
260/280 was above 1.8 for all samples. cDNA was synthesized from RNA samples using a
Promega Reverse Transcription kit (Promega, Madison, USA) as published before [19].
RT-PCR was conducted using SensiMix SYBR Green (Quantace, London, UK). The
primers used for RT-PCR are listed in Table 3. The PCR reaction was performed as
follows: 10 min at 95oC and then 40 cycles of amplification at 95oC for 15 s, at 56oC for 15
s and at 72oC for 40 s, followed by a dissociation stage (at 95oC for 15 s, at 60oC for 15 s
and at 95oC for 15s). All assays were performed at least in duplicate. The comparative
threshold cycle (CT) was used for quantification of the mRNA. The relative expression of
genes 2^(∆CT) was calculated by the difference of the CT of the target gene and the CT of
the reference gene (GAPDH) from the same sample.
Table 3 Sequences of the primers for quantitative Real-Time PCR rat genes
Gene Forward primer(5’ – 3’) Reverse primer(5’ – 3’)
GAPDH CTGTGGTCATGAGCCCCTCC CGCTGGTGCTGAGTATGTCG
MDR-1a GATGGAATTGATAATGTGGAC AAGGATCAGGAACAATAAA
MDR-1b GAAATAATGCTTATGAATCCCAAAG GGTTTCATGGTCGTCGTCTCTTGA
IL-1α TCGGGAGGAGACGACTCTAA GAAAGCTGCGGATGTGAAGT
IL-1β AGAGCTTCAGGAAGGCAGTG GCAGTGCAGCTGTCTAATGG
iNOS CGTTCGATGTTCAAAGCAAA CCCTGGACTTCTCACTCTGC
eNOS TGACCCTCACCGATACAACA TCTGGCCTTCTGCTCATTTT
IL-6 ATGTTGTTGACAGCCACTGC ACAGTGCATCATCGCTGTTC
IL-10 GGAGTGAAGACCAGCAAAGG GGCAACCCAAGTAACCCTTA
TNF1α TGCCTCAGCCTCTTCTCATT TTTGCTACGACGTGGGCTAC
HO-1 CTCGCATGAACACTCTGGAGAT GCAGGAAGGCGGTCTTAGC
HSP70 GGTTGCATGTTCTTTGCGTTTA GGTGGCAGTGCTGAGGTGTT
MHC-II CGTGGGCTATCAGAGAGGAG ATTAGCCAATGCACCCTGAG
Chapter 4
88
Statistical Analysis
All experiments were performed with a minimum of 3 livers and at least 3 slices from
each liver. Results were compared using two-tailed unpaired Student’s t-test. The criterion
for significance is a p value <0.05. Statistical differences for ATP content were determined
using values normalized to controls in each experiment. For gene expression data, the
significance of the differences was determined using the ∆Ct values.
Results
Influence of perfusion with TransSend W on the viability of PCLS and on their
susceptibility to the toxicity of CPAs
The viability of PCLS was determined by the ATP content, histomorphological
appearance and the LDH content and leakage in the medium after 3 hour of incubation.
As shown in Fig 1A, the in-situ perfusion significantly improved the recovery of ATP
content of PCLS compared to the control after loading/unloading CPAs from 70% to 95%
for Sol Y, from 69% to 89% for Sol Z and from 54% to 78% for M22 respectively. M22
was more toxic than Sol Y and Sol Z with or without perfusion. As shown in Fig. 1B, the
ATP content of control slices without perfusion (18 nmol/mg protein) after 3 h incubation
was significantly higher than that of control slices with perfusion (12.2 nmol/mg protein).
Leakage of LDH is a well-known indicator of cell membrane integrity and cell
viability [20]. The initial content of LDH in fresh slices after the perfusion with TransSend
W was higher than that in the non-perfused slices (Fig. 4). In general, the LDH leakage into
the medium was similar in all samples (both the control slices and the slices treated with
CPA) for both perfusion and non-perfusion. As a result the percentage of LDH leakage was
lower in slices from perfused livers. The only exception was the non-perfused slices treated
with M22, where LDH leakage was significantly higher than that from the non-perfused
control. Moreover, perfusion reduced the absolute amount of LDH leakage from the M22-
treated slices into the medium.
Histomorphological appearances of slices (Fig.3) from perfusion and non-perfusion
closely resembled each other both for the control and for each of the CPA treatments. In
general, after CPA treatment more pyknotic and condensed nuclei were observed in the
hepatocytes. Moreover the sinusoidal cells became more round, and the number of non-
parenchymal cells seemed reduced. Therefore we decided to perform immunohistochemical
staining for markers of the Kupffer, endothelial and hepatic stellate cells
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
89
4
Figure 1. ATP content of PCLS after treatment with different CPA and 3 hours of additional incubation at 37oC. (A) ATP content is expressed as relative values to the control; (B) ATP content is expressed as nmol/mg per protein. 3 CPA solutions were tested within one experiment with 11 rats for no perfusion and 9 rats for perfusion with TransSend W, with four slices for each rat. Data are expressed as mean + SEM. **p<0.01 and ***p<0.001 when comparing perfusion with no perfusion; #p<0.05 when compared with the corresponding control; $ p<0.05 and $$ p<0.01 when compared with M22 in the same group: perfusion or no perfusion.
Figure 2. LDH leakage after 3 h incubation of PCLS. 3 CPA solutions were tested within one experiment with 2 rats for no perfusion and 3 rats for perfusion with TransSend W, with 3 PCLS per experiment. *p<0.05 when comparing perfusion and no perfusion; #p<0.05 when compared with the corresponding control.
Total Control Sol Y Sol Z M220
500
1000
1500
2000No perfusion
Perfusion*
*#
LDH leakage in the mediumLDH
LD
H U
/L
A B
Control Sol Y Sol Z M220
50
100
150 No perfusionPerfusion
*** *****
$$
$
$$
$$
% o
f C
on
tro
l(A
TP
Co
nte
nt)
Control Sol Y Sol Z M220
5
10
15
20 No perfusion
Perfusion***
**$$$
$$$$
AT
P (
nm
ol/
mg
pro
tein
)
Chapter 4
90
.
Figure 3. Representative pictures of H&E stained control and slices after treatment with 3 different
CPA solutions and 3 hours of additional incubation at 37oC. Scale bars, 100µm.
Influence of perfusion with TransSend W on the presence and functionality of non-
parenchymal cells in PCLS treated with CPA
The presence of the different non-parenchymal cells (Kupffer cells, endothelial cells
and stellate cells) in slices was determined by immunohistochemical staining for ED2,
RECA-1 and desmin respectively (Fig. 4). The staining intensities for the non-parenchymal
cells in control slices were not affected by the perfusion. The staining for all three cell types
in slices of non-perfused livers was decreased after CPA treatment compared to non-CPA
treated controls, suggesting toxicity of the CPAs to the NPC. Interestingly, the perfusion of
the liver with TransSend W significantly reduced the loss of Kupffer cell and endothelial
cells staining in slices after Sol Z and M22 treatment. The staining for ED2 and RECA-1 in
slices treated with Sol Z and M22 was not significantly different from their corresponding
non CPA-treated controls.
The effect of perfusion and CPA treatment on the functionality of Kupffer cells was
assessed by measuring LPS-stimulated NOx production in the medium after 24 hours of
incubation with LPS (Fig.5). LPS treatment resulted in higher NO production in slices of
perfused livers than in slices of non-perfused livers (205 vs 160 µM, p<0.05). CPA
treatment significantly decreased the LPS-stimulated NOX production compared to the
control to the same extent in slices of both non-perfused and perfused livers.
Control Sol Y Sol Z M22
No
Pe
rfu
sio
n
Pe
rfu
sio
n
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
91
4
Fig
ure 4
. Imm
un
oh
istoch
emical stain
ing fo
r ED
2 (K
C m
arker), d
esmin
(HS
C m
arker), an
d R
EC
A-1
(EC
mark
er) in P
CL
S
treated w
ith d
ifferent C
PA
solu
tion
. Rep
resentativ
e ph
oto
micro
grap
hs an
d q
uan
titative an
alysis o
f ED
-2, R
EC
A-1
and d
esmin
. S
cale bars:1
00µ
m. P
erf=P
erfusio
n. N
o P
erf=N
o p
erfusio
n. *
*p<
0.0
1 an
d *
**p
<0
.00
1 w
hen
com
pared
with
no p
erfusio
n; #
p<
0.0
5
wh
en co
mp
ared w
ith th
e corresp
on
din
g co
ntro
l;
Chapter 4
92
Influence of perfusion with TransSend W on 7-EC metabolism of PCLS treated with
CPA
Besides investigation of the functionality of Kupffer cells, we also investigated
whether in situ perfusion of the liver with TransSend W could prevent decrease of the
metabolic rate towards the model compound 7-ECdue to CPA treatment. Phase I
metabolism of 7-EC (500 µM) towards 7-HC by cytochrome P450 and Phase II metabolism
of 7-HC to 7-HC–Gluc and 7-HC-Sulf by conjugation with UDP-glucuronyltransferase and
sulfotransferase (Fig 6A) were examined. The total formation of 7-HC as indicated in Fig
6B is calculated as the sum of all phase I and phase II metabolites: 7-HC, 7-HC–Gluc and
7-HC-Sulf. The results in Fig 6B-D indicate that perfusion did not change phase I or phase
II metabolic capacity of the control slices, the slight differences in 7-HC–Gluc and 7-HC-
Sulf between control slices of perfused and non-perfused livers were not significant.
Exposure to the CPAs reduced the formation of all metabolites in slices from non-perfused
livers, although the decrease was not significant for 7-HC-Sulf formation after exposure to
Sol Y and Sol Z. In contrast in slices prepared from perfused livers exposure to Sol Y and
Sol Z did not cause any reduction in metabolite formation. Exposure to M22 reduced phase
1 metabolism and glucuronidation but to a lesser extent than in slices from non- perfused
livers (Fig. 6B and 6C). In general, compared to glucuronidation, the sulfation rate (Fig.
6D) in slices was less affected by CPA treatment regardless of perfusion or non-perfusion.
Our results indicated that in-situ perfusion of a rat liver with TransSend W protected both
phase I and phase II metabolic capacity of hepatocytes from the toxicity of CPA.
NC Control Sol Y Sol Z M220
50
100
150 No perfusion
Perfusion
# ##
##
#
NO
x P
rod
uc
tio
n%
of
Co
ntr
ol
Figure 5. LPS-stimulated NOx production in the culture medium by PCLS in 24 h. Data are expressed as mean + SEM. #p<0.05 when compared with the corresponding control. NC are control slices that were not stimulated with LPS. Control with LPS from non-perfused livers vs perfused
livers: 160 µM vs 205 µM. #p<0.05 when compared with the corresponding control;
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
93
4
Control Sol Y Sol Z M220
10
20
30
40
* *
#
#
*
#
CNo perfusion
Perfusion
#
Fo
rmati
on
of
7-H
C-G
luc
(pm
ol/
3h
r/µµ µµ
g p
rote
in)
Figure 6. (A) Metabolic pathway of 7-ethoxycoumarin (7-EC), and metabolic conversion of 500 µM 7-EC into (B) 7-HC, (C) 7-HC-Gluc and (D) 7-HC-Sulf. Data are expressed as Mean + SEM (n=3). *p<0.05 when compared with and without perfusion; #p<0.05 when compared with the corresponding control.
Influence of perfusion with TransSend on GSH content of PCLS treated with CPA
The effect of perfusion with TransSend W on the GSH, GSSG and total glutathione in
PCLS is shown in Fig. 7. The perfusion with TransSend W only decreased the GSH content
in the control slices, but not in the slices treated with CPA. While the GSH content in slices
of non-perfused livers was decreased after CPA treatment (although only significantly after
M22 treatment), the GSH content of perfused slices was not affected by CPA treatment.
The total glutathione levels were not affected by perfusion or CPA treatment.
Influence of perfusion with TransSend on gene expression of PCLS
Gene expression of a set of genes including inflammation-related cytokines (IL6
(interleukin 6), TNF-α (Tumor Necrosis Factor α), IL10 (interleukin 10), IL α (interleukin
α) and IL β (interleukin β)), general markers for cellular stress (eNOS (endothelial nitric
oxide synthase), iNOS (inducible nitric oxide synthase), HO-1 (heme-oxygenase 1), Hsp70
(heat shock protein 70)), MDR-1a (muti-drug resistance-1a), MDR-1b (muti-drug
resistance-1b) and MHC-II (major histocompatibility complex II) were measured in both
Control Sol Y Sol Z M220
10
20
30
##
D
No perfusion
PerfusionF
orm
ati
on
of
7-H
C-S
ulf
(pm
ol/
3h
r/µµ µµ
g p
rote
in)
Control Sol Y Sol Z M220
20
40
60
80 No perfusion
Perfusion
* *#
#
B
*# #
Fo
rmati
on
of
7-H
C
(pm
ol/
3h
r/µµ µµ
g p
rote
in)
A
Chapter 4
94
perfused and non-perfused control slices after 3 hours incubation. IL-6, TNF-α, iNOS, and
eNOS were significantly down-regulated due to perfusion, suggesting a reduced
inflammatory response in slices (Fig. 8). Also MDR 1a and MDR 1b were significantly
down-regulated. The gene expression of IL10, ILα, ILβ, Hsp70 and HO-1 known for their
contribution to protect against ROS and of MHC-II was not affected by perfusion.
ControlSol Y Sol Z M22 ControlSol Y Sol Z M220
10
20
30
40
50 GSH
GSSG
# *
No perfusion Perfusion
To
tal
glu
tath
ion
e c
on
ten
t
(nm
ol/
µµ µµg
pro
tein
)
Figure 7. GSH and total glutathione content of rat PCLS after CPA treatment with or without perfusion and 3 hours of additional incubation at 37oC. Data are expressed as mean + SEM (n=3), using 3 PCLS for each group in every experiment. *P<0.05 when compared with the group without perfusion. #p<0.05 when compared with the corresponding control.
MDR-1
a
MDR-1
b
iNOS
eNOS
IL-6
TNF α
IL-1
0
HO-1
HSP70
MHC-II
Il-1a
IL-1
b
-15
-10
-5
0
5
*****
***
***
*
Lo
g2 (
Fo
ld I
nd
ucti
on
)
Figure 8. The expression of selected genes in PCLS after TransSend W in situ perfusion and 3 hours additional incubation at 37oC. Expression levels were normalized with GAPDH and expressed as fold change compared to slices of non-perfused livers. Data are from 6 rats for perfusion and 6 rats for no perfusion, using 4 PCLS per experiment. *P<0.05, **p<0.01 and ***p<0.001 when compared with slices without TransSend W perfusion.
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
95
4
Discussion
PCLS retain a high degree of integrity of the liver architecture, cell-cell interactions
and cellular heterogeneity. To successfully cryopreserve PCLS, it is important that all the
different liver cell types remain viable both after CPA loading/unloading and after
vitrification. The basic principle of hypothermic perfusion with a preservation solution is to
minimize the deleterious effect of ischemia during harvesting of the organ and subsequent
cold storage by removing blood cells, providing an appropriate osmotic condition to avoid
cell swelling, providing some substrates for cell protection and reducing temperature at the
same time. Hypothermic perfusion is a standard practice in order to preserve organs for
tissue transplantation [15].TransSend W is an organ preservation solution designed
specifically for liver perfusion [21]. Besides the two impermeants, polyglycerol and lactose
to prevent cell swelling under hypothermic condition, other additives such as adenine
(nucleotide precursors)[22], glutathione[12] and chlorpromazine [16] (antioxidant) and
appropriate buffer capacity [12] are also included in TransSend W. The aim of the present
study was to investigate whether in-situ perfusion with TransSend W is able to improve the
conditions (viability and functionality) of PCLS before and after CPA treatment which is
important for the successful cryopreservation of PCLS.
ATP content, reflecting the energy status and overall metabolic capacity, is considered
as a sensitive marker for viability [1]. Our results indicated that in-situ perfusion
significantly improved the recovery of the viability of PCLS treated with CPA compared to
the control slices. Interestingly, the initial ATP content of the control slices of the perfused
livers were significantly reduced compared to that of the non-perfused livers. We
(unpublished data) and other scientists [9, 23, 24] have observed that it takes 1-6 h for ATP
to recover to the maximal values for non-perfused slices and ATP levels remain stable at
least 48-72 h. The observed difference for ATP content in perfused vs non-perfused slices
may be explained by assuming that the time for recovery may vary between the different
experimental systems (perfusion vs non-perfusion). In contrast to the ATP content, the
initial total LDH content of slices from perfused livers was significantly higher than from
non-perfused livers, which may indicate that LDH leakage during slicing was reduced in
these perfused livers. During slicing, cell damage can result from the cold ischemia injury
due to perturbations in osmoregulation, energetics, and aerobic metabolism [25] or result
from free radicals [26-29]. Perfusion also protected against leakage of LDH caused by M22
treatment, and M22 appeared to be the most toxic among the CPAs tested based on the ATP
content. For the other two CPAs, leakage of LDH was similar to that of control slices and a
significant protective effect of perfusion could not be observed. The beneficial effect on
preserving the LDH total content and on reducing leakage from M22 toxicity might be due
to the inhibition of the formation of free radicals or reduced metabolic activity before and
during slicing by in-situ perfusion with TransSend. Chlorpromazine, one of the components
in TransSend, is capable of a one-electron transfer to Fe3+ to form a cationic free radical
which therefore can act as an antioxidant to terminate a free radical cascade [30].
Chapter 4
96
Moreover, chlorpromazine has shown protective effects in rat liver [31, 32] and kidney [33]
against ischemia injury.
The beneficial effect of in-situ hypothermic perfusion was further confirmed by the
immunohistochemical staining for Kupffer cells and endothelial cells in PCLS after Sol Z
and M22 treatment. In-situ perfusion with TransSend clearly protects non-parenchymal
cells from the damage of the toxicity of certain CPAs although the protective effect was not
universal for all the cell types. Moreover, perfusion increased the reaction to LPS in control
slices but all CPAs reduced the reaction to LPS and perfusion did not protect against this
decreased reaction. Kupffer cells are activated by LPS to increase iNOS expression, NO
production and cytokines excretion, which in turn activate the hepatocytes to increased
expression of iNOS and formation of NO. Therefore, whether the observed difference in
NO production was due to reduced Kupffer cell activity or reduced response of the
hepatocytes or both still has to be determined.
Interestingly, the in-situ perfusion with TransSend W protected the biotransformation
function of the hepatocytes from the toxicity of all CPA treatments as indicated by the
phase I metabolism of 7-HC. It appeared that the protection was not due to an induction of
the metabolic enzymes by the TransSend W since perfusion did not increase the phase I
metabolism in the control slices. The increased phase II glucuronide formation by CPA-
treated slices after perfusion is most likely the result of the increased formation of phase I
metabolites and does not represent an improved capacity for phase II glucuronidation since
the increased amount of phase II glucuronide (7-HC-Gluc) was similar to the increase in
phase I metabolite (7-HC). The relative amount of the two phase II metabolites:
glucuronide and sulfate was the same as previously reported by our lab [2, 34].
The results of the effect of exposure to CPAs on phase I metabolism in slices from
perfused livers were in line with the corresponding ATP results. Interestingly, the results of
IHC staining for the markers of the different NPC cells were not necessarily correlated with
the general viability markers (ATP or LDH leakage). In slices from perfused livers M22
was more toxic than Sol Y, which seemed to be nontoxic as indicated by ATP levels and
leakage of LDH, but the IHC staining for NPC was generally lower after Sol Y than that
after M22 exposure in slices from perfused livers. Hepatocytes account for more than 85%
of the liver volume and for 60% of the total number of liver cells while NPC cells including
Kupffer cells. endothelial cells and stellate cells constitute 40% of the cell number [1]. The
responses by the hepatocytes therefore contribute more to the overall changes in viability
parameters than the individual NPC cell types. Our results indicated the importance of
studying the effect of the CPAs on each of the different cell types in the liver slices.
GSH is an important endogenous antioxidant for the detoxification of oxygen-derived
free radicals and therefore protects cells against oxidative stress and reactive metabolites
[35, 36]. TransSend W contains GSH and chlorpromazine which can act as free-radical
scavengers [37]. We speculated that perfusion with TransSend W could increase the GSH
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
97
4
content, which might contribute to the beneficial effect of in-situ perfusion before tissue
slicing and CPA load/unloading. Interestingly, the GSH content in the control slices was
significantly lower after perfusion while total glutathione remained the same.
Instead, the beneficial effect could be explained by the fact the perfusion suppressed
the inflammatory responses as indicated by the down-regulation of gene expression of IL-6,
TNF-α, MHC-II, eNOS and iNOS. An up-regulation of MDR genes has previously been
observed in ischemic organs [38] or due to hypoxia [39], and our results show that the
expression of both MDR 1a and MDR 1B were lower after perfusion. Taken together, these
data indicate that in-situ perfusion exhibits protective effects against ischemia injury during
preparation and subsequent reperfusion damage during incubation of the PCLS.
Conclusion
We found that hypothermic in-situ perfusion with TransSend W was protective to liver
slices in particular when exposed subsequently to CPAs as indicated by both the general
viability markers (ATP and LDH leakage) and the presence and functionality markers for
different cells types including hepatocytes, Kupffer cells, stellate cells and endothelial cells
(IHC staining, NOx and metabolism). Although the exact mechanism of protecting tissue
by perfusion with TransSend W against toxicity of CPA is still unknown, the protective
effects observed might be due to the better tissue condition before CPA loading (LDH
content and lower expression of cell stress-related genes). In conclusion, the in-situ
perfusion with TransSend W is protective to PCLS exposed subsequently to CPA, which
indicates that this perfusion may be a first step to successful development of improved
vitrification protocols for PCLS.
References 1. de Graaf, I.A., Olinga, P., de Jager, M.H., Merema, M.T., de Kanter, R., van de Kerkhof, E.G.,
and Groothuis, G.M., Preparation and incubation of precision-cut liver and intestinal slices for application in drug metabolism and toxicity studies. Nat. Protoc., 2010. 5(9): p. 1540-51.
2. de Kanter, R., Monshouwer, M., Meijer, D.K., and Groothuis, G.M., Precision-cut organ slices as a tool to study toxicity and metabolism of xenobiotics with special reference to non-hepatic tissues. Curr Drug Metab, 2002. 3(1): p. 39-59.
3. Vickers, A.E. and Fisher, R.L., Precision-cut organ slices to investigate target organ injury. Expert Opin Drug Metab Toxicol, 2005. 1(4): p. 687-99.
4. Mazur, P., Freezing of living cells: mechanisms and implications. Am J Physiol, 1984. 247(3 Pt 1): p. C125-42.
5. Rall, W.F. and Fahy, G.M., Ice-free cryopreservation of mouse embryos at -196 degrees C by vitrification. Nature, 1985. 313(6003): p. 573-5.
6. Fahy, G.M., MacFarlane, D.R., Angell, C.A., and Meryman, H.T., Vitrification as an approach to cryopreservation. Cryobiology, 1984. 21(4): p. 407-26.
7. Fahy, G.M., Wowk, B., Wu, J., and Paynter, S., Improved vitrification solutions based on the predictability of vitrification solution toxicity. Cryobiology, 2004. 48(1): p. 22-35.
8. Fahy, G.M., Cryoprotectant toxicity neutralization. Cryobiology, 2010. 60(3 Suppl): p. S45-53. 9. de Graaf, I.A. and Koster, H.J., Cryopreservation of precision-cut tissue slices for application
in drug metabolism research. Toxicol In Vitro, 2003. 17(1): p. 1-17.
Chapter 4
98
10. Fahy, G.M., Wowk, B., Wu, J., Phan, J., Rasch, C., Chang, A., and Zendejas, E., Cryopreservation of organs by vitrification: perspectives and recent advances. Cryobiology, 2004. 48(2): p. 157-78.
11. Guan, N., Blomsma, S.A., van Midwoud, P.M., Fahy, G.M., Groothuis, G.M., and de Graaf, I.A., Effects of cryoprotectant addition and washout methods on the viability of precision-cut liver slices. Cryobiology, 2012. 18: p. 18.
12. Dinant, S., Roseboom, H.J., Levi, M., van Vliet, A.K., and van Gulik, T.M., Hypothermic in situ perfusion of the porcine liver using Celsior or Ringer-lactate solution. Langenbecks Arch Surg, 2009. 394(1): p. 143-50.
13. Azoulay, D., Eshkenazy, R., Andreani, P., Castaing, D., Adam, R., Ichai, P., Naili, S., Vinet, E., Saliba, F., Lemoine, A., Gillon, M.C., and Bismuth, H., In situ hypothermic perfusion of the liver versus standard total vascular exclusion for complex liver resection. Ann Surg, 2005. 241(2): p. 277-85.
14. Fuller, B.J. and Lee, C.Y., Hypothermic perfusion preservation: the future of organ preservation revisited? Cryobiology, 2007. 54(2): p. 129-45.
15. St Peter, S.D., Imber, C.J., and Friend, P.J., Liver and kidney preservation by perfusion. Lancet, 2002. 359(9306): p. 604-13.
16. Fahy, G.M., Polyglycerol compositions for the protection of living systems from states of reduced metabolism United States Patent 7550255 B2, 2009.
17. Moshage, H., Kok, B., Huizenga, J.R., and Jansen, P.L., Nitrite and nitrate determinations in plasma: a critical evaluation. Clin Chem, 1995. 41(6 Pt 1): p. 892-6.
18. van Midwoud, P.M., Groothuis, G.M., Merema, M.T., and Verpoorte, E., Microfluidic biochip for the perifusion of precision-cut rat liver slices for metabolism and toxicology studies. Biotechnol Bioeng, 2010. 105(1): p. 184-94.
19. Khan, A.A., Chow, E.C., van Loenen-Weemaes, A.M., Porte, R.J., Pang, K.S., and Groothuis, G.M., Comparison of effects of VDR versus PXR, FXR and GR ligands on the regulation of CYP3A isozymes in rat and human intestine and liver. Eur J Pharm Sci, 2009. 37(2): p. 115-25.
20. Alves, I.D., Goasdoue, N., Correia, I., Aubry, S., Galanth, C., Sagan, S., Lavielle, S., and Chassaing, G., Membrane interaction and perturbation mechanisms induced by two cationic cell penetrating peptides with distinct charge distribution. Biochim Biophys Acta, 2008. 1780(7-8): p. 948-59.
21. Fahy, G.M., Guan, N., de Graaf, I.A.M., Tan, Y., Griffina, L., and Groothius, G.M.M., Cryopreservation of Precision-Cut Tissue Slices. Xenobiotica, 2012. accepted.
22. Bishop, C., Blood preservation solutions containing adenine, phosphate, and guanosine. Proc Soc Exp Biol Med, 1966. 122(2): p. 424-8.
23. Smith, P.F., Krack, G., McKee, R.L., Johnson, D.G., Gandolfi, A.J., Hruby, V.J., Krumdieck, C.L., and Brendel, K., Maintenance of adult rat liver slices in dynamic organ culture. In Vitro Cell Dev Biol, 1986. 22(12): p. 706-12.
24. Dogterom, P., Development of a simple incubation system for metabolism studies with precision-cut liver slices. Drug Metab Dispos, 1993. 21(4): p. 699-704.
25. Salahudeen, A.K., Cold ischemic injury of transplanted kidneys: new insights from experimental studies. Am J Physiol Renal Physiol, 2004. 287(2): p. F181-7.
26. Li, C. and Jackson, R.M., Reactive species mechanisms of cellular hypoxia-reoxygenation injury. Am J Physiol Cell Physiol, 2002. 282(2): p. C227-41.
27. Rauen, U. and de Groot, H., Cold-induced release of reactive oxygen species as a decisive mediator of hypothermia injury to cultured liver cells. Free Radic Biol Med, 1998. 24(7-8): p. 1316-23.
28. Rauen, U., Elling, B., Gizewski, E.R., Korth, H.G., Sustmann, R., and de Groot, H., Involvement of reactive oxygen species in the preservation injury to cultured liver endothelial cells. Free Radic Biol Med, 1997. 22(1-2): p. 17-24.
29. Salahudeen, A.K., Huang, H., Patel, P., and Jenkins, J.K., Mechanism and prevention of cold storage-induced human renal tubular cell injury. Transplantation, 2000. 70(10): p. 1424-31.
The Effect of Hypothermic in Situ Perfusion on Cryoprotectant Toxicity
99
4
30. Jeding, I., Evans, P.J., Akanmu, D., Dexter, D., Spencer, J.D., Aruoma, O.I., Jenner, P., and Halliwell, B., Characterization of the potential antioxidant and pro-oxidant actions of some neuroleptic drugs. Biochem Pharmacol, 1995. 49(3): p. 359-65.
31. Farber, J.L., Biology of disease: membrane injury and calcium homeostasis in the pathogenesis of coagulative necrosis. Lab Invest, 1982. 47(2): p. 114-23.
32. Chien, K.R., Abrams, J., Pfau, R.G., and Farber, J.L., Prevention by chlorpromazine of ischemic liver cell death. Am J Pathol, 1977. 88(3): p. 539-57.
33. Araújo, W.M.d., Tucci Júnior, S., Costa, R.S., Ferreira, R.A., Pozza, M.d.L., Mazzetto, S.A., Alves, P., Cologna, A.J., and Martins, A.C.P., Animal model of renal ischemic injury, and chlorpromazine protector effect, evaluate by tc-99m-mag3 dynamic renal scan. Acta Cirurgica Brasileira, 2002. 17: p. 15-19.
34. de Kanter, R., de Jager, M.H., Draaisma, A.L., Jurva, J.U., Olinga, P., Meijer, D.K., and Groothuis, G.M., Drug-metabolizing activity of human and rat liver, lung, kidney and intestine slices. Xenobiotica, 2002. 32(5): p. 349-62.
35. Fernandez-Checa, J.C., Kaplowitz, N., Garcia-Ruiz, C., and Colell, A., Mitochondrial glutathione: importance and transport. Semin Liver Dis, 1998. 18(4): p. 389-401.
36. Kaplowitz, N., Aw, T.Y., and Ookhtens, M., The regulation of hepatic glutathione. Annu Rev Pharmacol Toxicol, 1985. 25: p. 715-44.
37. Slater, T.F., Free-radical mechanisms in tissue injury. Biochem J, 1984. 222(1): p. 1-15. 38. Lazarowski, A.J., Garcia Rivello, H.J., Vera Janavel, G.L., Cuniberti, L.A., Cabeza Meckert,
P.M., Yannarelli, G.G., Mele, A., Crottogini, A.J., and Laguens, R.P., Cardiomyocytes of chronically ischemic pig hearts express the MDR-1 gene-encoded P-glycoprotein. J Histochem Cytochem, 2005. 53(7): p. 845-50.
39. Comerford, K.M., Wallace, T.J., Karhausen, J., Louis, N.A., Montalto, M.C., and Colgan, S.P., Hypoxia-inducible factor-1-dependent regulation of the multidrug resistance (MDR1) gene. Cancer Res, 2002. 62(12): p. 3387-94.
