University of Groningen

Acetylcholine beyond bronchoconstriction: a regulator of inflammation and remodelingKistemaker, Loes

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Kistemaker, L. (2015). Acetylcholine beyond bronchoconstriction: a regulator of inflammation andremodeling. [S.l.]: [S.n.].

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 10-03-2020

  

Acetylcholine beyond bronchoconstriction: 

a regulator of inflammation and remodeling 

 

 

 

 

Loes E.M. Kistemaker

 

  

The  studies  described  in  this  thesis  were  performed  within  the  framework  of  the 

Groningen University  Institute for Drug Exploration (GUIDE) and the Groningen Research 

Institute for Asthma and COPD (GRIAC), and financially supported by the Netherlands Lung 

Foundation. 

Printing of this thesis was financially supported by: 

Univeristy of Groningen 

Groningen Graduate School of Science 

Netherlands Lung Foundation 

Boehringer Ingelheim 

Holaira  

 

 

 

 

 

Paranimfen:   Anita Spanjer ‐ van Dijk 

    Els Vernooij ‐ Kistemaker 

 

 

 

 

 

ISBN: 978‐90‐367‐7618‐9 

ISBN: 978‐90‐367‐7617‐2 (electronic version) 

Cover:  The  bronchial  tree  of  fetal  pig  lung,  stained  for  nerves  and  smooth  muscle; 

previously published in The Lung: Development, Aging and the Environment, MP Sparrow, 

Development of the Airway Innervation, 33‐53, Copyright Elsevier (2003). 

Cover design: Bart Leferink 

Printed by: Ipskamp Drukkers BV, Enschede 

Copyright © L.E.M. Kistemaker, 2015 

All  rights  reserved. No  part  of  this  book may  be  reproduced  in  any manner  or  by  any 

means without permission.   

  

 

Acetylcholine beyond bronchoconstriction A regulator of inflammation and remodeling 

    

Proefschrift      

ter verkrijging van de graad van doctor aan de  Rijksuniversiteit Groningen 

op gezag van de rector magnificus prof. dr. E. Sterken, 

en volgens het besluit van het College voor Promoties.  

De openbare verdediging zal plaats vinden op  

vrijdag 6 maart 2015 om 16.15 uur    

door    

Loes Elisabeth Maria Kistemaker  

geboren op 4 september 1986 te Oldenzaal  

 

  

Promotores   

Prof. dr. R. Gosens 

Prof. dr. H. Meurs 

Prof. dr. H.A.M. Kerstjens 

 

 

Beoordelingscommissie 

Prof. dr. A.J. Halayko 

Prof. dr. W. Kummer 

Prof. dr. D.S. Postma 

 

 

  

Table of contents 

Chapter 1 

 

General introduction 

7 

Chapter 2  Regulation of airway inflammation and remodeling by muscarinic 

receptors: perspectives on anticholinergic therapy in asthma and 

COPD 

Life Sci, 2012, 91(21‐22):1126‐33  

35 

Chapter 3  Muscarinic receptor subtype‐specific effects on cigarette smoke‐

induced inflammation in mice 

Eur Respir J, 2013, 42(6):1677‐88  

57 

Chapter 4  Muscarinic M3  receptors  on  structural  cells  regulate  cigarette 

smoke‐induced neutrophilic airway inflammation in mice 

Am J Physiol Lung Cell Mol Physiol, 2015, 308(1):L96‐L103  

81 

Chapter 5  Anti‐inflammatory  effects  of  acetylcholine  inhibition  after 

targeted lung denervation in patients with COPD 

Submitted to Thorax, 2015  

101 

Chapter 6  Muscarinic M₃  receptors  contribute  to  allergen‐induced  airway 

remodeling in mice 

Am J Respir Cell Mol Biol, 2014, 50(4):690‐8  

111 

Chapter 7  Murine precision‐cut  lung slices as a model  to study TGF‐β and 

bronchoconstriction‐induced remodeling  

135 

Chapter 8  Tiotropium  attenuates  IL‐13‐induced  goblet  cell  metaplasia  of 

human airway epithelial cells 

Thorax, 2015, In revision  

155 

Chapter 9  General discussion and summary

Trends Pharmacol Sci, 2014, Epub  

175 

 

Nederlandse samenvatting  

199 

Dankwoord  

211 

Curriculum vitae  

217 

List of publications  219 

  

 

 

  

 

 

 

 

 

CHAPTER 1 

GENERAL INTRODUCTION 

Chapter 1 

8 

Preface 

The  objective  of  this  thesis  is  to  establish  the  role  of  acetylcholine  and  individual 

muscarinic  receptor  subtypes  in  inflammation  and  remodeling  of  the  airways. 

Inflammation and remodeling are two  important pathophysiological processes  in asthma 

and chronic obstructive pulmonary disease (COPD), affecting the decline  in  lung function 

and  severity  of  the  disease.  In  the  airways,  acetylcholine  acts  as  a  parasympathetic 

neurotransmitter,  but  also  as  an  autocrine  and/or  paracrine  hormone.  Muscarinic 

receptors are target receptors  for acetylcholine and muscarinic receptor antagonists are 

used  as  a  therapy  for  COPD,  and  to  a  lesser  extent  also  for  asthma.  Consequently,  a 

potential role for acetylcholine in inflammation and remodeling in COPD and asthma could 

have important therapeutic implications. 

 

Acetylcholine, a neurotransmitter and a hormone 

Acetylcholine – a neurotransmitter 

Acetylcholine  is  the  primary  parasympathetic  neurotransmitter  of  the  airways. 

Acetylcholine was detected by Otto Loewi and Sir Henry Dale in the early 1920s, for which 

they received the Nobel prize in 1936. As a neurotransmitter, acetylcholine is synthesized 

in nerve endings from the substrates choline and acetyl‐CoA by the enzyme choline acetyl 

transferase  (ChAT)  (1).  The  uptake  of  choline  from  the  extracellular  space  is  the  rate‐

limiting  step  in  this  process  (2).  Synthesized  acetylcholine  is  translocated  into  synaptic 

vesicles  via  the  vesicular acetylcholine  transporter  (VAChT), and  released by exocytosis. 

Exocytosis  is  triggered  by  a  depolarizing  stimulus  and modulated  by  several  regulatory 

mechanisms  in the neuroeffector  junction (1). This results  in the release of acetylcholine 

from airway parasympathetic nerve endings  in the extracellular space, where  it  interacts 

with  postsynaptic  target  receptors,  but  also with  presynaptic  receptors  on  cholinergic 

nerve  terminals  themselves.  Target  receptors  of  acetylcholine  include  muscarinic 

receptors  and  nicotinic  receptors,  which  will  be  introduced  in  more  detail  below. 

Acetylcholine  in  the  synaptic  cleft  is  rapidly  degraded  into  acetate  and  choline  by  the 

highly expressed enzyme acetylcholine esterase (AChE). Alternatively, acetylcholine can be 

degraded by butyrylcholinesterase (BChE) (1). Choline can be taken up again by the nerve 

for acetylcholine synthesis. The acetylcholine synthesis pathway in neurons is summarized 

in figure 1A, together with the non‐neuronal synthesis pathway, which will be elaborated 

on later. 

 

 

General introduction 

 9 

  

Figure 1. Schematic representation of acetylcholine synthesis, release, action and breakdown in neuronal cells at 

a  cholinergic nerve  terminal  (A) and  in non‐neuronal  cells,  such as epithelial  cells  (B).  In neurons,  there  is an 

efficient metabolism  of  acetylcholine  (ACh),  involving  the  high‐affinity  choline  transporter‐1  (CHT1),  choline 

acetyltransferase (ChAT), the vesicular ACh transporter (VAChT) and ACh release via exocytosis. Although some 

non‐neuronal  cells  also  express  these  components,  they  are  not  common  to  all  cell  types  and  probably 

alternative, less efficient, mechanisms predominate. Perhaps as a consequence, acetylcholine content is lower. In 

non‐neuronal  cells,  choline  is  taken up not only via CHT1, but also via  choline  transporter‐like proteins  (CTL), 

including  CTL1,  CTL2  and  CTL4.  Carnitine  acetyltransferase  (CarAT)  has  been  identified  as  an  alternative 

synthesizing enzyme of ACh. Organic cation transporters (OCT),  including OCT1 and OCT2, have been shown to 

transport ACh in and out of cells (3). MR: muscarinic receptor, NR: nicotinic receptor, AChE: acetylcholinesterase, 

BChE: butyrylcholinesterase. 

 

Airway nerves 

Airway  nerves  regulate many  aspects  of  airway  function.  One  of  the most  prominent 

effects is the regulation of airway smooth muscle tone, the neural component of which is 

almost solely controlled by the parasympathetic nervous system (4, 5). Although airways 

also  express  sympathetic  and non‐adrenergic, non‐cholinergic  (NANC) neural pathways, 

focus  of  this  thesis  is  on  the  parasympathetic  neural  pathway, which  is  the  dominant 

neural pathway in the airways and uses acetylcholine as a neurotransmitter. Airway vagal 

nerve  fibers  can  be  divided  into  three major  components:  the  primary  afferent  nerve 

fibers, the  integrating centers  in the brain and the parasympathetic efferent nerve fibers 

(see figure 2) (6). Afferent nerve fibers in the airways include stretch‐sensitive myelinated 

nerve fibers or A‐fibers, and unmyelinated C‐fibers (7). A‐fibers conduct action potentials 

Chapter 1 

10 

at a relatively high velocity and consist of rapidly adapting receptors (RARs) in the mucosal 

layer, which respond to the dynamic phase of  inspiration, and slowly adapting receptors 

(SARs) in the smooth muscle layer, which respond to maintained inflation (7‐9). However, 

most  of  the  airway  afferent  nerves  are  unmyelinated  C‐fibers,  which  are  present 

throughout the airways and conduct action potentials at a much slower velocity compared 

to A‐fibers  (6, 10). C‐fibers  respond  to noxious  stimuli  such as heat, cold or mechanical 

forces,  but  also  to  mediators  released  upon  tissue  damage  and  inflammation  (7). 

Activation  of  these  C‐fibers  results  in  bronchoconstriction, mucus  secretion  and  cough 

(11). This can be a  local reflex  in the airways at the  level of the parasympathetic ganglia, 

which involves the release of peptide neurotransmitters, including substance P and other 

tachykinins, directly from the nerve terminals (12). Next to this local reflex, a central reflex 

arch  via  the  brain  stem  exists  (9).  Parasympathetic  efferent  nerve  fibers  consist  of 

preganglionic neurons, which innervate the parasympathetic ganglia in or near the airway 

wall of  larger airways, and postganglionic neurons  (6). Postganglionic neurons  innervate 

airway  smooth muscle, mucus  glands  and  the microvasculature  throughout  the  airway 

tree  (figure  2).  In  addition,  postganglionic  parasympathetic  neurons, which  do  not  use 

acetylcholine as a transmitter, exist. Instead, these NANC pathways use nitric oxide and/or 

neuropeptides  such  as  vasoactive  intestinal  peptide  as  a  transmitter,  and  are  in  fact 

bronchodilatory  (6).  However,  the  parasympathetic  cholinergic  nervous  system  is  the 

major neural regulator of airway smooth muscle tone (4, 9, 13). 

 

 

Figure  2.  The  vagal  nervous  system  in  the  airways.  Mechanical  forces,  inhaled  irritants  and  endogenous 

inflammatory mediators activate afferent nerve fibres, which send signals to the central nervous system (CNS). 

This  results  in  the  release of acetylcholine  (ACh)  in  the airways. Parasympathetic, post‐ganglionic neurons are 

located within the airway wall and innervate airway smooth muscle and submucosal glands to induce contraction 

and mucus secretion, respectively. Blue: afferent nerve fibers; red: efferent nerve fibers. RAR: rapidly adapting 

receptors; SAR: slowly adapting receptors. 

General introduction 

 11 

Acetylcholine ‐ a hormone 

During the last decades, it has become clear that acetylcholine production in the airways is 

not  only  restricted  to  the  nerves.  Bacteria,  algae,  protozoa,  tubellariae  and  primitive 

plants,  all  lacking  a  nervous  system,  express  acetylcholine.  This  suggests  an  early  and 

widely distributed  role of acetylcholine  (14).  Indeed, cells of higher organisms,  including 

cells  of  the  human  airway,  have  been  shown  to  produce  acetylcholine  (14,  15).  Thus, 

acetylcholine  can act as a  local  signaling molecule  in an autocrine or paracrine  fashion, 

which  is  referred  to  as  non‐neuronal  acetylcholine.  RNA  expression  of  ChAT  has  been 

detected  in almost all cell  types of  the airways,  including epithelial cells, airway smooth 

muscle cells and  inflammatory cells (16). Additionally, carnitine acetyltransferase (CarAT) 

has been detected as an alternative, albeit less efficient, route for acetylcholine synthesis 

in airway cells (2). In particular epithelial cells have been shown to express relatively high 

levels  of  acetylcholine  (17,  18),  and  the  epithelial  non‐cholinergic  system  has  been 

characterized  in detail  (2). Evidence  for the actual release of non‐neuronal acetylcholine 

from other airway cell types is still  limited (15). Part of the biosynthesis pathway of non‐

neuronal acetylcholine overlaps with  that used by  the neuronal  system; however,  clear 

differences exist, the former being  less efficient (2). For example, neurons use the highly 

efficient  CHT1  transporter  for  choline  uptake,  whereas  non‐neuronal  cells mainly  use 

choline transporter‐like proteins (CTLs) and organic cation transporters (OCTs) for choline 

uptake (2). In addition, in neurons, acetylcholine is stored and subsequently released from 

vesicles, whereas  in non‐neuronal cells acetylcholine  is mainly released directly via OCTs 

(2, 3) (figure 1B). As a consequence, acetylcholine levels seem to be lower in non‐neuronal 

cells compared to neuronal cells. The functional relevance of non‐neuronal acetylcholine 

in  the  airways  still  has  to  be  established  and  it  is  unclear  whether  non‐neuronal 

acetylcholine contributes to the classical cholinergic driven effects as described above (3). 

However,  the  concept  that  acetylcholine  is  not  only  a  neurotransmitter  but  also  a 

hormone has dramatically broadened the view on the role of acetylcholine in the airways, 

and  holds  therapeutic  promises  for  the  future, which will  be  further  elaborated  on  in 

chapter 2 (19‐21).  

Targets of acetylcholine 

Acetylcholine  can  act  via  two  different  classes  of  receptors,  namely  muscarinic  and 

nicotinic  receptors. Muscarinic  receptors are G‐protein coupled  receptors, characterized 

by a seven transmembrane domain (1). Five different subtypes have been identified (M1‐

M5), of which M1‐M3 receptors are expressed abundantly in the airways (1, 16, 21). Almost 

all  cell  types  in  the  airways  express muscarinic  receptors,  as discussed  in detail below. 

Activation of muscarinic receptors in the airways leads to bronchoconstriction and mucus 

secretion (21). Nicotinic receptors are  ligand gated  ion channels, which are comprised of 

Chapter 1 

12 

one  to  five different  types of  subunits  (α,  β,  γ,  δ and  ε)  (1). Multiple different nicotinic 

receptor isotypes exist and at least ten different α‐subunits and four different β‐subunits 

have been  identified.  In  the airways, almost all cell  types express nicotinic  receptors  (1, 

15). Nicotinic receptors are involved in neurotransmission in the airways, and activation of 

nicotinic  receptors  causes  an  influx  of  positively  charged  ions,  leading  to  membrane 

depolarization (1, 22). The nicotinic α7 receptor is highly expressed on multiple cell types 

in  the  airways  and  plays  an  immunomodulatory  role  (15). Moreover,  the  nicotinic  α7 

receptor  is  thought  to  play  a  regulatory  role  in  lung  cancer  (23).  Current  therapy  for 

obstructive  airway  diseases,  however,  is  selectively  directed  to  muscarinic  receptors. 

Therefore, the focus of this thesis  is on muscarinic receptors, and nicotinic receptors will 

not be discussed in more detail here. 

 

Muscarinic receptors 

Expression of muscarinic receptors 

Expression  of muscarinic M1, M2  and M3  receptors  has  been  detected  in  the  airways. 

Although muscarinic  receptor antibodies have been proven not  to be very useful  in  the 

detection  of  subtype  specific  expression  of  muscarinic  receptors  because  of  lack  of 

specificity  (24,  25),  other  techniques,  including  binding  studies  and  gene  expression 

analyses, have elucidated the expression pattern of muscarinic receptors throughout the 

airways.  From  these  studies,  it  is  clear  that  M1  receptors  appear  to  be  expressed 

particularly in peripheral lung tissue, M2 receptors are expressed throughout the airways, 

whereas expression of M3 receptors is highest in the larger airways (1, 26). Almost all cells 

of  the  airways  express  muscarinic  receptors,  with  high  expression  on  airway  smooth 

muscle  cells,  epithelial  cells  and  submucosal  glands.  Moreover,  in  parasympathetic 

ganglia, M1 receptors are expressed, as well as autoinhibitory prejunctional M2 receptors 

(21,  22).  Expression  of muscarinic  receptors  per  cell  type,  and  their major  functional 

effects, are summarized in table 1. 

Signal transduction of muscarinic receptors 

Muscarinic receptors couple to heterotrimeric G proteins. G proteins are composed of an 

α‐, β‐ and γ‐subunit, and are classified according to the α‐subunit. Four different families 

have been identified: Gαs, Gαi/o, Gαq/11 and Gα12/13 (30, 31). M2 receptors couple primarily 

to  Gαi  and  M1  and  M3  receptors  couple  primarily  to  Gαq  (32).  Receptor  activation 

promotes  the exchange of  guanosine diphosphate  (GDP), bound  to  the  α‐subunit, with 

guanosine triphosphate (GTP). This will lead to dissociation of the α‐subunit from the βγ‐

heterodimer and subsequent activation of second messengers  (30). Activation of Gαi via 

M2 receptors results in inhibition of adenylyl cyclase (AC), which in turn inhibits the second 

General introduction 

 13 

messenger  cyclic AMP  (cAMP), and Gβγ mediated  inhibition of potassium  channels  (33, 

34). Activation of Gαq  via M1 and M3  receptors  results  in activation of phospholipase C 

(PLC).  PLC  converts  phosphatidylinositol‐4,5‐bisphosphate  (PIP2)  into  inositol  1,4,5‐

trisphosphate  (IP3)  and  diacylglycerol  (DAG).  IP3  induces  the  release  of  calcium  from 

internal endoplasmic reticulum stores, whereas DAG activates protein kinase C (PKC). The 

initial  calcium  release  is  followed  by  a  more  sustained  calcium  release  mediated  via 

ryanodine  receptors  on  the  endoplasmic  reticulum,  and  via  an  increase  in  the  open 

probability of calcium channels in the cell membrane, mediated via PKC (35). 

Functional roles in the airways 

Neurotransmission 

M1  receptors expressed  in parasympathetic ganglia  contribute  to neurotransmission, by 

facilitating  depolarization  via  inhibition  of  potassium  currents.  The  magnitude  of 

muscarinic depolarization may not be sufficient to initiate an action potential by itself, but 

rather  enhances  or  facilitates  nicotinic‐induced  depolarization  (1).  It  should  be  noted 

therefore  that  there  is  still  debate  about  the  functional  relevance  of  M1‐mediated 

neurotransmission (1). Evidence for the auto‐inhibitory role of prejunctional M2 receptors 

is more  convincing,  since M2  selective  antagonists  enhance  electrical  field  stimulation‐

induced  acetylcholine  release  from  guinea  pig  and  human  trachea  (36,  37).  The 

autoinhibitory M2 receptor is dysfunctional in asthma, which contributes to the enhanced 

cholinergic tone in this disease (16). No such mechanism has been observed in COPD (38). 

 

Table 1. Expression of muscarinic receptors on airway cells and their major effects (16, 27‐29). 

Cell  Muscarinic receptor 

expression 

Functional effect 

Neuron  M1, M2  Neurotransmission 

Airway smooth muscle cell  M2, M3  Bronchoconstriction via M3 

Epithelial cell  M1, M2, M3  Mucus secretion via M3 

Submucosal gland  M1, M3  Mucus secretion via M3 

Fibroblast  M1, M2, M3  Proliferation, ECM production 

Mast cell  M1, M3  Inhibition of histamine release 

Macrophage  M1, M2, M3  Cytokine production 

Lymphocyte  M1, M2, M3  Cytokine production 

Neutrophil  M1, M2, M3  Cytokine production 

Eosinophil  M1, M2, M3  ? 

 

   

Chapter 1 

14 

Airway smooth muscle contraction 

Muscarinic  receptors  on  airway  smooth  muscle  mediate  airway  smooth  muscle 

contraction, and therefore play an  important role  in bronchoconstriction associated with 

COPD and asthma. Although M2 receptors represent the majority of muscarinic receptors 

expressed  on  airway  smooth  muscle,  airway  smooth  muscle  contraction  is  primarily 

mediated by M3 receptors  (39). This  is clear from affinity profiles of selective muscarinic 

antagonists  in  different  species,  including  humans  (16). Moreover,  the  introduction  of 

specific  muscarinic  receptor  subtype  deficient  animals  confirmed  that  this  is  an  M3‐

mediated  effect,  as  M3  receptor  deficient  mice  (M3R‐/‐),  and  not  M2R

‐/‐  mice,  lack 

methacholine and vagally‐induced bronchoconstriction in vivo (40).  

Mucus secretion 

Muscarinic  receptors  regulate  mucus  secretion  in  the  airways.  Mucus  secretion  is 

enhanced  in COPD and asthma, which  contributes  to airflow obstruction of  the airways 

(41). Mucus  is  secreted  by  airway  submucosal  glands, which  are  in  connection  to  the 

airway  lumen,  and  by  goblet  cells,  which  are  embedded  in  the  airway  epithelium. 

Submucosal  glands  are  innervated  by  parasympathetic  nerves  (see  also  figure  2),  and 

mucus  secretion  from  glands  is  under  cholinergic  control, mediated  via M3  receptors. 

Thus,  electrical  field  stimulation  increases  mucus  secretion  from  airway  preparations, 

which can be inhibited by the M3 antagonist 4‐DAMP (1,1‐Dimethyl‐4‐diphenylacetoxy‐pi‐ 

peridinium  iodide)  (42, 43). Acetylcholine  can  also  induce mucus  secretion  from  goblet 

cells,  again mediated primarily  via M3  receptors  (21,  41).  There  is  still  debate whether 

acetylcholine‐induced mucus secretion from goblet cells is mediated by neuronal or non‐

neuronal acetylcholine, or by a combination of both. M1 receptors are also expressed on 

epithelial  cells  and  submucosal  glands,  and mediate  electrolyte  and water  secretion  in 

cooperation with M3 receptors (21, 42). 

 

Vagal dysregulation 

Activity  of  the  neuronal  system  is  altered  in  disease,  including  asthma  and  COPD,  via 

several  mechanisms,  leading  to  exaggerated  acetylcholine  release  and  airway 

hyperresponsiveness (9, 13, 44). This can be via [1] changes in activity of afferent nerves, 

[2] changes  in synaptic  transmission and  [3] changes  in neurotransmitter content  in  the 

synaptic cleft. First, changes in activity of afferent nerves have been observed in response 

to inflammatory mediators, present in the airways of patients with COPD or asthma. This 

results  in enhanced release of acetylcholine from vagal nerve endings and an  increase  in 

cholinergic  tone  (6).  This  effect  can  be mediated  via  several  inflammatory mediators, 

including  histamine,  tachykinins,  prostaglandins  and  thromboxane  A2,  which  stimulate 

General introduction 

 15 

sensory  nerve  fibers  directly  (6,  45). Moreover,  epithelial  damage will  expose  afferent 

sensory  nerve  endings  in  the  subepithelial  layer  to  the  airway  lumen  (46).  Second, 

inflammation can also change synaptic transmission, by increasing synaptic efficacy and by 

increasing acetylcholine release, via the release of mediators including tachykinins, which 

interact with receptors on nerve terminals (6, 12). Moreover, autoinhibitory prejunctional 

M2  receptors,  which  limit  acetylcholine  release  under  healthy  conditions,  are 

dysfunctional  in  asthmatic  airways.  This  has  been  shown  in  animal models  of  allergen 

exposure, viral  infection and ozone exposure  (47), but also  in patients with asthma  (16, 

48). M2 receptor dysfunction is probably mediated via several mechanisms, but convincing 

evidence exists for the involvement of major basis protein. Major basic protein is secreted 

by eosinophils that are recruited to airway nerves, and acts as an allosteric antagonist for 

the M2 receptor (49). In support, treatment with an antibody against major basic protein 

prevents M2 receptor dysfunction  in guinea pigs  (50). Third, acetylcholine content  in the 

synaptic  cleft  is  altered.  In  part  this  is  due  to  dysfunctional M2  receptors  as  described 

above, but  it has  also been  shown  that  activity of AChE  is  reduced  in  tracheal  smooth 

muscle homogenates obtained  from  ragweed pollen‐sensitized dogs  compared  to  sham 

controls  (51).  Together,  this  results  in  enhanced  acetylcholine  concentrations  in  the 

synaptic cleft and prolonged effects on postjunctional target receptors.  

There  is  little  evidence  for  altered muscarinic  receptor  expression  in  asthma  or  COPD. 

Using  radioligand  binding  studies,  no  significant  changes  were  observed  in  affinity  or 

density of muscarinic receptors in the central or peripheral airways of patients compared 

to  healthy  controls  (52,  53).  Moreover,  until  now,  there  is  no  evidence  for  genetic 

polymorphisms of muscarinic receptors, as at least M2 and M3 receptors seem to be highly 

conserved, and no  significant differences between healthy and asthmatic  subjects were 

detected (54). 

Besides these acute effects on vagal nerves, there is also evidence for neural remodeling. 

Growth and development of airway nerves continues well into adolescence, and exposure 

to allergens might alter airway nerve structure (55). Pan et al. demonstrated that allergen 

exposure  in  guinea pigs  results  in  a  shift  from  a NANC phenotype, which does not use 

acetylcholine  as  a  neurotransmitter,  towards  a  cholinergic  phenotype  (56).  In  addition, 

alterations  in airway nerve  structure might  start very early  in  life, which may affect  the 

incidence of airway diseases later in life (57). A recent paper demonstrated that early‐life 

exposure of mouse neonates to ovalbumin leads to a two‐fold increase in airway smooth 

muscle innervation in adulthood (58). Furthermore, exposure of infant rhesus monkeys to 

ozone and/or house dust mite  results  in  changes  in airway  innervation  in  the epithelial 

region  (59). Thus, exposure  to allergen or environmental stress, either early  in  life or  in 

Chapter 1 

16 

adulthood, may lead to dysregulated vagal innervation, and might thereby affect airways 

diseases. 

Although  most  of  these  studies  focus  on  asthmatic  airways,  evidence  suggests  that 

innervation is also altered in the airways of COPD patients (7). The inflammatory response 

in  the  airways  of  patients  with  COPD  might  trigger  acetylcholine  release  via  above 

described mechanisms. Moreover, altered breathing patterns and changes in gas tensions 

in patients with COPD activate RAR‐fibers and SAR‐fibers  (7), and  the ability of SARs  to 

respond  to  lung  inflation seems  to be be altered  in patients with COPD  (13). Therefore, 

dysregulation of vagal nerves, leading to an increased cholinergic tone, largely contributes 

to both COPD and asthma pathophysiology.  Strikingly,  increased  cholinergic  tone  is  the 

major reversible component of airflow limitation in COPD (60, 61). 

 

Muscarinic receptors in the treatment of COPD and asthma 

Therapeutic targets in COPD and asthma       

As described above, muscarinic receptors play a key role in regulating bronchoconstriction 

and mucus secretion, and cholinergic tone is increased in patients with COPD and asthma. 

For  these reasons, muscarinic receptors represent key therapeutic  targets  for COPD and 

asthma. Muscarinic  receptor  antagonists,  referred  to  as  anticholinergics,  have  already 

been used for centuries for the treatment of obstructive airway diseases. This started with 

the use of naturally occurring medicinal plants containing anticholinergic alkaloids such as 

atropine.  Fumes of  these medicinal plants were  inhaled,  and  later on even  smoked  via 

cigarettes, until the middle of the 20th century (62, 63). Since then, more safe and effective 

synthetic anticholinergics have been introduced to the market.  

Anticholinergics 

Ipratropium was  the  first synthetic anticholinergic  introduced  to  the market. Because of 

the quaternary ammonium structure, ipratropium is much safer compared to the natural 

occurring anticholinergic atropine. Atropine can easily pass the blood‐brain barrier leading 

to numerous side effects, which is prevented by the quaternary structure of ipratropium. 

The safety profile of  ipratropium  is further enhanced by applying the drug via  inhalation, 

thereby  limiting  systemic  exposure.  Besides  dry  mouth,  ipratropium,  but  also  other 

anticholinergics,  have  limited  side  effects  (64).  Thereafter,  oxitropium was  introduced. 

Both drugs have relatively short durations of action (4‐8 hours), and there was a need for 

long‐acting anticholinergics. Tiotropium  is the  first  long‐acting anticholinergic  introduced 

to the market in the early 2000s. Tiotropium has been shown to be a potent muscarinic  

General introduction 

 17 

Table 2. Binding affinity and half‐life time at the M1, M2 and M3 receptor for the different anticholinergics against 

human M1, M2 and M3 receptors.   

  Binding affinitiy (‐log M)  t1/2 (h) 

M1R  M2R  M3R  M1R  M2R  M3R 

Ipratropium  9.40  9.53  9.58  0.1  0.03  0.22 

Tiotropium  10.80  10.69  11.02  10.5  2.6  27 

Aclidinium  10.78  10.68  10.74  6.4  1.8  10.7 

Glycopyrronium  10.09  9.67  10.04  2.0  0.37  6.1  

Binding affinity was determined  in heterologous competition experiments against  [3H]NMS. Data represent pKi 

values of at least three independent experiments performed in triplicate and the standard error was 0.1 or less. 

Dissociation half‐life was determined by the dissociation constants, by analyzing competition kinetics curves  in 

the presence of  [3H]NMS and different  concentrations of antagonist. At  least  three  independent experiments 

were performed in triplicate. Data from Casarosa et al (66). 

 

receptor antagonist; the affinity of tiotropium for muscarinic receptors  is around 10‐fold 

higher  compared  to  ipratropium.  However,  onset  of  action  is  slower  compared  to 

ipratropium  (65).  Although  the  steady‐state  affinity  of  tiotropium  for M1, M2  and M3 

receptors  is  similar, dissociation  from  the M3  receptor  is much  slower compared  to  the 

other receptor subtypes, in particular compared to M2 receptors (table 2) (66, 67). Used as 

a bronchodilator, this is a desired property, since inhibition of M3 receptors inhibits airway 

smooth  muscle  contraction,  whereas  antagonizing  M2  receptors  would  enhance 

acetylcholine release and thereby enhance airway smooth muscle contraction. Moreover, 

this  long  duration  of  action  at  the  M3  receptor  allows  for  once  daily  dosing.  Slow 

dissociation of tiotropium from the M3 receptor is attributed to interactions at the binding 

site, which prevents rapid dissociation via a snap‐lock mechanism (68). Recently,  inhaled 

glycopyrronium  and  aclidinium were  also  introduced  to  the market.  As  becomes  clear 

from  table 2,  like  tiotropium, glycopyrronium and aclidinium are kinetically selective  for 

the M3 receptor, and similarly, there is no difference in affinity of both drugs for individual 

muscarinic  receptors. However,  the dissociation half‐life  from  the M3  receptor of  these 

compounds  is smaller compared  to  tiotropium  (66). Glycopyrronium  is given once daily, 

whereas  aclidinium  is  given  twice  daily.  Several  new  anticholinergics  have  recently 

reached  the market,  as well  as  combinations  of  long‐acting  anticholinergics with  long‐

acting β2‐agonists and/or corticosteroids (69).  

Use of anticholinergics in COPD               

In  COPD,  anticholinergics  represent  a  first‐line  of  treatment  according  to  the  Global 

Initiative  for  Chronic  Obstructive  Lung  Disease  (GOLD)  guidelines  (70).  Long‐acting 

anticholinergics  and  long‐acting  β2‐agonists  are  the  most  frequently  prescribed 

bronchodilators  for  COPD  treatment.  Anticholinergics  have  a  particular  value  in  the 

Chapter 1 

18 

treatment of COPD because they block the increased cholinergic tone, which is the major 

reversible component of the disease (60, 61). The first randomized controlled clinical trial 

into  the efficacy and  safety of  tiotropium  in patients with COPD was published  in 2000 

(71).  In  this  study,  tiotropium  was  compared  to  ipratropium.  Both  tiotropium  and 

ipratropium  induced an  increase  in  lung  function over a 13 week period, and  the  long‐

acting  tiotropium  was  more  effective  compared  to  the  short‐acting  ipratropium.  The 

safety profile of both drugs was similar  (71). Since then, a number of studies have been 

undertaken, of which the UPLIFT (Understanding Potential Long‐term Impacts on Function 

with Tiotropium) trial was the most extensive study. In this study, a total of 5993 patients 

were  randomly assigned  to placebo or  tiotropium, and  followed  for 4 years. Tiotropium 

significantly  improved  lung  function  and  quality  of  life,  and  reduced  the  number  of 

exacerbations compared to placebo. Tiotropium did not alter the rate of decline in forced 

expiratory  volume  in  1  second  (FEV1)  (72). More  recently,  new  anticholinergics  were 

introduced,  including  glycopyrronium  and  aclidinium.  Glycopyrronium  (NVA237)  was 

shown  to  improve  lung  function, quality of  life and dyspnoea, and  to  reduce  the  risk of 

exacerbations compared to placebo in patients with moderate to severe COPD (73), with 

efficacy comparable  to  tiotropium  (74). Similarly, aclidinium was shown  to  improve  lung 

function, quality of  life and dyspnoea compared to placebo  in moderate to severe COPD 

patients (75, 76), which was comparable to the effects of tiotropium over a 15 day period 

(77). Fixed‐dose  combinations of  several  long‐acting anticholinergics and  long‐acting  β2‐

agonists are currently under development or have recently reached the market, and large 

trials  are  evaluating  the  efficacy  and  safety  of  fixed‐dose  combinations  (35,  78).  First 

evidence  suggests  that  the  fixed‐dose  combinations  of  tiotropium  and  olodaterol  (79), 

glycopyrronium  and  indacaterol  (80,  81),  aclidinium  and  formoterol  (82,  83),  and 

umeclidinium and vilanterol (84, 85) are more effective than monotherapy. 

Use of anticholinergics in asthma               

In asthma,  the use of anticholinergics  is  limited  to  the  treatment of exacerbations, and 

anticholinergics are not approved for chronic treatment (86). Short‐acting anticholinergics 

have a significant but small effect on peak expiratory flow  (PEF) compared to placebo  in 

patients with stable asthma  (87). The effects of short‐acting anticholinergics are smaller 

than the effects of short‐acting β2‐agonists in patients with asthma (64, 87). According to 

the Global Initiative for Asthma (GINA) guidelines, ipratropium can be used in stable state 

as an alternative bronchodilator to short‐acting β2‐agonists, but is usually less effective. In 

case of an exacerbation, the addition of a short‐acting anticholinergic to the short‐acting 

β2‐agonists is recommended (86). More recently, clinical trials into the effects of the long‐

acting anticholinergic tiotropium on lung function in patients with asthma have started. In 

one  of  the  first  studies,  Peters  et  al.  demonstrated  that  the  addition  of  tiotropium  to 

General introduction 

 19 

glucocorticoid therapy in patients with mild to moderate asthma was more effective than 

doubling  of  the  glucocorticoid  dose  by  means  of  morning  peak  expiratory  flow,  the 

proportion of asthma‐control days, FEV1 and daily symptom scores, and very similar to the 

effects of adding salmeterol (88). Moreover,  it was shown  in a phase 2 study  in patients 

with  severe  uncontrolled  asthma  that  addition  of  tiotropium  to  standard  therapy with 

inhaled corticosteroids and long‐acting β2‐agonists improved lung function over an 8 week 

period  (89).  These  findings  were  confirmed  by  two  replicate  phase  3  randomized 

controlled  trials  involving  912  severe  asthma  patients  over  a  period  of  48  weeks. 

Tiotropium induced bronchodilation on top of the use of inhaled corticosteroids and long‐

acting  β2‐agonists.  Furthermore,  tiotropium  reduced  exacerbations  and  episodes  of 

worsening  of  asthma  (90).  Two  phase  2  studies  in  patients  with moderate  persistent 

asthma  demonstrated  that  tiotropium  can  also  induce  bronchodilation  in  this  patient 

group, on top of the use of corticosteroids (91, 92). These results have been confirmed in 

two  large replicate phase 3 trials  in 2100 patients with uncontrolled asthma on medium 

dose  corticosteroids,  of which  the  results  have  only  been  presented  as  abstracts  (93). 

Tiotropium  induced  sustained  bronchodilation  after  24  weeks,  accompanied  by 

improvements  in asthma control, all very similar to salmeterol  (93). Together these data 

indicate  that  asthma  patients  might  benefit  from  addition  of  tiotropium  to  standard 

therapy.  

   

Regulation of inflammation and remodeling by muscarinic receptors 

COPD  and  asthma  are  associated with  airway  inflammation  and  remodeling.  Increasing 

evidence  suggests  a  role  for  acetylcholine  in  inflammation  and  remodeling  in  both 

obstructive airway diseases (16, 21). This suggests that the role of acetylcholine in patients 

with COPD or asthma might be much broader than previously appreciated.  

Inflammation and remodeling in COPD 

COPD  is  associated  with  persistent  inflammation  and  remodeling  of  the  airways. 

Inflammation  is  present  throughout  the  airways  (94),  and  the  degree  of  inflammation 

correlates to the severity of the disease (95). Upon inhalation of cigarette smoke, which is 

the  main  risk  factor  for  COPD,  epithelial  cells  are  activated  and  macrophages  are 

attracted,  resulting  in  the  release  of  chemotactic  factors. Macrophages  are  thought  to 

orchestrate  the  inflammatory  response  in  COPD  (96).  Amongst  others,  macrophages 

release  CC‐chemokine  ligand  2  (CCL2),  also  known  as  monocyte  chemotactic  protein 

(MCP1), to attract more monocytes to the  lung, and CXC‐chemokine  ligand (CXCL)‐1 and 

CXCL‐8,  to attract neutrophils  (94, 96). Moreover, both macrophages and epithelial cells 

release CXCL9, CXCL10 and CXCL11, which attract T‐cells to the lung (94, 97). In COPD, T‐

Chapter 1 

20 

cells  are mainly  T‐helper  type  1  (TH1)  and  type  1  cytotoxic  T  (TC1)  CD8+  cells  (94).  The 

inflammatory response  is thought to contribute to the remodeling of the airways, by the 

release  of  TGF‐β  and  proteases  such  as matrix metalloproteinase  9  (MMP9)  (94,  98). 

Fibrosis, by means of peribronchiolar deposition of extracellular matrix proteins, mainly 

occurs around the small airways, and is an important factor contributing to the irreversible 

airway narrowing observed in COPD (99). Moreover, alveolar walls in the lung parenchyma 

are destructed due to the chronic inflammation, which is called emphysema. Emphysema 

results  in enlargement of parenchymal airspaces and  loss of elastic recoil, and  is a major 

contributor to morbidity and mortality in COPD (100, 101). Remodeling of the epithelium 

also  occurs,  leading  to  squamous  and mucous metaplasia  (100).  Together with mucus 

gland hypertrophy, this  leads to mucus hypersecretion  in patients with COPD (102, 103). 

Remodeling of the airways starts later in life in patients with COPD, but is progressive and 

irreversible, and is the major contributor to the decline in lung function (100).  

Inflammation and remodeling in asthma 

Like  COPD,  asthma  is  characterized  by  airway  inflammation  and  remodeling. However, 

there  are marked  differences  between  the  pattern  of  inflammation  and  remodeling  in 

asthma compared to COPD. In asthma, inflammation and remodeling is mainly present in 

the  larger  conducting  airways. Depending on  the  severity of disease,  small  airways  can 

also be affected, however, the lung parenchyma is generally not affected in most patients 

with  asthma  (94).  The  nature  of  the  inflammation  and  the  cell  types  involved  in  the 

inflammatory  response  in  asthma  are  different  compared  to  COPD.  Upon  allergen 

challenge, which is the main trigger for an inflammatory response in allergic asthma, mast 

cells are activated. Mast cells release bronchoconstricting agents, including histamine and 

lipid mediators. Moreover, CD4+ T‐helper  type 2  (TH2)  cytokines  IL‐4,  IL‐5  and  IL‐13 are 

released  by mast  cells  (94,  97).  In  addition  to mast  cells,  TH2  cells  also  release  these 

cytokines, and TH2 cells play a central role  in orchestrating the  inflammatory response  in 

asthma  (94).  IL‐4  release  stimulates  B  cells  to  synthesize  IgE,  the  driver  of  allergic 

inflammation  that  binds  to  high‐affinity  Fc  receptors  for  IgE  (FcεRI)  on mast  cells.  The 

release  of  IL‐5  attracts  eosinophils,  whereas  the  release  of  IL‐13  contributes  to  an 

enhancement of airway hyperresponsiveness and an increase in goblet cell number (104, 

105). There  is also an  increase  in  the size of submucosal glands  (106), and  together  this 

leads to excessive mucus production. Enhanced mucus secretion significantly contributes 

to airflow limitation in asthma by obstructing the airways (41, 107). Furthermore, there is 

thickening  of  the  basement‐membrane,  as  a  result  of  collagen  deposition  under  the 

epithelium,  and  thickening  of  the  airway  smooth  muscle  layer,  as  a  result  of  airway 

smooth muscle hyperplasia and hypertrophy (100). The former is observed in all patients 

with asthma, whereas the latter is mainly observed in patients with severe asthma (108). 

General introduction 

 21 

Airway  smooth  muscle  thickness  is  related  to  severity  of  the  disease,  but  not  to  its 

duration,  since  airway  smooth  muscle  thickening  is  already  present  in  children  with 

asthma  (109, 110). Pulmonary  vascular  remodeling and  increased angiogenesis are also 

observed,  which  is mediated  by  various  angiogenic  proteins,  including  several  growth 

factors, like vascular endothelial growth factor (VEGF) (100, 111). Structural changes in the 

airways  of  patients  with  asthma  are  considered  an  important  component  of  airflow 

limitation and may accelerate the decline in lung function (112, 113).  

Muscarinic receptor regulation of inflammation and remodeling 

Increasing  evidence  suggests  a  role  for  acetylcholine  in  regulating  airway  inflammation 

and remodeling. From in vitro studies it is known that muscarinic receptor stimulation can 

enhance  the  release  of  cytokines  from  inflammatory  cells  and  structural  cells  of  the 

airways,  either  alone or  in  concerted  action with  stimuli  including  cigarette  smoke  and 

growth  factors.  Moreover,  acetylcholine  has  been  shown  to  enhance  remodeling 

parameters  in vitro. Thus, muscarinic receptor stimulation of airway smooth muscle cells 

and fibroblast enhances proliferation and the production of extracellular matrix proteins 

(16, 21). This  is  further  supported by evidence  from  in vivo  studies, demonstrating  that 

airway  inflammation and  remodeling  can be  inhibited by anticholinergic  intervention.  It 

has  been  shown  that  cigarette  smoke‐induced  inflammation  in mice,  and  LPS‐induced 

inflammation and remodeling in guinea pigs can be inhibited by tiotropium, indicating the 

potential  relevance  of  anticholinergic  treatment  for  patients with  COPD  (114,  115).  In 

addition, allergen‐induced inflammation and remodeling can be inhibited by tiotropium in 

both mice and guinea pigs, indicating the potential relevance of anticholinergic treatment 

for  patients  with  asthma  (116‐118).  The  role  of  acetylcholine  in  inflammation  and 

remodeling is extensively reviewed in chapter 2, and will therefore not be elaborated on 

in more detail here.  

Clinical implications 

As briefly described above and reviewed in chapter 2, there is convincing evidence from in 

vitro and in vivo animal studies that acetylcholine contributes to airway inflammation and 

remodeling. This might be  relevant  for patients with COPD and asthma, especially since 

acetylcholine  release  is enhanced  in  these disease  states. However,  this hypothesis  still 

needs  to  be  proven  by  clinical  studies  investigating  the  effect  of  acetylcholine  or 

anticholinergic  therapy  on  airway  inflammation  and  remodeling.  In  the  UPLIFT  study, 

COPD patients treated with tiotropium for 4 years showed improvements in lung function, 

quality  of  life  and  exacerbation  frequency  (72).  The  latter  might  suggest  an  anti‐

inflammatory  effect  of  tiotropium,  as  the  inflammatory  response  is  enhanced  during 

exacerbations, with  increased  expression  of  pro‐inflammatory  cytokines,  including  IL‐8 

Chapter 1 

22 

(119, 120). However, Powrie et al. were not able to demonstrate a reduction in sputum IL‐

6 or IL‐8 levels after tiotropium use for one year, even though the exacerbation frequency 

was reduced (121). In this study, tiotropium reduced the amount of sputum, which might 

result in a concentration of cytokines in the sputum of patients treated with tiotropium, as 

proposed by the authors to explain this discrepancy. Therefore, further studies are needed 

to elucidate the mechanism by which tiotropium reduces the number of exacerbations in 

patients  with  COPD  and  whether  a  direct  anti‐inflammatory  effect  of  tiotropium  is 

involved. Structural changes in the airways of COPD patients may accelerate the decline of 

lung  function.  Initially,  it was  thought  that  tiotropium might affect  this process,  since a 

retrospective study suggested that the use of tiotropium was associated with a reduction 

in decline of lung function after 1 year (122). However, this was not replicated in the large, 

prospective  UPLIFT  trial,  in  which  no  significant  effect  on  the  rate  of  decline  in  lung 

function  was  observed  in  the  overall  study  population  (72).  Pre‐specified  post‐hoc 

subgroup  analysis  revealed  that  tiotropium  did  inhibit  the  accelerated  decline  in  lung 

function  in  young  patients  and  in  patients  with  moderate  disease  (123,  124).  Future 

studies  are needed  to understand  the effects of  tiotropium on  lung  function decline  in 

patients with COPD in these subgroups.  

Recently,  clinical  studies  into  the  effects  of  tiotropium  in  patients  with  asthma  have 

started. Addition of tiotropium to standard therapy for severe asthma patients with long‐

acting  β‐agonists  and  corticosteroids  increased  the  time  to  the  first  exacerbation  and 

reduced the risk of a severe exacerbation (90). Moreover, it has been shown that repeated 

inhalation of the muscarinic receptor agonist methacholine induces airway remodeling in 

mild  asthma  patients  (125).  This  suggests  that  acetylcholine  might  also  affect  airway 

inflammation  and  remodeling  in  patients  with  asthma,  but  clearly  more  studies  are 

needed  to  further  elucidate  the  effects  of  acetylcholine  or  anticholinergic  therapy  on 

airway inflammation and remodeling in patients with asthma. 

 

Scope of the thesis                 

The above mentioned  findings  suggest  that acetylcholine  is not only a neurotransmitter 

involved  in bronchoconstriction and mucus secretion  in the airways, but might also be a 

mediator of airway  inflammation and  remodeling, which possibly  involves non‐neuronal 

acetylcholine. This will have  implications  for  therapy of obstructive airways diseases  like 

COPD and asthma,  in which muscarinic antagonists are  frequently used. This  thesis will 

further elucidate  the  role of acetylcholine  in  inflammation and  remodeling  in COPD and 

asthma. Specifically, the aim of this thesis is to investigate the role of individual muscarinic 

General introduction 

 23 

receptor  subtypes,  as  well  as  the  contribution  of  neuronal  versus  non‐neuronal 

acetylcholine, to airway inflammation and remodeling in COPD and asthma. 

Chapter 2 provides a comprehensive review on the regulation of airway inflammation and 

remodeling  in  COPD  and  asthma  by  muscarinic  receptors.  In  addition,  therapeutic 

implications  of  muscarinic  receptor  regulation  of  inflammation  and  remodeling  are 

discussed. 

The  following  chapters deal with  the  role of  acetylcholine  in  inflammation  in COPD. As 

stated  above,  there  is  evidence  for  a  pro‐inflammatory  role  of  acetylcholine  in 

inflammation. However, it is not known which individual muscarinic receptor subtypes are 

involved  in this response. There  is a focus for anticholinergics on M3 receptor selectivity, 

because of involvement of this receptor subtype in bronchoconstriction, however, there is 

no evidence that the pro‐inflammatory effects of acetylcholine are also mediated via this 

receptor subtype. Therefore,  in chapter 3, we  investigated the contribution of  individual 

muscarinic  receptor  subtypes  to  cigarette  smoke‐induced  inflammation.  Because  of 

limited  selectivity  of  available  muscarinic  receptor  antagonists,  muscarinic  receptor 

subtype specific knock‐out animals were used.  In this way, the contribution of  individual 

muscarinic  receptors  can be  investigated  in  detail.  Knock‐out  animals were  exposed  to 

cigarette smoke for four days and the inflammatory response in the airways was analyzed. 

The  contribution  of  the  M3  receptor  to  cigarette  smoke‐induced  inflammation  was 

investigated  in more detail  in  chapter  4. As discussed  above, practically  all  cells  in  the 

airways express muscarinic receptors.  It  is not known which cell  types contribute  to  the 

pro‐inflammatory  effect  of  the M3  receptor  as  described  in  chapter  3.  To  distinguish 

between effects of structural cells and inflammatory cells, bone marrow chimeric animals 

were generated and exposed to cigarette smoke, using a similar protocol as described  in 

chapter 3. In this way, the contribution of structural cells versus inflammatory cells to the 

pro‐inflammatory effect of the M3 receptor can be defined.  

In chapter 5, we  further elucidated  the role of acetylcholine  in  inflammation  in patients 

with COPD. In this chapter, we investigated the effects of targeted lung denervation (TLD) 

on inflammation in patients with COPD. TLD is a novel potential therapy for patients with 

COPD,  in  which  parasympathetic  airway  nerves  are  ablated  by  locally  applying  radio‐

frequency  energy  in  the  main  bronchi  using  bronchoscopy,  to  inhibit  acetylcholine‐

induced  bronchoconstriction.  We  hypothesized  that  TLD  would  also  inhibit  airway 

inflammation. Specifically, we studied whether TLD affects inflammatory cell number and 

pro‐inflammatory cytokine expression in bronchial wash fluid and gene expression of pro‐

inflammatory cytokines in bronchial brush specimen. 

Chapter 1 

24 

The second half of the thesis  is focused on the role of acetylcholine  in  inflammation and 

remodeling  in asthma. As  is described above for COPD,  it  is not known which muscarinic 

receptor subtypes mediate inflammation and remodeling in asthma. Therefore, in chapter 

6,  we  investigated  the  effects  of  individual muscarinic  receptor  subtypes  on  allergen‐

induced  inflammation and remodeling. To  this aim, muscarinic receptor subtype specific 

knock‐out animals were exposed  to ovalbumin, and  lungs were collected  for analysis of 

inflammation and remodeling.  

Increasing evidence suggests that airway remodeling might not only be a consequence of 

inflammation, but might also or alternatively be a  consequence of bronchoconstriction, 

which  triggers  TGF‐β  release  via  biomechanical  activation.  In  chapter  7,  we  aimed  to 

investigate  the  effect  of  TGF‐β  and  bronchoconstriction  on  remodeling,  and  the 

involvement of the M3 receptor in this response, by using murine precision cut lung slices 

(PCLS). TGF‐β was used to induce remodeling in PCLS from wild‐type animals. In addition, 

PCLS were stimulated with methacholine, to investigate the effect of bronchoconstriction 

on  remodeling.  Moreover,  PCLS  from  M3R‐/‐  mice,  in  which  bronchoconstriction  is 

abolished, were exposed  to TGF‐β and methacholine,  to  investigate  the  involvement of 

the M3 receptor in this response. After two days, expression of remodeling parameters, as 

well as the functional impact on bronchoconstriction, was analyzed.  

In  chapter 8, we  investigated  the effects of endogenous non‐neuronal acetylcholine on 

epithelial  cell  differentiation.  There  is  evidence  from  in  vivo  studies which  suggests  an 

indirect role  for acetylcholine  in epithelial cell differentiation and goblet cell metaplasia. 

Here, we aimed to investigate direct effects of endogenous non‐neuronal acetylcholine on 

epithelial cell differentiation and possible mechanisms  involved. Human airway epithelial 

cells were  isolated  from  healthy  donors  and  cultured  at  an  air‐liquid  interface. During 

differentiation at the air‐liquid interface, cells were exposed to tiotropium, to investigate 

the effects of acetylcholine on epithelial cell differentiation following air exposure, and to 

IL‐13 and  tiotropium,  to  investigate  the effects of acetylcholine on  IL‐13‐induced goblet 

cell metaplasia. 

Finally, in chapter 9, the results of this thesis are summarized and discussed. Perspectives 

for future studies are provided. 

   

General introduction 

 25 

References 

(1)  Racke  K, Matthiesen  S.  The  airway  cholinergic  system:  physiology  and  pharmacology.  Pulm 

Pharmacol Ther 2004;17:181‐198.  

(2) Kummer W, Lips KS, Pfeil U. The epithelial cholinergic system of the airways. Histochem Cell Biol 

2008;130:219‐234.  

(3) Kummer W, Krasteva‐Christ G. Non‐neuronal  cholinergic airway epithelium biology. Curr Opin 

Pharmacol 2014;16C:43‐49.  

(4) Colebatch HJ, Halmagyi DF. Effect of Vagotomy and Vagal Stimulation on Lung Mechanics and 

Circulation. J Appl Physiol 1963;18:881‐887.  

(5) Widdicombe JG, Nadel JA. Airway Volume, Airway Resistance, and Work and Force of Breathing: 

Theory. J Appl Physiol 1963;18:863‐868.  

(6) Undem B, Myers A. Cholinergic and noncholinergic parasympathetic  control of airway  smooth 

muscle.  In:  Zaagsma  J, Meurs H  and Roffel AF,  editors. Muscarinic  receptors  in  airways diseases. 

Basel: Birkhauser; 2001. p. 1‐‐24.  

(7) Undem BJ, Kollarik M. The role of vagal afferent nerves in chronic obstructive pulmonary disease. 

Proc Am Thorac Soc 2005;2:355‐60; discussion 371‐2.  

(8) Sant'Ambrogio G, Widdicombe J. Reflexes from airway rapidly adapting receptors. Respir Physiol 

2001;125:33‐45.  

(9) Undem BJ, Carr MJ. The role of nerves in asthma. Curr Allergy Asthma Rep 2002;2:159‐165.  

(10) Agostoni E, Chinnock JE, De Daly MB, Murray JG. Functional and histological studies of the vagus 

nerve and its branches to the heart, lungs and abdominal viscera in the cat. J Physiol 1957;135:182‐

205.  

(11) Coleridge JC, Coleridge HM. Afferent vagal C fibre innervation of the lungs and airways and its 

functional significance. Rev Physiol Biochem Pharmacol 1984;99:1‐110.  

(12) Verhein KC, Fryer AD,  Jacoby DB. Neural control of airway  inflammation. Curr Allergy Asthma 

Rep 2009;9:484‐490.  

(13)  Canning  BJ,  Fischer  A.  Neural  regulation  of  airway  smooth  muscle  tone.  Respir  Physiol 

2001;125:113‐127.  

(14)  Wessler  I,  Kirkpatrick  CJ,  Racke  K.  The  cholinergic  'pitfall':  acetylcholine,  a  universal  cell 

molecule in biological systems, including humans. Clin Exp Pharmacol Physiol 1999;26:198‐205.  

(15) Wessler I, Kirkpatrick CJ. Acetylcholine beyond neurons: the non‐neuronal cholinergic system in 

humans. Br J Pharmacol 2008;154:1558‐1571.  

(16) Gosens R, Zaagsma J, Meurs H, Halayko AJ. Muscarinic receptor signaling in the pathophysiology 

of asthma and COPD. Respir.Res. 2006;7:73.  

(17) Klapproth H, Reinheimer T, Metzen J, Munch M, Bittinger F, Kirkpatrick CJ, Hohle KD, Schemann 

M, Racke K, Wessler I. Non‐neuronal acetylcholine, a signalling molecule synthezised by surface cells 

of rat and man. Naunyn Schmiedebergs Arch Pharmacol 1997;355:515‐523.  

(18) Proskocil BJ, Sekhon HS, Jia Y, Savchenko V, Blakely RD, Lindstrom J, Spindel ER. Acetylcholine is 

an  autocrine or paracrine hormone  synthesized  and  secreted by  airway bronchial epithelial  cells. 

Endocrinology 2004;145:2498‐2506.  

Chapter 1 

26 

(19)  Gwilt  CR,  Donnelly  LE,  Rogers  DF.  The  non‐neuronal  cholinergic  system  in  the  airways:  an 

unappreciated regulatory role in pulmonary inflammation? Pharmacol Ther 2007;115:208‐222.  

(20) Pieper MP. The non‐neuronal  cholinergic  system as novel drug  target  in  the airways.  Life Sci 

2012;91:1113‐1118.  

(21)  Kistemaker  LE,  Oenema  TA,  Meurs  H,  Gosens  R.  Regulation  of  airway  inflammation  and 

remodeling by muscarinic receptors: perspectives on anticholinergic  therapy  in asthma and COPD. 

Life Sci 2012;91:1126‐1133.  

(22)  Racke  K,  Juergens  UR, Matthiesen  S.  Control  by  cholinergic mechanisms.  Eur  J  Pharmacol 

2006;533:57‐68.  

(23) Schuller HM. Regulatory role of the alpha7nAChR in cancer. Curr Drug Targets 2012;13:680‐687.  

(24) Jositsch G, Papadakis T, Haberberger RV, Wolff M, Wess J, Kummer W. Suitability of muscarinic 

acetylcholine  receptor  antibodies  for  immunohistochemistry  evaluated  on  tissue  sections  of 

receptor gene‐deficient mice. Naunyn Schmiedebergs Arch Pharmacol 2009;379:389‐395.  

(25)  Pradidarcheep W,  Stallen  J,  Labruyere WT, Dabhoiwala NF, Michel MC,  Lamers WH.  Lack of 

specificity  of  commercially  available  antisera  against  muscarinergic  and  adrenergic  receptors. 

Naunyn Schmiedebergs Arch Pharmacol 2009;379:397‐402.  

(26)  Ikeda  T,  Anisuzzaman  AS,  Yoshiki  H,  Sasaki  M,  Koshiji  T,  Uwada  J,  Nishimune  A,  Itoh  H, 

Muramatsu I. Regional quantification of muscarinic acetylcholine receptors and beta‐adrenoceptors 

in human airways. Br J Pharmacol 2012;166:1804‐1814.  

(27) Profita M, Bonanno A, Siena L, Bruno A, Ferraro M, Montalbano AM, Albano GD, Riccobono L, 

Casarosa P, Pieper MP, Gjomarkaj M. Smoke, choline acetyltransferase, muscarinic  receptors, and 

fibroblast  proliferation  in  chronic  obstructive  pulmonary  disease.  J  Pharmacol  Exp  Ther 

2009;329:753‐763.  

(28) Radosa J, Dyck W, Goerdt S, Kurzen H. The cholinergic system  in guttate psoriasis with special 

reference to mast cells. Exp Dermatol 2011;20:677‐679.  

(29) Wallon C, Persborn M, Jonsson M, Wang A, Phan V, Lampinen M, Vicario M, Santos J, Sherman 

PM, Carlson M, Ericson AC, McKay DM, Soderholm JD. Eosinophils express muscarinic receptors and 

corticotropin‐releasing  factor  to disrupt  the mucosal barrier  in ulcerative colitis. Gastroenterology 

2011;140:1597‐1607.  

(30) Simon MI, Strathmann MP, Gautam N. Diversity of G proteins  in  signal  transduction. Science 

1991;252:802‐808.  

(31) Neves SR, Ram PT, Iyengar R. G protein pathways. Science 2002;296:1636‐1639.  

(32) Caulfield MP, Birdsall NJ. International Union of Pharmacology. XVII. Classification of muscarinic 

acetylcholine receptors. Pharmacol Rev 1998;50:279‐290.  

(33) Meurs H, Roffel AF, Elzinga CRS, Zaagsma J. Muscarinic receptor‐beta‐adrenaceptor cross‐talk in 

airway  smooth muscle.  In:  Zaagsma  J, Meurs  H  and  Roffel  AF,  editors. Muscarinic  receptors  in 

airways diseases. Basel: Birkhauser; 2001. p. 121‐‐158.  

(34)  Zhou XB, Wulfsen  I,  Lutz  S, Utku  E,  Sausbier U, Ruth P, Wieland  T, Korth M. M2 muscarinic 

receptors  induce airway smooth muscle activation via a dual, Gbetagamma‐mediated  inhibition of 

large conductance Ca2+‐activated K+ channel activity. J Biol Chem 2008;283:21036‐21044.  

(35)  Pera  T,  Penn  RB.  Crosstalk  between  beta‐2‐adrenoceptor  and  muscarinic  acetylcholine 

receptors in the airway. Curr Opin Pharmacol 2014;16C:72‐81.  

General introduction 

 27 

(36)  Kilbinger H,  Schneider  R,  Siefken H, Wolf D, D'Agostino G.  Characterization  of  prejunctional 

muscarinic autoreceptors in the guinea‐pig trachea. Br J Pharmacol 1991;103:1757‐1763.  

(37) ten Berge RE, Zaagsma J, Roffel AF. Muscarinic inhibitory autoreceptors in different generations 

of human airways. Am J Respir Crit Care Med 1996;154:43‐49.  

(38) On LS, Boonyongsunchai P, Webb S, Davies L, Calverley PM, Costello RW. Function of pulmonary 

neuronal M(2) muscarinic  receptors  in  stable  chronic obstructive pulmonary disease. Am  J Respir 

Crit Care Med 2001;163:1320‐1325.  

(39) Roffel AF, Elzinga CR, Van Amsterdam RG, De Zeeuw RA, Zaagsma J. Muscarinic M2 receptors in 

bovine  tracheal  smooth  muscle:  discrepancies  between  binding  and  function.  Eur  J  Pharmacol 

1988;153:73‐82.  

(40) Fisher JT, Vincent SG, Gomeza J, Yamada M, Wess J. Loss of vagally mediated bradycardia and 

bronchoconstriction  in  mice  lacking  M2  or  M3  muscarinic  acetylcholine  receptors.  FASEB  J 

2004;18:711‐713.  

(41) Rogers DF. Motor control of airway goblet cells and glands. Respir Physiol 2001;125:129‐144.  

(42) Ramnarine SI, Haddad EB, Khawaja AM, Mak JC, Rogers DF. On muscarinic control of neurogenic 

mucus secretion in ferret trachea. J Physiol 1996;494 ( Pt 2):577‐586.  

(43) Baker B, Peatfield AC, Richardson PS. Nervous control of mucin secretion into human bronchi. J 

Physiol 1985;365:297‐305.  

(44)  Spina  D,  Shah  S,  Harrison  S. Modulation  of  sensory  nerve  function  in  the  airways.  Trends 

Pharmacol Sci 1998;19:460‐466.  

(45) Undem BJ, Carr MJ. Pharmacology of airway afferent nerve activity. Respir Res 2001;2:234‐244.  

(46) Gleich GJ, Flavahan NA, Fujisawa T, Vanhoutte PM. The eosinophil as a mediator of damage to 

respiratory epithelium: a model  for bronchial hyperreactivity.  J Allergy Clin  Immunol 1988;81:776‐

781.  

(47)  ten  Berge  RE,  Santing  RE,  Hamstra  JJ,  Roffel  AF,  Zaagsma  J.  Dysfunction  of muscarinic M2 

receptors after the early allergic reaction: possible contribution to bronchial hyperresponsiveness in 

allergic guinea‐pigs. Br J Pharmacol 1995;114:881‐887.  

(48) Minette PA,  Lammers  JW, Dixon CM, McCusker MT, Barnes PJ. A muscarinic agonist  inhibits 

reflex  bronchoconstriction  in  normal  but  not  in  asthmatic  subjects.  J  Appl  Physiol  (1985) 

1989;67:2461‐2465.  

(49) Coulson FR, Fryer AD. Muscarinic acetylcholine receptors and airway diseases. Pharmacol Ther 

2003;98:59‐69.  

(50)  Evans  CM,  Fryer  AD,  Jacoby  DB,  Gleich  GJ,  Costello  RW.  Pretreatment  with  antibody  to 

eosinophil major basic protein prevents hyperresponsiveness by protecting neuronal M2 muscarinic 

receptors in antigen‐challenged guinea pigs. J Clin Invest 1997;100:2254‐2262.  

(51) Mitchell RW, Kelly E, Leff AR. Reduced activity of acetylcholinesterase in canine tracheal smooth 

muscle homogenates after active immune‐sensitization. Am J Respir Cell Mol Biol 1991;5:56‐62.  

(52)  Haddad  EB, Mak  JC,  Belvisi MG,  Nishikawa M,  Rousell  J,  Barnes  PJ. Muscarinic  and  beta‐

adrenergic receptor expression in peripheral lung from normal and asthmatic patients. Am J Physiol 

1996;270:L947‐53.  

Chapter 1 

28 

(53)  van  Koppen  CJ,  Lammers  JW,  Rodrigues  de Miranda  JF,  Beld  AJ,  van  Herwaarden  CL,  van 

Ginneken  CA.  Muscarinic  receptor  binding  in  central  airway  musculature  in  chronic  airflow 

obstruction. Pulm Pharmacol 1989;2:131‐136.  

(54) Fenech AG, Ebejer MJ, Felice AE, Ellul‐Micallef R, Hall IP. Mutation screening of the muscarinic 

M(2) and M(3) receptor genes in normal and asthmatic subjects. Br J Pharmacol 2001;133:43‐48.  

(55) Nockher WA, Renz H. Neurotrophins and asthma: novel insight into neuroimmune interaction. J 

Allergy Clin Immunol 2006;117:67‐71.  

(56) Pan J, Rhode HK, Undem BJ, Myers AC. Neurotransmitters  in airway parasympathetic neurons 

altered by neurotrophin‐3 and repeated allergen challenge. Am J Respir Cell Mol Biol 2010;43:452‐

457.  

(57) Hunter DD, Wu Z, Dey RD. Sensory neural responses to ozone exposure during early postnatal 

development in rat airways. Am J Respir Cell Mol Biol 2010;43:750‐757.  

(58) Aven  L, Paez‐Cortez  J, Achey R, Krishnan R, Ram‐Mohan  S, Cruikshank WW, Fine A, Ai X. An 

NT4/TrkB‐dependent  increase  in  innervation  links early‐life allergen exposure  to persistent airway 

hyperreactivity. FASEB J 2014;28:897‐907.  

(59) Larson SD, Schelegle ES, Walby WF, Gershwin LJ, Fanuccihi MV, Evans MJ, Joad JP, Tarkington 

BK,  Hyde  DM,  Plopper  CG.  Postnatal  remodeling  of  the  neural  components  of  the  epithelial‐

mesenchymal trophic unit  in the proximal airways of  infant rhesus monkeys exposed to ozone and 

allergen. Toxicol Appl Pharmacol 2004;194:211‐220.  

(60)  Gross  NJ,  Skorodin MS.  Role  of  the  parasympathetic  system  in  airway  obstruction  due  to 

emphysema. N Engl J Med 1984;311:421‐425.  

(61)  Barnes  PJ.  The  role  of  anticholinergics  in  chronic  obstructive  pulmonary  disease. Am  J Med 

2004;117 Suppl 12A:24S‐32S.  

(62) Jackson M. "Divine stramonium": the rise and fall of smoking for asthma. Med Hist 2010;54:171‐

194.  

(63) Meurs H, Oenema  TA,  Kistemaker  LE, Gosens  R.  A  new  perspective  on muscarinic  receptor 

antagonism in obstructive airways diseases. Curr Opin Pharmacol 2013;13:316‐323.  

(64) Gross NJ. Anticholinergic agents in asthma and COPD. Eur J Pharmacol 2006;533:36‐39.  

(65) Barnes PJ. The pharmacological properties of tiotropium. Chest 2000;117:63S‐6S.  

(66) Casarosa P, Bouyssou T, Germeyer S, Schnapp A, Gantner F, Pieper M. Preclinical evaluation of 

long‐acting muscarinic antagonists: comparison of tiotropium and investigational drugs. J Pharmacol 

Exp Ther 2009;330:660‐668.  

(67) Disse B,  Speck GA, Rominger KL, Witek TJ,Jr., Hammer R.  Tiotropium  (Spiriva): mechanistical 

considerations and clinical profile in obstructive lung disease. Life Sci 1999;64:457‐464.  

(68)  Tautermann  CS,  Kiechle  T,  Seeliger  D,  Diehl  S, Wex  E,  Banholzer  R,  Gantner  F,  Pieper MP, 

Casarosa P. Molecular basis for the  long duration of action and kinetic selectivity of tiotropium for 

the muscarinic M3 receptor. J Med Chem 2013;56:8746‐8756.  

(69) Matera MG, Rogliani P, Cazzola M. Muscarinic receptor antagonists for the treatment of chronic 

obstructive pulmonary disease. Expert Opin Pharmacother 2014;15:961‐977.  

(70) Global Initiative for Chronic Obstructive Lung Disease (GOLD). Global Strategy for the Diagnosis, 

Management  and  Prevention  of  COPD  (GOLD)  2013.  Available  from: 

http://www.goldcopd.org/uploads/users/files/GOLD_Report_2014_Jan23.pdf. ;June 4, 2014.  

General introduction 

 29 

(71)  van  Noord  JA,  Bantje  TA,  Eland  ME,  Korducki  L,  Cornelissen  PJ.  A  randomised  controlled 

comparison  of  tiotropium  nd  ipratropium  in  the  treatment  of  chronic  obstructive  pulmonary 

disease. The Dutch Tiotropium Study Group. Thorax 2000;55:289‐294.  

(72)  Tashkin  DP,  Celli  B,  Senn  S,  Burkhart  D,  Kesten  S, Menjoge  S,  Decramer M,  UPLIFT  Study 

Investigators. A 4‐year  trial of  tiotropium  in  chronic obstructive pulmonary disease. N Engl  J Med 

2008;359:1543‐1554.  

(73) D'Urzo A, Ferguson GT, van Noord JA, Hirata K, Martin C, Horton R, Lu Y, Banerji D, Overend T. 

Efficacy and  safety of once‐daily NVA237  in patients with moderate‐to‐severe COPD:  the GLOW1 

trial. Respir Res 2011;12:156‐9921‐12‐156.  

(74) Kerwin E, Hebert J, Gallagher N, Martin C, Overend T, Alagappan VK, Lu Y, Banerji D. Efficacy and 

safety  of  NVA237  versus  placebo  and  tiotropium  in  patients with  COPD:  the  GLOW2  study.  Eur 

Respir J 2012;40:1106‐1114.  

(75) Rennard SI, Scanlon PD, Ferguson GT, Rekeda L, Maurer BT, Garcia Gil E, Caracta CF. ACCORD 

COPD  II:  a  randomized  clinical  trial  to  evaluate  the  12‐week  efficacy  and  safety  of  twice‐daily 

aclidinium  bromide  in  chronic  obstructive  pulmonary  disease  patients.  Clin  Drug  Investig 

2013;33:893‐904.  

(76) Jones PW, Singh D, Bateman ED, Agusti A, Lamarca R, de Miquel G, Segarra R, Caracta C, Garcia 

Gil E. Efficacy and safety of twice‐daily aclidinium bromide in COPD patients: the ATTAIN study. Eur 

Respir J 2012;40:830‐836.  

(77) Fuhr R, Magnussen H, Sarem K,  Llovera AR, Kirsten AM, Falques M, Caracta CF, Garcia Gil E. 

Efficacy  of  aclidinium  bromide  400  mug  twice  daily  compared  with  placebo  and  tiotropium  in 

patients with moderate to severe COPD. Chest 2012;141:745‐752.  

(78) Bateman ED, Mahler DA, Vogelmeier CF, Wedzicha JA, Patalano F, Banerji D. Recent advances in 

COPD disease management with  fixed‐dose  long‐acting  combination  therapies.  Expert Rev Respir 

Med 2014;8:357‐379.  

(79) Derom E, Westerman J, Groenke L, Hamilton A, Li C, Beeh K. The 24‐Hour Lung Function Profile 

Of  Once‐Daily  Tiotropium  And  Olodaterol  Fixed‐Dose  Combination  Compared With  Placebo  And 

Monotherapies  In  Chronic Obstructive  Pulmonary  Disease  [abstract].  Am  J  Respir  Crit  Care Med 

2014;189:A6727.  

(80)  Bateman  ED,  Ferguson  GT,  Barnes  N,  Gallagher  N,  Green  Y,  Henley  M,  Banerji  D.  Dual 

bronchodilation with QVA149 versus  single bronchodilator  therapy:  the SHINE  study. Eur Respir  J 

2013;42:1484‐1494.  

(81) Frampton  JE. QVA149  (Indacaterol/Glycopyrronium Fixed‐Dose Combination): A Review of  Its 

Use in Patients with Chronic Obstructive Pulmonary Disease. Drugs 2014;74:465‐488.  

(82)  Cazzola  M,  Rogliani  P,  Matera  MG.  Aclidinium  bromide/formoterol  fumarate  fixed‐dose 

combination for the treatment of chronic obstructive pulmonary disease. Expert Opin Pharmacother 

2013;14:775‐781.  

(83)  Singh  D,  Jones  PW,  Bateman  ED,  Korn  S,  Serra  C,  Molins  E,  Caracta  C,  Leselbaum  A. 

Aclidinium/formoterol Fixed‐Dose Combination  Improves Bronchodilation And  Is Well Tolerated  In 

Patients With COPD: Results From The Acliform/COPD Study  [abstract]. Am J Respir Crit Care Med 

2014;189:A5987.  

Chapter 1 

30 

(84) Decramer M, Anzueto A, Kerwin E, Kaelin T, Richard N, Crater G, Tabberer M, Harris S, Church A. 

Efficacy  and  safety of umeclidinium plus  vilanterol  versus  tiotropium,  vilanterol, or umeclidinium 

monotherapies over 24 weeks in patients with chronic obstructive pulmonary disease: results from 

two multicentre, blinded, randomised controlled trials. Lancet Respir Med 2014;2:472‐486.  

(85)  Gras  J.  Umeclidinium/vilanterol  fixed‐dose  combination  for  COPD.  Drugs  Today  (Barc) 

2014;50:231‐238.  

(86) Global Initiative for Asthma (GINA). GINA Report, Global Strategy for Asthma Management and 

Prevention. Available from: www.ginasthma.org. 2014;June 4, 2014.  

(87) Westby M, Benson M, Gibson P. Anticholinergic agents for chronic asthma in adults. Cochrane 

Database Syst Rev 2004;(3):CD003269.  

(88) Peters SP, Kunselman SJ, Icitovic N, Moore WC, Pascual R, Ameredes BT, Boushey HA, Calhoun 

WJ, Castro M, Cherniack RM, Craig T, Denlinger L, Engle LL, DiMango EA, Fahy JV, Israel E, Jarjour N, 

Kazani  SD,  Kraft M,  Lazarus  SC,  Lemanske  RF,Jr,  Lugogo  N, Martin  RJ, Meyers  DA,  Ramsdell  J, 

Sorkness  CA,  Sutherland  ER,  Szefler  SJ, Wasserman  SI, Walter MJ, Wechsler ME,  Chinchilli  VM, 

Bleecker  ER,  National  Heart,  Lung,  and  Blood  Institute  Asthma  Clinical  Research  Network. 

Tiotropium  bromide  step‐up  therapy  for  adults  with  uncontrolled  asthma.  N  Engl  J  Med 

2010;363:1715‐1726.  

(89) Kerstjens HA, Disse B, Schroder‐Babo W, Bantje TA, Gahlemann M, Sigmund R, Engel M, van 

Noord  JA.  Tiotropium  improves  lung  function  in  patients  with  severe  uncontrolled  asthma:  a 

randomized controlled trial. J Allergy Clin Immunol 2011;128:308‐314.  

(90)  Kerstjens HA,  Engel M, Dahl  R,  Paggiaro  P,  Beck  E,  Vandewalker M,  Sigmund  R,  Seibold W, 

Moroni‐Zentgraf P, Bateman ED. Tiotropium in asthma poorly controlled with standard combination 

therapy. N Engl J Med 2012;367:1198‐1207.  

(91)  Bateman  ED,  Kornmann  O,  Schmidt  P,  Pivovarova  A,  Engel  M,  Fabbri  LM.  Tiotropium  is 

noninferior  to  salmeterol  in  maintaining  improved  lung  function  in  B16‐Arg/Arg  patients  with 

asthma. J Allergy Clin Immunol 2011;128:315‐322.  

(92)  Beeh  KM,  Moroni‐Zentgraf  P,  Ablinger  O,  Hollaenderova  Z,  Unseld  A,  Engel  M,  Korn  S. 

Tiotropium Respimat(R) in asthma: a double‐blind, randomised, dose‐ranging study in adult patients 

with moderate asthma. Respir Res 2014;15:61.  

(93) Kerstjens HAM, Bleecker E, Meltzer E, Casale T, Pizzichini E, Schmidt O, Engel M, Bour LJ, Verkleij 

CB, Moroni‐Zentgraf PM, Bateman ED. Tiotropium as add‐on therapy to  inhaled corticosteroids for 

patients with symptomatic asthma: Lung function and safety. ERJ 2013;42: Suppl 57:4629.  

(94) Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol 

2008;8:183‐192.  

(95) Di  Stefano  A,  Capelli  A,  Lusuardi M,  Balbo  P,  Vecchio  C, Maestrelli  P, Mapp  CE,  Fabbri  LM, 

Donner CF, Saetta M. Severity of airflow limitation is associated with severity of airway inflammation 

in smokers. Am J Respir Crit Care Med 1998;158:1277‐1285.  

(96) Barnes PJ. Alveolar macrophages as orchestrators of COPD. COPD 2004;1:59‐70.  

(97) Barnes PJ. The cytokine network  in asthma and chronic obstructive pulmonary disease.  J Clin 

Invest 2008;118:3546‐3556.  

(98) Barnes PJ. Chronic obstructive pulmonary disease. N Engl J Med 2000;343:269‐280.  

General introduction 

 31 

(99)  Hogg  JC,  Chu  F,  Utokaparch  S, Woods  R,  Elliott WM,  Buzatu  L,  Cherniack  RM,  Rogers  RM, 

Sciurba  FC,  Coxson  HO,  Pare  PD.  The  nature  of  small‐airway  obstruction  in  chronic  obstructive 

pulmonary disease. N Engl J Med 2004;350:2645‐2653.  

(100) Jeffery PK. Remodeling  in asthma and chronic obstructive  lung disease. Am J Respir Crit Care 

Med 2001;164:S28‐S38.  

(101) Rabe KF, Hurd S, Anzueto A, Barnes PJ, Buist SA, Calverley P, Fukuchi Y, Jenkins C, Rodriguez‐

Roisin  R,  van Weel  C,  Zielinski  J,  Global  Initiative  for  Chronic  Obstructive  Lung  Disease.  Global 

strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: 

GOLD executive summary. Am J Respir Crit Care Med 2007;176:532‐555.  

(102) Caramori G, Di Gregorio C, Carlstedt I, Casolari P, Guzzinati I, Adcock IM, Barnes PJ, Ciaccia A, 

Cavallesco G,  Chung  KF,  Papi A. Mucin  expression  in  peripheral  airways  of  patients with  chronic 

obstructive pulmonary disease. Histopathology 2004;45:477‐484.  

(103) Saetta M, Turato G, Baraldo S, Zanin A, Braccioni F, Mapp CE, Maestrelli P, Cavallesco G, Papi 

A, Fabbri LM. Goblet cell hyperplasia and epithelial  inflammation  in peripheral airways of smokers 

with both symptoms of chronic bronchitis and chronic airflow limitation. Am J Respir Crit Care Med 

2000;161:1016‐1021.  

(104) Corren J. Role of interleukin‐13 in asthma. Curr Allergy Asthma Rep 2013;13:415‐420.  

(105) Lambrecht BN, Hammad H. The airway epithelium in asthma. Nat Med 2012;18:684‐692.  

(106) Ordonez  CL,  Khashayar  R, Wong HH,  Ferrando  R, Wu  R, Hyde DM, Hotchkiss  JA,  Zhang  Y, 

Novikov A, Dolganov G, Fahy  JV. Mild and moderate asthma  is associated with airway goblet  cell 

hyperplasia and abnormalities  in mucin gene expression. Am J Respir Crit Care Med 2001;163:517‐

523.  

(107) Morcillo EJ, Cortijo J. Mucus and MUC in asthma. Curr Opin Pulm Med 2006;12:1‐6.  

(108)  Benayoun  L, Druilhe  A, Dombret MC,  Aubier M,  Pretolani M.  Airway  structural  alterations 

selectively associated with severe asthma. Am J Respir Crit Care Med 2003;167:1360‐1368.  

(109)  James AL, Bai  TR, Mauad  T, Abramson MJ, Dolhnikoff M, McKay KO, Maxwell PS,  Elliot  JG, 

Green  FH.  Airway  smooth muscle  thickness  in  asthma  is  related  to  severity  but  not  duration  of 

asthma. Eur Respir J 2009;34:1040‐1045.  

(110) Payne DN, Rogers AV, Adelroth E, Bandi V, Guntupalli KK, Bush A, Jeffery PK. Early thickening of 

the  reticular  basement membrane  in  children with  difficult  asthma.  Am  J  Respir  Crit  Care Med 

2003;167:78‐82.  

(111) Hoshino M, Nakamura Y, Hamid QA. Gene expression of vascular endothelial growth  factor 

and its receptors and angiogenesis in bronchial asthma. J Allergy Clin Immunol 2001;107:1034‐1038.  

 (112) An SS, Bai TR, Bates JH, Black JL, Brown RH, Brusasco V, Chitano P, Deng L, Dowell M, Eidelman 

DH,  Fabry  B,  Fairbank  NJ,  Ford  LE,  Fredberg  JJ,  Gerthoffer WT,  Gilbert  SH,  Gosens  R,  Gunst  SJ, 

Halayko AJ,  Ingram RH,  Irvin CG,  James AL,  Janssen LJ, King GG, Knight DA, Lauzon AM, Lakser OJ, 

Ludwig MS, Lutchen KR, Maksym GN, Martin JG, Mauad T, McParland BE, Mijailovich SM, Mitchell 

HW, Mitchell RW, Mitzner W, Murphy TM, Pare PD, Pellegrino R, Sanderson MJ, Schellenberg RR, 

Seow CY, Silveira PS, Smith PG, Solway  J, Stephens NL, Sterk PJ, Stewart AG, Tang DD, Tepper RS, 

Tran  T, Wang  L.  Airway  smooth muscle  dynamics:  a  common  pathway  of  airway  obstruction  in 

asthma. Eur Respir J 2007;29:834‐860.  

Chapter 1 

32 

(113) Pare PD, Roberts CR, Bai TR, Wiggs BJ. The functional consequences of airway remodeling  in 

asthma. Monaldi Arch Chest Dis 1997;52:589‐596.  

(114)  Pera  T,  Zuidhof A, Valadas  J,  Smit M,  Schoemaker RG, Gosens R, Maarsingh H,  Zaagsma  J, 

Meurs H.  Tiotropium  inhibits  pulmonary  inflammation  and  remodelling  in  a  guinea  pig model  of 

COPD. Eur Respir J 2011;38:789‐796.  

(115) Wollin L, Pieper MP. Tiotropium bromide exerts anti‐inflammatory activity in a cigarette smoke 

mouse model of COPD. Pulm Pharmacol Ther 2010;23:345‐354.  

(116) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y, Minoguchi K, Ohnishi T, Hirose T, 

Nagase H, Ohta K, Adachi M. Effect of tiotropium bromide on airway inflammation and remodelling 

in a mouse model of asthma. Clin Exp Allergy 2010;40:1266‐1275.  

(117) Bos  IS, Gosens R,  Zuidhof AB,  Schaafsma D, Halayko AJ, Meurs H,  Zaagsma  J.  Inhibition  of 

allergen‐induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J 

2007;30:653‐661.  

(118)  Gosens  R,  Bos  IS,  Zaagsma  J,  Meurs  H.  Protective  effects  of  tiotropium  bromide  in  the 

progression of airway smooth muscle remodeling. Am J Respir Crit Care Med 2005;171:1096‐1102.  

(119) Wedzicha  JA, Donaldson GC. Exacerbations of chronic obstructive pulmonary disease. Respir 

Care 2003;48:1204‐13; discussion 1213‐5.  

(120) Qiu Y, Zhu J, Bandi V, Atmar RL, Hattotuwa K, Guntupalli KK, Jeffery PK. Biopsy neutrophilia, 

neutrophil chemokine and receptor gene expression in severe exacerbations of chronic obstructive 

pulmonary disease. Am J Respir Crit Care Med 2003;168:968‐975.  

(121) Powrie DJ, Wilkinson TM, Donaldson GC, Jones P, Scrine K, Viel K, Kesten S, Wedzicha JA. Effect 

of tiotropium on sputum and serum inflammatory markers and exacerbations in COPD. Eur Respir J 

2007;30:472‐478.  

(122)  Anzueto  A,  Tashkin  D, Menjoge  S,  Kesten  S.  One‐year  analysis  of  longitudinal  changes  in 

spirometry in patients with COPD receiving tiotropium. Pulm Pharmacol Ther 2005;18:75‐81.  

(123) Decramer M, Celli B, Kesten S, Lystig T, Mehra S, Tashkin DP. Effect of tiotropium on outcomes 

in patients with moderate chronic obstructive pulmonary disease (UPLIFT): a prespecified subgroup 

analysis of a randomised controlled trial. Lancet 2009;374:1171‐1178.  

(124) Morice AH, Celli B, Kesten S, Lystig T, Tashkin D, Decramer M. COPD in young patients: a pre‐

specified analysis of the four‐year trial of tiotropium (UPLIFT). Respir Med 2010;104:1659‐1667.  

(125) Grainge CL, Lau LC, Ward  JA, Dulay V, Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. 

Effect of bronchoconstriction on airway remodeling in asthma. N Engl J Med 2011;364:2006‐2015.  

 

 

 

 

 

 

 

 

 

CHAPTER 2 

REGULATION OF AIRWAY INFLAMMATION AND REMODELING BY 

MUSCARINIC RECEPTORS: PERSPECTIVES ON ANTICHOLINERGIC 

THERAPY IN ASTHMA AND COPD 

 

 

 

 

 

 

 

Loes E.M. Kistemaker 

Tjitske A. Oenema 

Herman Meurs  

Reinoud Gosens 

 

Life Sci, 2012, 91(21‐22):1126‐33   

Chapter 2 

36 

Abstract 

Acetylcholine  is  the  primary  parasympathetic  neurotransmitter  in  the  airways  and  an 

autocrine/paracrine secreted hormone from non‐neuronal origins including inflammatory 

cells and airway structural cells. In addition to the well‐known functions of acetylcholine in 

regulating  bronchoconstriction  and  mucus  secretion,  it  is  increasingly  evident  that 

acetylcholine regulates inflammatory cell chemotaxis and activation, and also participates 

in  signaling  events  leading  to  chronic  airway  wall  remodeling  that  is  associated  with 

chronic obstructive airways diseases including asthma and COPD. As muscarinic receptors 

appear  responsible  for  most  of  the  pro‐inflammatory  and  remodeling  effects  of 

acetylcholine,  these  findings  have  significant  implications  for  anticholinergic  therapy  in 

asthma and COPD, which is selective for muscarinic receptors. Here, the regulatory role of 

acetylcholine  in  inflammation  and  remodeling  in  asthma  and  COPD  will  be  discussed 

including  the perspectives  that  these  findings offer  for  anticholinergic  therapy  in  these 

diseases. 

 

Introduction 

Acetylcholine  is  the  primary  parasympathetic  neurotransmitter  in  the  airways  and  a 

paracrine/autocrine  hormone  released  from  non‐neuronal  origins.  The  role  of 

acetylcholine  in  the  regulation of bronchomotor  tone and mucus  secretion  from airway 

submucosal glands is well established (1). More recent findings suggest that acetylcholine, 

acting  on muscarinic  receptors,  regulates  additional  functions  in  the  airways,  including 

inflammation and  remodeling  in obstructive airways diseases such as asthma and COPD 

(2‐4). Based on these findings, we have previously questioned the traditional view on the 

role  of  acetylcholine,  and  suggested  new  possibilities  for  therapeutic  targeting  of 

muscarinic  receptors  in asthma and COPD  (2).  In  this  review, we will discuss  the  role of 

muscarinic receptors  in obstructive airways disease  further and update the discussion  in 

view of these recent research papers and trials. In view of the selectivity of currently used 

anticholinergics  for muscarinic  receptors, we will not  elaborate on  the  role of nicotinic 

receptors  in  this  review. Nicotinic  receptors are, however, expressed  in  the airways and 

mediate  anti‐inflammatory  effects  of  acetylcholine.  For  excellent  reviews  on  the  anti‐

inflammatory  role  of  nicotinic  receptors, we would  like  to  refer  to  recently  published 

reviews (5‐7). 

 

 

Muscarinic receptors in inflammation and remodeling 

 37 

Acetylcholine and muscarinic receptors in the airways 

Biosynthesis, metabolism and mode of action of acetylcholine 

Acetylcholine  is  synthesized  from  choline and acetyl‐CoA mainly by  the enzyme  choline 

acetyltransferase  (ChAT)  (7).  Airway  neurons  and  non‐neuronal  cells  such  as  airway 

epithelial  cells  express  ChAT  and  release  acetylcholine  (8).  Further, macrophages, mast 

cells,  lymphocytes,  granolucytes,  fibroblasts  and  smooth  muscle  cells  all  have  been 

suggested to express ChAT (7), although the release of acetylcholine from these cells has 

not yet been demonstrated directly. Acetylcholine can bind to and activate a family of G 

protein coupled muscarinic receptors, but also a  family of nicotinic receptors, which are 

ligand gated  cation  channels  (9). Most  inflammatory and airway  structural  cells express 

muscarinic and/or nicotinic receptors (2,7). The individual receptor subtypes and subunits 

expressed by these cells have been reviewed extensively by Wessler and Kirkpatrick (7).  

The mechanisms  that  regulate  the metabolism of non‐neuronal acetylcholine by airway 

epithelial  cells  are  still  not  fully  established,  although  recent  studies  have  yielded 

important new insights. The uptake of choline is the rate‐limiting step in the synthesis of 

acetylcholine.  Choline  uptake  in  airway  epithelial  cells  is  regulated  by  the  high  affinity 

choline transporter (CHT1) and by choline‐specific transporter‐like proteins (CTL) (10,11). 

Organic cation transporter (OCT) subtypes 1 and 2 play a dominant role  in the release of 

acetylcholine  by  airway  epithelial  cells  (10,11).  Furthermore,  the  expression  of  the 

vesicular  acetylcholine  transporter  (VAChT)  by  some  epithelial  cell  types,  including 

secretory cells, neuroendocrine cells and brush cells has been  reported,  suggesting  that 

storage  and  release  of  acetylcholine  via  vesicles may mediate  acetylcholine  release  by 

non‐neuronal  cell  types  (10,11).  The  expression  of  muscarinic  receptors,  nicotinic 

receptors, synthesizing enzymes such as ChAT and the release of acetylcholine from non‐

neuronal cells  is solid evidence for the existence of a non‐neuronal cholinergic system  in 

the airways next to the well‐established neuronal cholinergic system. 

Muscarinic receptor expression and function in the airways 

Muscarinic  receptors  are  the  target  for  anticholinergic  therapy  in  obstructive  airways 

diseases as asthma and COPD and are the focus of this review. Muscarinic receptors are 

expressed by structural cells in the airways, predominantly airway smooth muscle, airway 

epithelium and airway fibroblasts. The parasympathetic neural network penetrates deep 

into  the  airway  wall,  and  regulates  bronchoconstriction,  the  release  of  mucus  from 

submucosal glands, and to a  lesser degree from goblet cells  in the airway epithelium (2). 

The functional role of non‐neuronal acetylcholine released from the airway epithelium  is 

less  well  described,  although  recent  studies  suggest  a  role  in  airway  smooth  muscle 

contraction (12). It should be noted however that this finding is still controversial (13,14). 

Chapter 2 

38 

Additionally,  acetylcholine,  either  neuronal  or  non‐neuronal,  may  modulate  airway 

inflammation and remodeling, as will be discussed further on. 

The distribution of muscarinic receptor subtypes throughout the bronchial tree  is mainly 

restricted  to muscarinic M1, M2  and M3  receptors  (2). M1  receptors  are  expressed  by 

epithelial cells, where they play a modulatory role in electrolyte and water secretion, and 

in the ganglia, where they facilitate parasympathetic neurotransmission. M2 receptors are 

expressed  by  neurons, where  they  function  as  autoreceptors,  inhibiting  the  release  of 

acetylcholine from both preganglionic nerves and from parasympathetic nerve terminals. 

M2 autoreceptors are dysfunctional in allergic asthma due to eosinophil‐derived release of 

major  basic  protein  which  acts  as  an  allosteric  antagonist  of  the  M2  receptor  (15), 

augmenting  acetylcholine  release.  Furthermore, M2  receptors  are widely  expressed  by 

airway mesenchymal cells such as fibroblasts and smooth muscle cells (2). Recent studies 

suggest  that  they may modulate  cellular  responses  associated with  airway  remodeling 

(16). Also, a role  in  inhibition of Gs mediated airway smooth muscle relaxation has been 

proposed  (1). M3  receptors  are  probably  the  best  characterized  subtype  and  are  the 

dominant receptor subtype in the regulation of mucus secretion from submucosal glands 

and airway smooth muscle contraction (2). As a result, M3 receptors are the primary target 

for  anticholinergics,  and  M3  subtype‐selectivity  has  been  advocated  for  by  several 

research groups (17‐22).  

Muscarinic receptors as therapeutic targets for asthma and COPD 

Anticholinergic  therapy  in  COPD,  and  to  a  lesser  extent  asthma,  is  mainly  aimed  at 

inhibition of bronchoconstriction by inhibition of muscarinic receptors. Although the term 

anticholinergic  is  most  commonly  used,  all  available  anticholinergics  used  for  the 

treatment of asthma and COPD are  in  fact  specific antimuscarinics as  they  lack binding 

affinity at  the nicotinic  receptor. Clinically available anticholinergics are  the  short‐acting 

ipratropium and  the  long‐acting  tiotropium.  In addition  to  its  longer duration of action, 

tiotropium has a considerably slower rate of dissociation from the M1 and the M3 receptor 

than from the M2 receptor, making the drug ‘kinetically selective’ for M1 and M3 receptors 

(21). It is conceivable that this functional selectivity of tiotropium is beneficial, as smooth 

muscle contraction is primarily mediated by M3 receptors, whereas M2 receptor blockade 

facilitates  acetylcholine  release  from  parasympathetic  nerves  (2).  However,  direct 

evidence for a beneficial clinical effect of this functional M3 selectivity of tiotropium is still 

lacking  and  the major  difference  between  these  drugs  appears  to  be  the  duration  of 

action. 

Muscarinic receptors in inflammation and remodeling 

 39 

The  Understanding  the  Potential  Long‐term  Impacts  of  on  Function  with  Tiotropium 

(UPLIFT) trial has demonstrated that treatment with tiotropium provides a significant and 

sustained improvement in lung function and quality of life in COPD patients, and reduces 

exacerbations and hospitalizations (23). Currently available anticholinergics are the short‐

acting  ipratropium  and  the  long‐acting  tiotropium.  These  can  be  used  either  as 

monotherapy or  in combination with β2‐agonists and provide significant  improvement  in 

FEV1 in both asthma and COPD patients (24‐27). The combination therapy with β2‐agonists 

is  more  effective  than  anticholinergic  treatment  alone;  nonetheless,  monotherapy  is 

already  markedly  effective  (28).  The  explanation  for  this  relatively  large  effect  of 

monotherapy may  lie within  the  role  that mediators of  inflammation  (e.g.  thromboxane 

A2, histamine) have  in activating the airway cholinergic system. Airway  inflammation has 

several ways  to  increase  the output of neuronally  released acetylcholine, as  it  results  in 

exposure  and  activation  of  afferent  C‐fibres  that  facilitate  ganglionic  and  central 

parasympathetic  neurotransmission.  Further,  the  release  of  acetylcholine  can  be 

facilitated  directly  via  excitatory  receptors  for  inflammatory  mediators  (e.g. 

prostaglandins,  tachykinins) present on parasympathetic nerve  terminals,  and  indirectly 

via inhibition of the M2 autoreceptor through the release of eosinophil derived major basic 

protein  that  acts  as  an  allosteric  M2  receptor  antagonist  (1,2).  As  a  result,  the 

bronchoconstrictor  response  (and  perhaps  additional  responses)  induced  by  pro‐

inflammatory  mediators  such  as  thromboxane  A2  is  for  a  large  part  mediated  by 

neuronally released acetylcholine (29). Further, bronchoconstriction induced by histamine 

after the early asthmatic response can be inhibited by ipratropium in a guinea pig model 

of asthma (30). This advocates for the use of anticholinergic therapy not only  in COPD – 

where parasympathetic  tone  is  the primary  reversible component of airway obstruction 

(31) – but also in asthma. Indeed, recent clinical trials indicate significant improvements in 

lung function in asthma patients on top of usual care, and show that tiotropium therapy is 

non‐inferior to β2‐agonist therapy when combined with corticosteroids  in severe asthma 

patients  (25,26,32). The additional observations that next to FEV1 also exacerbation rate 

and lung function decline in subgroups of COPD patients are improved by treatment with 

tiotropium  (33,34)  has  prompted  speculations  on  the  possible  beneficial  effects  of 

anticholinergics on airway inflammation and remodeling (35).  

 

Airway inflammation 

Asthma and COPD are both characterized by chronic airway inflammation, albeit that the 

patterns of inflammation are markedly different. Different subtypes of T cells are involved 

in asthma and COPD: in asthma there is an increase in TH2 (CD4+) cells, whereas in COPD 

Chapter 2 

40 

CD8+ T  cells predominate. Furthermore,  the  inflammation  that occurs  in asthma  can be 

described  as  eosinophilic,  whereas  that  occurring  in  COPD  is  mainly  neutrophilic. 

However, when disease severity increases these differences become less pronounced (36).  

Inflammation and the non‐neuronal cholinergic system 

Increasing  evidence  suggests  that  acetylcholine  contributes  to  airway  inflammation.  In 

2004,  Wessler  et  al.  found  that  in  patients  with  atopic  dermatitis,  a  condition 

characterized  by  TH2  type  inflammation  and  often  associated  with  bronchial  asthma, 

expression  of  ChAT  is  increased  in  skin  biopsies,  with  a  consequent  increase  in 

acetylcholine (37). Further, Profita et al. (2011) demonstrated that cigarette smoke extract 

upregulated the non‐neuronal cholinergic system  in bronchial epithelial cells, by showing 

that  expression  of M2  and M3  receptors  and  ChAT mRNA  and  protein were  increased, 

whereas M1  receptor  levels were not affected. Consequently, acetylcholine  levels  in cell 

extracts  were  significantly  higher  after  stimulation  with  cigarette  smoke  extract.  This 

increase could be reduced by tiotropium (38). In contrast,  lungs of ovalbumin challenged 

rats  and  mice  show  a  significant  decrease  in  ChAT  and  other  components  of  the 

cholinergic  system,  including  the  functionally  relevant  choline  transporter  CHT1  (39). 

Future  studies are  clearly warranted within  this area  to better understand  the  complex 

mechanism of regulation of the cholinergic system by inflammation and the significance of 

this process in asthma and COPD. 

Inflammatory cells 

Acetylcholine has been shown to affect  inflammatory cells  involved  in asthma and COPD 

directly,  by  inducing  proliferation  or  cytokine  release  from  these  cells.  Carbachol  can 

induce  the proliferation of macrophages  from mice  in vitro  (40). Also T‐cell proliferation 

can be observed ex vivo after treatment of rats with the muscarinic agonist oxotremorine, 

whereas  atropine  suppresses  the  proliferation  of  T‐cells  (41).  These  anti‐inflammatory 

properties  of  atropine were  also  demonstrated  in  rats  in  vivo, were  it  suppressed  the 

turpentine‐induced infiltration of leukocytes (41). Moreover, bovine alveolar macrophages 

exhibit  neutrophil,  eosinophil  and  monocyte  chemotactic  activity  in  response  to 

acetylcholine, which  is  likely  explained by  cholinergic  induction of  leukotriene B4  (LTB4) 

release  (42).  Recently,  this  was  confirmed  for  primary  human  macrophages  (43). 

Moreover,  it was shown  that acetylcholine‐induced  release of chemotactic activity  from 

monocytes, macrophages and epithelial cells could be inhibited by tiotropium (43). It has 

also been shown  that acetylcholine can  induce  the  release of LTB4  from sputum cells of 

COPD  patients  (44).  These  results  are  consistent  with  a  study  demonstrating  that 

tiotropium and also acetylcholinesterase, the degrading enzyme of acetylcholine, inhibited 

alveolar macrophage mediated migration of neutrophils  from COPD patients  (45). Using 

Muscarinic receptors in inflammation and remodeling 

 41 

the M3‐selective antagonist 4‐DAMP  it was shown that this effect  is mediated via the M3 

receptor (45). Further, although R,R‐glycopyrrolate, a muscarinic receptor antagonist, did 

not inhibit LPS‐induced TNF‐α release by itself, it synergistically inhibited the rolipram and 

budesonide  induced decrease  in TNF‐α release  from human primary monocytes  (46). All 

these findings support a broad role for acetylcholine acting on muscarinic receptors in the 

regulation of airway inflammatory cells (figure 1). 

Epithelial cells 

The expression of non‐neuronal acetylcholine is relatively high in bronchial epithelial cells 

(8). Acetylcholine  is  known  to  induce eosinophil, monocyte  and neutrophil  chemotactic 

activity  in  bronchial  epithelial  cells  (47,48).  The  increase  in  epithelial  neutrophil 

chemotactic  activity  by  acetylcholine  could  be  inhibited  by  tiotropium,  indicating  the 

involvement  of  muscarinic  receptors  in  this  response  (49).  The  acetylcholine‐induced 

neutrophil chemotactic activity from epithelial cells is partially dependent on IL‐8 release,   

 

  

Figure 1. The regulatory role of acetylcholine in inflammatory cell chemotaxis and activation. Acetylcholine can 

be neuronally  released or secreted as an autocrine or paracrine hormone  from  inflammatory cells and airway 

structural cells, most notably airway epithelial cells.  In susceptible  individuals, the release of acetylcholine may 

be enhanced in response to environmental factors such as cigarette smoke or allergens. As a consequence, pro‐

inflammatory cytokines including IL‐6, IL‐8 and LTB4 are produced, which attract and activate inflammatory cells, 

most  notably  neutrophils. Muscarinic M3  receptors  expressed  on  airway  smooth muscle  and muscarinic M1‐3 

receptors expressed by airway epithelial cells mediate the release of these factors via activation of ERK1/2 and 

NF‐kB signaling pathways. 

Chapter 2 

42 

since it is inhibited by an anti‐IL‐8 monoclonal antibody (49). In line with this contention, 

the  increase  in  IL‐8  release  in  response  to  acetylcholine  could be  partially  inhibited by 

tiotropium.  In addition, acetylcholine  induced LTB4 release from bronchial epithelial cells 

in a tiotropium sensitive manner (38). Both IL‐8 and LTB4 release from bronchial epithelial 

cells  is mediated  via  ERK1/2  and NF‐κB  signaling  pathways  and  dependent  on multiple 

muscarinic receptor subtypes (M1/M2/M3) (38,49). Taken together, these studies implicate 

an important role for epithelial acetylcholine in airway inflammation, via the activation of 

muscarinic receptors (figure 1). 

Another potential mechanism by which tiotropium could inhibit inflammation induced by 

epithelial cells  is by attenuating respiratory syncytial virus (RSV) replication  in these cells 

(50). RSV  is one of  the major  causes of  acute  lower  respiratory  tract  infection  and has 

been  detected  in  patients with  exacerbations  of  asthma  and  COPD  (51).  In  an  in  vitro 

study,  Iesato et al. demonstrated  that  the attenuation of virus  replication by  tiotropium 

was partially due to  inhibition of RhoA activity. Moreover, tiotropium  inhibited epithelial 

IL‐6  and  IL‐8  production  induced  by  RSV  infection  (50).  In  vivo  studies  are  needed  to 

investigate  the  importance  of  inhibition  of  infection‐induced  airway  inflammation  by 

tiotropium. 

Airway smooth muscle cells 

The  airway  smooth  muscle  is  increasingly  recognized  for  its  role  in  modulating 

inflammation  by  secreting  cytokines  and  chemokines  (52),  and  it  has been  shown  that 

muscarinic  receptors  on  airway  smooth muscle  cells  are  involved  in  these  responses. 

Stimulation of bovine airway smooth muscle strips with the muscarinic agonist carbachol 

induces pro‐inflammatory gene expression, including IL‐6, IL‐8 and cyclo‐oxygenase‐2 (53). 

Furthermore, carbachol augmented  the cyclic stretch‐induced expression of  these genes 

(53). Stimulation of airway  smooth muscle cells with carbachol also  induces  the protein 

release  of  IL‐6  and  IL‐8  via  M3  receptors  (54).  Furthermore,  methacholine  strongly 

augmented cigarette smoke extract (CSE) induced IL‐8 release (54). In line with findings in 

epithelial cells,  IL‐8 release  induced by stimulation with methacholine and CSE  in airway 

smooth muscle is ERK1/2 and NF‐κB dependent (55).  

In vivo studies 

The regulatory role of muscarinic receptor signaling in inflammatory processes involved in 

asthma and COPD has been  confirmed by  in vivo  studies, using animal models of  these 

diseases.  

 

Muscarinic receptors in inflammation and remodeling 

 43 

Wollin and Pieper were the first to report anti‐inflammatory properties of tiotropium in an 

animal model of cigarette smoke induced COPD (56). Total cell number and neutrophils in 

the bronchoalveolar  lavage fluid (BALF) were concentration‐dependently decreased after 

treatment  with  tiotropium.  Furthermore,  tiotropium  inhibited  the  increase  of  several 

cytokines in the BALF, including IL‐6, KC, TNF‐α and LTB4 (56). Similar inhibitory effects of 

tiotropium on airway neutrophilia were observed  in a guinea pig model of  LPS‐induced 

COPD (57). Moreover, neutrophilia was inhibited by ipratropium in a cadmium‐induced rat 

model  of  pulmonary  inflammation  (58),  by  tiotropium  in  a  HCl‐induced  rat  model  of 

gastro‐oesophageal reflux (59) and by bilateral vagotomy or treatment with atropine in a 

diesel particle‐induced rat model of pulmonary  inflammation  (60). Of  interest, the  latter 

study found that atropine was more effective  in  inhibiting pulmonary  inflammation than 

bilateral vagotomy, suggesting a role for non‐neuronal acetylcholine in this response (60). 

These  findings may  also be  relevant  for  asthma. Our  group has  shown  that  tiotropium 

partially  inhibits  eosinophilia  in  a  guinea  pig  model  of  asthma  (61),  which  has  been 

confirmed by Buels et al. (62). In line with these findings, infiltration of macrophages and 

eosinophils  in  the BALF was  significantly  inhibited by  tiotropium  treatment  in  a murine 

model  of  asthma.  Furthermore,  expression  levels  in  BALF  of  IL‐4,  IL‐5  and  IL‐13 were 

decreased  by  tiotropium  treatment  (63).  In  addition,  aclidinium,  a  novel  muscarinic 

receptor  antagonist,  inhibited  infiltration  of  eosinophils  in  BALF  in  a mouse model  of 

Aspergillus  fumigatus‐induced  asthma  (64).  A  recent  study  also  suggested  that  M3 

receptors  regulate  these  inflammatory  responses, although  the  selectivity profile of  the 

antagonist bencycloquidium that was used in this study precludes firm conclusions on the 

involvement of other receptor subtypes (65,65). Since both tiotropium and aclidinium are 

kinetically  selective  for  the M3  receptor,  this  suggests predominant  involvement of  this 

receptor subtype  in the observed anti‐inflammatory effects  in asthma and COPD models 

described above. This is supported by our own data on M3R‐/‐ mice, in which neutrophilia 

and cytokine release in BALF were inhibited compared to wild‐type mice after exposure to 

cigarette smoke (chapter 3). 

Clearly, all these in vivo studies indicate a profound role for acetylcholine in inflammation 

in asthma and COPD, which is in accordance with results of in vitro studies that report pro‐

inflammatory effects of muscarinic receptors (figure 1). The implication of these findings is 

that  treatment  with  anticholinergics  may  have  beneficial  effects  that  exceed  their 

bronchodilatory  properties,  a  contention  confirmed  in  several  models  of  pulmonary 

inflammation.  However,  the  exact  mechanism  responsible  for  the  regulatory  role  of 

acetylcholine in inflammation is far from understood.  

Chapter 2 

44 

Airway remodeling  

Airway  inflammation  in  chronic  airway  diseases  such  as  asthma  and  COPD  is  often 

associated with  cellular  and  structural  alterations  in  the  airways,  referred  to  as  airway 

remodeling  (66).  Airway  remodeling  is  considered  a  major  component  of  irreversible 

airflow  limitation  in  these  diseases  (67),  is  progressive,  and  correlates  with  disease 

severity (68,69). Airway remodeling in asthma and COPD is characterized by mucus gland 

hypertrophy, goblet cell hyperplasia and pulmonary vascular remodeling (66). In addtion, 

in asthma the basement membrane is thickened, there is subepithelial fibrosis, and there 

is considerable thickening of the airway smooth muscle bundle (67). In contrast, in COPD 

the  fibrosis  is mostly peribronchial, and although  increased airway smooth muscle mass 

may  occur,  this  appears  restricted  to  severe  stages  of  COPD  (68).  Airway  structural 

alterations may accelerate decline of lung function (70). 

Epithelial cells and mucus production 

The airway epithelial layer is in continuous interaction with the external environment. To 

protect  itself  from  exogenous  stimuli,  mucus  is  secreted  under  the  control  of  the 

cholinergic  system  by muscarinic  receptors  (71). Mucus  secretion  can  be  increased  by 

electrical field stimulation of the vagal nerve in bronchial preparations, predominantly via 

M3 receptors on the submucosal glands (71). In addition, electrolyte and water secretion 

are  regulated  by M1  and M3  receptors  (72,73). Neuronal M2  autoreceptors  appears  to 

regulate  the  extent  of  the  secretory  response,  by  limiting  neuronally  released 

acetylcholine (73). In response to acetylcholine, glandular goblet cells also produce mucus 

(71).  

Mucus  hypersecretion  is  an  important  pathological  feature  of  chronic  airway  diseases 

contributing to airway obstruction (71). MUC5AC expression in airway epithelial cells and 

airway submucosal glands is directly correlated to airway obstruction in smokers (74) and 

in  smokers, COPD patients and asthma patients,  the expression of  the MUC5AC gene  is 

augmented  (75). Also,  the expression of MUC5B and  the  insoluble MUC2 are  increased, 

particularly  in COPD. The ratio of mucus cells to serous cells  in the submucosal glands  is 

also  increased  in  COPD  patients  (76).  In  vitro  studies  demonstrated  that  aclidinium 

suppressed  carbachol‐induced  MUC5AC  overexpression  in  human  bronchial  tissue. 

Additionally,  the  increased  expression  of  MUC5AC  by  the  co‐stimulation  of  cigarette 

smoke  extract  and  carbachol  could be  attenuated by  the use of  aclidinium or  atropine 

(77). Moreover,  epidermal  growth  factor  (EGF)  stimulation  enhanced  the  ACh‐induced 

response  on  mucus  cell  activation  in  airway  submucosal  glands  (78).  In  vivo  studies 

confirm  the  role  of  acetylcholine  in  mucus  hypersecretion  and  demonstrate  that 

tiotropium  reduces  allergen‐induced  mucus  gland  hypertrophy  and  MUC5AC‐positive 

Muscarinic receptors in inflammation and remodeling 

 45 

goblet  cell  number  in  guinea  pigs  (61).  Further,  it  has  been  reported  that  tiotropium 

inhibits neutrophil elastase‐induced goblet cell metaplasia in mice (79) and that treatment 

with tiotropium inhibited the increased MUC5AC expression and mucus gland hypertrophy 

in a guinea pig model of COPD (57). This demonstrates the important role of acetylcholine 

in  the  regulation of mucus secretion, both  in vitro and  in animal models of asthma and 

COPD in vivo (figure 2). 

Acetylcholine may  also  regulate  the  proliferative  and  pro‐fibrotic  responses  of  airway 

epithelial  cells.  Bronchoconstriction  induced  by  repeated  challenges with methacholine 

induced epithelial  cell proliferation and an  increase  in  the expression of  the profibrotic 

cytokine TGF‐β by these cells  in mild asthmatic subjects  (80).  In  line with these  findings, 

airway constriction  induced by methacholine significantly  increased  the phosphorylation 

of the EGF receptor in airway epithelial cells (81). Moreover, in rat tracheal epithelial cells, 

acetylcholine induces proliferation mediated by M1 receptors (82) and autocrine release of 

acetylcholine  is sufficient  to  induce monkey airway epithelial cell proliferation  (8). Thus, 

the cholinergic system  is able  to  regulate epithelial cell proliferation, either  through  the 

induction of mechanical strain or in an autocrine/paracrine manner, which is required for 

the repair of the airway epithelial layer.  

Mesenchymal cells 

Airway mesenchymal  cells  (e.g.  fibroblasts,  airway  smooth muscle  cells)  contribute  to 

airway  remodeling  by  means  of  proliferation,  contractile  protein  expression  and  the 

release  of  components  such  as  mediators,  extracellular  matrix  proteins  and  matrix 

metalloproteinases  (MMPs)  (83,84).  In  vitro  studies  showed  that  the  stimulation  of 

muscarinic  receptors  on  lung  fibroblasts  induces  cell  proliferation  and  the  synthesis  of 

collagen  (16,85) through the activation of the mitogen‐activated protein kinase pathway 

(85,86).  This  effect was mediated  by  the  activation  of M2  receptors  (16).  Interestingly, 

acetylcholine‐induced cell proliferation is enhanced in human lung fibroblasts from COPD 

patients  compared with  healthy  non‐smokers  and  healthy  smokers without  COPD  (87). 

The higher activation of  cell proliferation  in  fibroblasts  from COPD patients was due  to 

enhanced ERK1/2 and NF‐κB phosphorylation. Notably, the synthesizing enzyme ChAT was 

also increased in lung fibroblasts from healthy smokers and COPD patients (87). 

MMPs play a key role in airway remodeling, inflammation and emphysema (88). In COPD 

patients,  increased expression  levels of MMP‐1, MMP‐2 and MMP‐9 have been reported 

(89,90).  The  activity  of  the  MMPs  can  be  inhibited  by  tissue  inhibitor  of  matrix 

metalloproteinases (TIMPs) (88). Recently, it was demonstrated that tiotropium inhibited 

TGF‐β‐induced protein expression of both MMP‐1 and MMP‐2  in human  lung fibroblasts, 

Chapter 2 

46 

but had no effect on the TGF‐β‐induced TIMP‐1 and TIMP‐2 expression (91,92). Therefore, 

these data suggest that treatment with tiotropium improves the balance between MMPs 

and  TIMPs,  inhibiting  pro‐fibrotic  responses. As MMPs  also  play  important  roles  in  the 

infiltration of inflammatory cells, this effect could also contribute to the anti‐inflammatory 

properties of anticholinergics. 

Airway smooth muscle thickening is a characteristic pathological feature of asthma, and to 

a  lesser  extent  of  COPD.  The  induction  of  airway  smooth muscle  cell  proliferation  by 

growth factors, including PDGF and EGF, can be enhanced by the stimulation of muscarinic 

receptors  (93‐96).  Specifically, Gβγ  subunits derived  from Gq protein  coupled  receptors 

cooperate  with  receptor  tyrosine  kinases  (e.g.  the  PDGF/EGF  receptor)  to  induce 

synergistic activation of PI3K/Akt/p70S6K signaling leading to cell proliferation (93,95,96). 

 

  

Figure 2. The regulatory role of acetylcholine in airway wall remodeling. Acetylcholine is neuronally released and 

secreted  as  an  autocrine  or  paracrine  hormone  from  airway  structural  cells  and  inflammatory  cells.  In  the 

inflamed  airway,  inflammatory  cells  and  airway  epithelial  cells  also  secrete  growth  factors  that  in  concerted 

action with acetylcholine activate cell proliferation and matrix production by airway mesenchymal cells, including 

airway  fibroblasts  and  airway  smooth  muscle  cells.  Furthermore,  acetylcholine  activates  smooth  muscle 

contraction  leading  to airway wall  compression, which activates  inflammatory  cells and promotes  remodeling 

responses  by  airway  epithelial  cells.  Acetylcholine  also  directly  promotes  mucus  production  by  and  cell 

proliferation of airway epithelial cells. 

Muscarinic receptors in inflammation and remodeling 

 47 

Moreover, the activation of conventional PKC isoenzymes, likely via M3 receptor mediated 

Gαq  stimulation,  leads  to  GSK‐3  inactivation, which  potentiates  both  translational  and 

transcriptional  processes  (94).  These  pathways  are  also  involved  in  the  acquisition  of 

contractile protein expression by TGF‐β via transcriptional and translational processes (97‐

99) and can be activated by muscarinic receptor stimulation (100). Indeed, the expression 

of myosin light‐chain kinase was augmented by carbachol in human airway smooth muscle 

cells exposed to cyclical mechanical strain (101). Additionally, we recently described that 

muscarinic  receptor  stimulation  enhanced  the  TGF‐β1‐induced  contractile  protein 

expression in human airway smooth muscle cells (102). Collectively, these findings suggest 

an  important role of muscarinic receptor stimulation  in the proliferation and maturation 

of mesenchymal cells (figure 2). 

In vivo studies 

Inhibitory effects of anticholinergics on airway mesenchymal cell remodeling have indeed 

been  reported  in  animal  models  of  asthma  and  COPD.  Treatment  with  tiotropium 

significantly inhibited airway smooth muscle remodeling in a guinea‐pig model of chronic 

asthma  using  repeated  challenges with  ovalbumin  (103).  This was  associated with  the 

inhibition  of  increased  contractile  protein  expression  and  of  airway  smooth  muscle 

thickening.  In  a  murine  model  of  asthma,  it  was  shown  that  tiotropium  could  also 

significantly  inhibit smooth muscle thickening and the expression of TGF‐β1  in BALF (63). 

Similar  effects  have  been  described  for  the  M3  receptor  selective  antagonist 

bencycloquidium bromide  (65).  Furthermore, bencycloquidium bromide  reduced mucus 

production, globet cell metaplasia and collagen deposition and inhibited the upregulation 

of MMP‐9, but not of TIMP‐1 mRNA  (65). Treatment with  tiotropium also  inhibited  the 

increased peribronchial collagen deposition in a guinea pig model of COPD (57). Similarly, 

in  a  chronic  gastro‐oesophageal  reflux  model,  tiotropium  treatment  prevented  the 

increase  in  airway  fibrosis  (59).  Taken  together,  these  in  vivo  studies  confirm  in  vitro 

studies  showing  that  anticholinergics  have  anti‐remodeling  properties  in  asthma  and 

COPD (figure 2). 

 

Clinical implications 

The above mentioned in vitro and in vivo studies indicate significant pro‐inflammatory and 

remodeling  effects  for  acetylcholine  via  muscarinic  receptors,  suggesting  that 

anticholinergics may  have  anti‐inflammatory  and  anti‐remodeling  properties  in  asthma 

and COPD patients. This hypothesis still needs to be proven in clinical studies, however. In 

the UPLIFT study, COPD patients treated with tiotropium during a 4 year period showed 

an  improved  quality  of  life  and  lung  function,  and  a  reduction  in  the  frequency  of 

Chapter 2 

48 

exacerbations.  Although  tiotropium  did  not  reduce  FEV1  decline  in  the  overall  study 

population (23), in pre‐specified post‐hoc studies, GOLD stage II and young COPD patients 

with  rapid  lung  function decline had a  significant  improvement  in  the accelerated post‐

bronchodilator FEV1 decline (33,34). No notable reduction in exacerbation frequency was 

reported for ipratropium (104,105). This suggests a beneficial role for tiotropium as a long‐

acting anticholinergic or a possible role for M3 receptor subtype selectivity, as tiotropium 

is  kinetically  selective  for M3  receptors  compared with  ipratropium. Moreover,  it  also 

indicates  anti‐inflammatory  effects  of  tiotropium,  since  patients  who  have  more 

exacerbations demonstrate increased levels of inflammatory markers at stable state (106). 

However, Powrie et al. (2007) were not able to demonstrate a reduction in sputum IL‐6 or 

IL‐8 levels in patients treated with tiotropium during one year, even though the number of 

exacerbations  was  significantly  decreased  (107).  A  possible  explanation  for  this 

discrepancy  proposed  by  the  authors  is  that  the  reduction  in  amount  of  sputum  after 

tiotropium  treatment  might  result  in  an  increase  in  cytokine  concentrations. 

Measurement of cytokine concentrations  in sputum might  therefore not be  the optimal 

method. Also, Perng et al. did not  find a decrease  in sputum  IL‐8  levels after tiotropium 

treatment (108). However, the treatment group in their study was small and patients only 

received tiotropium for 12 weeks. Further studies are therefore needed to elucidate the 

mechanisms by which tiotropium reduces exacerbations and FEV1 decline in subgroups of 

COPD patients and whether this  is based on  the anti‐inflammatory effects of  tiotropium 

discussed  in  this  paper  or  by  other  effects,  including  a  reduction  in  dyspnea  or mucus 

hypersecretion.  Likewise,  further  studies  on  the  beneficial  effects  of  anticholinergics  in 

asthma  patients  are  warranted.  In  patients  with  severe,  uncontrolled  asthma  it  has 

recently  been  shown  that  treatment  with  tiotropium  improves  lung  function  (25). 

Furthermore, a recent clinical trial showed that repeated  inhalations with the muscarinic 

receptor agonist methacholine  induces airway  remodeling  in asthma patients,  including 

the expression of TGF‐β and  collagen  I  in bronchial biopsies  (80). Therefore, although a 

rationale  for  beneficial  effects  of  anticholinergics  beyond  the  well‐described 

bronchodilator properties  in asthma and COPD certainly exists,  it  is evident that this still 

needs to be confirmed in clinical studies.  

 

Acknowledgements 

The authors would like to thank the Netherlands Lung Foundation (grant 3.2.08.014) and 

the Groningen Center for Drug Research for financial support. 

Muscarinic receptors in inflammation and remodeling 

 49 

References 

(1)  Belmonte  KE.  Cholinergic  pathways  in  the  lungs  and  anticholinergic  therapy  for  chronic 

obstructive pulmonary disease. Proc Am Thorac Soc 2005; 2(4):297‐304. 

(2) Gosens R, Zaagsma J, Meurs H, Halayko AJ. Muscarinic receptor signaling in the pathophysiology 

of asthma and COPD. Respir Res 2006; 7:73. 

(3)  Racke  K, Matthiesen  S.  The  airway  cholinergic  system:  physiology  and  pharmacology.  Pulm 

Pharmacol Ther 2004; 17(4):181‐198. 

(4) Racke K, Juergens UR, Matthiesen S. Control by cholinergic mechanisms. Eur J Pharmacol 2006; 

533(1‐3):57‐68. 

(5)  Cui  WY,  Li  MD.  Nicotinic  modulation  of  innate  immune  pathways  via  alpha7  nicotinic 

acetylcholine receptor. J Neuroimmune Pharmacol 2010; 5(4):479‐488. 

(6) Rosas‐Ballina M, Tracey KJ. Cholinergic control of  inflammation. J  Intern Med 2009; 265(6):663‐

679. 

(7) Wessler I, Kirkpatrick CJ. Acetylcholine beyond neurons: the non‐neuronal cholinergic system in 

humans. Br J Pharmacol 2008; 154(8):1558‐1571. 

(8) Proskocil BJ,  Sekhon HS,  Jia Y,  Savchenko V, Blakely RD,  Lindstrom  J et al. Acetylcholine  is an 

autocrine  or  paracrine  hormone  synthesized  and  secreted  by  airway  bronchial  epithelial  cells. 

Endocrinology 2004; 145(5):2498‐2506. 

(9) Wess  J,  Eglen  RM, Gautam  D. Muscarinic  acetylcholine  receptors: mutant mice  provide  new 

insights for drug development. Nat Rev Drug Discov 2007; 6(9):721‐733. 

(10) Kummer W, Lips KS, Pfeil U. The epithelial cholinergic system of the airways. Histochem Cell Biol 

2008; 130(2):219‐234. 

(11)  Lips KS, Volk C,  Schmitt BM, Pfeil U, Arndt P, Miska D et  al. Polyspecific  cation  transporters 

mediate luminal release of acetylcholine from bronchial epithelium. Am J Respir Cell Mol Biol 2005; 

33(1):79‐88. 

(12) Moffatt  JD,  Cocks  TM,  Page  CP.  Role  of  the  epithelium  and  acetylcholine  in mediating  the 

contraction  to  5‐hydroxytryptamine  in  the  mouse  isolated  trachea.  Br  J  Pharmacol  2004; 

141(7):1159‐1166. 

(13) Kummer W, Wiegand S, Akinci S, Wessler I, Schinkel AH, Wess J et al. Role of acetylcholine and 

polyspecific cation transporters  in serotonin‐induced bronchoconstriction  in the mouse. Respir Res 

2006; 7:65. 

(14) Kummer W, Wiegand S, Akinci S, Schinkel AH, Wess J, Koepsell H et al. Role of acetylcholine and 

muscarinic receptors  in serotonin‐induced bronchoconstriction  in the mouse. J Mol Neurosci 2006; 

30(1‐2):67‐68. 

(15)  Jacoby  DB,  Gleich  GJ,  Fryer  AD.  Human  eosinophil  major  basic  protein  is  an  endogenous 

allosteric antagonist at the inhibitory muscarinic M2 receptor. J Clin Invest 1993; 91(4):1314‐1318. 

(16) Matthiesen S, Bahulayan A, Kempkens S, Haag S, Fuhrmann M, Stichnote C et al. Muscarinic 

receptors mediate stimulation of human lung fibroblast proliferation. Am J Respir Cell Mol Biol 2006; 

35(6):621‐627. 

Chapter 2 

50 

(17) Decramer M, Celli B, Tashkin DP, Pauwels RA, Burkhart D, Cassino C et al. Clinical  trial design 

considerations  in  assessing  long‐term  functional  impacts of  tiotropium  in COPD:  the UPLIFT  trial. 

COPD 2004; 1(2):303‐312. 

(18) Lu S, Parekh DD, Kuznetsova O, Green SA, Tozzi CA, Reiss TF. An oral selective M3 cholinergic 

receptor antagonist in COPD. Eur Respir J 2006; 28(4):772‐780. 

(19)  Barnes  PJ.  The  role  of  anticholinergics  in  chronic  obstructive  pulmonary  disease.  Am  J Med 

2004; 117 Suppl 12A:24S‐32S. 

(20) Campbell SC. Clinical aspects of  inhaled anticholinergic  therapy. Respir Care 2000; 45(7):864‐

867. 

(21) Disse B, Speck GA, Rominger KL, Witek TJ,  Jr., Hammer R. Tiotropium  (Spiriva): mechanistical 

considerations and clinical profile in obstructive lung disease. Life Sci 1999; 64(6‐7):457‐464. 

(22) Barnes PJ, Belvisi MG, Mak JC, Haddad EB, O'Connor B. Tiotropium bromide (Ba 679 BR), a novel 

long‐acting muscarinic  antagonist  for  the  treatment of obstructive  airways disease.  Life  Sci 1995; 

56(11‐12):853‐859. 

(23) Tashkin DP, Celli B, Senn S, Burkhart D, Kesten S, Menjoge S et al. A 4‐year trial of tiotropium in 

chronic obstructive pulmonary disease. N Engl J Med 2008; 359(15):1543‐1554. 

(24) Kerstjens HA, Bantje TA, Luursema PB, Sinninghe Damste HE, de Jong JW, Lee A et al. Effects of 

short‐acting bronchodilators added  to maintenance  tiotropium  therapy. Chest 2007; 132(5):1493‐

1499. 

(25) Kerstjens HA, Disse B, Schroder‐Babo W, Bantje TA, Gahlemann M, Sigmund R et al. Tiotropium 

improves lung function in patients with severe uncontrolled asthma: A randomized controlled trial. J 

Allergy Clin Immunol 2011; 128(2):308‐314. 

(26)  Peters  SP,  Kunselman  SJ,  Icitovic  N, Moore WC,  Pascual  R,  Ameredes  BT  et  al.  Tiotropium 

bromide  step‐up  therapy  for adults with uncontrolled asthma. N Engl  J Med 2010; 363(18):1715‐

1726. 

(27) Tashkin D, Kesten S. Long‐term treatment benefits with tiotropium  in COPD patients with and 

without short‐term bronchodilator responses. Chest 2003; 123(5):1441‐1449. 

(28)  Vogelmeier  C,  Kardos  P,  Harari  S,  Gans  SJ,  Stenglein  S,  Thirlwell  J.  Formoterol mono‐  and 

combination  therapy with  tiotropium  in patients with COPD:  a 6‐month  study. Respir Med 2008; 

102(11):1511‐1520. 

(29) Allen IC, Hartney JM, Coffman TM, Penn RB, Wess J, Koller BH. Thromboxane A2 induces airway 

constriction through an M3 muscarinic acetylcholine receptor‐dependent mechanism. Am J Physiol 

Lung Cell Mol Physiol 2006; 290(3):L526‐L533. 

(30)  ten  Berge  RE,  Santing  RE,  Hamstra  JJ,  Roffel  AF,  Zaagsma  J.  Dysfunction  of muscarinic M2 

receptors after the early allergic reaction: possible contribution to bronchial hyperresponsiveness in 

allergic guinea‐pigs. Br J Pharmacol 1995; 114(4):881‐887. 

(31)  Gross  NJ,  Skorodin MS.  Role  of  the  parasympathetic  system  in  airway  obstruction  due  to 

emphysema. N Engl J Med 1984; 311(7):421‐425. 

(32)  Bateman  ED,  Kornmann  O,  Schmidt  P,  Pivovarova  A,  Engel  M,  Fabbri  LM.  Tiotropium  is 

noninferior  to  salmeterol  in  maintaining  improved  lung  function  in  B16‐Arg/Arg  patients  with 

asthma. J Allergy Clin Immunol 2011; 128(2):315‐322. 

Muscarinic receptors in inflammation and remodeling 

 51 

(33) Decramer M, Celli B, Kesten S, Lystig T, Mehra S, Tashkin DP. Effect of tiotropium on outcomes 

in patients with moderate chronic obstructive pulmonary disease (UPLIFT): a prespecified subgroup 

analysis of a randomised controlled trial. Lancet 2009; 374(9696):1171‐1178. 

(34) Morice AH, Celli B, Kesten S, Lystig T, Tashkin D, Decramer M. COPD  in young patients: a pre‐

specified analysis of the four‐year trial of tiotropium (UPLIFT). Respir Med 2010; 104(11):1659‐1667. 

(35)  Bateman  ED,  Rennard  S,  Barnes  PJ,  Dicpinigaitis  PV,  Gosens  R,  Gross  NJ  et  al.  Alternative 

mechanisms for tiotropium. Pulm Pharmacol Ther 2009; 22(6):533‐542. 

(36) Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol 

2008; 8(3):183‐192. 

(37)  Wessler  I,  Reinheimer  T,  Kilbinger  H,  Bittinger  F,  Kirkpatrick  CJ,  Saloga  J  et  al.  Increased 

acetylcholine levels in skin biopsies of patients with atopic dermatitis. Life Sci 2003; 72(18‐19):2169‐

2172. 

(38)  Profita M, Bonanno A, Montalbano AM,  Ferraro M,  Siena  L, Bruno A  et  al. Cigarette  smoke 

extract  activates  human  bronchial  epithelial  cells  affecting  non‐neuronal  cholinergic  system 

signalling in vitro. Life Sci 2011; 89(1‐2):36‐43. 

(39) Lips KS, Luhrmann A, Tschernig T, Stoeger T, Alessandrini F, Grau V et al. Down‐regulation of the 

non‐neuronal acetylcholine synthesis and release machinery in acute allergic airway inflammation of 

rat and mouse. Life Sci 2007; 80(24‐25):2263‐2269. 

(40) de la Torre E, Genaro AM, Ribeiro ML, Pagotto R, Pignataro OP, Sales ME. Proliferative actions 

of muscarinic  receptors expressed  in macrophages derived  from normal and  tumor bearing mice. 

Biochim Biophys Acta 2008; 1782(2):82‐89. 

(41) Razani‐Boroujerdi S, Behl M, Hahn FF, Pena‐Philippides JC, Hutt J, Sopori ML. Role of muscarinic 

receptors  in the regulation of  immune and  inflammatory responses. J Neuroimmunol 2008; 194(1‐

2):83‐88. 

(42) Sato E, Koyama S, Okubo Y, Kubo K, Sekiguchi M. Acetylcholine stimulates alveolar macrophages 

to release inflammatory cell chemotactic activity. Am J Physiol 1998; 274(6 Pt 1):L970‐L979. 

(43) Buhling F, Lieder N, Kuhlmann UC, Waldburg N, Welte T. Tiotropium suppresses acetylcholine‐

induced release of chemotactic mediators in vitro. Respir Med 2007; 101(11):2386‐2394. 

(44) Profita M, Giorgi RD, Sala A, Bonanno A, Riccobono L, Mirabella F et al. Muscarinic receptors, 

leukotriene  B4  production  and  neutrophilic  inflammation  in  COPD  patients.  Allergy  2005; 

60(11):1361‐1369. 

(45) Vacca G, Randerath WJ, Gillissen A. Inhibition of granulocyte migration by tiotropium bromide. 

Respir Res 2011; 12:24. 

(46) Pahl A, Bauhofer A, Petzold U, Cnota PJ, Maus J, Brune K et al. Synergistic effects of the anti‐

cholinergic R,R‐glycopyrrolate with anti‐inflammatory drugs. Biochem Pharmacol 2006; 72(12):1690‐

1696. 

(47) Koyama S, Rennard SI, Robbins RA. Acetylcholine stimulates bronchial epithelial cells to release 

neutrophil and monocyte chemotactic activity. Am J Physiol 1992; 262(4 Pt 1):L466‐L471. 

(48) Koyama S, Sato E, Nomura H, Kubo K, Nagai S, Izumi T. Acetylcholine and substance P stimulate 

bronchial epithelial cells to release eosinophil chemotactic activity. J Appl Physiol 1998; 84(5):1528‐

1534. 

Chapter 2 

52 

(49)  Profita M,  Bonanno  A,  Siena  L,  Ferraro M, Montalbano  AM,  Pompeo  F  et  al.  Acetylcholine 

mediates  the  release  of  IL‐8  in  human  bronchial  epithelial  cells  by  a  NFkB/ERK‐dependent 

mechanism. Eur J Pharmacol 2008; 582(1‐3):145‐153. 

(50) Iesato K, Tatsumi K, Saito K, Ogasawara T, Sakao S, Tada Y et al. Tiotropium bromide attenuates 

respiratory syncytial virus replication in epithelial cells. Respiration 2008; 76(4):434‐441. 

(51)  Johnston  NW.  The  similarities  and  differences  of  epidemic  cycles  of  chronic  obstructive 

pulmonary disease and asthma exacerbations. Proc Am Thorac Soc 2007; 4(8):591‐596. 

(52) Tliba O, Panettieri  Jr RA. Noncontractile Functions of Airway Smooth Muscle Cells  in Asthma. 

Annu Rev Physiol 2008. 

(53) Kanefsky J, Lenburg M, Hai CM. Cholinergic receptor and cyclic stretch‐mediated inflammatory 

gene expression in intact ASM. Am J Respir Cell Mol Biol 2006; 34(4):417‐425. 

(54) Gosens R, Rieks D, Meurs H, Ninaber DK, Rabe KF, Nanninga  J et al. Muscarinic M3  receptor 

stimulation increases cigarette smoke‐induced IL‐8 secretion by human airway smooth muscle cells. 

Eur Respir J 2009; 34(6):1436‐1443. 

(55)  Oenema  TA,  Kolahian  S,  Nanninga  JE,  Rieks  D,  Hiemstra  PS,  Zuyderduyn  S  et  al.  Pro‐

inflammatory mechanisms of muscarinic receptor stimulation  in airway smooth muscle. Respir Res 

2010; 11:130. 

(56) Wollin L, Pieper MP. Tiotropium bromide exerts anti‐inflammatory activity in a cigarette smoke 

mouse model of COPD. Pulm Pharmacol Ther 2010; 23(4):345‐354. 

(57)  Pera  T,  Zuidhof  A,  Valadas  J,  Smit M,  Schoemaker  RG,  Gosens  R  et  al.  Tiotropium  inhibits 

pulmonary inflammation and remodelling in a guinea pig model of COPD. Eur Respir J 2011. 

(58)  Zhang W,  Fievez  L,  Cheu  E,  Bureau  F,  Rong W,  Zhang  F  et  al.  Anti‐inflammatory  effects  of 

formoterol  and  ipratropium  bromide  against  acute  cadmium‐induced  pulmonary  inflammation  in 

rats. Eur J Pharmacol 2010; 628(1‐3):171‐178. 

(59) Cui Y, Devillier P, Kuang X, Wang H, Zhu L, Xu Z et al. Tiotropium reduction of lung inflammation 

in a model of chronic gastro‐oesophageal reflux. Eur Respir J 2010; 35(6):1370‐1376. 

(60)  McQueen  DS,  Donaldson  K,  Bond  SM,  McNeilly  JD,  Newman  S,  Barton  NJ  et  al.  Bilateral 

vagotomy or atropine pre‐treatment reduces experimental diesel‐soot  induced  lung  inflammation. 

Toxicol Appl Pharmacol 2007; 219(1):62‐71. 

(61) Bos  IS, Gosens R, Zuidhof AB, Schaafsma D, Halayko AJ, Meurs H et al.  Inhibition of allergen‐

induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J  2007; 

30(4):653‐661. 

(62) Buels KS, Jacoby DB, Fryer AD. Non‐bronchodilating mechanisms of tiotropium prevent airway 

hyperreactivity in a guinea pig model of allergic asthma. Br J Pharmacol 2011. 

(63) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y et al. Effect of tiotropium bromide 

on  airway  inflammation  and  remodelling  in  a  mouse  model  of  asthma.  Clin  Exp  Allergy  2010; 

40(8):1266‐1275. 

(64) Damera G, Jiang M, Zhao H, Fogle HW, Jester WF, Freire J et al. Aclidinium bromide abrogates 

allergen‐induced  hyperresponsiveness  and  reduces  eosinophilia  in  murine  model  of  airway 

inflammation. Eur J Pharmacol 2010; 649(1‐3):349‐353. 

Muscarinic receptors in inflammation and remodeling 

 53 

(65) Cao R, Dong XW,  Jiang  JX, Yan XF, He  JS, Deng YM et al. M(3) muscarinic receptor antagonist 

bencycloquidium  bromide  attenuates  allergic  airway  inflammation,  hyperresponsiveness  and 

remodeling in mice. Eur J Pharmacol 2011; 655(1‐3):83‐90. 

(66)  Jeffery PK. Remodeling  in asthma and chronic obstructive  lung disease. Am  J Respir Crit Care 

Med 2001; 164(10 Pt 2):S28‐S38. 

(67) An SS, Bai TR, Bates JH, Black JL, Brown RH, Brusasco V et al. Airway smooth muscle dynamics: a 

common pathway of airway obstruction in asthma. Eur Respir J 2007; 29(5):834‐860. 

(68) Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L et al. The nature of small‐airway 

obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004; 350(26):2645‐2653. 

(69) James AL, Bai TR, Mauad T, Abramson MJ, Dolhnikoff M, McKay KO et al. Airway smooth muscle 

thickness in asthma is related to severity but not duration of asthma. Eur Respir J 2009; 34(5):1040‐

1045. 

(70) Pare PD, Roberts CR, Bai TR, Wiggs BJ. The  functional consequences of airway  remodeling  in 

asthma. Monaldi Arch Chest Dis 1997; 52(6):589‐596. 

(71) Rogers DF. Motor control of airway goblet cells and glands. Respir Physiol 2001; 125(1‐2):129‐

144. 

(72) Ishihara H, Shimura S, Satoh M, Masuda T, Nonaka H, Kase H et al. Muscarinic receptor subtypes 

in feline tracheal submucosal gland secretion. Am J Physiol 1992; 262(2 Pt 1):L223‐L228. 

(73) Ramnarine SI, Haddad EB, Khawaja AM, Mak JC, Rogers DF. On muscarinic control of neurogenic 

mucus secretion in ferret trachea. J Physiol 1996; 494 ( Pt 2):577‐586. 

(74)  Innes  AL, Woodruff  PG,  Ferrando  RE, Donnelly  S, Dolganov GM,  Lazarus  SC  et  al.  Epithelial 

mucin  stores are  increased  in  the  large airways of  smokers with airflow obstruction. Chest 2006; 

130(4):1102‐1108. 

(75) Morcillo EJ, Cortijo J. Mucus and MUC in asthma. Curr Opin Pulm Med 2006; 12(1):1‐6. 

(76)  Rogers  DF.  Airway mucus  hypersecretion  in  asthma:  an  undervalued  pathology?  Curr  Opin 

Pharmacol 2004; 4(3):241‐250. 

(77) Cortijo J, Mata M, Milara J, Donet E, Gavalda A, Miralpeix M et al. Aclidinium inhibits cholinergic 

and tobacco smoke‐induced MUC5AC in human airways. Eur Respir J 2011; 37(2):244‐254. 

(78) Iwase N, Sasaki T, Oshiro T, Tamada T, Nara M, Sasamori K et al. Differential effect of epidermal 

growth  factor  on  serous  and  mucous  cells  in  porcine  airway  submucosal  gland.  Respir  Physiol 

Neurobiol 2002; 132(3):307‐319. 

(79) Arai N, Kondo M, Izumo T, Tamaoki J, Nagai A. Inhibition of neutrophil elastase‐induced goblet 

cell metaplasia by tiotropium in mice. Eur Respir J 2010; 35(5):1164‐1171. 

(80) Grainge CL, Lau LC, Ward JA, Dulay V, Lahiff G, Wilson S et al. Effect of bronchoconstriction on 

airway remodeling in asthma. N Engl J Med 2011; 364(21):2006‐2015. 

(81) Tschumperlin DJ, Dai G, Maly  IV, Kikuchi T, Laiho LH, McVittie AK et al. Mechanotransduction 

through growth‐factor shedding into the extracellular space. Nature 2004; 429(6987):83‐86. 

(82) Metzen J, Bittinger F, Kirkpatrick CJ, Kilbinger H, Wessler I. Proliferative effect of acetylcholine 

on rat trachea epithelial cells is mediated by nicotinic receptors and muscarinic receptors of the M1‐

subtype. Life Sci 2003; 72(18‐19):2075‐2080. 

(83) Kelly EA, Jarjour NN. Role of matrix metalloproteinases  in asthma. Curr Opin Pulm Med 2003; 

9(1):28‐33. 

Chapter 2 

54 

(84) Parks WC, Shapiro SD. Matrix metalloproteinases in lung biology. Respir Res 2001; 2(1):10‐19. 

(85)  Haag  S, Matthiesen  S,  Juergens  UR,  Racke  K. Muscarinic  receptors mediate  stimulation  of 

collagen synthesis in human lung fibroblasts. Eur Respir J 2008; 32(3):555‐562. 

(86) Matthiesen  S,  Bahulayan A, Holz O,  Racke  K. MAPK  pathway mediates muscarinic  receptor‐

induced human lung fibroblast proliferation. Life Sci 2007. 

(87)  Profita M, Bonanno A,  Siena  L, Bruno A,  Ferraro M, Montalbano AM  et  al.  Smoke, Choline‐

Acetyl‐Transferase, Muscarinic Receptors and fibroblast proliferation in COPD. J Pharmacol Exp Ther 

2009. 

(88)  Lagente  V,  Boichot  E.  Role  of  matrix  metalloproteinases  in  the  inflammatory  process  of 

respiratory diseases. J Mol Cell Cardiol 2010; 48(3):440‐444. 

(89) Cataldo D, Munaut C, Noel A, Frankenne F, Bartsch P, Foidart  JM et al. MMP‐2‐ and MMP‐9‐

linked  gelatinolytic  activity  in  the  sputum  from  patients  with  asthma  and  chronic  obstructive 

pulmonary disease. Int Arch Allergy Immunol 2000; 123(3):259‐267. 

(90) Imai K, Dalal SS, Chen ES, Downey R, Schulman LL, Ginsburg M et al. Human collagenase (matrix 

metalloproteinase‐1) expression in the lungs of patients with emphysema. Am J Respir Crit Care Med 

2001; 163(3 Pt 1):786‐791. 

(91) Asano K, Shikama Y, Shibuya Y, Nakajima H, Kanai K, Yamada N et al. Suppressive activity of 

tiotropium  bromide  on matrix metalloproteinase  production  from  lung  fibroblasts  in  vitro.  Int  J 

Chron Obstruct Pulmon Dis 2008; 3(4):781‐789. 

(92) Asano K, Shikama Y, Shoji N, Hirano K, Suzaki H, Nakajima H. Tiotropium bromide inhibits TGF‐

beta‐induced MMP production from lung fibroblasts by interfering with Smad and MAPK pathways 

in vitro. Int J Chron Obstruct Pulmon Dis 2010; 5:277‐286. 

(93) Billington CK, Kong KC, Bhattacharyya R, Wedegaertner PB, Panettieri RA,  Jr., Chan TO et al. 

Cooperative  regulation  of  p70S6  kinase  by  receptor  tyrosine  kinases  and  G  protein‐coupled 

receptors augments airway smooth muscle growth. Biochemistry 2005; 44(44):14595‐14605. 

(94) Gosens R, Dueck G, Rector E, Nunes RO, Gerthoffer WT, Unruh H et al. Cooperative regulation 

of GSK‐3 by muscarinic and PDGF  receptors  is associated with airway myocyte proliferation. Am  J 

Physiol Lung Cell Mol Physiol 2007; 293(5):L1348‐L1358. 

(95) Kong KC, Billington CK, Gandhi U, Panettieri RA, Jr., Penn RB. Cooperative mitogenic signaling by 

G protein‐coupled receptors and growth factors is dependent on G(q/11). FASEB J 2006; 20(9):1558‐

1560. 

(96)  Krymskaya  VP,  Orsini  MJ,  Eszterhas  AJ,  Brodbeck  KC,  Benovic  JL,  Panettieri  RA,  Jr.  et  al. 

Mechanisms of proliferation  synergy by  receptor  tyrosine  kinase  and G protein‐coupled  receptor 

activation in human airway smooth muscle. Am J Respir Cell Mol Biol 2000; 23(4):546‐554. 

(97) Deng H, Dokshin GA,  Lei  J, Goldsmith  AM,  Bitar  KN,  Fingar DC  et  al.  Inhibition  of  glycogen 

synthase  kinase‐3beta  is  sufficient  for  airway  smooth  muscle  hypertrophy.  J  Biol  Chem  2008; 

283(15):10198‐10207. 

(98) Goldsmith AM, Bentley JK, Zhou L, Jia Y, Bitar KN, Fingar DC et al. Transforming growth factor‐

beta induces airway smooth muscle hypertrophy. Am J Respir Cell Mol Biol 2006; 34(2):247‐254. 

(99)  Zhou  L,  Goldsmith  AM,  Bentley  JK,  Jia  Y,  Rodriguez ML,  Abe MK  et  al.  4E‐binding  protein 

phosphorylation and eukaryotic  initiation  factor‐4E release are required  for airway smooth muscle 

hypertrophy. Am J Respir Cell Mol Biol 2005; 33(2):195‐202. 

Muscarinic receptors in inflammation and remodeling 

 55 

(100) Halayko AJ, Tran T, Gosens R. Phenotype and  functional plasticity of airway smooth muscle: 

role of caveolae and caveolins. Proc Am Thorac Soc 2008; 5(1):80‐88. 

(101) Fairbank NJ, Connolly SC, Mackinnon JD, Wehry K, Deng L, Maksym GN. Airway smooth muscle 

cell tone amplifies contractile function in the presence of chronic cyclic strain. Am J Physiol Lung Cell 

Mol Physiol 2008; 295(3):L479‐L488. 

(102) Oenema TA, Smit M, Racke K, Halayko AJ, Meurs H, Gosens R. Muscarinic receptor stimulation 

augments TGF‐B1  induced contractile protein and fibronectin stimulation  in airway smooth muscle 

cells. Am J Respir Crit Care Med 2010; 181:A5314. 

(103)  Gosens  R,  Bos  IS,  Zaagsma  J,  Meurs  H.  Protective  effects  of  tiotropium  bromide  in  the 

progression of airway smooth muscle  remodeling. Am  J Respir Crit Care Med 2005; 171(10):1096‐

1102. 

(104) Anthonisen NR, Connett JE, Kiley JP, Altose MD, Bailey WC, Buist AS et al. Effects of smoking 

intervention and the use of an inhaled anticholinergic bronchodilator on the rate of decline of FEV1. 

The Lung Health Study. JAMA 1994; 272(19):1497‐1505. 

(105)  Van  Den  BA,  Gailly  J,  Neyt  M.  Does  tiotropium  lower  exacerbation  and  hospitalization 

frequency in COPD patients: results of a meta‐analysis. BMC Pulm Med 2010; 10:50. 

(106)  Bhowmik  A,  Seemungal  TA,  Sapsford  RJ,  Wedzicha  JA.  Relation  of  sputum  inflammatory 

markers  to  symptoms and  lung  function  changes  in COPD exacerbations. Thorax 2000; 55(2):114‐

120. 

(107) Powrie DJ, Wilkinson TM, Donaldson GC, Jones P, Scrine K, Viel K et al. Effect of tiotropium on 

sputum and serum inflammatory markers and exacerbations in COPD. Eur Respir J 2007; 30(3):472‐

478. 

(108)  Perng  DW,  Tao  CW,  Su  KC,  Tsai  CC,  Liu  LY,  Lee  YC.  Anti‐inflammatory  effects  of 

salmeterol/fluticasone, tiotropium/fluticasone or tiotropium  in COPD. Eur Respir J 2009; 33(4):778‐

784. 

 

 

 

 

 

 

 

 

 

CHAPTER 3 

MUSCARINIC RECEPTOR SUBTYPE‐SPECIFIC EFFECTS ON 

CIGARETTE SMOKE‐INDUCED INFLAMMATION IN MICE 

   

  Loes E.M. Kistemaker 

I. Sophie T. Bos 

Machteld N. Hylkema 

Martijn C. Nawijn 

Pieter S. Hiemstra 

Jürgen Wess 

Herman Meurs  

Huib A.M. Kerstjens 

Reinoud Gosens 

 

Eur Respir J, 2013, 42(6):1677‐88 

Chapter 3 

58 

Abstract 

Rationale 

Cholinergic tone contributes to airflow obstruction in COPD. Accordingly, anticholinergics 

are effective bronchodilators by blocking  the muscarinic M3  receptor on airway  smooth 

muscle.  Recent  evidence  indicates  that  acetylcholine  also  contributes  to  airway 

inflammation. However, which muscarinic  receptor subtype(s)  regulate(s)  this process  is 

unknown. 

Methods  

Muscarinic receptor subtype deficient mice were exposed to cigarette smoke for four days 

to  investigate  the  contribution  of  the M1, M2  and M3  receptor  subtypes  to  cigarette 

smoke‐induced airway inflammation. 

Results 

In wild‐type mice, cigarette smoke  induced an  increase  in macrophages, neutrophils and 

lymphocytes  in  bronchoalveolar  lavage  fluid.  Neutrophilic  inflammation  was  higher  in 

M1R‐/‐ and M2R

‐/‐ mice compared to wild‐type mice, but lower in M3R‐/‐ mice. Accordingly, 

the  release of KC, MCP‐1  and  IL‐6 was higher  in M1R‐/‐ and M2R

‐/‐ mice  and  reduced  in  

M3R‐/‐ mice. Markers of  remodeling were not  increased after cigarette  smoke exposure. 

However, M3R‐/‐ mice had  reduced expression of TGF‐β1  and matrix proteins. Cigarette 

smoke‐induced inflammatory cell recruitment and KC release were also prevented by the 

M3 receptor selective antagonist 4‐DAMP in wild‐type mice. 

Conclusions 

Our data indicate a pro‐inflammatory role for the M3 receptor in cigarette smoke‐induced 

neutrophilia and cytokine release, yet an anti‐inflammatory role for M1 and M2 receptors. 

Introduction 

Chronic obstructive pulmonary disease  (COPD)  is an  inflammatory disease characterized 

by a progressive airflow limitation that is not fully reversible (1). The most common cause 

of COPD in the Western world is tobacco smoking. Inflammation plays a central role in the 

disease, and contributes to airway fibrosis, mucus hypersecretion and emphysema that is 

observed  in  patients  with  COPD  (1).  Macrophages  and  neutrophils  are  particularly 

increased in patients with COPD and this increase is related to an increased production of 

specific cytokines and chemokines, including interleukin (IL)‐8, IL‐6, IL‐1β, IL‐17, monocyte 

chemotactic protein‐1 (MCP‐1) and tumor necrosis factor‐α (TNF‐α) (2). Moreover, COPD 

is  associated  with  an  increased  production  of  growth  factors,  including  transforming 

growth factor (TGF)‐β and vascular endothelial growth factor (VEGF), which are thought to 

contribute to the remodeling of the airways (3). 

M3 receptors promote smoke‐induced inflammation 

 59 

Acetylcholine is the primary parasympathetic neurotransmitter in the airways that induces 

bronchoconstriction. Parasympathetic activity is increased in patients with COPD, and this 

appears  to  be  the  major  reversible  component  of  airway  obstruction  (4).  Therefore, 

treatment with anticholinergics,  inhibiting muscarinic  receptor activation,  is an effective 

bronchodilator therapy in COPD.  

Five  muscarinic  receptor  subtypes  are  present  in  the  human  genome  (M1‐M5).  The 

muscarinic M1, M2 and M3 receptors are abundantly expressed in the lungs and have been 

extensively  studied  in  the  context  of  vagal  neurotransmission.  Their  primary  roles  are 

bronchoconstriction and mucus secretion, which are mainly regulated via M3 receptors on 

airway  smooth  muscle  and  glands,  respectively.  Further,  the  M1  receptor  facilitates 

neurotransmission  in  the  parasympathetic  ganglia  and  regulates  electrolyte  and water 

secretion by mucus producing  cells. The M2  receptor  is an auto‐inhibitory prejunctional 

receptor on vagal nerves inhibiting acetylcholine release, and an abundant postjunctional 

receptor on airway smooth muscle (chapter 2, 5, 6). 

It is now known that acetylcholine can exert many additional, non‐neuronal effects in the 

airways. Muscarinic receptors are expressed by almost all cell types in the lungs, including 

epithelial  and  inflammatory  cells  (7,  8).  Strikingly,  these  cells  express  all  necessary 

components  to  synthesize and  release acetylcholine by  themselves,  including ChAT,  the 

synthesizing  enzyme  of  acetylcholine.  This  is  referred  to  as  non‐neuronal  acetylcholine 

and may contribute  to airway  inflammation  (8, 8‐10).  Indeed,  in vitro studies revealed a 

variety of effects of acetylcholine on these cell types (10), including an induced release of 

the  potent  neutrophil  chemoattractants  IL‐8  and  leukotriene  B4  (LTB4)  from  airway 

epithelial,  smooth muscle and  inflammatory  cells  (11‐14). Recent evidence  from  in  vivo 

studies  also  demonstrated  a  pro‐inflammatory  role  for  acetylcholine  under 

pathophysiological  conditions.  In  a  cigarette  smoke‐induced  mouse  model  of  COPD, 

tiotropium  partly  prevented  the  increase  in  total  cells  and  neutrophils  in  the 

bronchoalveolar  lavage  fluid  (BALF).  Furthermore,  the  release  of  various  cytokines, 

including  IL‐6, keratinocoyte‐derived chemokine (KC, the mouse orthologue of  IL‐8), LTB4 

and MCP‐1, was inhibited by tiotropium (15). Our group recently demonstrated that LPS‐

induced  neutrophilic  inflammation  could  be  completely  prevented  by  tiotropium  in  a 

guinea  pig model  of  COPD  (16).  Similar  findings  indicating  a  pro‐inflammatory  role  for 

acetylcholine  have  been  observed  in  animal models  of  asthma,  acute  lung  injury  and 

fibrosis (see chapter 2 for review). 

Together,  these  studies  clearly  indicate  a  role  for  acetylcholine  in  inflammation, which 

may  have  implications  for  anticholinergic  therapy  in  patients with  COPD.  Therapy with 

Chapter 3 

60 

anticholinergics  is  presently  focused  on  the M3  receptor,  since  this  receptor  subtype 

mediates bronchoconstriction. Although in vitro studies suggest a role for the M3 receptor 

in  cytokine  release  (11,  17),  no  information  is  available with  respect  to  the muscarinic 

receptor  subtypes  involved  in  the  pro‐inflammatory  effects  of  acetylcholine  in  vivo. 

Therefore, the aim of this study was to investigate the role of the M1, M2 and M3 receptor 

subtypes  in  cigarette  smoke‐induced  airway  inflammation  using  muscarinic  receptor 

subtype‐deficient mice. We hypothesized that the M3 receptor plays a predominant pro‐

inflammatory  role.  In  order  to  study  this,  we  assessed  inflammatory  cell  counts  and 

mediator  release  in  the  lavage  fluid. Furthermore, we analyzed  the expression of genes 

associated with remodeling.  

Methods 

Animals 

Homozygous, inbred, specific‐pathogen‐free breeding colonies of M1R‐/‐, M2R

‐/‐ and M3R‐/‐ 

mice  and  C57Bl/6NTac  wild‐type  (WT)  mice  with  the  same  genetic  background  were 

obtained from Taconic (Cambridge City,  Indiana, USA). The M1R‐/‐, M2R

‐/‐ and M3R‐/‐ mice 

used  were  generated  on  a  129  Sv/J  background  and  backcrossed  for  at  least  10 

generations onto  the C57Bl/6NTac background  (18‐20). Knock‐out animals did not differ 

from WT controls in overall health, fertility and longevity (18‐20), although the weight of 

M3R‐/‐ mice was less compared to WT mice (table S1). Exposure to cigarette smoke (CS) did 

not affect the weight of the mice (table S1). Animals were housed conventionally under a 

12‐h  light‐dark  cycle  and  received  food  and  water  ad  libitum.  All  experiments  were 

performed  in accordance with the national guidelines and approved by the University of 

Groningen Committee for Animal Experimentation.  

Animal model 

Male mice (n=8‐9 per group, 10 – 12 weeks old) were exposed to CS from Kentucky 3R4F 

research  cigarettes  (Tobacco Research  Institute, University of Kentucky,  Lexington, USA) 

on 4 consecutive days by whole body exposure. Each cigarette was smoked without a filter 

in 5 minutes at a rate of 5L/hr in a ratio with 60L/hr air using a peristaltic pump (45 rpm, 

Watson Marlow 323 E/D, Rotterdam, The Netherlands). CS was directly distributed into a 

6‐liter  perspex  box.  On  day  1, mice  were  exposed  to  the mainstream  smoke  of  one 

cigarette in the morning and three cigarettes in the afternoon. On day 2 to 4, mice were 

exposed  to  five  cigarettes  in  the morning  and  five  in  the  afternoon  (figure  1).  Control 

animals were  handled  in  the  same way  but  exposed  to  fresh  air  only.  Because  of  the 

capacity of the experimental set‐up, not all animals used for this study could be included 

in a single experiment. Therefore, experiments were performed on 3 occasions (n=19‐24 

M3 receptors promote smoke‐induced inflammation 

 61 

animals  per  experiment).  Air  and  cigarette  smoke  exposed WT mice were  included  in 

every experiment to minimize variability. Sixteen hours after the last CS exposure, animals 

were  euthanized  by  intraperitoneal  pentobarbital  injection  (400  mg/kg,  hospital 

pharmacy, University Medical Center Groningen), after which the lungs were immediately 

lavaged, resected and snap frozen in liquid nitrogen.  

Muscarinic antagonist administration 

In a sub‐study, the M3 receptor selective antagonist 4‐DAMP  (1mg/kg) was administered 

to WT mice (n=7) by intraperitoneal injection, 30 minutes prior to each CS exposure. The 

same experimental protocol was used as described above.  

Analysis of the bronchoalveolar lavage fluid 

After euthanizing the mice, the lungs were gently lavaged through a tracheal cannula with 

1 ml PBS containing 5% BSA and protease inhibitors (inhibiting chymotrypsin, thermolysin, 

papain, pronase, pancreatic extract and trypsin; F. Hoffman‐La Roche, Basel, Switzerland) 

and another 4 times with 1 ml PBS. Cells were pelleted and the supernatants of the first 

fraction were stored at ‐20◦C for measurement of cytokines and growth factors by ELISA. 

For  each  animal  individually,  BAL  cells  of  the  different  fractions  were  combined, 

resuspended  in  500  µl  PBS,  and  total  cell  numbers  were  determined.  For  cytological 

examination, cytospin‐preparations were stained with May–Grünwald and Giemsa  (both 

Sigma, St. Louis) and a differential cell count was performed by counting at least 400 cells 

in duplicate in a blinded fashion. KC, MCP‐1, IL‐6, IL‐1β, IL‐17, TNF‐α and VEGF release was 

determined in BALF supernatants by a MILLIPLEX assay (Millipore, Billerica, USA). TGF‐β in 

BALF was determined by an ELISA kit  (R&D Systems, Minneapolis, USA) according to the 

manufacturer’s instructions.  

 

Figure  1.  Experimental  procedure.  Male 

C57Bl/6NTac mice  were  exposed  to  cigarette 

smoke  twice  daily  on  4  consecutive  days  by 

whole body  exposure.  Sixteen hours  after  the 

last  smoke exposure a bronchoalveolar  lavage 

is performed and  lungs are harvested  for  lung 

tissue homogenates and cryo‐sections. 

Chapter 3 

62 

ChAT staining 

To  identify ChAT expression, 5‐µm‐thick cryo‐sections  (n=4) were stained with a specific 

rabbit  anti‐ChAT‐antibody  provided  by  Prof.  Kummer  (Institute  for  Anatomy  and  Cell 

Biology, Justus‐Liebig‐University, Giessen, Germany). The antibody was visualized using a 

horseradish  peroxidase‐linked  secondary  antibody  and  diaminobenzidine  (1  mg/ml). 

Airways within each section were digitally photographed. 

Analysis of gene expression in lung tissue 

Total  RNA was  extracted  from  lung  tissue  (right  superior  lobe)  or  BAL  cells  using  the 

RNeasy  mini  kit  (Qiagen,  Venlo,  The  Netherlands)  according  to  the  manufacturer's 

instructions.  Lung  homogenates  were  prepared  by  pulverizing  the  tissue  under  liquid 

nitrogen.  Equal  amounts  of  total mRNA were  then  reverse  transcribed  and  cDNA was 

subjected  to  real‐time qPCR  (Westburg,  Leusden,  The Netherlands). Real  time PCR was 

performed with denaturation at 94°C for 30 seconds, annealing at 59°C for 30 seconds and 

extension at 72°C for 30 seconds for 40 cycles followed by 10 minutes at 72°C. Real‐time 

PCR  data were  analyzed  using  the  comparative  cycle  threshold  (Ct:  amplification  cycle 

number)  method.  The  amount  of  target  gene  was  normalized  to  the  endogenous 

reference  gene  18S  ribosomal  RNA.  Several  other  housekeeping  genes,  including  β2‐

microglobulin and GAPDH, were tested for the influence of the experimental procedure on 

the expression. The expression of all housekeeping genes, including 18S, was stable in the 

tested conditions. The specific forward and reverse primers used are listed in table S2. 

Statistical analysis 

Data  are presented  as mean  ±  s.e. of  the mean.  Statistical differences between means 

were  calculated  using  one‐  or  two‐way  ANOVA,  followed  by  Newman  Keuls  multiple 

comparison tests. Differences were considered significant at p<0.05. 

Results 

Characterization of the mice 

The genotypes of the knock‐out mice were confirmed by PCR analysis of mouse ear DNA 

(figure 2A, table S3). We also examined whether the deletion of one muscarinic receptor 

gene affected the expression levels of the two other muscarinic receptors expressed in the 

lung. As  shown  in  figure 2B, no  such compensatory changes were observed. Muscarinic 

receptors were highly expressed  in  lung tissue homogenates, with M2R>M3R>M1R (figure 

2B). 

M3 receptors promote smoke‐induced inflammation 

 63 

 Figure  2. Characterization  of  the  mice.  A)  SYBR  Safe‐stained  agarose  gel  showing  the  PCR  products  for 

genotyping,  including  the WT, M1R‐/‐, M2R

‐/‐ and M3R

‐/‐ band  for M1R

‐/‐, M2R

‐/‐ and M3R

‐/‐ mice,  respectively. B) 

Gene expression of muscarinic receptors in lung tissue homogenates depicted as Ct values corrected for 18S (n=5 

mice per group), NA: not applicable. Note that data are expressed as Ct values, thus  lower values mean higher 

expression levels and every unit lower on the y‐axis represents a two‐fold increase in expression.

 

The non‐neuronal cholinergic system 

It has been proposed that the non‐neuronal cholinergic system  (NNCS) might contribute 

to airway inflammation (10). To investigate the effect of CS exposure, gene expression of 

different components of the cholinergic system was analyzed in lung tissue homogenates 

of  WT  mice,  including  the  choline  transporters  CHT1  and  CTL1,  the  acetylcholine 

synthesizing  enzyme ChAT,  the  acetylcholine degrading  enzyme AChE  and  the different 

muscarinic receptor subtypes. As depicted in figure 3A, these components were expressed 

in the murine lungs and CS exposure did not affect their expression level.  

Chapter 3 

64 

  

Figure 3. Effect of  cigarette  smoke exposure on  the expression of  the non‐neuronal  cholinergic  system. Mice 

were  treated  as  described  in  figure  1.  Sixteen  hours  after  the  last  smoke  exposure  lung  tissue  and 

bronchoalveolar lavage fluid (BALF) were harvested. Gene expression in lung tissue homogenates (A) and in BAL 

cells (B) was analyzed (n=3‐5 mice per group). Ct values corrected for 18S are depicted, expressed as mean ± s.e. 

of  the mean. Note  that data are expressed as Ct values,  thus  lower values mean higher expression  levels and 

every unit  lower on  the y‐axis  represents a  two‐fold  increase  in expression. High‐affinity choline  transporter‐1 

(CHT1),  choline  transporter  like  protein‐1  (CTL1),  choline  acetyl  transferase  (ChAT),  acetylcholine‐esterase 

(AChE), muscarinic M1 receptor  (M1R), M2 receptor (M2R) and M3 receptor (M3R). (C) Cryo‐sections of WT mice 

exposed to air and smoke stained for ChAT. A representative picture of n=4 animals is shown. Photographs were 

taken at 200x and 400x magnification. Lu: airway lumen, ep: epithelium, asm: airway smooth muscle. 

M3 receptors promote smoke‐induced inflammation 

 65 

Similarly,  the muscarinic  receptor  expression  in  the  BAL  cells  from WT mice  was  not 

altered after CS exposure  figure 3B).  In  lung  tissue, M2  receptors were expressed at  the 

highest  levels  (M2R>M3R>M1R), whereas  in  the  cells  from  the  lavage  fluid M3  receptors 

were  expressed  at  the  highest  levels  (M3R>M1R>M2R;  figure  S1).  ChAT  expression, 

detected by  immunohistochemical staining, was  localized  to  the epithelium and smooth 

muscle  layer of  the airway wall  in WT mice  (figure 3C). Exposure  to CS did not alter  the 

expression or localization of ChAT (figure 3C). 

Cigarette smoke‐induced inflammatory cell recruitment 

To  study  the  contribution  of  muscarinic  receptor  subtypes  to  CS‐induced  airway 

inflammation,  cell  counts were determined  in  the BALF of WT, M1R‐/‐, M2R

‐/‐ and M3R‐/‐ 

mice. All mice exposed  to CS had a 2‐fold  increase  in  the number of  inflammatory cells 

compared to air‐exposed control animals (figure 4A). The predominant cell type after CS 

exposure was the macrophage, which almost doubled in number in all strains (figure 4B). 

Only  small  increases  in  lymphocytic  infiltration were observed after CS exposure, which 

were  comparable  in  all  strains  (figure  4C).  Neutrophilic  infiltration  however,  showed 

significant differences among  the strains  (figure 4D). A 4‐fold  increase  in  the amount of 

neutrophils was  observed  in WT mice  compared  to  air  exposed  animals.  In M1R‐/‐  and   

M2R‐/‐ mice  however,  the  increase  in  neutrophil  number  upon  CS  exposure was much 

higher,  up  to  a  24‐fold  in M1R‐/‐  mice.  In  striking  contrast,  no  significant  increase  in 

neutrophil  numbers  was  observed  in M3R‐/‐ mice  after  CS  exposure  compared  to  air‐

exposed control animals (figure 4D). 

Cigarette smoke‐induced cytokine release 

Subsequently,  inflammatory cytokine  release  in BALF was determined. Levels of KC  (the 

mouse  orthologue  of  IL‐8)  in  BALF  of  WT  mice  exposed  to  CS  were  15‐fold  higher 

compared to air‐exposed animals (figure 5A). No significant differences in MCP‐1 and IL‐6 

release  were  observed  in  CS‐exposed WT mice  (figure  5B  and  C).  In M1R‐/‐ mice,  CS‐

exposed mice  had  higher  levels  of  KC, MCP‐1  and  IL‐6  compared  to  air‐exposed mice. 

Interestingly,  the  concentration  of  all  these  cytokines  was  significantly  higher  when 

compared  to  WT  CS‐exposed  mice.  In  CS‐exposed  M2R‐/‐  mice,  KC  release  was  also 

significantly  higher,  both  compared  to  air‐exposed mice  and  to WT  CS‐exposed mice, 

whereas  MCP‐1  and  IL‐6  release  were  not  significantly  different.  In  M3R‐/‐  mice,  no 

increase in the release of any of these cytokines was observed after CS exposure, and KC 

release was significantly  lower compared to WT CS‐exposed mice  (figure 5). Levels of  IL‐

17, IL‐1β and TNF‐α were below detection limit in all strains (not shown). 

Chapter 3 

66 

 Figure 4. Inflammatory cell counts after cigarette smoke exposure. Mice were treated as described  in figure 1. 

Sixteen  hours  after  the  last  smoke  exposure  a  bronchoalveolar  lavage  was  performed  and  total  cells  (A), 

macrophages  (B),  lymphocytes  (C) and neutrophils  (D) were determined  in  the BALF. Results are expressed as 

mean ± s.e. of the mean. Data were analyzed using two‐way ANOVA; individual comparisons were made using a 

Student‐Newman‐Keuls multiple  comparisons  post‐hoc  test;  *  p<0.05;  ***  p<0.001  compared  to  air  exposed 

control mice, # p<0.05 compared to WT CS‐exposed mice, n=8‐9 mice per group. 

 

M3 receptors promote smoke‐induced inflammation 

 67 

 

Figure  5. Inflammatory  cytokine  release  after  cigarette  smoke  exposure. Mice were  treated  as  described  in 

figure  1.  Sixteen  hours  after  the  last  smoke  exposure  a  bronchoalveolar  lavage was  performed.  Release  of 

keratinocyte‐derived chemokine (KC; A), monocyte chemotactic protein‐1 (MCP‐1; B) and interleukin‐6 (IL‐6; C) in 

BALF was  determined.  Results  are  expressed  as mean  ±  s.e.  of  the mean.  N.d.:  not  detectable.  Data were 

analyzed  using  two‐way ANOVA;  individual  comparisons were made  using  a  Student‐Newman‐Keuls multiple 

comparisons post‐hoc test; * p<0.05; *** p<0.001 compared to air exposed control mice, # p<0.05; ### p<0.001 

compared to WT CS‐exposed mice, n=8‐9 mice per group.  

Cigarette smoke‐induced growth factor and extracellular matrix expression 

We next determined the release of the growth factors TGF‐β1 and VEGF in the BALF. Small 

increases  in TGF‐β1 protein release were observed  in all strains after CS‐exposure  (1.4 – 

2.0‐fold), which was significant in WT mice (figure 6A). Remarkably, there was significantly 

less  TGF‐β1  in  the BALF of M3R‐/‐ mice  compared  to WT mice,  irrespective of  air or CS 

exposure  (56%  and 46%  lower,  respectively). VEGF  release was not  altered  (figure 6A). 

Expression of TGF‐β1 at  the mRNA  level  in  lung  tissue of M3R‐/‐ mice was  reduced  to a 

similar extent compared to protein  levels (figure 6B). At the transcriptional  level, TGF‐β1 

expression was significantly  increased by 1.4 fold  in M1R‐/‐ mice and by 1.7 fold  in M2R

‐/‐ 

mice after CS exposure (figure 6B).  

In  addition, we  analyzed  the  gene  expression  of  the matrix  proteins  collagen  Iα1  and 

fibronectin in lung tissue. No increased expression after CS exposure was observed (figure 

6C),  with  the  exception  of  collagen  Iα1  in M2R‐/‐ mice,  which  was  increased  after  CS 

exposure. Furthermore, expression  levels of collagen  Iα1 and  fibronectin were higher  in 

CS‐exposed M2R‐/‐ mice  compared  to CS‐exposed WT mice.  In  line with  the  findings on 

TGF‐β1, both matrix proteins were expressed at a significantly  lower  level  in M3R‐/‐ mice 

compared to WT mice, irrespective of air or CS exposure (68 and 65% lower, respectively). This was confirmed at  the protein  level  for  fibronectin, which was 38.6 ± 8.9%  lower  in 

M3R‐/‐ mice  than  in WT mice  (p<0.05).  Finally, CS exposure had no  significant effect on 

MUC5AC gene expression in any of the analyzed strains (figure 6D). 

Chapter 3 

68 

 

Figure 6. Parameters of remodeling after cigarette smoke exposure. Mice were treated as described in figure 1. 

Sixteen hours after the last smoke exposure a bronchoalveolar lavage was performed and lungs were collected. 

Release  of  transforming  growth  factor  (TGF)‐β1  and  vascular  endothelial  growth  factor  (VEGF)  in  BALF was 

determined (A). In lung tissue homogenates, gene expression of TGF‐β1 (B), collagen Iα1 and fibronectin (C) and 

MUC5AC (D) was determined. Results are expressed as mean ± s.e. of the mean. Data were analyzed using two‐

way ANOVA;  individual comparisons were made using a Student‐Newman‐Keuls multiple comparisons post‐hoc 

test;  *  p<0.05;  ***  p<0.001  compared  to  air  exposed  control mice,  #  p<0.05;  ###  p<0.001  compared  to WT 

control mice, n=8‐9 mice per group. Statistics were performed on log‐transformed data. 

 

Inhibition of CS‐induced inflammation by an M3 antagonist 

To investigate whether the pro‐inflammatory role of the M3 receptor can also be observed 

using  a  pharmacological  intervention, WT mice were  pretreated with  the M3  receptor 

selective antagonist 4‐DAMP 30 minutes prior  to every CS exposure. This  resulted  in an 

inhibition of inflammatory cell number in the BALF by 30% compared to untreated animals 

(figure  7A).  Similar  inhibitory  effects  of  pretreatment with  4‐DAMP were  observed  on 

macrophage accumulation  (figure 7B), whereas CS‐induced  lymphocytic and neutrophilic 

inflammation were completely prevented (figures 7C and D). This was accompanied by the 

absence of CS‐induced KC release after pretreatment with 4‐DAMP (figure 7E). 

M3 receptors promote smoke‐induced inflammation 

 69 

  

Figure  7. Cigarette  smoke‐induced  inflammation  after  pretreatment  with  4‐DAMP.  The  same  experimental 

model was used as described  in  figure 1; however prior  to each  smoke exposure mice were  treated with  the 

selective M3  antagonist  4‐DAMP.  Sixteen  hours  after  the  last  smoke  exposure  a  bronchoalveolar  lavage was 

performed  and  total  cells  (A),  macrophages  (B),  lymphocytes  (C),  neutrophils  (D)  and  KC  release  (E)  were 

determined  in the BALF. Results are expressed as mean ± s.e. of the mean. Data were analyzed using one‐way 

ANOVA; individual comparisons were made using a Student‐Newman‐Keuls multiple comparisons post‐hoc test; 

* p<0.05; *** p<0.001 compared to air exposed control mice, # p<0.05 compared to CS‐exposed mice, n=7‐13 

mice per group. 

 

Discussion 

In  this  study we  demonstrate  that  the muscarinic M3  receptor  plays  a  profound  pro‐

inflammatory  role  in  CS‐induced  inflammation  and  that  this  is  the  primary muscarinic 

receptor subtype  involved  in  the pro‐inflammatory effects of acetylcholine.  Inhibition of 

the M3  receptor, by  total  knock‐out of  the  receptor or by a pharmacological approach, 

prevented  neutrophilic  inflammation  and  cytokine  release  in  the  lavage  fluid  of  CS‐

exposed mice.  In  striking  contrast,  knock‐out  of  the M1  and M2  receptors  resulted  in 

increased neutrophils and  cytokine  release  in  the BALF,  indicating an anti‐inflammatory 

role  of  these  receptor  subtypes  in  CS‐induced  inflammation.  This  study  is  the  first  to 

demonstrate  the differential  regulation of  inflammation by muscarinic  receptors  in  vivo 

and implies an anti‐inflammatory role for M3 selective anticholinergics. 

Chapter 3 

70 

Neutrophils are  considered as one of  the major  cell  types  involved  in COPD  (2).Various 

studies  suggest  an  important  role  for  acetylcholine  in  regulating  neutrophilic 

inflammation. Activation of muscarinic  receptors  can  contribute  to neutrophil  influx by 

inducing  neutrophil  chemotactic  activity  from macrophages  (21,  22)  and  LTB4  release 

from sputum cells of COPD patients (14). Furthermore, IL‐8 is released from epithelial and 

airway smooth muscle cells in response to muscarinic receptor stimulation (11, 13). These 

findings are supported by  in vivo studies  in which CS‐ and LPS‐induced neutrophilia was 

inhibited by the muscarinic receptor antagonist tiotropium (15, 16).  

The regulatory effects of muscarinic receptors appeared to be specific  for neutrophils  in 

the muscarinic receptor deficient mice, whereas macrophages and lymphocytes were not 

altered. Our results on neutrophilic  inflammation are  in  line with various  in vitro studies 

demonstrating  that  the  pro‐inflammatory  effects  of muscarinic  receptor  activation  are 

mainly dependent on the M3 receptor subtype. Thus, it has been shown that 4‐DAMP and 

DAU5884, M3 receptor selective antagonists,  inhibited methacholine and CS‐induced  IL‐8 

release from airway smooth muscle cells (11). In addition, alveolar macrophage mediated 

migration of neutrophils  from COPD patients was  inhibited by 4‐DAMP  (17). Moreover, 

the M3 receptor was the primary receptor subtype expressed by inflammatory cells within 

the  BALF  as  shown  in  our  study.  It  is  also  known  that  inflammatory  cells  express M3 

receptors  and  that  this  receptor mediates  pro‐inflammatory  effects  (7). We  therefore 

believe  that  the  pro‐inflammatory  effect  of  the M3  receptor  as  found  in  our  study  is 

dependent on regulation of cytokine release by structural cells, in combination with direct 

activation of M3 receptors on inflammatory cells. 

In contrast to the findings in M3R‐/‐ mice, neutrophilic inflammation was increased in M2R

‐/‐ 

mice  compared  to WT  mice.  The M2  receptor  is  located  prejunctionally  on  pre‐  and 

postganglionic nerves and acts as an inhibitory autoreceptor limiting acetylcholine release 

(5). Furthermore,  the M2  receptor  is expressed postjunctionally by  smooth muscle  cells 

and fibroblasts (chapter 2, 23). With acetylcholine acting as a pro‐inflammatory mediator 

inducing chemokine  release  from  structural and  inflammatory cells via  the M3  receptor, 

increased  levels of acetylcholine  in the M2R‐/‐ mice, due to  loss of  its autoinhibitory role, 

may therefore explain the observed aggravated neutrophilia. In support of such a role, M2 

receptor  expression  appeared  low  on  inflammatory  cells  in  the  BALF,  but  high  in  lung 

tissue, suggesting that the effects of M2 receptor deficiency are not due to direct effects 

on  inflammatory  cells.  The  literature  supports  this  notion,  indicating  that  the  pro‐

inflammatory effects of acetylcholine  in macrophages, epithelial cells and airway smooth 

muscle cells are not mediated by M2 receptors (11, 22, 24). 

M3 receptors promote smoke‐induced inflammation 

 71 

A role for M2 receptors as prejunctional autoreceptors driving exaggerated acetylcholine 

release and inflammation has significant implications. Acetylcholine has long been known 

as a classical neurotransmitter. More  recent  findings suggest  that acetylcholine can also 

be  released  from  non‐neuronal  origins,  including  epithelial,  airway  smooth muscle  and 

inflammatory  cells  (8,  9).  It  is  not  yet  known  to  which  extent  this  non‐neuronal 

acetylcholine affects airway inflammation (10). The release of non‐neuronal acetylcholine 

is not known to be affected by M2 receptors in an auto‐inhibitory way. Our data therefore 

imply an  important  role  for neuronal acetylcholine  in CS‐induced  inflammation. Further, 

we did not find any upregulation of expression of components of the NNCS in the lungs of 

CS‐exposed mice, in contrast to the previously reported increase in cultured human airway 

epithelial  cells  after  exposure  to  CS  extract  (12).  Future  studies  investigating  the 

contribution  of  neuronal  and  non‐neuronal  acetylcholine  to  inflammation  are  clearly 

warranted. 

Surprisingly, neutrophilic inflammation was also enhanced in M1R‐/‐ mice. It is well known 

that M1  receptors  facilitate neurotransmission  in  the parasympathetic ganglia  (5). Based 

on  this  however,  one  would  expect  that  M1  receptor  deficiency  causes  reduced 

acetylcholine release leading to inhibition of inflammation. Reinheimer et al. reported that 

the M1  receptor  selective antagonist pirenzepine can antagonize  the  inhibitory effect of 

acetylcholine on histamine release from human mast cells (25). Lack of this inhibitory M1 

receptor might explain the increased neutrophil chemotaxis, since mast cell numbers are 

increased upon smoking and higher  in patients with COPD  (26, 27). Alternatively, as the 

M1  receptor also controls electrolyte and water secretion by airway epithelial cells  (28), 

lack of M1 receptor expression may result in a reduced ability of M1R‐/‐ mice to clear their 

lungs of smoke particles after CS exposure, leading to aggravated inflammatory and injury 

responses.  The  sharp  induction  of  the  damage  response‐associated  cytokines  IL‐6  and 

MCP‐1 in M1R‐/‐ mice, which is absent in WT mice, supports this hypothesis. 

The results of this study on transgenic mice suggest a primary role for the M3 receptor in 

regulating  CS‐induced  inflammation,  implying  that  M3  receptor  subtype  selectivity  of 

anticholinergics would be beneficial.  Indeed, we show that pharmacological  inhibition of 

the M3  receptor  using  4‐DAMP  partly  prevented  accumulation  of  inflammatory  cells  in 

BALF, accompanied by a strong  inhibition of CS‐induced KC  release. 4‐DAMP  is selective 

for M3 receptors over M2 (~16‐fold) (6) and to a lesser extent M1 receptors (~3‐fold) (29). 

Interestingly,  the  anti‐inflammatory  effects  of  pharmacological  inhibition  of  the  M3 

receptor  are  more  pronounced  than  effects  of  knock‐out  of  this  receptor.  Similar 

discrepant data are reported on muscarinic receptor mediated contraction ex vivo, which 

can be fully  inhibited with a M3 receptor selective antagonist  in wild‐type mice, whereas 

Chapter 3 

72 

only partial inhibition of contraction is observed in M3R knock‐out mice (30, 31). Although 

the mechanism  behind  this  discrepancy  is  unclear  it  thus  appears  that  compensating 

mechanisms are operative in the knock‐out mice that limit the impact of the M3 receptor 

deficiency. 

Although tiotropium is known to be kinetically selective for the M3 receptor (dissociation 

half‐life = 27h), it still has a dissociation half‐life from the M1 receptor of 10.5 hours (32). 

Steady‐state binding affinity of tiotropium for the M1, M2 and M3 receptors is not different 

(33).  The  half‐life  ratio  of  ipratropium  and  of  aclidinium  and  glycopyrrolate,  two 

anticholinergics  under  development,  for  the M3  versus M1  receptor  is  comparable  to 

tiotropium  (32).  Our  study  suggests  that  an  even  more  selective  compound  solely 

inhibiting M3  receptors  is  desirable  and may  lead  to  improved  effects  on  CS‐induced 

inflammation.  

Interestingly,  in our  study basal expression of TGF‐β1,  collagen  Iα1 and  fibronectin was 

significantly lower in M3R‐/‐ mice compared to WT mice. In M2R

‐/‐ mice, expression of these 

components  was  increased  after  CS  exposure.  This  suggests  that  in  addition  to 

inflammation,  acetylcholine  regulates  important  aspects  of  lung  structure  via  the  M3 

receptor.  Indeed, M3 receptors are expressed by structural cells  in the airways,  including 

epithelial  cells  and  airway  smooth  muscle  cells  (23). Moreover,  in  vitro  studies  have 

demonstrated  a  role  for  the M3  receptor  in  the  regulation  of  airway  smooth muscle 

proliferation (34) and in vivo studies have shown a protective effect of anticholinergics on 

matrix protein deposition  (16, 35). The exact  roles of  the  individual muscarinic  receptor 

subtypes in this process are not yet clear and remain to be elucidated (chapter 2). 

Evidence for the pro‐inflammatory role of acetylcholine from in vitro and in vivo studies is 

increasing  (chapter 2). However, the translational utility of these observations  is not yet 

clear, since in patients with COPD, effects on inflammation or on the rate of decline in lung 

function after anticholinergic therapy have not been demonstrated. It  is known from the 

UPLIFT  (Understanding Potential Long‐Term  Impacts on Function with Tiotropium) study 

that the use of tiotropium is associated with a reduction in the number of exacerbations, 

generally  seen  as  inflammatory  events  (36).  Patients  who  have  more  exacerbations 

demonstrate  increased  levels  of  inflammatory markers  at  stable  state  (37,  38).  In  two 

recent  studies  however,  no direct  evidence  for  an  anti‐inflammatory  effect was  found, 

since  IL‐6 and  IL‐8  levels  in the sputum of patients with COPD were not decreased after 

anticholinergic  therapy  (39,  40).  However,  both  studies  have  substantial  limitations  as 

discussed by the authors. In the study of Perng et al., the treatment group was small and 

patients were only treated with tiotropium for 12 weeks (40). In the study of Powrie et al., 

M3 receptors promote smoke‐induced inflammation 

 73 

the  amount  of  sputum  was  reduced  after  tiotropium  treatment,  which  might  have 

resulted in increased cytokine concentrations (39). Future studies using different methods 

to  assess  inflammation  could  therefore  resolve  the  question  whether  anticholinergics 

indeed have anti‐inflammatory properties  in patients with COPD. At present, there  is no 

evidence for such a role. 

In  conclusion,  the  results  of  our  study  demonstrate  that  inhibition  of  the M3  receptor 

prevents  inflammation  in  response  to CS‐exposure  in mice. This confirms  the previously 

established  pro‐inflammatory  role  of  acetylcholine  in  the  pathophysiology  of  airway 

diseases, and demonstrates that this is solely mediated via M3 receptors, since knock‐out 

of  the M1  and M2  receptor aggravated  inflammation  compared  to WT mice. This  study 

therefore opens new perspectives on M3 receptor selective anticholinergics to specifically 

target airway inflammation. 

 

Acknowledgements 

The authors would  like  to  thank  the Netherlands  Lung Foundation  for  financial  support 

(grant: 3.2.08.014). 

   

Chapter 3 

74 

Supplement 

Table S1. Average weight of WT, M1R‐/‐, M2R

‐/‐ and M3R

‐/‐ mice before and after one week of air or CS exposure. 

 

  Air exposed    Smoke exposed 

Before  After  Before  After 

WT mice  27.5 (±0.62)  27.3 (±0.73)  26.0 (±0.53)  25.7 (±0.67) 

M1R‐/‐ mice  26.3 (±0.55)  26.0 (±0.54)  22.7 (±0.85)  22.6 (±0.93) 

M2R‐/‐ mice  25.8 (±0.56)  25.4 (±0.47)  27.6 (±0.38)  27.3 (±0.29) 

M3R‐/‐ mice  22.8 (±0.53)  23.7 (±0.71)  20.3 (±0.58)  21.0 (±0.41) 

 

 

Table S2. Primers used for qRT‐PCR analysis. CHT1: high‐affinity choline transporter 1; CTL: choline transporter‐

like protein 1; ChAT: choline acetyltransferase; AChE: acetylcholinesterase  

Gene  Primer sequence  NCBI accession 

number 

Muscarinic M1 receptor  Forward – AGAAGAGGCTGCCACAGGTA 

Reverse  – CAGACCCCACCTGGACTTTA 

NM_001112697 

Muscarinic M2 receptor  Forward – GAATGGGGATGAAAAGCAGA 

Reverse  – GCAGGGTTGATGGTGCTATT 

NM_203491  

Muscarinic M3 receptor  Forward – CACAGCCAAGACCTCTGACA 

Reverse  – ATGATGTTGTAGGGGGTCCA 

NM_033269 

CHT1  Forward – GGTTGGAGGAGGCTACATCA 

Reverse  – TATCCCTTGGAACGCATAGG 

AJ401467 

 

CTL1  Forward – GGCAGTGCTGTTCAGAATGA 

Reverse  – ATCTGCTGACAGGCGAGAAT 

NM_133891 

 

ChAT  Forward – GGCTGCAAAGAGACCTCATC 

Reverse  – GCTCTTTCCTTTGCTGTTGG 

NM_009891 

AChE  Forward – CCTGGGTTTGAGGGTACTGA 

Reverse  – GGTTCCCACTCGGTAGTTCA 

NM_009599 

Fibronectin  Forward – ACCACCCAGAACTACGATGC 

Reverse  – GGAACGTGTCGTTCACATTG 

NM_010233 

Collagen Iα1  Forward – CACCCTCAAGAGCCTGAGTC 

Reverse  – GTTCGGGCTGATGTACCAGT 

NM_007742 

MUC5AC  Forward – GAGATGGAGGATCTGGGTCA 

Reverse  – GCAGAAGCAGGGAGTGGTAG 

NM_010844 

18S  Forward – AAACGGCTACCACATCCAAG 

Reverse  – CCTCCAATGGATCCTCGTTA 

NR_003278 

  

M3 receptors promote smoke‐induced inflammation 

 75 

Table S3. Primers used for genotyping.  

Gene  Primer sequence 

M1‐S1  5'‐CCAACATCACCGTCTTGGCAC‐3' 

M1‐A1  5'‐AGTGCCAATGATGAGATCAGC‐3' 

M2‐A6  5'‐GCTATTACCAGTCCTTACAAGACA‐3' 

M2‐B5  5'‐CCAGAGGATGAAGGAAAGAACC‐3' 

M3‐A3  5'‐AAGACCACAGTAGCAGTG‐3' 

M3‐B  5'‐CTCTCTACATCCATAGTCCC‐3' 

NEO‐1  5'‐CAGCTCATTCCTCCCACTCATGAT‐3' 

M3‐NEO9  5'‐TGGATGTGGAATGTGTGCGAGG‐3' 

 Figure S1. Muscarinic receptor expression in lung tissue and BAL cells. Mice were treated as described in figure 

1.  Sixteen  hours  after  the  last  smoke  exposure  lung  tissue  and  bronchoalveolar  lavage  fluid  (BALF)  were 

harvested. Gene expression  in  lung  tissue homogenates  (light grey bars) and  in BAL cells  (dark grey bars) was 

analyzed (n=3‐5 mice per group). Ct values corrected for 18S are depicted, expressed as mean ± s.e. of the mean. 

Note that  low Ct values mean high expression  levels. Muscarinic M1 receptor (M1R), M2 receptor (M2R) and M3 

receptor (M3R). Data were analyzed using two‐way ANOVA; individual comparisons were made using a Student‐

Newman‐Keuls multiple comparisons post‐hoc test; *** p<0.001 (adjusted p‐value). Statistics were performed on 

log‐transformed data. 

Chapter 3 

76 

References 

(1) Barnes PJ. Chronic obstructive pulmonary disease. N Engl J Med 2000;343:269‐280.  

(2) Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol 

2008;8:183‐192.  

(3)  Postma  DS,  Timens  W.  Remodeling  in  asthma  and  chronic  obstructive  pulmonary  disease. 

Proc.Am.Thorac.Soc. 2006;3:434‐439.  

(4)  Gross  NJ,  Skorodin  MS.  Role  of  the  parasympathetic  system  in  airway  obstruction  due  to 

emphysema. N Engl J Med 1984;311:421‐425.  

(5) Lee AM, Jacoby DB, Fryer AD. Selective muscarinic receptor antagonists for airway diseases. Curr 

Opin Pharmacol 2001;1:223‐229.  

(6) Roffel AF, Elzinga CR, Van Amsterdam RG, De Zeeuw RA, Zaagsma J. Muscarinic M2 receptors in 

bovine  tracheal  smooth  muscle:  discrepancies  between  binding  and  function.  Eur  J  Pharmacol 

1988;153:73‐82.  

(7) Gosens R, Zaagsma J, Meurs H, Halayko AJ. Muscarinic receptor signaling in the pathophysiology 

of asthma and COPD. Respir.Res. 2006;7:73.  

(8) Wessler I, Kirkpatrick CJ. Acetylcholine beyond neurons: the non‐neuronal cholinergic system in 

humans. Br J Pharmacol 2008;154:1558‐1571.  

(9) Kummer W, Lips KS, Pfeil U. The epithelial cholinergic system of the airways. Histochem Cell Biol 

2008;130:219‐234.  

(10)  Gwilt  CR,  Donnelly  LE,  Rogers  DF.  The  non‐neuronal  cholinergic  system  in  the  airways:  an 

unappreciated regulatory role in pulmonary inflammation? Pharmacol Ther 2007;115:208‐222.  

(11) Gosens R, Rieks D, Meurs H, Ninaber DK, Rabe KF, Nanninga J, Kolahian S, Halayko AJ, Hiemstra 

PS,  Zuyderduyn  S.  Muscarinic  M3  receptor  stimulation  increases  cigarette  smoke‐induced  IL‐8 

secretion by human airway smooth muscle cells. Eur Respir J 2009;34:1436‐1443.  

(12) Profita M, Bonanno A, Montalbano AM,  Ferraro M,  Siena  L, Bruno A, Girbino  S, Albano GD, 

Casarosa P, Pieper MP, Gjomarkaj M. Cigarette smoke extract activates human bronchial epithelial 

cells affecting non‐neuronal cholinergic system signalling in vitro. Life Sci 2011;89:36‐43.  

(13) Profita M, Bonanno A, Siena L, Ferraro M, Montalbano AM, Pompeo F, Riccobono L, Pieper MP, 

Gjomarkaj M. Acetylcholine mediates  the  release  of  IL‐8  in human  bronchial  epithelial  cells  by  a 

NFkB/ERK‐dependent mechanism. Eur J Pharmacol 2008;582:145‐153.  

(14) Profita M, Giorgi RD, Sala A, Bonanno A, Riccobono L, Mirabella F, Gjomarkaj M, Bonsignore G, 

Bousquet  J,  Vignola  AM.  Muscarinic  receptors,  leukotriene  B4  production  and  neutrophilic 

inflammation in COPD patients. Allergy 2005;60:1361‐1369.  

(15) Wollin L, Pieper MP. Tiotropium bromide exerts anti‐inflammatory activity in a cigarette smoke 

mouse model of COPD. Pulm Pharmacol Ther 2010;23:345‐354.  

(16) Pera T, Zuidhof A, Valadas J, Smit M, Schoemaker RG, Gosens R, Maarsingh H, Zaagsma J, Meurs 

H. Tiotropium inhibits pulmonary inflammation and remodelling in a guinea pig model of COPD. Eur 

Respir J 2011;38:789‐796.  

(17) Vacca G, Randerath WJ, Gillissen A. Inhibition of granulocyte migration by tiotropium bromide. 

Respir Res 2011;12:24.  

M3 receptors promote smoke‐induced inflammation 

 77 

(18) Fisahn A, Yamada M, Duttaroy A, Gan JW, Deng CX, McBain CJ, Wess J. Muscarinic induction of 

hippocampal gamma oscillations requires coupling of the M1 receptor to two mixed cation currents. 

Neuron 2002;33:615‐624.  

(19) Gomeza  J, Shannon H, Kostenis E, Felder C, Zhang L, Brodkin  J, Grinberg A, Sheng H, Wess  J. 

Pronounced  pharmacologic  deficits  in M2 muscarinic  acetylcholine  receptor  knockout mice.  Proc 

Natl Acad Sci U S A 1999;96:1692‐1697.  

(20) Yamada M, Miyakawa T, Duttaroy A, Yamanaka A, Moriguchi T, Makita R, Ogawa M, Chou CJ, 

Xia B, Crawley JN, Felder CC, Deng CX, Wess J. Mice lacking the M3 muscarinic acetylcholine receptor 

are hypophagic and lean. Nature 2001;410:207‐212.  

(21) Buhling F, Lieder N, Kuhlmann UC, Waldburg N, Welte T. Tiotropium suppresses acetylcholine‐

induced release of chemotactic mediators in vitro. Respir Med 2007;101:2386‐2394.  

(22) Sato E, Koyama S, Okubo Y, Kubo K, Sekiguchi M. Acetylcholine stimulates alveolar macrophages 

to release inflammatory cell chemotactic activity. Am J Physiol 1998;274:L970‐L979.  

(23) Meurs H, Dekkers BG, Maarsingh H, Halayko AJ, Zaagsma J, Gosens R. Muscarinic receptors on 

airway mesenchymal cells: novel findings for an ancient target. Pulm Pharmacol Ther 2013;26:145‐

155.  

(24) Koyama S, Rennard SI, Robbins RA. Acetylcholine stimulates bronchial epithelial cells to release 

neutrophil and monocyte chemotactic activity. Am J Physiol 1992;262:L466‐L471.  

(25) Reinheimer T, Mohlig T, Zimmermann S, Hohle KD, Wessler  I. Muscarinic control of histamine 

release  from airways.  Inhibitory M1‐receptors  in human bronchi but absence  in  rat  trachea. Am  J 

Respir Crit Care Med 2000;162:534‐538.  

(26)  Lamb  D,  Lumsden  A.  Intra‐epithelial  mast  cells  in  human  airway  epithelium:  evidence  for 

smoking‐induced changes in their frequency. Thorax 1982;37:334‐342.  

(27)  Jeffery PK. Structural and  inflammatory changes  in COPD: a comparison with asthma. Thorax 

1998;53:129‐136.  

(28)  Ishihara H, Shimura S, Satoh M, Masuda T, Nonaka H, Kase H, Sasaki T, Sasaki H, Takishima T, 

Tamura K. Muscarinic receptor subtypes in feline tracheal submucosal gland secretion. Am J Physiol 

1992;262:L223‐8.  

(29) Boddeke HW, Buttini M. Pharmacological properties of cloned muscarinic receptors expressed 

in A9 L cells; comparison with in vitro models. Eur J Pharmacol 1991;202:151‐157.  

(30)  Schlenz  H,  Kummer  W,  Jositsch  G,  Wess  J,  Krasteva  G.  Muscarinic  receptor‐mediated 

bronchoconstriction  is coupled  to caveolae  in murine airways. Am  J Physiol Lung Cell Mol Physiol 

2010;298:L626‐36.  

(31) Garssen J, Van Loveren H, Gierveld CM, Van der Vliet H, Nijkamp FP. Functional characterization 

of muscarinic receptors in murine airways. Br J Pharmacol 1993;109:53‐60.  

(32) Casarosa P, Bouyssou T, Germeyer S, Schnapp A, Gantner F, Pieper M. Preclinical evaluation of 

long‐acting muscarinic antagonists: comparison of tiotropium and investigational drugs. J Pharmacol 

Exp Ther 2009;330:660‐668.  

(33) Barnes PJ. The pharmacological properties of tiotropium. Chest 2000;117:63S‐6S.  

(34) Gosens R, Nelemans SA, Grootte Bromhaar MM, McKay S, Zaagsma J, Meurs H. Muscarinic M3‐

receptors mediate cholinergic synergism of mitogenesis  in airway smooth muscle. Am J Respir Cell 

Mol Biol 2003;28:257‐262.  

Chapter 3 

78 

(35)  Bos  IS,  Gosens  R,  Zuidhof  AB,  Schaafsma  D,  Halayko  AJ, Meurs  H,  Zaagsma  J.  Inhibition  of 

allergen‐induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J 

2007;30:653‐661.  

(36)  Tashkin  DP,  Celli  B,  Senn  S,  Burkhart  D,  Kesten  S, Menjoge  S,  Decramer M,  UPLIFT  Study 

Investigators. A 4‐year  trial of  tiotropium  in  chronic obstructive pulmonary disease. N Engl  J Med 

2008;359:1543‐1554.  

(37)  Liesker  JJ, Bathoorn  E, Postma DS, Vonk  JM,  Timens W, Kerstjens HA.  Sputum  inflammation 

predicts  exacerbations  after  cessation  of  inhaled  corticosteroids  in  COPD.  Respir  Med 

2011;105:1853‐1860.  

(38) Bhowmik A, Seemungal TA, Sapsford RJ, Wedzicha JA. Relation of sputum inflammatory markers 

to symptoms and lung function changes in COPD exacerbations. Thorax 2000;55:114‐120.  

(39) Powrie DJ, Wilkinson TM, Donaldson GC, Jones P, Scrine K, Viel K, Kesten S, Wedzicha JA. Effect 

of tiotropium on sputum and serum inflammatory markers and exacerbations in COPD. Eur Respir J 

2007;30:472‐478.  

(40)  Perng  DW,  Tao  CW,  Su  KC,  Tsai  CC,  Liu  LY,  Lee  YC.  Anti‐inflammatory  effects  of 

salmeterol/fluticasone, tiotropium/fluticasone or tiotropium in COPD. Eur Respir J 2009;33:778‐784.  

 

 

 

 

 

 

 

 

 

 

 

CHAPTER 4 

MUSCARINIC M3 RECEPTORS ON STRUCTURAL CELLS  

REGULATE CIGARETTE SMOKE‐INDUCED NEUTROPHILIC  

AIRWAY INFLAMMATION IN MICE 

 

Loes E.M. Kistemaker 

Ronald P. van Os 

Albertina Dethmers‐Ausema 

I. Sophie T. Bos 

Machteld N. Hylkema 

Maarten van den Berge 

Pieter S. Hiemstra 

Jürgen Wess 

Herman Meurs  

Huib A.M. Kerstjens 

Reinoud Gosens 

 

Am J Physiol Lung Cell Mol Physiol, 2015, 308(1):L96‐L103

Chapter 4 

82 

Abstract 

Rationale 

Anticholinergics,  blocking  the muscarinic M3  receptor,  are  effective  bronchodilators  for 

patients with COPD. Recent evidence  from M3  receptor deficient mice  (M3R‐/‐)  indicates 

that M3 receptors also regulate neutrophilic inflammation in response to cigarette smoke 

(CS). M3 receptors are present on almost all cell  types and  in  this study we  investigated 

the relative contribution of M3 receptors on structural cells versus  inflammatory cells  to 

CS‐induced inflammation using bone‐marrow chimeric mice. Methods  

Bone‐marrow chimeras  (C56Bl/6 mice) were generated and engraftment was confirmed 

after 10 weeks. Thereafter, irradiated and non‐irradiated control animals were exposed to 

CS or fresh air for four consecutive days. 

Results 

CS  induced a significant  increase  in neutrophil numbers  in non‐irradiated and  irradiated 

control animals (4‐35 fold). Interestingly, wild‐type animals receiving M3R‐/‐ bone marrow 

showed a similar  increase  in neutrophil number  (15‐fold).  In contrast, no  increase  in the 

number of neutrophils was observed  in M3R‐/‐ animals receiving wild‐type bone marrow. 

The  increase  in KC  levels was  similar  in all  smoke‐exposed groups  (2.5‐5.0  fold). Micro‐

array  analysis  revealed  that  fibrinogen  α  and  CD177,  both  involved  in  neutrophil 

migration, were  downregulated  in  CS‐exposed M3R‐/‐  animals  receiving wild‐type  bone 

marrow  compared  to  CS‐exposed wild‐type  animals, which was  confirmed  by  RT‐qPCR 

(1.6‐2.5 fold). 

Conclusions 

These findings  indicate that the M3 receptor on structural cells plays a pro‐inflammatory 

role  in CS‐induced neutrophilic  inflammation, whereas the M3 receptor on  inflammatory 

cells does not. This effect is probably not mediated via KC release, but may involve altered 

adhesion and transmigration of neutrophils via fibrinogen α and CD177. 

Introduction 

Acetylcholine  is the primary parasympathetic neurotransmitter  in the airways.  It  induces 

bronchoconstriction and mucus secretion via M3 receptors (chapter 2). Cholinergic tone is 

increased in patients with chronic obstructive pulmonary diseases (COPD), and this is the 

major  reversible  component  of  airflow  obstruction  in  COPD  (1,  2).  Therefore, 

anticholinergics, which block M3 receptors, are effective bronchodilators for patients with 

COPD (2).  

M3 receptors on structural cells regulate inflammation 

 83 

In addition to  inducing bronchoconstriction and mucus secretion, acetylcholine has been 

shown to affect airway inflammation (chapter 2), which is a hallmark feature of COPD (3). 

In animal models of COPD, pretreatment with anticholinergics  inhibits  cigarette  smoke‐

induced  and  LPS‐induced  neutrophilic  inflammation  (4,  5).  More  recently,  we 

demonstrated  that  these pro‐inflammatory effects of acetylcholine are mediated via M3 

receptors.  Total  knock‐out  of  the M3  receptor,  or  inhibition  of  the M3  receptor  by  a 

pharmacological approach using the muscarinic antagonist 4‐DAMP, which is selective for 

M3  receptors  over  M2  receptors,  prevented  cigarette  smoke‐induced  neutrophilic 

inflammation  in  an  early  smoke  induced‐inflammation model  in mice mice  (chapter 3). 

Together, these data suggest a pro‐inflammatory role for acetylcholine via M3 receptors. 

M3 receptors are expressed abundantly throughout the airways and almost all cell types 

express  M3  receptors.  This  includes  structural  cells,  such  as  airway  smooth  muscle, 

epithelial  and  endothelial  cells,  but  also  inflammatory  cells,  such  as macrophages  and 

neutrophils  (6). From  in vitro studies  it  is known  that muscarinic receptor stimulation of 

both structural and inflammatory cells might contribute to the pro‐inflammatory effects of 

acetylcholine. For  instance, stimulation of airway smooth muscle cells and epithelial cells 

with  methacholine  or  acetylcholine  induces  the  release  of  IL‐8  (7,  8).  Furthermore, 

acetylcholine  activates  human  monocytes  and  alveolar  macrophages  to  promote 

neutrophil  migration,  which  is  also  observed  when  using  macrophages  from  COPD 

patients  (9, 10).  It  is not  known whether  the pro‐inflammatory  effects of  acetylcholine 

observed  in  vivo  are  primarily mediated  via M3  receptors  on  structural  cells  or  via M3 

receptors on inflammatory cells. 

Therefore,  in  this study, we  investigated  the relative contribution of  the M3 receptor on 

structural  cells  versus  inflammatory  cells  to  cigarette  smoke‐induced  inflammation.  In 

order  to  distinguish  between  structural  cells  and  inflammatory  cells,  bone  marrow 

chimeric mice were generated. Here, we demonstrate that the pro‐inflammatory effects 

of acetylcholine on neutrophilic inflammation are primarily mediated via M3 receptors on 

structural cells, which may involve altered adhesion and transmigration of neutrophils. 

Methods 

Animals 

Homozygous,  inbred, specific‐pathogen‐free breeding colonies of muscarinic M3 receptor 

deficient (M3R‐/‐) mice and C57Bl/6NTac wild‐type mice with the same genetic background 

(CD45.2) were  obtained  from  Taconic  (Cambridge  City,  Indiana,  USA).  The M3R‐/‐ mice 

were on a 129 Sv/J background and had been backcrossed for at least 10 generations onto 

Chapter 4 

84 

the  C57Bl/6NTac  background  (11).  CD45.1  congenic  C57Bl/6 mice were  obtained  from 

Jackson  Laboratories  (Bar Harbor, ME). All animals were maintained  in our own  facility. 

Animals were housed conventionally under a 12‐h light‐dark cycle and received food and 

water  ad  libitum.  All  experiments  were  performed  in  accordance  with  the  national 

guidelines  and  approved  by  the  University  of  Groningen  Committee  for  Animal 

Experimentation (number: 5463G). 

Generation of bone marrow chimeras 

Bone marrow  cells were  collected  from  femurs  and  tibia  of M3R‐/‐ mice  and wild‐type 

CD45.2  or  CD45.1 mice,  and  retro‐orbitally  injected  into  irradiated male mice  (9  Gy), 

within 24 hours after irradiation. Per mouse, 8 × 106 bone marrow cells were transplanted. 

Non‐irradiated wild‐type  animals were  used  as  additional  controls;  see  table  1  for  an 

overview of the groups. After 10 weeks, engraftment was analyzed by flow cytometry of 

peripheral  blood.  Seventy microliter  of  heparinized  peripheral  blood  was  collected  10 

weeks after bone marrow transplantation and at the end of the study when the mice were 

sacrificed. Red blood cells were lysed and the remaining cells were stained with antibodies 

directed against the following markers: CD45.2‐PE (CD45.2), CD45.1‐Pacific Blue (CD45.1), 

CD3‐APC  (T  cells),  B220‐FITC  (B  cells),  GR‐1‐PE/Cy7  and Mac1‐PE/Cy7  (monocytes  and 

granulocytes,  respectively)  (Biolegend,  San  Diego,  CA,  USA).  The  stained  cells  were 

analyzed with a LSR‐II  flow cytometer  (BD Biosciences, San Diego, CA, USA). Engrafment 

was calculated as a percentage of CD45.1 versus CD45.2 cells. Engraftment was high in all 

animals (>90% donor derived cells  in all  lineages), and mice were  included  in the study 3 

months after bone marrow reconstitution (figure 1). 

 

Table 1. Overview of the experimental groups included in this study. Back‐ 

ground       

Recipient  Irradiation  Donor  Groups 

CD45.1  CD 45.1  ‐  ‐  Non‐irradiated control 

CD 45.1  +  CD45.2  Irradiated control 

CD 45.1  +  M3R‐/‐  M3R inflammatory cells 

CD45.2  CD45.2  ‐  ‐  Non‐irradiated control 

CD45.2  +  CD45.1  Irradiated control 

M3R‐/‐  +  CD45.1  M3R structural cells 

 

 

 

M3 receptors on structural cells regulate inflammation 

 85 

Cigarette smoke exposure 

Mice (n=5‐12 per group) were exposed to cigarette smoke from Kentucky 3R4F research 

cigarettes  (Tobacco  Research  Institute,  University  of  Kentucky,  Lexington,  USA)  on  4 

consecutive days by whole body exposure in an early smoke induced‐inflammation model, 

as  described  previously  (chapter  3). Mice were  exposed  to mainstream  smoke  of  one 

cigarette in the morning and three cigarettes in the afternoon on the first day. On day 2 to 

4, mice were exposed to five cigarettes in the morning and five in the afternoon (figure 1). 

Each cigarette was smoked without a filter  in 5 minutes at a rate of 5L/hr  in a ratio with 

60L/hr  air  using  a  peristaltic  pump  (45  rpm, Watson Marlow  323  E/D,  Rotterdam,  The 

Netherlands). Control animals were handled in the same way but instead exposed to fresh 

air  only.  Sixteen  hours  after  the  last  CS  exposure,  animals  were  euthanized  by 

intraperitoneal pentobarbital injection (400 mg/kg, hospital pharmacy, University Medical 

Center Groningen), after which  the  lungs were  immediately  lavaged,  resected and  snap 

frozen in liquid nitrogen. Bronchoalveolar lavage (BAL) fluid was stored at ‐20°C and lung 

tissue was stored at ‐80°C. 

Analysis of bronchoalveolar lavage cells and cytokines 

A BAL was performed as described previously  (chapter 3). Briefly,  lungs were  lavaged 5 

times with 1 ml PBS. The first fraction was used for measurement of cytokines by ELISA. 

Levels  of  KC,  IL‐6  and  MCP‐1  were  determined  by  a  multiplex  assay  (R&D  Systems, 

Minneapolis, USA). Total cell numbers were determined and cytospins were prepared and 

stained with May–Grünwald and Giemsa (both Sigma, St. Louis) after which a differential 

cell count was performed by counting at least 400 cells in duplicate in a blinded fashion. 

 

 

Figure 1. Experimental protocol. Chimeric animals were generated by  sublethal  irradiation  (9 Gy) of  recipient 

male C57Bl/6 mice (n=5‐12) and subsequent transplantation of 8 x 106 donor bone marrow cells via retro‐orbital 

injection within 24h after irradiation. To allow for complete engraftment, animals were included in the protocol 

three months  after  bone marrow  reconstitution. Animals were  exposed  to  cigarette  smoke  twice  daily  on  4 

consecutive days by whole body exposure. Sixteen hours after the last smoke exposure a bronchoalveolar lavage 

was performed and lungs were harvested for lung tissue homogenates.

Chapter 4 

86 

Analysis of gene expression in lung tissue 

Total RNA was extracted from  lung tissue  (right superior  lobe) using the RNeasy mini kit 

(Qiagen, Venlo, The Netherlands), as described previously  (chapter 3). Equal amounts of 

total mRNA were  then  reverse  transcribed  and  cDNA was  subjected  to  real‐time  qPCR 

(Westburg,  Leusden, The Netherlands) or  to micro‐array analysis using an  Illumina  chip 

and GeneSpring  software.  The  specific  forward  and  reverse  primers  used  for  real‐time 

qPCR are listed in table 2. 

Statistical analysis 

Data  are presented  as mean  ±  s.e. of  the mean.  Statistical differences between means 

were  calculated  using  one‐  or  two‐way  ANOVA,  followed  by  Newman  Keuls  multiple 

comparison tests, or by a Student’s t‐test with two‐tailed distribution where appropriate. 

Differences were considered significant at p<0.05. 

 

Table 2. Primers used for qRT‐PCR analysis. KC: keratinocyte‐derived chemokine, the mouse orthologue of IL‐8, 

also known as CXCL1 in mice. MIP‐2 is also known as CXCL2, LIX is also known as CXCL5.  

Gene  Primer sequence  NCBI accession 

number 

KC  Forward – GCTGGGATTCACCTCAAGAA 

Reverse  – AGGTGCCATCAGAGCAGTCT 

NM_008176.3 

IL‐6  Forward – CCGGAGAGGAGACTTCACAG 

Reverse  – TCCACGATTTCCCAGAGAAC 

NM_031168.1 

MIP‐2  Forward – AAGTTTGCCTTGACCCTGAA 

Reverse  – AGGCACATCAGGTACGATCC 

NM_009140.2 

LIX  Forward – GAAAGCTAAGCGGAATGCAC 

Reverse  – GGGACAATGGTTTCCCTTTT 

NM_009141.3 

Fibrinogen α  Forward – AACTTCAGGTGCCCAAAATG 

Reverse  – AACTGAGCCCCTCAGAGTGA 

NM_001111048.1 

CD177  Forward – GGGAGGTGGACTGACTACCA 

Reverse  – GGGTTCAGCAGAGAGGACAG 

NM_026862.3 

18S  Forward – AAACGGCTACCACATCCAAG 

Reverse  – CCTCCAATGGATCCTCGTTA 

NR_003278 

 

 

 

 

M3 receptors on structural cells regulate inflammation 

 87 

Results 

Analysis of engraftment 

To  confirm  that  the  bone  marrow  transplantation  was  successful,  engraftment  was 

analyzed after 10 weeks and at  the day of sacrifice of  the mice. As depicted  in  figure 2, 

after 10 weeks engraftment was high and this was not different between the experimental 

groups (not shown). Therefore, all animals were included in the study 3 months after bone 

marrow  reconstitution. Engraftment was even  further enhanced at  the day of  sacrifice. 

Engraftment was  as  follows:  total  cells 97.1%  (ranging  from 94.2  to 99.0%), monocytes 

99.4%  (97.5  to 100%), granulocytes 99.8%  (97.8  to 100%), B cells 99.9%  (99.3  to 100%), 

and T cells 90.6% (81.7 to 97.4%) (figure 2). 

 

  

Figure 2. Engraftment of bone marrow cells. Engraftment was analyzed  in peripheral blood of mice, 10 weeks 

after  the  bone  marrow  transplantation  and  at  the  day  of  sacrifice.  Average  engraftment  levels  (A)  and 

representative FACS images for total single cells (B), monocytes (C), granulocytes (D), B cells (E) and T cells (F) at 

the day of sacrifice are shown. N=68 animals. 

 

 

 

Chapter 4 

88 

Contribution of the M3 receptor on inflammatory cells 

To  study  the  contribution  of  the M3  receptor  on  inflammatory  cells  to  early  cigarette 

smoke‐induced  airway  inflammation,  inflammatory  cells  in  the  lavage  fluid  of  CD45.1 

animals were determined after exposure  to cigarette smoke. The  following groups were 

compared:  CD45.1  non‐irradiated  control  animals,  irradiated  CD45.1  control  animals 

receiving wild‐type  (CD45.2) bone marrow cells and  irradiated CD45.1 animals  receiving 

M3R‐/‐ (CD45.2) bone marrow cells (table 1). Cigarette smoke exposure had no significant 

effect on macrophage and  lymphocyte numbers  in all groups  (figure 3). Cigarette smoke 

induced a significant increase in neutrophil numbers in non‐irradiated (figure 3A; 28‐fold) 

and irradiated control animals receiving wild‐type bone marrow cells (figure 3B; 18‐fold). 

Interestingly,  wild‐type  animals  receiving  M3R‐/‐  bone  marrow  cells  showed  a  similar 

increase  in  neutrophil  number  (figure  3C;  15‐fold),  suggesting  that  the M3  receptor  on 

inflammatory cells is not involved in cigarette smoke‐induced neutrophilic inflammation. 

Contribution of the M3 receptor on structural cells 

To study the contribution of the M3 receptor on structural cells to early cigarette smoke‐

induced  airway  inflammation,  inflammatory  cells  in  the  lavage  fluid  of  CD45.2  animals 

were determined after exposure to cigarette smoke (figure 4). The following groups were 

compared:  CD45.2  non‐irradiated  control  animals,  irradiated  CD45.2  control  animals 

receiving  CD45.1  bone  marrow  cells  and  irradiated  M3R‐/‐  (CD45.2)  animals  receiving 

CD45.1  bone  marrow  cells  (table  1).  Cigarette  smoke  induced  a  small  increase  in 

macrophage  numbers  in  the  lavage  fluid  in  all  groups  (1.3‐1.4  fold).  No  increase  in 

lymphocyte  numbers  was  observed.  Cigarette  smoke  induced  a  significant  increase  in 

neutrophil  numbers  in  non‐irradiated  (figure  4A;  8‐fold)  and  irradiated  control  animals 

receiving wild‐type bone marrow cells  (figure 4B; 4‐fold).  In contrast, no  increase  in  the 

number of neutrophils was observed  in M3R‐/‐ animals  receiving wild‐type bone marrow 

(figure  4C),  suggesting  that  the M3  receptor  on  structural  cells  is  involved  in  cigarette 

smoke‐induced neutrophilic inflammation. 

  

M3 receptors on structural cells regulate inflammation 

 89 

 

Figure 3. Inflammatory cells  in the  lavage  fluid of CD45.1 animals. Mice were treated as described  in  figure 1. 

Sixteen  hours  after  the  last  smoke  exposure  a  bronchoalveolar  lavage  was  performed  and  macrophages, 

lymphocytes and neutrophils were determined  in the  lavage fluid of non‐irradiated wild‐type animals (A), wild‐

type animals receiving wild‐type bone marrow cells (B) and wild‐type animals receiving M3R‐/‐ bone marrow cells 

(C). * p<0.05, ** p<0.01, n=6‐12 animals. 

Chapter 4 

90 

 

Figure 4.  Inflammatory cells  in  the  lavage  fluid of CD45.2 animals. Mice were  treated as described  in  figure 1. 

Sixteen  hours  after  the  last  smoke  exposure  a  bronchoalveolar  lavage  was  performed  and  macrophages, 

lymphocytes and neutrophils were determined  in the  lavage fluid of non‐irradiated wild‐type animals (A), wild‐

type animals receiving wild‐type bone marrow cells (B) and M3R‐/‐ animals receiving wild‐type bone marrow cells 

(C). * p<0.05, n=5‐8 animals. 

 

M3 receptors on structural cells regulate inflammation 

 91 

Cigarette smoke‐induced cytokine release 

Subsequently, gene expression of KC (CXCL1), the mouse orthologue of IL‐8 (CXCL8), was 

determined in lung homogenates. Cigarette smoke induced an increase in KC. Remarkably, 

this increase was similar in all bone marrow transplanted groups (2.8‐5.0 fold), as depicted 

in figure 5. Similar findings were observed at the protein level in the lavage fluid. Of note, 

other neutrophil chemoattractants,  including MIP‐2  (CXCL2) and LIX  (CXCL5) were  found 

increased in response to cigarette smoke in the CD45.1 groups only, with no interaction of 

genotype, whereas no increase in IL‐6 or MCP‐1 expression in response to cigarette smoke 

was observed in all strains (data not shown).  

 

  

 

Neutrophil adhesion 

These  observations  suggest  that M3  receptors  on  structural  cells  do  not mediate  their 

effect  via  altered KC, MIP‐2 or  LIX production. Therefore, we  considered  the possibility 

that neutrophil adhesion might be altered after knock‐out of the M3 receptor on structural 

cells. We analyzed  the expression of genes  known  to play a  role  in  this process.  In  the 

airways, P‐selectin, E‐selectin and L‐selectin are involved in rolling of neutrophils, whereas 

intercellular adhesion molecule  (ICAM)‐1, vascular  cell adhesion molecule  (VCAM)‐1,  β2 

integrin  and  integrin  α4β1  (very  late  antigen‐4,  VLA4)  play  a  role  in  adhesion  and 

Figure  5. KC  expression  after 

cigarette  smoke  exposure.  Mice 

were  treated  as  described  in  figure 

1. Sixteen hours after the last smoke 

exposure lungs were collected. Gene 

expression  of  keratinocyte‐derived 

chemokine  (KC)  in  lung 

homogenates  was  determined. 

Results are expressed as mean ± s.e. 

of  the mean,  *  p<0.05;  **  p<0.01; 

*** p<0.001, n=5‐12 animals. 

Chapter 4 

92 

transmigration of neutrophils (12). However, we were not able to demonstrate regulation 

of  these markers  at  the  gene  expression  level  in  whole  lung  homogenates.  Thus,  no 

increase was observed  in wild‐type  animals  receiving wild‐type bone marrow  cells, nor 

were there any differences compared to M3R‐/‐ animals receiving wild‐type bone marrow 

cells  (data not shown). To be able to explain the observed effects, we proceeded with a 

micro‐array  gene  expression  analysis  on whole  lung  homogenates  of wild‐type  animals 

receiving  wild‐type  bone marrow  cells  and  of M3R‐/‐  animals  receiving  wild‐type  bone 

marrow  cells. We  selected genes which were up  regulated or down  regulated by more 

than 1.5‐fold in cigarette smoke‐exposed M3R‐/‐ animals receiving wild‐type bone marrow 

cells  compared  to  cigarette  smoke‐exposed wild‐type  animals  receiving wild‐type  bone 

marrow  cells  (table 3). Three genes were upregulated and  twelve were downregulated. 

Genes  which  were  shown  to  have  a  link  with  neutrophilic  inflammation  according  to 

literature were analyzed by real‐time qPCR. Down regulation of  fibrinogen α and CD177 

was confirmed, which was lower in M3R‐/‐ animals compared to wild‐type animals, and not 

influenced by  smoke exposure  (figure 6).  Interestingly, both genes are known  to play a 

role in neutrophil adhesion and transmigration. 

Table 3. Genes which were up regulated or down regulated by more than 1.5‐fold  in cigarette smoke‐exposed 

M3R‐/‐ animals  receiving wild‐type bone marrow  cells compared  to cigarette  smoke‐exposed wild‐type animals 

receiving wild‐type bone marrow cells. Genes in bold were analyzed by real‐time qPCR.  

Gene  Definition  Regulation 

AKR1C19  Aldo‐keto reductase family 1, member C19  + 2.0 

TNXB  Tenascin XB  + 2.0 

ERAF  Erythroid associated factor  + 1.7 

FGG  Fibrinogen gamma chain  ‐ 2.1 

FGA  Fibrinogen alpha chain  ‐ 1.9 

RETNLA  Resistin like alpha  ‐ 1.9 

CHI3L3  Chitinase 3‐like 3  ‐ 1.8 

LTF  Lactotransferrin  ‐ 1.7 

CLCA3  Chloride channel calcium activated 3  ‐ 1.6 

LOC100048554  Similar to monocyte chemoattractant protein‐2  ‐ 1.6 

OTTMUSG00000000971  Unknown  ‐ 1.6 

CD177  CD177 antigen  ‐ 1.5 

EAR5  Eosinophil‐associated ribonuclease 5  ‐ 1.5 

MFSD2  Major facilitator superfamily domain‐containing 2  ‐ 1.5 

SLC26A4  Pendrin; solute carrier family 26, member 4  ‐ 1.5 

M3 receptors on structural cells regulate inflammation 

 93 

  

Figure 6. Fibrinogen α and CD177 expression after cigarette smoke exposure. Mice were treated as described in 

figure  1.  Sixteen  hours  after  the  last  smoke  exposure  lungs  were  collected.  Micro‐array  analysis  on  lung 

homogenates revealed that fibrinogen α and CD177 were down regulated after smoke exposure in M3R‐/‐ animals 

receiving wild‐type bone marrow cells compared to wild‐type animals. Therefore, gene expression of fibrinogen 

α  (A)  and  CD177  (B) was  determined  by  real‐time  qPCR.  Results  are  expressed  as mean  ±  s.e.  of  the mean,            

* p<0.05, n=5‐8 animals. 

 

Discussion 

In  this  study,  we  demonstrated  that  the M3  receptor  on  structural  cells  plays  a  pro‐

inflammatory role in cigarette smoke‐induced inflammation. In M3R‐/‐ mice receiving wild‐

type  bone  marrow  cells,  neutrophilic  inflammation  in  response  to  cigarette  smoke 

exposure  is prevented.  In contrast, cigarette smoke‐induced neutrophilic  inflammation  is 

still observed after knock‐out of  the M3  receptor on  inflammatory cells,  suggesting  that 

the pro‐inflammatory effects of acetylcholine are primarily mediated via M3 receptors on 

structural  cells.  This  was  not  regulated  via  inhibition  of  cytokine  release,  which  was 

comparable  in  all  groups,  but  might  involve  altered  adhesion  and  transmigration  of 

neutrophils via fibrinogen α and CD177. 

Neutrophils  play  a  central  role  in  COPD,  and  previous  studies  have  shown  that 

acetylcholine  regulates  neutrophilic  inflammation  via  M3  receptors.  Inhibition  of 

muscarinic  receptors  by  anticholinergics,  including  tiotropium,  glycopyrrolate  and 

aclidinium, prevented neutrophilic inflammation in response to cigarette smoke exposure 

Chapter 4 

94 

or LPS exposure  in guinea pigs and mice  (4, 5, 13, 14). Since  long‐acting anticholinergics 

are kinetically selective  for M3  receptors,  these  findings suggest  the  involvement of  this 

specific  muscarinic  receptor  subtype.  A  recent  study  from  our  lab  using  M3R‐/‐  mice 

showed that the pro‐inflammatory effects of acetylcholine are indeed mediated via the M3 

receptor. We demonstrated that cigarette smoke‐induced neutrophilic  inflammation was 

prevented  in M3R‐/‐ mice, whereas  opposite  effects were  observed  in M1R

‐/‐  and M2R‐/‐ 

mice (chapter 3). In the present study we have extended these findings by demonstrating 

that the pro‐inflammatory effects of acetylcholine are primarily mediated via M3 receptors 

on  structural  cells  in  an  early  smoke  induced‐inflammation  model  in  mice.  The 

involvement of  the M3  receptor on  structural  cells  in  the  inflammatory  response  is also 

supported by evidence  from  in vitro studies. Methacholine and cigarette smoke‐induced 

IL‐8  release  from airway  smooth muscle cells can be  inhibited by  the M3 antagonists 4‐

DAMP  and  DAU5884  (7). Moreover,  acetylcholine‐induced  IL‐8  release  from  bronchial 

epithelial cells can be inhibited by 4‐DAMP (8). Strikingly, acetylcholine‐induced effects on 

inflammatory cells were also shown  to be mediated via M3 receptors. 4‐DAMP  inhibited 

acetylcholine‐induced neutrophil chemotactic activity  from macrophages  (15), as well as 

neutrophil chemotaxis from LPS‐activated macrophages from COPD patients (10). These in 

vitro  studies  suggest  a  direct  effect  of  acetylcholine  on  both  structural  cells  and 

inflammatory  cells.  Apparently,  the  observed  effects  of  acetylcholine  on  inflammatory 

cells  in vitro are not  relevant  to  the  in vivo  situation, as we demonstrate  that  cigarette 

smoke‐induced  inflammation  is  still  observed  after  knock‐out  of  the  M3  receptor  on 

inflammatory cells. 

Although  there was no  increase  in neutrophil numbers  in M3R‐/‐ animals  receiving wild‐

type bone marrow cells after exposure to cigarette smoke compared to wild‐type animals, 

the increase in the neutrophil chemoattractant KC was similar to the increase observed in 

wild‐type animals. This suggests that neutrophil recruitment  is altered after knock‐out of 

the  M3  receptor.  Neutrophil  recruitment  is  a  complex  cellular  process  which  occurs 

through a cascade of multiple  steps,  including  tethering,  rolling, adhesion,  crawling and 

subsequent  transmigration of neutrophils  (12). An  initial  screen on  genes  known  to be 

involved in the process of neutrophil recruitment, including selectins, ICAM‐1, VCAM‐1, β2 

integrin  and  VLA4,  could  not  explain  the  observed  increase  in  KC  in  M3R‐/‐  animals 

receiving  wild‐type  bone  marrow  cells,  without  an  increase  in  neutrophil  numbers. 

However,  using  a  micro‐array  analysis,  two  genes  which  were  recently  linked  to  the 

process of neutrophil  recruitment,  fibrinogen  α  and CD177  (16, 17), were  shown  to be 

down regulated in M3R‐/‐ animals compared to wild‐type animals. 

M3 receptors on structural cells regulate inflammation 

 95 

Fibrinogen  α,  besides  its  role  in  blood  hemostasis,  regulates  the  adhesive  behavior  of 

neutrophils.  Fibrinogen  can  bind  to  β2  integrins  and  thereby  alter  the  recruitment  of 

neutrophils (16, 18). Neutrophil recruitment in response to platelet activating factor (PAF) 

is altered  in  fibrinogen  α knock‐out mice. Specifically,  the number of  rolling neutrophils 

and  the number of adhering neutrophils was decreased  in  fibrinogen  α knock‐out mice 

compared  to wild‐type mice  (16). Therefore, a  reduction  in  fibrinogen  α  levels  in M3R‐/‐ 

mice might  affect  neutrophil  recruitment  in  response  to  cigarette  smoke  exposure,  by 

reducing the rolling and adhesion of neutrophils. 

CD177  is  a  neutrophil  specific  antigen,  expressed  by  a  subpopulation  of  neutrophils. 

CD177  can bind  to platelet  endothelial  cell  adhesion molecule  (PECAM)‐1,  and  thereby 

alter  the  recruitment  of  neutrophils  (17,  19).  PECAM‐1  is  known  to  be  involved  in 

neutrophil transmigration (12). In vitro, transmigration of neutrophils through endothelial 

cells  in  response  to  IL‐8  or  fMLP was  inhibited  after  inhibition  of  the  CD177‐PECAM‐1 

interaction  (17).  Interestingly,  the  same  study  showed  that  CD177‐positive  neutrophils 

transmigrated more efficiently  than CD177‐negative neutrophils,  indicating  the potential 

relevance of CD177  for  transmigration. These  findings were confirmed by Kuckleburg et 

al., who demonstrated  that  inhibition of CD177 or  inhibition of  the  interaction between 

CD177  and  PECAM‐1  inhibits  neutrophil  transmigration  under  both  static  and  flow 

conditions  (20).  Therefore,  a  reduction  in  CD177  levels  in  M3R‐/‐  mice  might  affect 

neutrophil  recruitment  in  response  to  cigarette  smoke  exposure,  by  reducing  the 

transmigration of neutrophils.  

The gene expression of neither fibrinogen α nor CD177 was regulated by cigarette smoke, 

indicating  that  this  is  a  constitutive  difference  between  the wild‐type  and M3R‐/‐ mice. 

Expression  levels  of  both  genes were  lower  in  the M3R‐/‐  strain  compared  to wild‐type 

mice, which further supports the observation that neutrophillic inflammation is altered in 

M3R‐/‐ mice receiving wild‐type bone marrow, and not in wild‐type animals receiving M3R

‐/‐ 

bone marrow. Interestingly, both genes were recently identified as potential inflammatory 

biomarkers for COPD. Fibrinogen was identified as a biomarker in the Evaluation of COPD 

Longitudinally  to  Identify  Predictive  Surrogate  Endpoints  (ECLIPSE)  study  (21),  and  an 

elevated level of fibrinogen was independently and significantly associated with mortality 

in patients with COPD  (22). CD177  levels were  increased  in  the  airways of Cynomolgus 

monkeys after ozon  challenge  (23),  indicating  the potential  relevance of both genes  for 

COPD pathophysiology. It is beyond the scope of the current manuscript to investigate the 

functional roles of CD177 and fibrinogen α  in detail; however, our results and the above 

mentioned clinical data certainly provide strong rationale for future studies in this area. 

Chapter 4 

96 

The fact that KC levels were increased in M3R‐/‐ mice receiving wild‐type bone marrow cells 

in  our  study  also  has  other  implications.  Previously, we  have  shown  that  increased  KC 

release in response to cigarette smoke exposure is prevented after total knock‐out of the 

M3 receptor (chapter 3). KC can be released from airway structural cells, including airway 

smooth  muscle  cells  and  epithelial  cells,  and  from  inflammatory  cells,  including 

macrophages.  The  finding  that  KC  release  is prevented  after  total  knock‐out of  the M3 

receptor, but not after knock‐out of  the M3  receptor on structural cells only, suggests a 

role for inflammatory cells in this response. The suggestion that acetylcholine induces the 

release of KC  from  inflammatory cellsis supported by  in vitro studies showing enhanced 

neutrophil  recruitment  after  stimulation  of  macrophages  with  acetylcholine  (10,  15). 

However,  knock‐out  of  the M3  receptor  only  on  inflammatory  cells  does  not  prevent 

neutrophilic inflammation, whereas knock‐out of the M3 receptor on structural cells does. 

Therefore,  the  contribution  of  the  M3  receptor  on  inflammatory  cells  to  the  pro‐

inflammatory  effect of  acetylcholine  is only  small,  and  this  is mainly dependent on M3 

receptors on structural cells.  

Acetylcholine  is not only  released as a neurotransmitter, but can also be  released  from 

non‐neuronal  cells.  Almost  all  cell  types  in  the  airways  have  been  shown  to  express 

synthesizing  enzymes  for  acetylcholine,  suggesting  acetylcholine production  (24).  It has 

been  proposed  that  this  non‐neuronal  acetylcholine might  contribute  to  inflammation, 

although direct evidence  is  still  limited  (chapter 2, 25). Results  from our  study  indicate 

that  non‐neuronal  acetylcholine  acting  on  inflammatory  cells  does  not  significantly 

contribute to the pro‐inflammatory effects of acetylcholine. There might be a role for non‐

neuronal  acetylcholine  released  from  airway  structural  cells  including  epithelial  cells, 

however, future studies are needed to investigate this in more detail. 

In conclusion, we demonstrate that acetylcholine regulates inflammation via M3 receptors 

on  structural  cells.  This  emphasizes  the  important  role  of  airway  structural  cells  in 

neutrophilic  inflammation  and  the  pathophysiology  of  COPD,  and  the  contribution  of 

acetylcholine to this response. Whether anticholinergic therapy also affects inflammation 

in patients with COPD still needs to be elucidated, but our results indicate that this might 

be an additional beneficial effect of M3 selective anticholinergics. 

 

Acknowledgements 

The authors would  like  to  thank  the Netherlands  Lung Foundation  for  financial  support 

(grant: 3.2.08.014).   

M3 receptors on structural cells regulate inflammation 

 97 

References 

(1)  Gross  NJ,  Skorodin  MS.  Role  of  the  parasympathetic  system  in  airway  obstruction  due  to 

emphysema. N Engl J Med 1984;311:421‐425.  

(2)  Barnes  PJ.  The  role  of  anticholinergics  in  chronic  obstructive  pulmonary  disease.  Am  J Med 

2004;117 Suppl 12A:24S‐32S.  

(3) Barnes PJ. Chronic obstructive pulmonary disease. N Engl J Med 2000;343:269‐280.  

(4) Pera T, Zuidhof A, Valadas J, Smit M, Schoemaker RG, Gosens R, Maarsingh H, Zaagsma J, Meurs 

H. Tiotropium inhibits pulmonary inflammation and remodelling in a guinea pig model of COPD. Eur 

Respir J 2011;38:789‐796.  

(5) Wollin L, Pieper MP. Tiotropium bromide exerts anti‐inflammatory activity  in a cigarette smoke 

mouse model of COPD. Pulm Pharmacol Ther 2010;23:345‐354.  

(6) Gosens R, Zaagsma J, Meurs H, Halayko AJ. Muscarinic receptor signaling in the pathophysiology 

of asthma and COPD. Respir.Res. 2006;7:73.  

(7) Gosens R, Rieks D, Meurs H, Ninaber DK, Rabe KF, Nanninga J, Kolahian S, Halayko AJ, Hiemstra 

PS,  Zuyderduyn  S.  Muscarinic  M3  receptor  stimulation  increases  cigarette  smoke‐induced  IL‐8 

secretion by human airway smooth muscle cells. Eur Respir J 2009;34:1436‐1443.  

(8) Profita M, Bonanno A, Siena L, Ferraro M, Montalbano AM, Pompeo F, Riccobono L, Pieper MP, 

Gjomarkaj M. Acetylcholine mediates  the  release  of  IL‐8  in human  bronchial  epithelial  cells  by  a 

NFkB/ERK‐dependent mechanism. Eur J Pharmacol 2008;582:145‐153.  

(9) Buhling F, Lieder N, Kuhlmann UC, Waldburg N, Welte T. Tiotropium suppresses acetylcholine‐

induced release of chemotactic mediators in vitro. Respir Med 2007;101:2386‐2394.  

(10) Vacca G, Randerath WJ, Gillissen A. Inhibition of granulocyte migration by tiotropium bromide. 

Respir Res 2011;12:24.  

(11) Fisahn A, Yamada M, Duttaroy A, Gan JW, Deng CX, McBain CJ, Wess J. Muscarinic induction of 

hippocampal gamma oscillations requires coupling of the M1 receptor to two mixed cation currents. 

Neuron 2002;33:615‐624.  

(12) Kolaczkowska E, Kubes P. Neutrophil recruitment and function in health and inflammation. Nat 

Rev Immunol 2013;13:159‐175.  

(13) Shen LL, Liu YN, Shen HJ, Wen C, Jia YL, Dong XW, Jin F, Chen XP, Sun Y, Xie QM. Inhalation of 

glycopyrronium  inhibits  cigarette  smoke‐induced  acute  lung  inflammation  in  a murine model  of 

COPD. Int Immunopharmacol 2014;18:358‐364.  

(14) Dominguez‐Fandos D, Ferrer E, Puig‐Pey R, Carreno C, Prats N, Aparici M, Musri MM, Gavalda A, 

Peinado VI, Miralpeix M, Barbera  JA.  Effects of  aclidinium bromide  in  a  cigarette  smoke‐exposed 

Guinea pig model of chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 2014;50:337‐

346.  

(15) Sato E, Koyama S, Okubo Y, Kubo K, Sekiguchi M. Acetylcholine stimulates alveolar macrophages 

to release inflammatory cell chemotactic activity. Am J Physiol 1998;274:L970‐L979.  

(16)  de  Almeida  VV,  Silva‐Herdade  A,  Calado  A,  Rosario  HS,  Saldanha  C.  Fibrinogen modulates 

leukocyte  recruitment  in  vivo during  the  acute  inflammatory  response. Clin Hemorheol Microcirc 

2012.  

Chapter 4 

98 

(17) Sachs UJ, Andrei‐Selmer CL, Maniar A, Weiss T, Paddock C, Orlova VV, Choi EY, Newman PJ, 

Preissner KT, Chavakis T, Santoso S. The neutrophil‐specific antigen CD177 is a counter‐receptor for 

platelet endothelial cell adhesion molecule‐1 (CD31). J Biol Chem 2007;282:23603‐23612.  

(18) Flick MJ, Du X, Witte DP, Jirouskova M, Soloviev DA, Busuttil SJ, Plow EF, Degen JL. Leukocyte 

engagement  of  fibrin(ogen)  via  the  integrin  receptor  alphaMbeta2/Mac‐1  is  critical  for  host 

inflammatory response in vivo. J Clin Invest 2004;113:1596‐1606.  

(19)  Stroncek  DF.  Neutrophil‐specific  antigen  HNA‐2a,  NB1  glycoprotein,  and  CD177.  Curr  Opin 

Hematol 2007;14:688‐693.  

(20) Kuckleburg CJ, Tilkens SB, Santoso S, Newman PJ. Proteinase 3 contributes to transendothelial 

migration of NB1‐positive neutrophils. J Immunol 2012;188:2419‐2426.  

(21) Dickens  JA, Miller BE, Edwards LD, Silverman EK, Lomas DA, Tal‐Singer R, Evaluation of COPD 

Longitudinally  to  Identify Surrogate Endpoints  (ECLIPSE) study  investigators. COPD association and 

repeatability of blood biomarkers in the ECLIPSE cohort. Respir Res 2011;12:146‐9921‐12‐146.  

(22) Celli BR, Locantore N, Yates  J, Tal‐Singer R, Miller BE, Bakke P, Calverley P, Coxson H, Crim C, 

Edwards LD, Lomas DA, Duvoix A, MacNee W, Rennard S, Silverman E, Vestbo J, Wouters E, Agusti A, 

ECLIPSE  Investigators.  Inflammatory biomarkers  improve  clinical prediction of mortality  in  chronic 

obstructive pulmonary disease. Am J Respir Crit Care Med 2012;185:1065‐1072.  

(23) Hicks A, Kourteva G, Hilton H, Li H, Lin TA, Liao W, Li Y, Wei X, March T, Benson J, Renzetti LM. 

Cellular  and  molecular  characterization  of  ozone‐induced  pulmonary  inflammation  in  the 

Cynomolgus monkey. Inflammation 2010;33:144‐156.  

(24) Wessler I, Kirkpatrick CJ. Acetylcholine beyond neurons: the non‐neuronal cholinergic system in 

humans. Br J Pharmacol 2008;154:1558‐1571.  

(25)  Gwilt  CR,  Donnelly  LE,  Rogers  DF.  The  non‐neuronal  cholinergic  system  in  the  airways:  an 

unappreciated regulatory role in pulmonary inflammation? Pharmacol Ther 2007;115:208‐222.  

 

 

 

 

 

 

 

 

 

 

CHAPTER 5 

ANTI‐INFLAMMATORY EFFECTS OF ACETYLCHOLINE INHIBITION 

AFTER TARGETED LUNG DENERVATION IN PATIENTS WITH COPD 

  

 

 

 

 

 

 

Loes E.M. Kistemaker 

Dirk‐Jan Slebos 

Herman Meurs  

Huib A.M. Kerstjens 

Reinoud Gosens 

 

Submitted to Thorax, 2015

Chapter 5 

102 

Abstract 

Rationale 

Acetylcholine  does  not  only  induce  bronchoconstriction,  but  is  also  identified  as  a 

regulator  of  airway  inflammation  in  animal  models  of  COPD.  This  has  not  been 

demonstrated  in patients with COPD. Therefore, the effect of targeted  lung denervation 

(TLD) on inflammation in patients with COPD was investigated in this study. TLD is a novel 

bronchoscopic  therapy  for COPD,  in which airway nerves are ablated by  locally applying 

radiofrequency energy. 

Methods 

Markers  of  inflammation  in bronchial washings  and  brushes were  investigated  30  days 

after TLD. 

Results 

TLD attenuated airway inflammation, with a significant decrease in CCL4 (MIP‐1β) protein 

levels in the bronchial wash and CXCL8 and TGF‐β gene expression levels in the bronchial 

brush. 

Conclusions 

These  findings  suggest  that  parasympathetic  denervation  reduces  inflammation  in 

patients with COPD. 

 

To the editor 

Acetylcholine  is  the  primary  parasympathetic  neurotransmitter  in  the  airways,  and 

induces  bronchoconstriction.  Animal models  of  COPD  revealed  that  acetylcholine  also 

promotes  airway  inflammation,  which  can  be  inhibited  by  anticholinergic  intervention 

(chapter 2). This could be clinically  relevant, but has never been demonstrated  in COPD 

patients.  

We  investigated the effect of targeted  lung denervation (TLD) on airway  inflammation  in 

COPD. TLD is a novel potential therapy for COPD, in which parasympathetic airway nerves 

are  bronchoscopically  ablated  by  applying  radiofrequency  energy.  Clinical  evidence  in 

COPD suggests  that TLD  improves  lung  function and quality of  life  (1). We hypothesized 

that TLD would inhibit airway inflammation. 

Seven  patients with moderate  to  severe  COPD were  recruited  as  part  of  a  safety  and 

technical feasibility study for TLD (NCT01483534) (1). TLD of the right lung was performed 

on  day  0  (see  supplement). A  bronchial wash  and  brush were  collected  from  the  lung 

distal  to  the  site  of  denervation  before  (day  0)  and  after  denervation  (day  30).  We 

Lung denervation attenuates inflammation 

 103 

analyzed  inflammatory cells and cytokines  in the bronchial wash, and gene expression of 

inflammatory markers in the brush. 

Patient  characteristics  are  presented  in  Table  1,  the main  results  in  Figure  1,  and  all 

inflammatory  cells  and  cytokines  in  Table  S1.  The  percentage  of  neutrophils  in  the 

bronchial wash was decreased after TLD in 5/7 patients, CXCL8 decreased in 4/7 patients, 

and  CCL4  decreased  in  6/7  patients  (p=0.047). Gene  expression  of  CXCL8  in  the  brush 

decreased  in  6/7  patients  (p=0.031),  as  did  IL‐6  in  5/7  patients,  TGF‐β  in  6/7  patients 

(p=0.047), and MUC5AC in 5/7 patients.  

Our  findings  suggest  that  TLD  attenuates  airway  inflammation.  Evidence on  the  role of 

acetylcholine  in  inflammation  from  patients  is  limited.  Although  the  use  of  tiotropium 

bromide  is  associated  with  a  reduction  in  exacerbation  frequency  (2), methodological 

problems have hampered the evaluation of  inflammation  in the available drug study (3). 

This bronchoscopic  targeting of  the parasympathetic  system enabled us  to examine  the 

effects  on  airway  inflammation  in  a  completely  novel,  direct  manner.  Although 

denervation  also  targets  sensory  nerve  fibers  that  release  pro‐inflammatory 

neuropeptides,  such  as  substance  P  and  calcitonin  gene‐related  peptide,  these  nerves 

have been shown  to regenerate,  in contrast  to cholinergic nerve  fibers. We believe  that 

these findings suggest a pro‐inflammatory role for acetylcholine in the airways.  

Acetylcholine is not only a neurotransmitter, but is also produced by non‐neuronal cells. It 

has  been  proposed  that  this  non‐neuronal  acetylcholine  is  responsible  for  the  pro‐

inflammatory  effects  of  acetylcholine  (chapter  2).  The  current  study  suggests  that 

neuronal acetylcholine may in fact contribute to inflammation in COPD.  

Table 1. Baseline characteristics of subjects (n=7 subjects).  

  Age (years)    56.4 (10.4) 

  Male (n, %)  2 (29%) 

  History of Smoking (n, %)  7 (100%) 

  Pack‐Years  35.8 (13.7) 

  FEV1 (L) – Pre‐bronchodilator  0.70 (0.13) 

  FVC (L) – Pre‐bronchodilator  2.19 (0.27)  

   Data are mean (SD) unless stated otherwise. FEV1=forced expiratory volume in 1 s.  

   FVC=forced vital capacity. 

 

Chapter 5 

104 

 

Figure 1. Percentage  change at day 30  compared  to day 0  in  levels of neutrophils and protein expression of 

CXCL8 and CCL4 in bronchial wash, and in gene expression of CXCL8, IL‐6, TGF‐β and MUC5AC in bronchial brush. 

Baseline values are set to 100%, represented by the dashed line. * p<0.05 (Wilcoxon signed rank test). CXCL8: C‐

X‐C chemokine 8, also known as  IL‐8; CCL4: chemokine C‐C  ligand 4, also known as MIP‐1β;  IL‐6:  interleukin‐6; 

TGF‐β: transforming growth factor‐β. In this small study population, a repeated measures analysis of covariance 

did not show significant interactions of these parameters with changes in FEV1 in response to TLD. 

 

Furthermore,  TLD  might  also  have  effects  on  airway  remodeling,  since  a  significant 

reduction  in TGF‐β was observed. This aligns well with  the  reduction  in TGF‐β we have 

previously  found  in muscarinic M3  receptor  knock‐out mice  (chapter  3),  and with  the 

human data  from  the UPLIFT  trial, where  tiotropium  reduced  lung  function decline  in a 

subgroup of patients (4).  

There  are  limitations  to  this  small  cohort  pilot  study,  including  the  limited  number  of 

subjects and the  lack of control of successful denervation. However, we believe that the 

findings  are  promising,  and  a  large‐scale  multicenter  sham‐controlled  study  of  the 

effectiveness of TLD is planned and will include similar analyses. This should provide more 

evidence  for  the  role  of  neuronal  acetylcholine  as  a  pro‐inflammatory  mediator. 

Moreover,  it would  be  interesting  to  perform  similar  analyses  in  patients  treated with 

anticholinergic drugs. 

In  conclusion, our  findings  constitute explorative evidence  for a  role of acetylcholine  in 

airway  inflammation  in  patients  with  COPD.  This  is  a  novel  and  sparsely  explored 

mechanism that could be relevant for treatment strategies, but first asks for confirmation. 

   

Lung denervation attenuates inflammation 

 105 

Acknowledgements 

The authors would like to thank the Netherlands Lung Foundation (grant: 3.2.08.014) and 

Holaira Inc. for financial support. 

   

Chapter 5 

106 

Supplement 

Methods 

Details of TLD Procedure 

Targeted lung denervation (TLD) was performed using a bronchoscopically guided catheter 

based  lung denervation  system  (Holaira,  Inc., Plymouth, MN, USA) delivered during  two 

rigid bronchoscopic procedures 30 days apart, performed under general anesthesia  in an 

outpatient setting. The lung denervation system includes a catheter with a stainless steel 

internally  cooled  electrode,  thermocouple,  expandable  balloon,  and  coolant  entry/exit 

tubing  that  are  attached  to  a  separate  radiofrequency  generator,  cooling  console,  and 

coolant  pump.  The  cooled  electrode  is  designed  to  generate  therapeutic  lesions  at  a 

sufficient depth from the  inner surface of the main right and  left bronchus to ablate the 

airway nerves that travel parallel to and outside of the main bronchi and  into the  lungs. 

The expandable balloon provided protective cooling to minimize airway wall effects of the 

main bronchi during radiofrequency ablation of the nerves. The electrode was placed and 

activated  as  prescribed  in  up  to  8  positions  per  bronchus  to  ensure  complete 

circumferential treatment. Bronchoscopic and fluoroscopic visualization was used to guide 

electrode positioning.  

Analysis on bronchial wash and brush 

On  the  bronchial  wash,  a  differential  cell  count  was  performed,  and  cytokine 

concentrations were measured. For a differential cell count, cytospin‐preparations were 

stained with May–Grünwald  and  Giemsa  (both  Sigma,  St.  Louis)  and  a  cell  count was 

performed by  counting at  least 400  cells  in duplicate  in a blinded  fashion.  Levels of 26 

cytokines  in  the wash were determined using a multiplex assay  (Millipore, Billerica, MA, 

USA). The following cytokines were assessed: eotaxin, G‐CSF, GM‐CSF, IFN‐α2, IFN‐γ, IL‐1α, 

IL‐1β, IL‐2, IL‐3, IL‐4, IL‐5, IL‐6, IL‐7, IL‐8, IL‐10, IL‐12 (p40), IL‐12 (p70), IL‐13, IL‐15, IL‐17, IP‐

10, MCP‐1, MIP‐1α, MIP‐1β, TNF‐α, and TNF‐β. From the bronchial brush, total RNA was 

extracted  (Qiagen, Venlo,  The Netherlands),  reverse  transcribed,  and  subjected  to qRT‐

PCR. qRT‐PCR was performed with denaturation at 94°C for 30 seconds, annealing at 59°C 

for 30 seconds and extension at 72°C for 30 seconds for 40 cycles followed by 10 minutes 

at  72°C.  Real‐time  PCR  data were  analyzed  using  the  comparative  cycle  threshold  (Ct: 

amplification cycle number) method. The amount of  target gene was normalized  to  the 

endogenous reference gene 18S ribosomal RNA.  

 

   

Lung denervation attenuates inflammation 

 107 

 

Table S1. Levels of inflam

matory cells and cytokines in

 bronchial w

ash fluid. C

CL2: also known as MCP‐1, CCL4: also known as MIP‐1β; C

CL11: also known as eotaxin;  

CXCL8: also known as IL‐8; C

XCL10: also known as IP‐10. O

ther cytokines were below the detection limit of 3.2 pg/ml.  

   

Subject 1 

Subject 2 

Subject 3 

Subject 4 

Subject 5 

Subject 6 

Subject 7 

0 

30 

0 

30 

0 

30 

0 

30 

0 

30 

0 

30 

0 

30 

Cells  

in wash 

(% of 

total 

cells) 

Neu

trophils 

32.45 

17.19 

18.40 

20.13 

22.48 

19.19 

60.21 

39.88 

10.87 

32.50 

70.63 

39.00 

49.75 

29.75 

Macrophages 

66.30 

81.63 

80.66 

78.94 

73.83 

78.88 

38.35 

58.38 

87.82 

66.31 

28.44 

59.19 

46.50 

67.29 

Lymphocytes 

1.06 

1.19 

0.69 

0.94 

2.06 

1.75 

0.25 

1.00 

1.25 

0.31 

0.31 

0.19 

0.19 

0.23 

Eosinophils 

0.19 

0.00 

0.25 

0.00 

1.62 

0.19 

1.19 

0.75 

0.06 

0.88 

0.63 

0.50 

3.56 

2.15 

Proteins  

in wash 

(pg/ml) 

CCL2 

80.98 

27.70 

47.02 

13.71 

73.73 

262.28 

49.02 

29.71 

14.78 

35.45 

131.51 

214.44 

85.48 

106.10 

CCL4 

32.23 

5.80 

10.71 

0.00 

12.12 

0.00 

12.65 

5.61 

12.61 

14.99 

20.31 

19.20 

16.36 

13.49 

CCL11 

12.46 

5.19 

12.71 

4.73 

5.20 

4.41 

7.83 

6.39 

12.20 

19.80 

32.32 

27.05 

25.10 

23.69 

CXCL8 

382.55 

98.26 

303.31 

98.65 

146.73 

89.49 

334.34 

253.24 

177.80 

274.15 

517.86 

568.10 

458.91 

899.18 

CXCL10 

231.51 

80.04 

195.21 

42.55 

79.32 

65.51 

145.77 

135.46 

34.71 

52.81 

193.74 

319.31 

869.57 

710.37 

G‐CSF 

108.24 

39.21 

94.48 

38.91 

33.00 

42.11 

119.97 

66.87 

79.01 

165.35 

294.60 

237.03 

51.75 

80.11 

IFNα2 

21.36 

13.78 

14.82 

9.81 

6.36 

13.09 

13.17 

11.79 

10.05 

4.03 

7.72 

16.25 

20.44 

14.84 

IL‐6 

19.42 

5.59 

21.18 

4.81 

4.67 

3.91 

21.49 

17.39 

1.18 

8.75 

15.89 

15.06 

16.26 

15.98 

IL‐7 

11.70 

4.00 

5.18 

1.19 

2.74 

2.74 

4.00 

5.53 

3.55 

2.80 

10.40 

7.34 

10.80 

9.43 

 

Chapter 5 

108 

References 

(1) Slebos DJ, Klooster K, Koegelenberg CFN, Theron J, Steyn D, Mayse M. Efficacy of targeted  lung 

denervation on patients with moderate to severe COPD [abstract]. ERJ 2014: 44; Suppl. 58: P1774.  

(2)  Tashkin  DP,  Celli  B,  Senn  S,  Burkhart  D,  Kesten  S,  Menjoge  S,  Decramer  M,  UPLIFT  Study 

Investigators. A 4‐year  trial of  tiotropium  in  chronic obstructive pulmonary disease. N Engl  J Med 

2008;359:1543‐1554.  

(3) Powrie DJ, Wilkinson TM, Donaldson GC, Jones P, Scrine K, Viel K, Kesten S, Wedzicha JA. Effect of 

tiotropium on  sputum and  serum  inflammatory markers and exacerbations  in COPD. Eur Respir  J 

2007;30:472‐478.  

(4) Morice AH, Celli B, Kesten S, Lystig T, Tashkin D, Decramer M. COPD  in young patients: a pre‐

specified analysis of the four‐year trial of tiotropium (UPLIFT). Respir Med 2010;104:1659‐1667.  

 

 

 

   

 

 

   

 

 

 

 

 

CHAPTER 6 

MUSCARINIC M3 RECEPTORS CONTRIBUTE TO ALLERGEN‐

INDUCED AIRWAY REMODELING IN MICE 

 

 

 

 

Loes E.M. Kistemaker 

I. Sophie T. Bos 

Willemieke M. Mudde 

Machteld N. Hylkema 

Pieter S. Hiemstra 

Jürgen Wess 

Herman Meurs  

Huib A.M. Kerstjens 

Reinoud Gosens 

 

Am J Respir Cell Mol Biol, 2014, 50(4):690‐8 

Chapter 6 

112 

Abstract 

Rationale 

Asthma  is  a  chronic  obstructive  airway  disease,  characterized  by  inflammation  and 

remodeling. Acetylcholine  contributes  to  symptoms by  inducing bronchoconstriction  via 

the  muscarinic  M3  receptor.  Recent  evidence  suggests  that  bronchoconstriction  can 

regulate airway remodeling and therefore implies a role for the M3 receptor. In this study, 

the contribution of the M3 receptor to allergen‐induced remodeling was investigated using 

M3 receptor subtype deficient (M3R‐/‐) mice. Wild‐type, M1R

‐/‐ and M2R‐/‐ mice were used 

as controls. 

Methods 

C57Bl/6 mice were sensitized and challenged with ovalbumin (twice weekly, for 4 weeks). 

Control animals were challenged with saline. 

Results 

Allergen exposure  induced goblet cell metaplasia, airway smooth muscle thickening (1.7‐

fold), pulmonary vascular smooth muscle remodeling (1.5‐fold) and deposition of collagen 

type  I  (1.7‐fold)  and  fibronectin  (1.6‐fold)  in  the  airway wall  of wild‐type mice.  These 

effects were absent or markedly lower in M3R‐/‐ mice (30‐100%), whereas M1R

‐/‐ and M2R‐/‐ 

mice  responded  similar  to  wild‐type  mice.  In  addition,  airway  smooth  muscle  and 

pulmonary vascular  smooth muscle mass were 35‐40%  lower  in  saline‐challenged M3R‐/‐ 

mice  compared  to wild‐type mice.  Interestingly,  allergen‐induced  airway  inflammation, 

assessed  as  infiltrated  eosinophils  and  TH2‐cytokine  expression,  was  similar  or  even 

enhanced in M3R‐/‐ mice. 

Conclusions 

Our  data  indicate  that  acetylcholine  contributes  to  allergen‐induced  remodeling  and 

smooth muscle mass via the M3 receptor, and not via M1 or M2 receptors. No stimulatory 

role  for M3  receptors  in allergic  inflammation was observed,  suggesting  that  the  role of 

acetylcholine in remodeling is independent of the allergic inflammatory response and may 

involve bronchoconstriction. 

 

Introduction 

Asthma  is  an  obstructive  lung  disease,  characterized  by  airway  inflammation  and 

remodeling.  In  the  inflammatory  process  eosinophils,  mast  cells  and  T  cells  play  an 

important  role.  Inflammation  is mainly  regulated by  the T‐helper  type 2  (TH2) cytokines 

interleukin  (IL)‐4,  IL‐5  and  IL‐13  (1).  The  inflammatory  response  may  contribute  to 

remodeling  of  the  airways,  inducing  structural  changes  such  as  goblet  cell metaplasia, 

airway smooth muscle  thickening and subepithelial  fibrosis  (2). Furthermore, pulmonary 

M3 receptors promote allergen‐induced remodeling 

 113 

vascular  remodeling  and  increased  angiogenesis  are  observed,  associated  with  higher 

vascular endothelial growth factor (VEGF) release (2, 3).  

The parasympathetic neurotransmitter acetylcholine  induces bronchoconstriction via M3 

receptor stimulation and can thereby contribute to symptoms and loss of lung function in 

asthma  (chapter 2). Parasympathetic nerve activity  is  increased  in patients with asthma 

and  the  airways  are  hyperresponsive  to  cholinergic  stimuli  (4,  5).  Indeed,  a  recent 

randomized controlled trial demonstrated that the  long‐acting anticholinergic tiotropium 

induces bronchodilation  in symptomatic asthma patients, when used on top of standard 

combination  therapy  of  inhaled  glucocorticosteroids  and  long‐acting  β2‐agonists  (6), 

indicating a role for muscarinic receptors in airflow obstruction in asthma (7‐9).  

Recent  evidence  indicates  that  acetylcholine  also  regulates  airway  inflammation  and 

remodeling, as indicated by the protective effects of anticholinergics on these parameters 

in animal models of asthma (10‐12). Inhibition of remodeling by anticholinergics may be a 

consequence  of  reduced  inflammation,  but might  also  be  caused  by  direct  inhibitory 

effects on bronchoconstriction. This latter hypothesis is supported by a recent study from 

Grainge et al., who demonstrated that repeated methacholine challenges induced airway 

remodeling in asthma patients, with no effect on inflammation (13). 

The  lung expresses multiple muscarinic  receptor  subtypes  that have differential  roles  in 

regulating bronchoconstriction,  inflammation and remodeling  (chapter 2). This  limits the 

interpretation  of  the  effects  of  non‐selective  anticholinergics  and muscarinic  receptor 

agonists on  these parameters. Since  the M3 receptor  is  the muscarinic receptor subtype 

that causes bronchoconstriction in the airways (14), we studied the specific role of the M3 

receptor  in  allergen‐induced  inflammation  and  remodeling  using M3  receptor  subtype 

deficient (M3R‐/‐) mice. We investigated the role of the M3 receptor on ovalbumin‐induced 

goblet cell metaplasia, airway smooth muscle thickening, pulmonary vascular remodeling, 

extracellular matrix  deposition,  airway  eosinophilia  and  cytokine  expression. M1R‐/‐  and 

M2R‐/‐ mice were used to verify that the effects were specific for the M3 receptor. In this 

study we demonstrate  the  specific  involvement of  the M3  receptor  in  allergen‐induced 

airway remodeling in vivo.  

 

 

 

 

 

Chapter 6 

114 

Methods 

Animals 

Homozygous, inbred, specific‐pathogen‐free breeding colonies of M1R‐/‐, M2R

‐/‐ and M3R‐/‐ 

mice  and  C57Bl/6NTac  wild‐type  (WT)  mice  with  the  same  genetic  background  were 

obtained from Taconic (Cambridge City,  Indiana, USA). The M1R‐/‐, M2R

‐/‐ and M3R‐/‐ mice 

used were on a 129 Sv/J background and backcrossed for at least 10 generations onto the 

C57Bl/6NTac background (15). Knock‐out animals did not differ from their WT littermates 

in  overall  health,  fertility  and  longevity  (15‐17).  Animals  were  housed  conventionally 

under  a  12‐h  light‐dark  cycle  and  received  food  and water  ad  libitum. All  experiments 

were  performed  in  accordance  with  the  national  guidelines  and  approved  by  the 

University of Groningen Committee for Animal Experimentation (number: 5463A). 

Animal model 

Female mice  (n=8‐10 per  group, 10–12 weeks old) were  sensitized  to ovalbumin  (OVA; 

Sigma‐Aldrich, Zwijndrecht, The Netherlands) on days 1, 14 and 21 by an  intraperitoneal 

injection  of  10  µg  OVA  emulsified  in  1.5 mg  aluminium  hydroxide  (Aluminject;  Pierce 

Chemical,  Etten‐Leur,  The Netherlands)  and  diluted  to  200 µl with  phosphate  buffered 

saline (PBS). Subsequently, mice were challenged with saline or OVA aerosols (1% in PBS) 

for 20 minutes twice weekly on consecutive days for 4 weeks (figure 1). The aerosol was 

delivered  to  a  Perspex  exposure  chamber  (9  l)  by  a De Vilbiss  nebulizer  (type  646; De 

Vilbiss, Somerset, PA) driven by an airflow of 40 l/min providing an aerosol with an output 

of 0.33 ml/min as described previously (18).  

 

 

Figure 1. Experimental procedure. Female C57Bl/6NTac mice  (n=8‐10 per group) were sensitized to ovalbumin 

on day 1, 14 en 21. Subsequently, mice were challenged with saline or ovalbumin aerosols for 20 minutes twice 

weekly for 4 weeks. Twenty‐four hours after the last challenge mice were sacrificed and lungs were harvested. 

 

Tissue collection 

Twenty‐four hours  after  the  last  challenge,  animals were  euthanized by  intraperitoneal 

pentobarbital  injection  (400  mg/kg,  hospital  pharmacy,  University  Medical  Center 

Groningen) and  lungs were harvested. The  smallest  lower  left  lobe was  snap  frozen  for 

mRNA  analysis,  the  upper  left  lobe  was  snap  frozen  for  multiplex  ELISA  and  protein 

M3 receptors promote allergen‐induced remodeling 

 115 

analysis, the two  lower right  lung  lobes were snap frozen for  immunohistochemistry and 

the  upper  right  lobe  was  formalin  fixed  and  embedded  in  paraffin  for 

immunohistochemistry.  A  complete  description  of  the  methods  for  mRNA  analysis, 

Western Blot analysis, cytokine analysis and  immunohistochemistry can be  found  in  the 

supplement. 

Statistical analysis 

Data  are presented  as mean  ±  s.e. of  the mean.  Statistical differences between means 

were calculated using two‐way ANOVA, followed by Newman Keuls multiple comparison 

tests. Differences were considered significant at p<0.05. 

 

Results 

Goblet cell metaplasia 

In  order  to  investigate  the  effect  of  ovalbumin  challenge  on  mucus‐producing  cells, 

sections were stained with PAS to identify goblet cells and MUC5AC gene expression was 

analyzed in lung homogenates. Ovalbumin challenge increased the number of goblet cells 

in  the  airways  of WT mice,  as well  as  in M3R‐/‐ mice  (figure  2A  and  B).  However,  the 

increase  in  goblet  cells  was  30%  lower  in M3R‐/‐ mice  compared  to  that  in WT mice 

(p<0.05). This  inhibitory effect was not  seen  in mice deficient  in  the M1 or M2  receptor 

(figure  S1).  In  line with  findings  on  goblet  cell  number,  ovalbumin  challenge  increased 

MUC5AC expression  in the  lungs of WT mice and M3R‐/‐ mice, but the  increase was 35% 

lower in M3R‐/‐ mice compared to WT mice (p<0.05; figure 2C).  

Airway smooth muscle remodeling 

To  assess  airway  smooth muscle  remodeling,  lung  sections were  stained  for  α‐smooth 

muscle (sm)‐actin. Ovalbumin challenge induced a 1.7‐fold increase in α‐sm‐actin positive 

area around  the airways of WT mice  (figure 3). This  increase was  fully absent  in M3R‐/‐ 

mice (figure 3). Interestingly, sm‐α‐actin positive area was lower in M3R‐/‐ mice compared 

to WT mice, irrespective of saline or ovalbumin treatment (p<0.001 by two‐way ANOVA). 

Mice  deficient  in  the M1  or M2  receptor  responded  similar  to WT mice,  although  the 

increase  in  α‐sm‐actin deposition  in  response  to ovalbumin was not  significant  in M2R‐/‐ 

mice (figure S2). This indicates that these effects are specific for the M3 receptor.  

Chapter 6 

116 

 Figure 2. Effect of ovalbumin challenge on goblet cell metaplasia  in  the airways of WT and M3R

‐/‐ mice. Mice 

were  treated  as described  in  figure 1.  Lungs were  collected 24 hours  after  the  last  challenge  and  goblet  cell 

numbers were determined by PAS  staining. Quantification  (A)  and  representative  images  (B)  are  shown.  Five 

airways were analyzed  for each animal, n=8‐10 mice per group, goblet cells are  indicated by arrows. MUC5AC 

gene expression was assessed  in  lung homogenates, n=8‐10 mice per group (C). Data represent mean ± s.e. of 

the  mean.  ***  p<0.001  compared  to  saline‐challenged  control  mice,  #  p<0.05  compared  to  ovalbumin‐

challenged WT mice. Magnification 200x. 

 

M3 receptors promote allergen‐induced remodeling 

 117 

Figure 3. Effect of ovalbumin challenge on airway smooth muscle thickening  in WT and M3R‐/‐ mice. Mice were 

treated as described in figure 1. Lungs were collected 24 hours after the last challenge and airway smooth muscle mass was determined by α‐sm‐actin staining. Quantification (A) and representative images (B) are shown. Airway α‐sm‐actin  positive  area  is  indicated  by  arrows. Data  represent mean  ±  s.e.  of  the mean.  Five  airways were analyzed  for each animal, n=8‐10 mice per group. ** p<0.01 compared  to saline‐challenged control mice, ### p<0.001 compared to ovalbumin‐challenged WT mice. Magnification 200x.  

 

Vascular remodeling 

To evaluate vascular remodeling, the α‐sm‐actin positive area  in pulmonary arteries was 

determined. Arterial α‐sm‐actin positive area was  increased by 1.5‐fold  in WT mice after 

ovalbumin challenge (figure 4A and B). A similar 1.5‐fold  increase was observed  in M3R‐/‐ 

mice; however,  these animals had  significantly  less arterial  α‐sm‐actin compared  to WT 

animals,  irrespective  of  saline  or  ovalbumin  treatment  (p<0.001  by  two‐way  ANOVA; 

figure 4A and B). Next, VEGF expression  in  lung homogenates was analyzed. Ovalbumin 

challenge induced a 1.4‐fold increase in the expression of VEGF in WT mice, whereas only 

a small increase in VEGF expression in M3R‐/‐ mice was observed, which was not significant 

(figure  4C).  As  for  arterial  α‐sm‐actin  positive  area,  basal  levels  of  VEGF  in  lung 

homogenates were lower in M3R‐/‐ mice than in WT mice (figure 4C). 

Chapter 6 

118 

  

Figure 4. Effect of ovalbumin challenge on vascular remodeling  in the  lungs of WT and M3R‐/‐ mice. Mice were 

treated  as described  in  figure 1.  Lungs were  collected 24 hours  after  the  last  challenge and  vascular  smooth 

muscle mass was determined by α‐sm‐actin staining. Quantification (A) and representative images (B) are shown. 

Five airways were analyzed for each animal, n=8‐10 mice per group. Vascular endothelial growth factor (VEGF) 

release was assessed in lung homogenates, n=6‐8 mice per group (C). Data represent mean ± s.e. of the mean.  

* p<0.05; ** p<0.01  compared  to  saline‐challenged  control mice, # p<0.05; ## p<0.01  compared  to WT mice. 

Magnification 200x. 

 

 

Extracellular matrix deposition 

To  assess  the  effects  of  ovalbumin  challenge  on  the  deposition  of  extracellular matrix 

proteins,  collagen  type  I  positive  area  was  determined  by  immunohistochemistry  and 

fibronectin  protein  levels  were  determined  by  Western  blot  analysis  as 

immunohistochemistry  for  fibronectin produced  a  too diffuse pattern  to be  adequately 

quantifiable (data not shown). Ovalbumin challenge induced a 1.7‐fold increase in collagen 

type I deposition around the airways of WT mice (figure 5A and B). This increase was fully 

absent in M3R‐/‐ mice (figure 5A and B). Fibronectin protein level was enhanced by 1.6‐fold 

in WT mice after ovalbumin challenge (figure 5C and D). Similar to the results for collagen 

M3 receptors promote allergen‐induced remodeling 

 119 

deposition,  ovalbumin‐induced  fibronectin  deposition  was  completely  absent  in M3R‐/‐ 

mice (figure 5C and D). Baseline levels of collagen I and fibronectin were similar in WT and 

M3R‐/‐ mice. 

 

 Figure 5. Effect of ovalbumin challenge on extracellular matrix deposition in the airways of WT and M3R

‐/‐ mice. 

Mice were treated as described in figure 1. Lungs were collected 24 hours after the last challenge and collagen 

type I positive area was determined by immunohistochemistry. Quantification (A) and representative images (B) 

are shown. Five airways were analyzed  for each animal, n=8‐10 mice per group. Fibronectin protein  level was 

determined by Western Blot analysis on  lung homogenates. Quantification  (C) and a  representative blot  (D)  is 

shown, n=8‐10 mice per group. Sal = saline, OA = ovalbumin. Data represent mean ± s.e. of the mean. * p<0.05; 

** p<0.01 compared  to saline‐challenged control mice, # p<0.05 compared  to ovalbumin‐challenged WT mice. 

Magnification 200x. 

 

 

 

   

Chapter 6 

120 

Inflammation 

In order  to  investigate whether  the observed effects on  remodeling could be  related  to 

reduced inflammation in M3R‐/‐ mice after ovalbumin challenge, the number of eosinophils 

and the expression of cytokines in the lungs of WT and M3R‐/‐ mice were analyzed. In WT 

mice, ovalbumin challenge induced a 10‐fold increase in the number of eosinophils (figure 

6A and B). A similar 10‐fold  increase was observed  in M3R‐/‐ mice  (figure 6A and B). The 

number  of  eosinophils  was  also  increased  in  M1R‐/‐  and  M2R

‐/‐  mice  after  ovalbumin 

challenge  (figure  S3).  Subsequently,  cytokine  expression  was  analyzed.  Ovalbumin 

challenge  induced an  increase  in  IL‐4  (figure 6C),  IL‐5  (figure 6D) and  IL‐17  (figure 6E)  in 

WT mice at the protein level. Expression of these cytokines was further enhanced in M3R‐/‐ 

mice  compared  to WT mice  (figure 6C, D and E).  Similar  findings were obtained  at  the 

gene expression level for IL‐13 (figure 6F). 

 Figure 6. Effect of ovalbumin challenge on  inflammatory responses  in the airways of WT and M3R

‐/‐ mice. Mice 

were  treated  as  described  in  figure  1.  Lungs were  collected  24  hours  after  the  last  challenge  and  eosinophil 

numbers were determined by DAB  staining. Quantification  (A) and  representative  images  (B) are  shown. Five 

airways  were  analyzed  for  each  animal,  n=8‐10 mice  per  group.  Cytokine  expression  was  assessed  in  lung 

homogenates. Levels of  IL‐4  (C),  IL‐5  (D) and  IL‐17  (E) were assessed by ELISA and  levels of  IL‐13  (F) by mRNA 

analysis, n=8‐10 mice per  group. Data  represent mean ±  s.e. of  the mean. * p<0.05;  ** p<0.01; *** p<0.001 

compared  to  saline‐challenged  control  mice,  #  p<0.05;  ##  p<0.01;  ###  p<0.001  compared  to  ovalbumin‐

challenged WT mice. Magnification 200x. 

M3 receptors promote allergen‐induced remodeling 

 121 

The non‐neuronal cholinergic system 

It has been proposed that the non‐neuronal cholinergic system  (NNCS) might contribute 

to airway  inflammation and remodeling (chapter 2, 19). In order to  investigate effects of 

ovalbumin challenge on the NNCS, gene expression of different components of the NNCS 

was analyzed  in  lung tissue homogenates of WT mice,  including the choline transporters 

CHT1 and CTL1, the acetylcholine synthesizing enzyme ChAT, the acetylcholine degrading 

enzyme  AChE  and  the  different muscarinic  receptor  subtypes.  As  shown  in  figure  S4, 

ovalbumin challenge did not influence expression levels of these components of the NNCS. 

Discussion 

In  this  study we demonstrate  that  the muscarinic M3  receptor plays a profound  role  in 

allergen‐induced  airway  remodeling.  In  M3R‐/‐  mice,  goblet  cell  metaplasia  is  partly 

prevented  compared  to WT  mice  after  ovalbumin  challenge,  whereas  airway  smooth 

muscle  thickening  and  excessive  extracellular matrix  deposition  are  completely  absent. 

These  effects  are  specific  for  the M3  receptor,  since M1R‐/‐  and M2R

‐/‐ mice  responded 

similar to ovalbumin as WT mice. Surprisingly, no stimulatory role for the M3 receptor  in 

allergic inflammation was observed, indicating that the role of acetylcholine in remodeling 

does not  involve an  increased TH2  type  inflammatory  response. This study  is  the  first  to 

demonstrate  the  specific  role  of  the  M3  receptor  in  regulating  allergen‐induced 

remodeling  in  vivo  and  implies  that  alternative  mechanisms  to  induce  remodeling, 

independent of eosinophilic inflammation, play an important role. 

Remodeling  of  the  airways,  including  goblet  cell  metaplasia,  airway  smooth  muscle 

thickening  and  excessive  extracellular  matrix  deposition,  is  an  important  feature  of 

asthma. It is known from in vitro studies that acetylcholine can induce proliferation of and 

mucus secretion  from epithelial cells  (20), which can be  inhibited by aclidinium, a novel 

long‐acting  anticholinergic  (21).  Furthermore,  muscarinic  receptor  stimulation  can 

enhance growth factor‐induced proliferation of airway smooth muscle cells and fibroblasts 

(22,  23)  and  enhances  extracellular matrix  deposition  (24,  25)  and  contractile  protein 

expression in these cells (26). Moreover, fibroblast to myofibroblast transition appears to 

be regulated by muscarinic receptors (27). This  is further supported by  in vivo studies  in 

mice  and  guinea  pigs,  in which  ovalbumin‐induced  structural  changes,  including mucus 

gland hypertrophy, airway smooth muscle remodeling and excessive extracellular matrix 

deposition,  can  be  inhibited  by  the  anticholinergic  tiotropium  (10‐12).  Acetylcholine 

contributes to the asthmatic response in these models as indicated by profound inhibitory 

effects  of  tiotropium  (10,  28).  Here,  we  demonstrate  that  the  remodeling‐promoting 

Chapter 6 

122 

effects of acetylcholine in vivo in response to allergen exposure are solely mediated via M3 

receptors, and not via M1 or M2 receptors.  

Furthermore,  our  study  also  demonstrates  that  the M3  receptor  is  involved  in  smooth 

muscle mass development and/or maintenance, since basal levels of α‐sm‐actin are lower 

in M3R‐/‐ mice compared to WT mice, both in the airways and arteries. For the airways, this 

may imply that parasympathetic regulation of for example bronchoconstriction is needed 

to fully develop and/or maintain the smooth muscle, as this  is  lacking  in M3R‐/‐ mice. For 

the arteries this is less easily explained. Possibly, the lower levels of pro‐angiogenic factors 

such as VEGF, or cardiovascular effects secondary to M3 deficiency might account for the 

decreased  actin  levels.  M3R‐/‐  mice  show  intact  bradycardia  in  response  to  vagal 

stimulation  but  have  reduced  peripheral  vasodilation  in  response  to  methacholine 

stimulation (29).  

There are some limitations to our study. Using an animal model we recapitulated different 

features of human asthma,  including eosinophilia, goblet cell metaplasia, airway smooth 

muscle thickening and enhanced extracellular matrix deposition. However, some features 

of  asthma,  including  cough  and mucus  gland  hypertrophy,  are  not  observed  in mice, 

whereas  these may be  sensitive  to  cholinergic  inhibition  as demonstrated  recently  (10, 

28).  Furthermore,  to  study  the  contribution  of  the  individual  muscarinic  receptor 

subtypes, we used muscarinic receptor knock‐out mice. Although these mice do not differ 

from WT mice  in overall health,  fertility  and  longevity,  they do have  some  known, and 

maybe also unknown, developmental differences. There  is no clear alternative however, 

as  subtype‐selective  agonists  are  not  available  and  the  subtype  selective M3  receptor 

antagonists that are available have significant affinity for M1 receptors. The same accounts 

for tiotropium, which is known to be kinetically selective for M3 receptors, but also has a 

substantial dissociation half‐life for the M1 receptor (30). Despite the  limitations, the use 

of muscarinic receptor knockout mice does provide a unique strength and novel view on 

the  role of muscarinic  receptor  subtypes  in allergic airways disease, as we now present 

strong evidence that M3 receptors, and not M1 or M2 receptors, are  involved  in allergen‐

induced airway remodeling in vivo. 

We  did  not  observe  a  stimulatory  role  for  individual muscarinic  receptor  subtypes  on 

inflammation in our study. If anything, the inflammatory response was enhanced in M3R‐/‐ 

mice.  Previously,  it  has  been  shown  that  acetylcholine  exerts  pro‐inflammatory  effects 

mediated  by  muscarinic  receptors,  both  in  vitro  and  in  vivo  (chapter  2).  Ovalbumin‐

induced  eosinophilia  can  be  inhibited  by  tiotropium  in  guinea  pigs  and mice  (10,  12). 

Similar  inhibitory effects of tiotropium are found on ovalbumin‐induced cytokine release 

M3 receptors promote allergen‐induced remodeling 

 123 

in  mice,  including  IL‐4,  IL‐5  and  IL‐13  (12).  The  absence  of  an  inhibitory  effect  on 

eosinophilia  and  increased  cytokine production  as observed  in M3R‐/‐ mice  in our  study 

were  therefore unexpected. A possible explanation  for  this observation  is  that multiple 

subtypes  may  be  involved  in  the  inflammatory  response  induced  by  acetylcholine. 

Tiotropium  is  kinetically  selective  for  M3  receptors;  however,  also  has  a  substantial 

dissociation  half‐life  for  the M1  receptor  (30).  As  shown  in  figure  S3,  there  is  a  trend 

towards lower eosinophil numbers in M1R‐/‐ mice after ovalbumin challenge compared to 

WT  mice.  It  is  therefore  possible  that  the  pro‐inflammatory  effect  of  acetylcholine 

depends on  the simultaneous activation of both M1 and M3  receptors, and  that a single 

muscarinic receptor  is not sufficient to  induce these effects. Anti‐inflammatory effects of 

acetylcholine in certain experimental settings (chapter 2, 31) and relaxation of bronchi by 

acetylcholine‐induced NO release (32), may also help to explain the differential outcomes 

of these studies. Furthermore, the antimuscarinic agents were administered after allergen 

sensitization in the above mentioned studies, whereas the mice used in our protocols lack 

specific  muscarinic  receptors  throughout  development.  Moreover,  since  cytokines 

responsible for recruiting eosinophils and inducing goblet cell metaplasia are increased in 

M3R‐/‐ mice compared to WT mice, whereas eosinophil numbers are similar and goblet cell 

numbers are even reduced in M3R‐/‐ mice compared to WT mice, M3R

‐/‐ mice may actually 

be less sensitive to inflammatory mediators.  

The finding that ovalbumin‐induced remodeling is greatly inhibited in M3R‐/‐ mice, with no 

inhibitory effect on inflammation, has significant implications. Generally, airway structural 

changes  after  allergen  challenge  are  attributed  to  eosinophilic  inflammation  (33). 

However, Grainge et al. recently demonstrated that repeated methacholine challenges in 

asthma  patients,  inducing  bronchoconstriction,  are  sufficient  to  induce  remodeling 

without  causing  an  inflammatory  response  (13).  Thus, methacholine  challenge  induced 

epithelial  TGF‐β  staining,  collagen  deposition,  goblet  cell metaplasia  and  epithelial  cell 

proliferation, with  no  effect  on  eosinophil  numbers  (13).  In  vitro, muscarinic  receptor 

stimulation  in combination with mechanical strain can  induce α‐sm‐actin and sm‐myosin 

mRNA  in  intact  bovine  tracheal  smooth  muscle  strips  and  myosin  light‐chain  kinase 

expression  in  human  airway  smooth  muscle  cells  (34,  35).  Moreover,  methacholine‐

induced  bronchoconstriction  induces  epithelial  epidermal  growth  factor  receptor 

activation in mice (36) and promotes TGF‐β release and airway smooth muscle remodeling 

in  guinea pig  lung  slices  (37). The M3  receptor  is  the muscarinic  receptor  subtype  that 

mediates  bronchoconstriction  and  in M3R‐/‐ mice  bronchoconstriction  is  abolished  (29). 

Therefore our current findings are in line with the above mentioned findings and suggest 

that  inhibition  of  bronchoconstriction  may  underlie  the  inhibition  of  allergen‐induced 

remodeling  after  knock‐out  of  the M3  receptor.  Our  hypothesis  is  that  acetylcholine‐

Chapter 6 

124 

induced  bronchoconstriction  via  M3  receptors  results  in  mechanical  stress  and  the 

subsequent  release  of  growth  factors  (e.g.  TGF‐β)  and  activation  of mechanosensitive 

transcription factors (e.g. myocardin). These events drive remodeling of the airways, both 

in  the  airway  smooth  muscle  and  the  airway  submucosal  compartment,  suggesting 

activation  of  both  airway  smooth muscle  cells  and  fibroblasts  by  acetylcholine.  This  is 

supported  by  the  findings  from  Grainge  et  al.,  who  report  that  bronchoconstriction 

activates  remodeling  processes  in  the  epithelial  and  submucosal  compartment, 

presumably  related  to mechanical  compression by  the airway  smooth muscle  (13). This 

hypothesis implies that prevention of bronchoconstriction in patients with asthma may be 

an important means of preventing remodeling later on. 

Currently,  anticholinergic  controller  therapy  is  not  included  in  the  guidelines  for  the 

treatment of asthma. However,  recently  it has been  shown  that  tiotropium  can  induce 

broncodilation in patients with severe asthma on top of the use of inhaled glucocorticoids 

and  long‐acting  β2‐agonists  (6).  Furthermore,  tiotropium  reduced  severe  exacerbations 

and episodes of worsening of asthma (6). Moreover, adding tiotropium to glucocorticoid 

therapy is more effective than doubling the glucocorticoid dose by means of morning peak 

expiratory flow, the proportion of asthma‐control days, the forced expiratory volume in 1 

second and daily symptom scores (9). Together, these observations  indicate that asthma 

patients may benefit  from  anticholinergic  therapy. Our data  suggests  that M3  receptor 

antagonism  may  also  affect  airway  remodeling  in  asthma  patients,  however,  clinical 

studies are clearly required to confirm this interesting hypothesis. 

In  the  last  decade,  it  has  become  clear  that  non‐neuronal  cells  can  also  produce  and 

release acetylcholine and it has been suggested that the observed effects of acetylcholine 

on inflammation and remodeling might be, at least in part, attributed to this non‐neuronal 

cholinergic system (NNCS) (chapter 2, 38, 39). Direct evidence for such a role is still lacking 

however.  In contrast  to  the previously  reported decreased expression  in components of 

the  NNCS  after  ovalbumin  challenge  (40),  we  did  not  find  any  regulation  of  these 

components  after  ovalbumin  challenge.  Similarly,  such  type  of  regulation was  also  not 

observed after cigarette smoke‐induced  inflammation  (chapter 3). Based on our studies, 

which  are  limited  to measurement  of mRNA  expression  levels,  we  cannot  confirm  or 

exclude a role for the NNCS. Until now, evidence for a role of the NNCS  is  limited to the 

fact  that  non‐neuronal  cells  can  produce  acetylcholine  (20,  39).  The  functional 

contribution  of  the  NNCS  to  airway  inflammation  and  remodeling  therefore  warrants 

further research.  

M3 receptors promote allergen‐induced remodeling 

 125 

In  conclusion,  the  results  of  the  present  study  demonstrate  that  the  M3  receptor 

contributes to allergen‐induced airway remodeling  in mice. These  findings provide novel 

insight  into  the  previously  established  role  of  acetylcholine  in  airway  diseases  and 

demonstrate that the remodeling‐promoting effect of acetylcholine is solely mediated via 

M3 receptors. This study may therefore open new perspectives on the role of M3 selective 

anticholinergics in the treatment of asthma. 

 

Acknowledgements 

The authors would  like  to  thank N. de Haas, F. Sinkeler and A. Al Awwadi  for  technical 

assistance. The authors would like to thank the Netherlands Lung Foundation for financial 

support (grant: 3.2.08.014). 

Chapter 6 

126 

Supplement 

Methods 

Immunohistochemistry 

Transverse cross‐sections of 5 µm thick were used for morphometric analyses.  

Goblet cells were stained with Periodic Aced Schiff’s (PAS, Sigma‐Aldrich, Zwijndrecht, The 

Netherlands)  in  paraffin‐embedded  sections.  PAS‐positive  cells  were  counted  and 

expressed per mm2 basement membrane.  

Collagen  type  I  and  α‐sm‐actin  were  stained  on  cryo‐sections  with  a  goat  anti‐type‐I 

collagen antibody (SBA, Birmingham, AL, USA) and a rabbit anti‐alpha smooth muscle actin 

antibody (Abcam, Cambridge, UK), respectively. Primary antibodies were visualised using 

horseradish‐peroxidase‐linked secondary antibodies and diaminobenzidine (Sigma‐Aldrich, 

Zwijndrecht, The Netherlands). Airways within sections were digitally photographed after 

which collagen I and α‐sm‐actin presence around the airway was quantified using Image J 

(National  Institute of Health).  The  surface of positively  stained  tissue was  expressed  as 

mm2 per mm2 basement membrane. 

Eosinophils  were  determined  by  staining  of  cryo‐sections  for  cyanide  resistant 

endogenous peroxidase  activity with diaminobenzidine  (Sigma‐Aldrich,  Zwijndrecht, The 

Netherlands). The number of eosinophils around the airways was counted and expressed 

as number of cells per mm basement membrane.  

mRNA analysis 

Lung homogenates were prepared by pulverizing the tissue under liquid nitrogen and total 

RNA was extracted using the RNeasy mini kit (Qiagen, Venlo, The Netherlands) according 

to  the  manufacturer's  instructions.  Equal  amounts  of  total  mRNA  were  then  reverse 

transcribed  and  cDNA  was  subjected  to  real‐time  qPCR  (Westburg,  Leusden,  The 

Netherlands). Real  time  PCR was performed with denaturation  at 94°C  for 30  seconds, 

annealing  at  59°C  for  30  seconds  and  extension  at  72°C  for  30  seconds  for  40  cycles 

followed by 10 minutes at 72°C. Real‐time PCR data were analyzed using the comparative 

cycle threshold (Ct: amplification cycle number) method. The amount of target gene was 

normalized  to  the endogenous  reference gene 18S  ribosomal RNA. The  specific  forward 

and reverse primers used are listed in table S1. 

 

   

M3 receptors promote allergen‐induced remodeling 

 127 

Table S1. Primers used for qRT‐PCR analysis. CHT1: high‐affinity choline transporter 1; CTL: choline transporter‐

like protein 1; ChAT: choline acetyltransferase; AChE: acetylcholinesterase.  

Gene  Primer sequence  NCBI accession 

number 

MUC5AC  Forward – GAGATGGAGGATCTGGGTCA 

Reverse  – GCAGAAGCAGGGAGTGGTAG 

NM_010844 

IL‐13  Forward – CAGCATGGTATGGAGTGTGG 

Reverse  – AGGCCATGCAATATCCTCTG 

NM_008355.3 

 

CHT1  Forward – GGTTGGAGGAGGCTACATCA 

Reverse  – TATCCCTTGGAACGCATAGG 

AJ401467 

 

CTL1  Forward – GGCAGTGCTGTTCAGAATGA 

Reverse  – ATCTGCTGACAGGCGAGAAT 

NM_133891 

 

ChAT  Forward – GGCTGCAAAGAGACCTCATC 

Reverse  – GCTCTTTCCTTTGCTGTTGG 

NM_009891 

AChE  Forward – CCTGGGTTTGAGGGTACTGA 

Reverse  – GGTTCCCACTCGGTAGTTCA 

NM_009599 

Muscarinic M1 receptor  Forward – AGAAGAGGCTGCCACAGGTA 

Reverse  – CAGACCCCACCTGGACTTTA 

NM_001112697 

Muscarinic M2 receptor  Forward – GAATGGGGATGAAAAGCAGA 

Reverse  – GCAGGGTTGATGGTGCTATT 

NM_203491  

Muscarinic M3 receptor  Forward – CACAGCCAAGACCTCTGACA 

Reverse  – ATGATGTTGTAGGGGGTCCA 

NM_033269 

18S  Forward – AAACGGCTACCACATCCAAG 

Reverse  – CCTCCAATGGATCCTCGTTA 

NR_003278 

 

Western analysis 

Lung  homogenates  were  prepared  by  pulverizing  tissue  under  liquid  nitrogen  and 

subsequent  sonication  in  SDS  lysis  buffer  supplemented  with  protease  inhibitors. 

Homogenates were stored at –80 °C until further use. Protein content was determined by 

a BCA assay according to Pierce. Protein homogenates were separated by sodium dodecyl 

sulfate/polyacrylamide  gel  electrophoresis,  followed  by  standard  immunoblotting 

techniques.  Rabbit  anti‐fibronectin  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands)  and 

mouse anti‐lamin AC  (Santa Cruz biotechnology, CA, USA) were used as  first antibodies. 

Expression levels are expressed relative to Lamin AC. 

   

Chapter 6 

128 

Cytokine analysis 

Lung  homogenates  were  prepared  by  pulverizing  tissue  under  liquid  nitrogen  and 

subsequent sonication  in Tris buffer  (pH=7.4). Homogenates were stored at –80  °C until 

further use. Protein content was determined by a BCA assay according to Pierce. Cytokine 

concentrations  (IL‐4,  IL‐5,  IL‐17  and  VEGF)  were  determined  by  a  MILLIPLEX  assay 

(Millipore, Billerica, USA) on  a  Luminex  100  system using  Starstation  software  (Applied 

Cytometry Systems, Sheffield, UK) according to the manufacturer's instructions. 

 

Figures 

 

  

Figure S1. Effect of ovalbumin challenge on goblet cell metaplasia in the airways of WT, M1R‐/‐, M2R

‐/‐ and M3R

‐/‐ 

mice. Mice were  treated as described  in  figure 1.  Lungs were  collected 24 hours after  the  last  challenge and 

goblet cell numbers were determined by PAS staining. Data represent mean ± s.e. of the mean, five airways were 

analyzed  for  each  animal.  ***  p<0.001  compared  to  saline‐challenged  control mice,  #  p<0.05  compared  to 

ovalbumin‐challenged WT mice, n=8‐10 mice per group. 

 

 

 

 

 

M3 receptors promote allergen‐induced remodeling 

 129 

  

Figure S2. Effect of ovalbumin  challenge on airway  smooth muscle  thickening  in WT, M1R‐/‐, M2R

‐/‐ and M3R

‐/‐ 

mice. Mice were  treated as described  in  figure 1.  Lungs were  collected 24 hours after  the  last  challenge and 

airway smooth muscle mass was determined by α‐sm‐actin staining. Data  represent mean ± s.e. of  the mean. 

Five airways were analyzed  for each animal. * p<0.05  compared  to  saline‐challenged  control mice, ## p<0.01 

compared to ovalbumin‐challenged WT mice, n=8‐10 mice per group. 

 

 

  

Figure S3. Effect of ovalbumin challenge on eosinophilic  inflammation  in  the airways of WT, M1R‐/‐, M2R

‐/‐ and 

M3R‐/‐ mice. Mice were treated as described  in figure 1. Lungs were collected 24 hours after the  last challenge 

and eosinophil numbers were determined by DAB staining. Data represent mean ± s.e. of the mean. Five airways 

were analyzed for each animal. * p<0.05; *** p<0.001 compared to saline‐challenged control mice, n=8‐10 mice 

per group. 

Chapter 6 

130 

 

Figure S4. Effect of ovalbumin challenge on the expression of the non‐neuronal cholinergic system. Mice were 

treated as described  in figure 1. Lungs were collected 24 hours after the  last challenge and gene expression  in 

lung tissue homogenates was analyzed. Ct values corrected for 18S are depicted, expressed as mean ± s.e. of the 

mean, n=4 mice per group. Note that low values mean high expression levels. High‐affinity choline transporter‐1 

(CHT1),  choline  transporter  like  protein‐1  (CTL1),  choline  acetyl  transferase  (ChAT),  acetylcholine‐esterase 

(AChE), M1 receptor (M1R), M2 receptor (M2R) and M3 receptor (M3R). 

M3 receptors promote allergen‐induced remodeling 

 131 

References 

(1) Barnes PJ.  The  cytokine network  in  asthma  and  chronic obstructive pulmonary disease.  J Clin 

Invest 2008;118:3546‐3556.  

(2) Jeffery PK. Remodeling in asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 

2001;164:S28‐38.  

(3) Hoshino M, Nakamura Y, Hamid QA. Gene expression of vascular endothelial growth factor and 

its receptors and angiogenesis in bronchial asthma. J Allergy Clin Immunol 2001;107:1034‐1038.  

(4) Gross NJ. Anticholinergic agents in asthma and COPD. Eur J Pharmacol 2006;533:36‐39.  

(5) Minette  PA,  Lammers  JW, Dixon  CM, McCusker MT,  Barnes  PJ.  A muscarinic  agonist  inhibits 

reflex  bronchoconstriction  in  normal  but  not  in  asthmatic  subjects.  J Appl  Physiol  1989;67:2461‐

2465.  

(6)  Kerstjens  HA,  Engel M,  Dahl  R,  Paggiaro  P,  Beck  E,  Vandewalker M,  Sigmund  R,  Seibold W, 

Moroni‐Zentgraf P, Bateman ED. Tiotropium in asthma poorly controlled with standard combination 

therapy. N Engl J Med 2012;367:1198‐1207.  

(7)  Bateman  ED,  Kornmann  O,  Schmidt  P,  Pivovarova  A,  Engel  M,  Fabbri  LM.  Tiotropium  is 

noninferior  to  salmeterol  in  maintaining  improved  lung  function  in  B16‐Arg/Arg  patients  with 

asthma. J Allergy Clin Immunol 2011;128:315‐322.  

(8) Kerstjens HA, Disse B,  Schroder‐Babo W, Bantje  TA, Gahlemann M,  Sigmund R,  Engel M,  van 

Noord  JA.  Tiotropium  improves  lung  function  in  patients  with  severe  uncontrolled  asthma:  a 

randomized controlled trial. J Allergy Clin Immunol 2011;128:308‐314.  

(9) Peters SP, Kunselman SJ,  Icitovic N, Moore WC, Pascual R, Ameredes BT, Boushey HA, Calhoun 

WJ, Castro M, Cherniack RM, Craig T, Denlinger L, Engle LL, DiMango EA, Fahy JV, Israel E, Jarjour N, 

Kazani  SD,  Kraft M,  Lazarus  SC,  Lemanske  RF,Jr,  Lugogo  N, Martin  RJ, Meyers  DA,  Ramsdell  J, 

Sorkness  CA,  Sutherland  ER,  Szefler  SJ, Wasserman  SI, Walter MJ, Wechsler ME,  Chinchilli  VM, 

Bleecker  ER,  National  Heart,  Lung,  and  Blood  Institute  Asthma  Clinical  Research  Network. 

Tiotropium  bromide  step‐up  therapy  for  adults  with  uncontrolled  asthma.  N  Engl  J  Med 

2010;363:1715‐1726.  

(10)  Bos  IS,  Gosens  R,  Zuidhof  AB,  Schaafsma  D,  Halayko  AJ, Meurs  H,  Zaagsma  J.  Inhibition  of 

allergen‐induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J 

2007;30:653‐661.  

(11)  Gosens  R,  Bos  IS,  Zaagsma  J,  Meurs  H.  Protective  effects  of  tiotropium  bromide  in  the 

progression of airway smooth muscle remodeling. Am J Respir Crit Care Med 2005;171:1096‐1102.  

(12) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y, Minoguchi K, Ohnishi T, Hirose T, 

Nagase H, Ohta K, Adachi M. Effect of tiotropium bromide on airway inflammation and remodelling 

in a mouse model of asthma. Clin Exp Allergy 2010;40:1266‐1275.  

(13) Grainge CL,  Lau  LC, Ward  JA, Dulay V,  Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. 

Effect of bronchoconstriction on airway remodeling in asthma. N Engl J Med 2011;364:2006‐2015.  

(14) Roffel AF, Elzinga CR, Van Amsterdam RG, De Zeeuw RA, Zaagsma J. Muscarinic M2 receptors in 

bovine  tracheal  smooth  muscle:  discrepancies  between  binding  and  function.  Eur  J  Pharmacol 

1988;153:73‐82.  

Chapter 6 

132 

(15) Fisahn A, Yamada M, Duttaroy A, Gan JW, Deng CX, McBain CJ, Wess J. Muscarinic induction of 

hippocampal gamma oscillations requires coupling of the M1 receptor to two mixed cation currents. 

Neuron 2002;33:615‐624.  

(16) Gomeza  J, Shannon H, Kostenis E, Felder C, Zhang L, Brodkin  J, Grinberg A, Sheng H, Wess  J. 

Pronounced  pharmacologic  deficits  in M2 muscarinic  acetylcholine  receptor  knockout mice.  Proc 

Natl Acad Sci U S A 1999;96:1692‐1697.  

(17) Yamada M, Miyakawa T, Duttaroy A, Yamanaka A, Moriguchi T, Makita R, Ogawa M, Chou CJ, 

Xia B, Crawley JN, Felder CC, Deng CX, Wess J. Mice lacking the M3 muscarinic acetylcholine receptor 

are hypophagic and lean. Nature 2001;410:207‐212.  

(18) Melgert BN, Postma DS, Geerlings M,  Luinge MA, Klok PA, van der Strate BW, Kerstjens HA, 

Timens  W,  Hylkema  MN.  Short‐term  smoke  exposure  attenuates  ovalbumin‐induced  airway 

inflammation in allergic mice. Am J Respir Cell Mol Biol 2004;30:880‐885.  

(19)  Gwilt  CR,  Donnelly  LE,  Rogers  DF.  The  non‐neuronal  cholinergic  system  in  the  airways:  an 

unappreciated regulatory role in pulmonary inflammation? Pharmacol Ther 2007;115:208‐222.  

(20) Proskocil BJ, Sekhon HS, Jia Y, Savchenko V, Blakely RD, Lindstrom J, Spindel ER. Acetylcholine is 

an  autocrine or paracrine hormone  synthesized  and  secreted by  airway bronchial epithelial  cells. 

Endocrinology 2004;145:2498‐2506.  

(21) Cortijo  J, Mata M, Milara  J, Donet E, Gavalda A, Miralpeix M, Morcillo EJ. Aclidinium  inhibits 

cholinergic and tobacco smoke‐induced MUC5AC in human airways. Eur Respir J 2011;37:244‐254.  

(22) Gosens R, Dueck G, Rector E, Nunes RO, Gerthoffer WT, Unruh H, Zaagsma J, Meurs H, Halayko 

AJ.  Cooperative  regulation  of GSK‐3  by muscarinic  and  PDGF  receptors  is  associated with  airway 

myocyte proliferation. Am J Physiol Lung Cell Mol Physiol 2007;293:L1348‐L1358.  

(23) Matthiesen S, Bahulayan A, Kempkens S, Haag S, Fuhrmann M, Stichnote C, Juergens UR, Racke 

K. Muscarinic receptors mediate stimulation of human lung fibroblast proliferation. Am J Respir Cell 

Mol Biol 2006;35:621‐627.  

(24) Oenema TA, Mensink G, Smedinga L, Halayko AJ, Zaagsma J, Meurs H, Gosens R, Dekkers BG. 

Cross‐talk  between  transforming  growth  factor‐beta(1)  and muscarinic M(2)  receptors  augments 

airway smooth muscle proliferation. Am J Respir Cell Mol Biol 2013;49:18‐27.  

(25)  Haag  S, Matthiesen  S,  Juergens  UR,  Racke  K. Muscarinic  receptors mediate  stimulation  of 

collagen synthesis in human lung fibroblasts. Eur Respir J 2008;32:555‐562.  

(26) Oenema TA, Smit M, Smedinga L, Racke K, Halayko AJ, Meurs H, Gosens R. Muscarinic receptor 

stimulation augments TGF‐beta1‐induced  contractile protein expression by airway  smooth muscle 

cells. Am J Physiol Lung Cell Mol Physiol 2012;303:L589‐97.  

(27) Milara  J, Serrano A, Peiro T, Gavalda A, Miralpeix M, Morcillo EJ, Cortijo  J. Aclidinium  inhibits 

human lung fibroblast to myofibroblast transition. Thorax 2012;67:229‐237.  

(28) Raemdonck K, de Alba J, Birrell MA, Grace M, Maher SA, Irvin CG, Fozard JR, O'Byrne PM, Belvisi 

MG. A role for sensory nerves in the late asthmatic response. Thorax 2012;67:19‐25.  

(29) Fisher JT, Vincent SG, Gomeza J, Yamada M, Wess J. Loss of vagally mediated bradycardia and 

bronchoconstriction  in  mice  lacking  M2  or  M3  muscarinic  acetylcholine  receptors.  FASEB  J 

2004;18:711‐713.  

(30) Barnes PJ. The pharmacological properties of tiotropium. Chest 2000;117:63S‐6S.  

(31) Rosas‐Ballina M, Tracey KJ. Cholinergic control of inflammation. J Intern Med 2009;265:663‐679.  

M3 receptors promote allergen‐induced remodeling 

 133 

(32) Matera MG,  Calzetta  L,  Passeri  D,  Facciolo  F,  Rendina  EA,  Page  C,  Cazzola M,  Orlandi  A. 

Epithelium integrity is crucial for the relaxant activity of brain natriuretic peptide in human isolated 

bronchi. Br J Pharmacol 2011;163:1740‐1754.  

(33) Kelly MM, O'Connor TM, Leigh R, Otis J, Gwozd C, Gauvreau GM, Gauldie J, O'Byrne PM. Effects 

of  budesonide  and  formoterol  on  allergen‐induced  airway  responses,  inflammation,  and  airway 

remodeling in asthma. J Allergy Clin Immunol 2010;125:349‐356.e13.  

(34) Fairbank NJ, Connolly SC, Mackinnon JD, Wehry K, Deng L, Maksym GN. Airway smooth muscle 

cell tone amplifies contractile function in the presence of chronic cyclic strain. Am J Physiol Lung Cell 

Mol Physiol 2008;295:L479‐88.  

(35) Wahl M,  Eddinger  TJ,  Hai  CM.  Sinusoidal  length  oscillation‐  and  receptor‐mediated mRNA 

expression  of myosin  isoforms  and  alpha‐SM  actin  in  airway  smooth muscle.  Am  J  Physiol  Cell 

Physiol 2004;287:C1697‐708.  

(36) Tschumperlin DJ, Dai G, Maly  IV, Kikuchi T,  Laiho  LH, McVittie AK, Haley KJ,  Lilly CM,  So PT, 

Lauffenburger  DA,  Kamm  RD,  Drazen  JM. Mechanotransduction  through  growth‐factor  shedding 

into the extracellular space. Nature 2004;429:83‐86.  

(37) Oenema  TA, Maarsingh H,  Smit M, Groothuis GM, Meurs H, Gosens  R.  Bronchoconstriction 

Induces  TGF‐beta  Release  and  Airway  Remodelling  in  Guinea  Pig  Lung  Slices.  PLoS  One 

2013;8:e65580.  

(38) Kummer W, Lips KS, Pfeil U. The epithelial cholinergic system of the airways. Histochem Cell Biol 

2008;130:219‐234.  

(39) Wessler I, Kirkpatrick CJ. Acetylcholine beyond neurons: the non‐neuronal cholinergic system in 

humans. Br J Pharmacol 2008;154:1558‐1571.  

(40) Lips KS, Luhrmann A, Tschernig T, Stoeger T, Alessandrini F, Grau V, Haberberger RV, Koepsell H, 

Pabst  R,  Kummer W.  Down‐regulation  of  the  non‐neuronal  acetylcholine  synthesis  and  release 

machinery in acute allergic airway inflammation of rat and mouse. Life Sci 2007;80:2263‐2269.  

 

 

 

 

 

 

 

 

CHAPTER 7 

MURINE PRECISION‐CUT LUNG SLICES AS A MODEL TO STUDY 

TGF‐β AND BRONCHOCONSTRICTION‐INDUCED REMODELING 

 

 

 

 

 

 

Loes E.M. Kistemaker 

I. Sophie T. Bos 

Cécile M. Bidan 

Jürgen Wess 

Huib A.M. Kerstjens 

Herman Meurs  

Reinoud Gosens 

 

Chapter 7 

136 

Abstract 

Rationale 

Asthma  is  a  chronic  obstructive  airway  disease,  characterized  by  airway  remodeling. 

Airway remodeling is conventionally thought to be the result of airway inflammation, with 

inflammatory cells giving rise to the production of pro‐remodeling factors, such as TGF‐β. 

However, new  insights  suggest  that  airway  remodeling might  also or  alternatively be  a 

consequence  of  bronchoconstriction,  which  triggers  TGF‐β  release  via  biomechanical 

activation. Previously, we developed a model to study this phenomenon, using guinea pig 

lung  slices  treated  with  bronchoconstrictors  in  culture.  As  the  mouse  offers  species 

advantages with  respect  to  the availability of molecular and genetic  tools, we aimed  to 

develop a similar model using murine precision cut  lung slices.  In addition, we aimed to 

investigate  the  involvement  of  the  M3  receptor  in  bronchoconstriction‐induced 

remodeling. 

Methods 

Airway  constriction  in  response  to methacholine was  assessed  in  lung  slices  from wild‐

type  and M3R‐/‐ mice.  In  subsequent experiments,  lung  slices  from wild‐type  and M3R

‐/‐ 

mice were  stimulated with  TGF‐β1  (2  ng/ml)  or methacholine  (10  μM)  for  two  days  to 

induce  airway  remodeling.  Thereafter,  slices  were  used  for  gene  expression  analysis, 

Western Blot analysis, 2‐photon imaging, or for constriction experiments. 

Results 

Slices were viable for at least three days. Methacholine induced a dose dependent airway 

constriction in wild‐type mice, with a maximal effect of 80%. In M3R‐/‐ mice, a 35% airway 

constriction was observed.  TGF‐β  induced  a  2‐fold  increase  in  the mRNA  expression of 

fibronectin, collagen Iα1 and α‐sm‐actin in both wild‐type and M3R‐/‐ mice. Similar findings 

were observed on  the protein  level. 2‐Photon  imaging  revealed  that collagen and α‐sm‐

actin  expression  was  localized  around  the  airways.  No  effect  of  methacholine  on 

parameters of remodeling was observed. Stimulation with TGF‐β or methacholine did not 

alter  airway  constriction  induced by  the  thromboxane A2  agonist U46619  compared  to 

control conditions in both wild‐type and M3R‐/‐ mice. 

Conclusions 

Murine  lung  slices  are  suitable  to  study  TGF‐β‐induced  airway  remodeling, which was 

comparable  in  wild‐type  and M3R‐/‐ mice. Methacholine  did  not  induce  remodeling  in 

murine lung slices, suggesting that the mouse, in contrast to the guinea pig, is not a good 

model to study bronchoconstriction‐induced remodeling. Despite effects of TGF‐β on the 

expression of fibronectin, collagen Iα1 and α‐sm‐actin, this did not translate into changes 

in airway contractility. Further studies, using a pharmacological approach, are needed to 

Lung slices as a model to study remodeling 

 137 

investigate the potential  involvement of the M3 receptor  in bronchoconstriction‐induced 

remodeling. 

 

Introduction 

Asthma  is  a  chronic  obstructive  airway  disease,  which  is  characterized  by  structural 

changes  in  the  airways,  referred  to  as  airway  remodeling.  Airway  remodeling 

encompasses airway smooth muscle  thickening and excessive deposition of extracellular 

matrix proteins  (1). These airway  structural  changes are  considered  to be an  important 

component of airflow limitation in asthma and may contribute to an accelerated decline in 

lung  function  (2, 3).  In addition, asthma  is characterized by airway hyperresponsiveness, 

which  consists  of  an  excessive  airway  narrowing  in  response  to  bronchoconstricting 

stimuli, and by airway inflammation (4).  

It  is believed  that  airway  remodeling  is  the  result of ongoing  airway  inflammation.  For 

example, eosinophils are a rich source of the pro‐remodeling factor TGF‐β  (5). However, 

the severity of airway remodeling in patients with asthma is not related to the severity of 

inflammation,  and  treatment  with  corticosteroids,  which modify  airway  inflammation, 

does not affect the decline in lung function or the natural history of asthma (6‐8).  

New insights suggest that airway remodeling might also or alternatively be a consequence 

of bronchoconstriction.  In patients with asthma, repeated challenges with methacholine, 

inducing  bronchoconstriction,  induced  features  of  airway  remodeling, without  affecting 

eosinophilic  inflammation.  Interestingly,  these  effects  could  be  prevented  when 

methacholine  was  combined  with  the  β2‐agonist  albuterol,  suggesting  that 

bronchoconstriction  is  importantly  involved  (9).  Furthermore,  in  a  mouse  model  of 

asthma, we demonstrated that ovalbumin‐induced remodeling is prevented in muscarinic 

M3  receptor  deficient  (M3R‐/‐) mice,  in which  bronchoconstriction  is  almost  completely 

abolished,  without  affecting  the  inflammatory  response  (chapter  6).  Together,  these 

studies indicated that airway remodeling is not merely induced by inflammation, but may 

also  be  a  consequence  of  mechanical  forces  applied  to  the  airways  during 

bronchoconstriction. 

The notion that mechanical forces could promote airway remodeling is also supported by 

in vitro evidence. For example, compression of epithelial cells  increases the activation of 

TGF‐β (10), the epithelial thickness (11), and the expression of fibronectin and collagen in 

a  co‐culture  system  with  fibroblasts  (12).  Moreover,  in  airway  smooth  muscle  cells, 

muscarinic receptor stimulation and mechanical strain  induces TGF‐β activation  (13) and 

Chapter 7 

138 

myosin expression (14). Clearly, mechanical forces have an impact on multiple cell types in 

the airway, and might thereby enhance remodeling of the airways.  

Recently we developed a model to study bronchoconstriction‐induced remodeling ex vivo, 

using  guinea  pig  precision‐cut  lung  slices  (PCLS).  Oenema  et  al.  demonstrated  that 

stimulation of  guinea pig PCLS with methacholine or other bronchoconstrictors  induces 

airway  remodeling  (15). The effects of methacholine were  comparable  to  the effects of 

TGF‐β, and were shown to be mediated via TGF‐β (15). In this study, we aimed to develop 

a  model  to  study  bronchoconstriction‐induced  remodeling  using  murine  PCLS  as  the 

mouse offers species advantages with respect to the availability of molecular and genetic 

tools. In addition, we aimed to investigate the potential involvement of the M3 receptor in 

these responses, for which PCLS from M3R‐/‐ mice were used.  

 

Methods 

Animals 

Homozygous,  inbred,  specific‐pathogen‐free  breeding  colonies  of  M3R‐/‐  mice  and 

C57Bl/6NTac  wild‐type  mice  with  the  same  genetic  background  were  obtained  from 

Taconic  (Cambridge  City,  Indiana,  USA).  The  M3R‐/‐  mice  used  were  on  a  129  Sv/J 

background  and  backcrossed  for  at  least  10  generations  onto  the  C57Bl/6NTac 

background. M3R‐/‐ mice did not differ  from  their wild‐type  littermates  in overall health, 

fertility and  longevity  (16). Animals were housed conventionally under a 12‐h  light‐dark 

cycle  and  received  food  and  water  ad  libitum.  All  experiments  were  performed  in 

accordance with  the  national  guidelines  and  approved  by  the  University  of  Groningen 

Committee for Animal Experimentation (DEC5463I and DEC6792A). 

Precision‐cut lung slices 

Mouse PCLS were prepared, according  to a protocol described previously  for guinea pig 

PCLS  by  our  lab  (15). Male mice  (6‐8  weeks  old)  were  euthanized  by  intraperitoneal 

pentobarbital  injection  (400  mg/kg,  hospital  pharmacy,  University  Medical  Center 

Groningen),  after  which  the  lungs  were  filled  with  1.5  ml  low  melting‐point  agarose 

solution  (1.5%  final  concentration  (Gerbu  Biotechnik  GmbH, Wieblingen,  Germany)  in 

CaCl2  (0.9 mM), MgSO4  (0.4 mM),  KCl  (2.7 mM), NaCl  (58.2 mM), NaH2PO4  (0.6 mM), 

glucose  (8.4  mM),  NaHCO3  (13  mM),  Hepes  (12.6  mM),  sodium  pyruvate  (0.5  mM), 

glutamine (1 mM), MEM‐amino acids mixture (1:50), and MEM‐vitamins mixture (1:100), 

pH=7.2). The agarose was solidified for 15 minutes by placing the lungs on ice. Lungs were 

harvested and individual lobes were sliced at a thickness of 250 µm in medium composed 

of CaCl2  (1.8mM), MgSO4  (0.8 mM), KCl  (5.4 mM), NaCl  (116.4 mM), NaH2PO4  (1.2 mM), 

Lung slices as a model to study remodeling 

 139 

glucose  (16.7 mM), NaHCO3  (26.1 mM), Hepes  (25.2 mM), pH = 7.2, using a tissue slicer 

(Compresstome™  VF‐300  microtome,  Precisionary  Instruments,  San  Jose  CA,  USA). 

Thereafter, slices were kept at 37°C  in a humidified atmosphere of 5% CO2 and washed 

every  30  minutes  for  four  times  to  remove  the  agarose  and  cell  debris  in  medium 

composed of CaCl2 (1.8mM), MgSO4 (0.8 mM), KCl (5.4 mM), NaCl (116.4 mM), NaH2PO4 

(1.2 mM),  glucose  (16.7 mM), NaHCO3  (26.1 mM), Hepes  (25.2 mM),  sodium  pyruvate 

(1mM),  glutamine  (2  mM),  MEM‐amino  acids  mixture  (1:50),  MEM‐vitamins  mixture 

(1:100,) penicillin (100 U/mL) and streptomycin (100 µg/mL), pH = 7.2. Average diameter 

of the airways was 179 µM ± 82 µM. 

Mitochondrial activity assay 

Viability  of  lung  slices was  assessed  by  a mitochondrial  activity  assay  performed  after 

culturing  the  slices  for  different  time  periods  in  Dulbecco’s  Modification  of  Eagle’s 

Medium (DMEM) supplemented with sodium pyruvate (1 mM), non‐essential amino acid 

mixture (1:100), gentamycin (45 µg/mL), penicillin (100 U/mL), streptomycin (100 µg/mL) 

and  amphotericin  B  (1.5  µg/mL)  at  37°C‐5%  CO2.  Slices  were  incubated  with  Hanks’ 

balanced  salt  solution  (pH  7.4),  containing  10%  Alamar  blue  solution  (BioSource, 

Camarillo,  CA),  for  30  min  at  37°C‐5%  CO2.  Mitochondrial  activity  was  assessed  by 

conversion of Alamar blue into its reduced form, as described previously (17).  

Treatment of lung slices 

Lung  slices  were  incubated  in  Dulbecco’s  Modification  of  Eagle’s  Medium  (DMEM) 

supplemented with  sodium pyruvate  (1 mM), non‐essential amino acid mixture  (1:100), 

gentamycin  (45  µg/mL),  penicillin  (100  U/mL),  streptomycin  (100  µg/mL)  and 

amphotericin B (1.5 µg/mL) at 37°C‐5% CO2 in a 12‐well plate, using 3 slices per well. The 

slices were treated with vehicle (CTR), 2 ng/ml TGF‐β1 (R&D systems, Abingdon, UK) or 10 

μM methacholine  (MCh;  ICN  Biomedicals,  Zoetermeer,  the  Netherlands)  for  two  days. 

After  two  days,  slices were  collected  for  contraction  studies,  gene  expression  analysis, 

Western Blot analysis, or for 2‐photon imaging. 

Airway narrowing studies 

Airway narrowing studies were performed on naïve lung slices and on slices treated with 

vehicle, TGF‐β or methacholine  (MCh)  for  two days. On naïve  lung slices, dose response 

curves for MCh (10‐9M ‐ 10‐3M) were recorded, as well as constriction after a single dose of 

MCh (10‐4M), after which the airways were dilated with the bitter taste receptor agonist 

chloroquine (10‐3M, Sigma‐Aldrich, Zwijndrecht, The Netherlands). On slices treated with 

vehicle, TGF‐β or MCh  for  two days, dose response curves  towards  the  thromboxane A2 

agonist U‐46619 (10‐10M ‐ 10‐5M, Sigma‐Aldrich) were recorded. As described previously, a 

Chapter 7 

140 

nylon mesh and metal washer were used  to keep  the  lung slice  in place  (18). Lung slice 

images were  captured  in  time‐lapse  (1  frame  per  2  seconds)  using  an  inverted  phase 

contrast microscope  (Eclipse,  TS100; Nikon).  Airway  luminal  area was  quantified  using 

image acquisition software (NIS‐elements; Nikon).  

Gene expression analysis 

Total RNA was extracted from lung slices by automated purification using the Maxwell 16 

instrument  and  the  corresponding  Maxwell  16  LEV  simply  RNA  tissue  kit  (Promega, 

Madison, USA) according to the manufacturer's instructions. Equal amounts of total mRNA 

were  then  reverse  transcribed  and  cDNA was  subjected  to  real‐time  qPCR  (Westburg, 

Leusden, The Netherlands). Real time PCR was performed with denaturation at 94°C for 30 

seconds, annealing at 59°C  for 30  seconds and extension at 72°C  for 30  seconds  for 40 

cycles  followed  by  10  minutes  at  72°C.  Real‐time  PCR  data  were  analyzed  using  the 

comparative  cycle  threshold  (Ct:  amplification  cycle  number) method.  The  amount  of 

target gene was normalized  to  the endogenous  reference gene 18S  ribosomal RNA. The 

specific forward and reverse primers used are listed in table 1. 

Western Blot analysis 

Lung slices were washed once with ice‐cold phosphate‐buffered saline (PBS, composition: 

NaCl (140 mM), KCl (2.6 mM), KH2PO4 (1.4 mM), Na2HPO4 (8.1 mM), pH 7.4), followed by 

lysis using ice‐cold SDS‐lysis buffer (Tris‐HCl (62.5 mM), SDS (2 %), NaF (1 mM), Na3VO4 (1 

mM),  aprotinin  (10  μg/mL),  leupeptin  (10  μg/mL),  pepstatin  A  (7  µg/mL)  at  pH  8.0). 

Protein  amounts  were  determined  by  Pierce  and  equal  amounts  of  protein  were 

separated  on  SDS  polyacrylamide  gels,  transferred  onto  nitrocellulose  membranes, 

followed  by  standard  immunoblotting  techniques.  All  bands were  normalized  either  to 

lamin AC or to tubulin. 

 

Table 1. Primers used for qRT‐PCR analysis. 

Gene  Primer sequence  NCBI accession 

number 

Fibronectin  Forward – ACCACCCAGAACTACGATGC 

Reverse – GGAACGTGTCGTTCACATTG 

NM_010233.2 

Collagen Iα1  Forward – CACCCTCAAGAGCCTGAGTC 

Reverse – GTTCGGGCTGATGTACCAGT 

NM_007742.3  

α‐sm‐actin  Forward – CTGACAGAGGCACCACTGAA 

Reverse – CATCTCCAGAGTCCAGCACA 

X13297.1 

18S  Forward – AAACGGCTACCACATCCAAG 

Reverse – CCTCCAATGGATCCTCGTTA 

NR_003278 

 

Lung slices as a model to study remodeling 

 141 

2‐photon imaging 

An  immunofluorescent  antibody  staining was  used  to  visualize  α‐smooth muscle‐actin, 

and 2‐photon imaging was used to visualize collagen. For α‐smooth muscle‐actin staining, 

lung slices were washed two times with cytoskeleton buffer (CB: MES (10 mM), NaCl (150 

mM),  EGTA  (5 mM), MgCl2  (5 mM),  and  glucose  (5 mM)  at  pH=6.1)  and  fixed with CB 

containing 3% paraformaldehyde (PFA) for 15 min. Thereafter, slices were incubated with 

CB buffer  containing 3% PFA and 0.3% Triton‐X‐100  for 5 min,  followed by  two washes 

with CB buffer. Lung slices were blocked for 1 h in cyto‐TBS (Tris‐base (20 mM), NaCl (154 

mM),  EGTA  (2.0 mM)  and MgCl2  (2.0 mM),  pH=7.2),  supplemented with  BSA  (1%)  and 

normal  donkey  serum  (2%).  Thereafter,  lung  slices were  stained with  rabbit  anti‐alpha 

smooth muscle actin antibody (Abcam, Cambridge, UK) overnight at 4°C. After washing 3 

times with  cyto‐TBS  containing 0.1% Tween‐20  (cyto‐TBS‐T)  for 10 min,  incubation with 

the secondary antibody  (FITC) was performed during 2 hour at room temperature. Lung 

slices were then washed 3 times for 15 min in cyto‐TBS‐T, followed by 3 washes with ultra‐

pure water.  The  slides were mounted with ProLong Gold  anti‐fade  reagent  (Invitrogen, 

Breda,  The Netherlands).  The  slides were  then  analyzed  using  a  fluorescence  confocal 

microscope (Leica) equipped with a multiphoton laser. The α‐sm‐actin staining was excited 

at  100  nm  and  collected  at  500  nm, whereas  the  collagen  bundles  excited  at  820  nm 

naturally emitted a second harmonic generation signal collected around 410 nm. 

Statistical analysis 

Data  are presented  as mean  ±  s.e. of  the mean.  Statistical differences between means 

were  calculated using  a paired  Student’s  t‐test with  two‐tailed distribution. Differences 

were considered significant at p<0.05. 

 

Results 

Viability of lung slices 

Viability of the  lung slices was assessed by a mitochondrial activity assay after 1, 2 and 3 

days  of  culturing.  As  depicted  in  figure  1,  no  significant  differences were  observed  in 

mitochondrial  activity  for  up  to  three  days  after  culturing.  This  indicates  that  the  lung 

slices are viable for at least three days and can be used for experiments within this period. 

Methacholine‐induced constriction 

MCh  induced a dose‐dependent airway constriction  in PCLS  from wild‐type mice, with a 

maximal effect of 80% airway closure compared to the initial airway lumen (figure 2A). In 

PCLS  from M3R‐/‐ mice,  the airways were more  sensitive  to MCh compared  to wild‐type 

PCLS, but the maximal airway narrowing was only 35% (figure 2A).  

Chapter 7 

142 

 Figure 1. Viability of  lung  slices  is preserved  for  three days. Mitochondrial activity, assessed by  conversion of 

Alamar blue into its reduced form, was not significantly different in the first three days of culture. Data represent 

mean ± s.e. of the mean of 4 animals, 2 slices per animal.  

 

As depicted  in  figure 2B, MCh  induced 40% airway closure  in PCLS  from wild‐type mice 

after  a  single dose of MCh  (10‐4M),  and  airway dilation was obtained  after  subsequent 

addition of chloroquine (10‐3M). In contrast to PCLS from wild‐type animals, in PCLS from 

M3R‐/‐ mice  there was  a  lag  time  after  addition  of MCh  before  the  airway  constriction 

started.  However,  the  constriction  rate was  higher,  and  a  plateau  phase was  reached 

earlier in slices from M3R‐/‐ mice compared to wild‐type mice. The maximal effect of MCh 

in PCLS from M3R‐/‐ mice was 30% closure, and the airways similarly dilated after addition 

of chloroquine  (figure 2B). Oscillations  in airway constriction were observed  in  the PCLS 

from M3R‐/‐ mice, as is demonstrated in figure 2C for a single experiment in which strong 

oscillations were observed. The oscillations can also be observed  in the plateau phase of 

constriction  in figure 2B; however, the effect of the strong oscillations observed  in single 

experiments is leveled out by averaging multiple experiments. 

Lung slices as a model to study remodeling 

 143 

 Figure  2. Methacholine‐induced  airway  constriction  in  PCLS  from  wild‐type  and  M3R

‐/‐  mice.  A:  Airway 

constriction  in response to  increasing concentrations of methacholine (MCh)  in PCLS from wild‐type and M3R‐/‐ 

mice. Data  represent mean ±  s.e. of  the mean, n=8  for wild‐type mice, n=4  for M3R‐/‐ mice, 2‐3 airways were 

quantified  for  each  animal. B: Airways were  constricted with MCh  (10‐4M)  and  after  10 minutes dilated with 

chloroquine (Cq, 10‐3M). Data represent mean of 8 mice, 3‐7 airways were quantified for each animal. For clarity 

reasons,  error  bars  are  omitted.  C. A  single  trace  of  airway  contraction  in  an M3R‐/‐ mouse,  in which  strong 

oscillations can be observed. 

 

Remodeling in PCLS from wild‐type animals 

In order to assess remodeling effects  in PCLS from wild‐type animals, slices were treated 

with  vehicle,  TGF‐β  or MCh  for  two  days,  and  expression  of  the  extracellular  matrix 

proteins fibronectin and collagenIα1, and the contractile protein α‐sm‐actin, was assessed. 

Stimulation with  TGF‐β  for  two  days  induced  a  1.7‐fold  increase  in  fibronectin mRNA 

expression (figure 3A), a 2.4‐fold increase in collagen Iα1 mRNA expression (figure 3B) and 

Chapter 7 

144 

a 2.0‐fold increase in α‐sm‐actin mRNA expression (figure 3C) compared to vehicle control. 

Similar findings were observed on the protein  level for all markers (1.8‐3.2 fold  increase, 

data  not  shown).  In  addition,  to  evaluate  bronchoconstriction‐induced  remodeling,  the 

effects of MCh were assessed. As shown in figure 3, MCh did not induce an increase in the 

mRNA expression of fibronectin, collagenIα1 or α‐sm‐actin. 

 

  

Figure 3. TGF‐β, and not methacholine, induces remodeling in PCLS from wild‐type mice. Lung slices from wild‐

type mice were treated with TGF‐β (2 ng/ml) or methacholine (MCh, 10 µM) for two days. mRNA expression of 

fibronectin (A), collagen  Iα1 (B) and α‐sm‐actin (C) was analyzed. Data represent mean ± s.e. of the mean, n=8 

animals, * p<0.05; ** p<0.01 compared to vehicle treated controls (CTR).  

 

Lung slices as a model to study remodeling 

 145 

Remodeling in M3R‐/‐ animals 

To  investigate  the  potential  involvement  of  the M3  receptor  in  remodeling,  PCLS  from 

M3R‐/‐ mice were treated  in the same way as PCLS from wild‐type animals. Treatment of 

PCLS  from M3R‐/‐ mice with TGF‐β  induced a similar  increase  in  the mRNA expression of 

fibronectin (1.9‐fold, figure 4A), collagen Iα1 (2.1‐fold, figure 4B) and α‐sm‐actin (2.0‐fold, 

figure 4C) as observed in wild‐type animals. Similar to wild‐type animals, stimulation with 

MCh  for  two  days  in M3R‐/‐  mice  did  not  affect  the  expression  levels  of  fibronectin, 

collagen Iα1 or α‐sm‐actin (figure 4). 

  

Figure 4. TGF‐β, and not methacholine,  induces  remodeling  in PCLS  from M3R‐/‐ mice.  Lung  slices  from M3R

‐/‐ 

mice were  treated with  TGF‐β  (2  ng/ml)  or methacholine  (MCh,  10  µM)  for  two  days. mRNA  expression  of 

fibronectin (A), collagen  Iα1 (B) and α‐sm‐actin (C) was analyzed. Data represent mean ± s.e. of the mean, n=6 

animals, * p<0.05; ** p<0.01 compared to vehicle treated controls (CTR). 

Chapter 7 

146 

Localization of α‐sm‐actin and collagen 

To  study  the  localization  of  the  extracellular matrix  and  contractile  protein  expression, 

lung  slices  were  stained  for  α‐sm‐actin  and  visualized  using  a  fluorescent microscope 

equipped  with  a  multiphoton  laser  to  collect  in  addition  the  second  harmonic  signal 

generated  by  the  collagen  bundles  under  a  specific  wave  length. We  confirmed  that 

virtually  all  α‐sm‐actin  and  collagen were  located  around  the  airways,  and  not  in  the 

parenchyma, as is shown by a representative image from a control animal in figure 5. No 

obvious  differences  in  localization  were  observed  after  stimulation  with  TGF‐β  or 

methacholine (data not shown). 

 

Figure 5. Expression of collagen and α‐sm‐actin is localized around the airways. PCLS were stained for α‐sm‐actin 

and  visualized using 2‐photon  imaging,  to  also  visualize  collagen. A  representative  image of  a  control  slice  is 

shown. Red: collagen bundles, green: α‐sm‐actin.

 

Functional effects of remodeling 

Finally, we  investigated whether  stimulation with  TGF‐β  or MCh  for  two  days  affected 

airway  constriction  in  PLCS  from  wild‐type  and  M3R‐/‐  mice  compared  to  control 

conditions. Because PCLS were stimulated with MCh  for two days, desensitization might 

occur. Therefore, we examined  airway  constriction  in  response  to  the  thromboxane A2 

agonist  U46619.  U46619  induced  constriction  in  vehicle  treated  PCLS  from  wild‐type 

animals, with a maximal  closure effect of 55%  compared  to  initial airway  lumen  (figure 

6A). No differences in airway constriction were observed in slices pretreated with TGF‐β or 

MCh  for  two  days.  As  depicted  in  figure  6B,  the maximal  effect  of U46619  on  airway 

closure in PCLS from M3R‐/‐ mice was comparable to that observed in PCLS from wild‐type 

mice, however, this effect was achieved at lower doses of the contractile agonist. Similar 

to wild‐type animals, no effect of pretreatment with TGF‐β or MCh on airway constriction 

to U46619 was observed in PCLS from M3R‐/‐ mice. 

Lung slices as a model to study remodeling 

 147 

 Figure 6. Pretreatment of PCLS with TGF‐β or methacholine does not affect U46619‐induced constriction. Lung 

slices from wild‐type and M3R‐/‐ mice were pretreated with vehicle (CTR), TGF‐β (2 ng/ml) or methacholine (MCh, 

10 µM)  for  two days. Airway constriction  in  response  to  increasing concentrations of U46619 was assessed  in 

wild‐type mice (A) and in M3R‐/‐ mice (B). Data represent mean ± s.e. of the mean of 4 animals, 2‐3 airways were 

quantified for each animal.

 

Discussion 

We hypothesized that mouse PCLS would be a good model to study bronchoconstriction‐

induced airway remodeling and its functional consequences, and aimed to investigate the 

involvement of  the M3  receptor  in  this  response. However,  although TGF‐β  induced  an 

increase  in the expression of fibronectin, collagen and α‐sm‐actin  in the airways of wild‐

type mice and M3R‐/‐ mice, no effect of methacholine on airway remodeling was observed. 

Previously, it has been shown by our lab that methacholine can induce airway remodeling 

in guinea pig PCLS (15). Therefore, species differences could underlie the lack of effect of 

methacholine in mouse PCLS. It is known that maximal contraction towards methacholine 

is higher  in guinea pig PCLS  compared  to mouse PCLS, and  that  the  relative amount of 

airway smooth muscle in the airways is considerably higher in the guinea pig compared to 

the mouse. Moreover,  whereas  guinea  pig  PCLS  stay  contracted  over  48  hours  while 

continuously  stimulated with methacholine, our unpublished observations  indicate  that 

contraction  in  response  to  methacholine  is  rapidly  lost  in  mouse  PCLS  (not  shown). 

Therefore,  the  mouse  PCLS  preparation  may  not  be  a  good  model  to  study 

bronchoconstriction‐induced remodeling, which might be explained by species differences 

between guinea pigs and mice.  

Chapter 7 

148 

TGF‐β  did  induce  features  of  airway  remodeling  in mouse  PCLS, which  is  in  line with 

previous studies (15, 19). However, despite the clear effect of TGF‐β on the expression of 

fibronectin,  collagen  Iα1  and  α‐sm‐actin,  this  did  not  translate  into  changes  in  airway 

contractility. Generally,  it  is assumed that airway remodeling affects airway contractility. 

Here, we were not able to demonstrate such a direct link. Chew et al. demonstrated that 

although  ovalbumin  challenge,  leading  to  airway  remodeling,  induced  airway 

hyperresponiveness  in  vivo,  airway  constriction  of  mouse  PCLS  in  response  to 

acetylcholine  ex  vivo  was  not  altered  (20).  Using  a  similar  approach,  Donovan  et  al. 

demonstrated airway hyperresponiveness to methacholine in vivo and in isolated trachea 

in vitro after ovalbumin challenge, however, in PCLS, airway narrowing was slower and the 

potency  of  methacholine  was  reduced  in  ovalbumin‐challenged  mice  compared  to 

controls  (21).  Although  PCLS  come  closer  to  the  in  vivo  situation  than  single  cells  or 

smooth muscle strips,  it may still be possible  that mechanical differences exist.  It might 

therefore be difficult to demonstrate a direct link between airway remodeling and airway 

contractility.  

Muscarinic  receptor  stimulation  can  augment  TGF‐β‐induced  expression  of  contractile 

proteins  and  extracellular  matrix  proteins  in  airway  smooth  muscle  cells  (22‐24). 

Moreover, Oenema et al. demonstrated in guinea pig PCLS that methacholine can induce 

remodeling via enhanced  release of TGF‐β  (15). Furthermore,  the muscarinic antagonist 

tiotropium has been shown to  inhibit ovalbumin‐induced TGF‐β release, and also airway 

remodeling,  in a mouse model of asthma  (25). Morevoer, TGF‐β  release  is decreased  in 

M3R‐/‐  animals  (chapter  3). Methacholine  has  also  been  shown  to  increase  TGF‐β  and 

collagen  levels  in  biopsies  of  asthma  patients  (9).  Therefore,  methacholine‐induced 

bronchoconstriction,  and  subsequent  TGF‐β  release, may  enhance  airway  remodeling. 

Since we have  shown here  that murine  PCLS may not be  an  adequate model  to  study 

bronchoconstriction‐induced  remodeling,  future  studies  to  investigate  mechanisms 

involved  in  this  response  and  the  potential  involvement  of  the M3  receptor  are  better 

performed using guinea pig or human lung slices. 

In our study, we found limited contraction towards methacholine in M3R‐/‐ mice, which is 

in  line with  previous  studies  using  lung  slices  from M3R‐/‐ mice  (26).  Although  the M3 

receptor is the dominant receptor in mediating airway smooth muscle contraction (27), it 

has been shown that after knock out of the M3 receptor, some contraction can be elicited 

via M2 receptors, and that airway contraction is only completely abolished after knock out 

of  both M2  and M3  receptors  (26,  28,  29).  Therefore,  the  observed  contraction  in  the   

M3R‐/‐ mice might  be mediated  via M2  receptors  in  our  study.  Clearly, methacholine‐

induced  contraction  is  regulated  via  at  least  partially  different  mechanisms  in  M3R‐/‐ 

Lung slices as a model to study remodeling 

 149 

animals than in wild‐type animals. Not only is there a lag time in effect, the contraction in 

M3R‐/‐ mice  also  seemed  to  be  sensitive  to  lower  doses  of methacholine  compared  to 

contraction in WT animals. Using airway smooth muscle strips, Kume et al. demonstrated 

that  contraction  in wild‐type  animals  at  low  concentrations  of methacholine  could  be 

completely  inhibited  by  the M2  antagonist  AF‐DX  116  and  by  pertussis  toxin, whereas 

contraction at higher  concentrations was only partially  inhibited by pertussis  toxin, and 

almost completely mediated via M3 receptors  (30). Similar  findings were observed using 

ileal  smooth  muscle  strips,  in  which  80%  of  the  contraction  was  inhibited  at  low 

concentrations of agonist by pertussis toxin, whereas contraction at higher concentrations 

was not altered by pertussis  toxin and  completely mediated via M3  receptors  (28). This 

might  explain  the  effect  of methacholine  at  low  concentrations  via M2  receptors  after 

knock‐out of the M3 receptors compared to wild‐type animals. Future studies are needed 

to  elucidate  the  exact  mechanisms  underlying  airway  contraction  in  M3R‐/‐  mice.  For 

example, experiments under calcium free conditions, or pretreatment with an M2 receptor 

selective antagonist or pertussis toxin, to uncouple Gi proteins, might help to explain the 

mechanisms involved. 

Finally,  strong  oscillations  in  airway  constriction were  observed  in M3R‐/‐ mice  after  a 

single dose of methacholine, which was not observed in wild‐type animals. Previously, we 

have shown that levels of fibronectin and collagen are lower in the airways of M3R‐/‐ mice 

(chapter 3). Decreased levels of these extracellular matrix proteins might result in altered 

mechanical  stability  of  the  airways  and  thereby  affect  the  capacity  of  the  airway  to 

maintain a  sustained  contraction  in M3R‐/‐ mice. Altered mechanical  stability might also 

explain the enhanced contraction rate  in M3R‐/‐ mice compared to wild‐type mice after a 

single  dose  of  methacholine.  Moreover,  this  might  explain  the  enhanced  airway 

constriction in M3R‐/‐ mice compared to wild‐type mice observed at low concentrations of 

methacholine,  but  also  at  low  concentrations  of U46619.  Increased  sensitivity  for both 

methacholine and U46619 might suggest that this is not a receptor driven process, but is 

rather caused by intrinsic differences in the airways of M3R‐/‐ mice compared to wild‐type 

mice, involving reduced mechanical stability.  

In conclusion, murine PCLS are suitable to study TGF‐β‐induced airway remodeling, but are 

most  likely not an appropriate model  to  study bronchoconstriction‐induced  remodeling. 

This is in contrast to guinea pig PCLS, which are well suited to study this response. 

 

 

 

Chapter 7 

150 

Acknowledgements 

We  would  like  to  thank  the  Netherlands  Lung  Foundation  (grant:  3.2.08.014)  and 

Boehringer Ingelheim (contract number: 43054530) for financial support. Part of the work 

has been performed at the University Medical Center Groningen Imaging and Microscopy 

Center (UMIC), which is sponsored by NWO‐grants 40‐00506‐98‐9021 and 175‐010‐2009‐

023.   

Lung slices as a model to study remodeling 

 151 

References 

(1) Jeffery PK. Remodeling in asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 

2001;164:S28‐S38.  

(2) An SS, Bai TR, Bates JH, Black JL, Brown RH, Brusasco V, Chitano P, Deng L, Dowell M, Eidelman 

DH,  Fabry  B,  Fairbank  NJ,  Ford  LE,  Fredberg  JJ,  Gerthoffer WT,  Gilbert  SH,  Gosens  R,  Gunst  SJ, 

Halayko AJ,  Ingram RH,  Irvin CG,  James AL,  Janssen LJ, King GG, Knight DA, Lauzon AM, Lakser OJ, 

Ludwig MS, Lutchen KR, Maksym GN, Martin JG, Mauad T, McParland BE, Mijailovich SM, Mitchell 

HW, Mitchell RW, Mitzner W, Murphy TM, Pare PD, Pellegrino R, Sanderson MJ, Schellenberg RR, 

Seow CY, Silveira PS, Smith PG, Solway  J, Stephens NL, Sterk PJ, Stewart AG, Tang DD, Tepper RS, 

Tran  T, Wang  L.  Airway  smooth muscle  dynamics:  a  common  pathway  of  airway  obstruction  in 

asthma. Eur Respir J 2007;29:834‐860.  

(3)  Pare PD, Roberts CR, Bai  TR, Wiggs BJ.  The  functional  consequences of  airway  remodeling  in 

asthma. Monaldi Arch Chest Dis 1997;52:589‐596.  

(4) Lemanske RF,Jr, Busse WW. Asthma: clinical expression and molecular mechanisms. J Allergy Clin 

Immunol 2010;125:S95‐102.  

(5) Minshall EM, Leung DY, Martin RJ, Song YL, Cameron L, Ernst P, Hamid Q. Eosinophil‐associated 

TGF‐beta1 mRNA  expression  and  airways  fibrosis  in  bronchial  asthma. Am  J  Respir  Cell Mol  Biol 

1997;17:326‐333.  

(6)  Benayoun  L,  Druilhe  A,  Dombret  MC,  Aubier  M,  Pretolani  M.  Airway  structural  alterations 

selectively associated with severe asthma. Am J Respir Crit Care Med 2003;167:1360‐1368.  

(7) Guilbert TW, Morgan WJ, Zeiger RS, Mauger DT, Boehmer SJ, Szefler SJ, Bacharier LB, Lemanske 

RF,Jr,  Strunk  RC,  Allen DB,  Bloomberg GR, Heldt G,  Krawiec M,  Larsen G,  Liu  AH,  Chinchilli  VM, 

Sorkness CA, Taussig  LM, Martinez FD.  Long‐term  inhaled  corticosteroids  in preschool  children at 

high risk for asthma. N Engl J Med 2006;354:1985‐1997.  

(8)  Murray  CS,  Woodcock  A,  Langley  SJ,  Morris  J,  Custovic  A,  IFWIN  study  team.  Secondary 

prevention  of  asthma  by  the  use  of  Inhaled  Fluticasone  propionate  in Wheezy  INfants  (IFWIN): 

double‐blind, randomised, controlled study. Lancet 2006;368:754‐762.  

(9) Grainge CL, Lau LC, Ward JA, Dulay V, Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. Effect 

of bronchoconstriction on airway remodeling in asthma. N Engl J Med 2011;364:2006‐2015.  

(10)  Ressler  B,  Lee  RT,  Randell  SH,  Drazen  JM,  Kamm  RD. Molecular  responses  of  rat  tracheal 

epithelial cells to transmembrane pressure. Am J Physiol Lung Cell Mol Physiol 2000;278:L1264‐72.  

(11) Choe MM, Sporn PH, Swartz MA. An in vitro airway wall model of remodeling. Am J Physiol Lung 

Cell Mol Physiol 2003;285:L427‐33.  

(12)  Swartz  MA,  Tschumperlin  DJ,  Kamm  RD,  Drazen  JM.  Mechanical  stress  is  communicated 

between different  cell  types  to elicit matrix  remodeling. Proc Natl Acad  Sci U  S A  2001;98:6180‐

6185.  

(13) Tatler AL, John AE, Jolly L, Habgood A, Porte J, Brightling C, Knox AJ, Pang L, Sheppard D, Huang 

X,  Jenkins G.  Integrin alphavbeta5‐mediated TGF‐beta activation by airway smooth muscle cells  in 

asthma. J Immunol 2011;187:6094‐6107.  

Chapter 7 

152 

(14) Wahl M,  Eddinger  TJ,  Hai  CM.  Sinusoidal  length  oscillation‐  and  receptor‐mediated mRNA 

expression  of myosin  isoforms  and  alpha‐SM  actin  in  airway  smooth muscle.  Am  J  Physiol  Cell 

Physiol 2004;287:C1697‐708.  

(15) Oenema  TA, Maarsingh H,  Smit M, Groothuis GM, Meurs H, Gosens  R.  Bronchoconstriction 

Induces  TGF‐beta  Release  and  Airway  Remodelling  in  Guinea  Pig  Lung  Slices.  PLoS  One 

2013;8:e65580.  

(16) Yamada M, Miyakawa T, Duttaroy A, Yamanaka A, Moriguchi T, Makita R, Ogawa M, Chou CJ, 

Xia B, Crawley JN, Felder CC, Deng CX, Wess J. Mice lacking the M3 muscarinic acetylcholine receptor 

are hypophagic and lean. Nature 2001;410:207‐212.  

(17) Gosens  R,  Baarsma HA, Heijink  IH, Oenema  TA, Halayko  AJ, Meurs H,  Schmidt M. De  novo 

synthesis  of  {beta}‐catenin  via H‐Ras  and MEK  regulates  airway  smooth muscle  growth.  FASEB  J 

2010;24:757‐768.  

(18) Rosner SR, Ram‐Mohan S, Paez‐Cortez JR, Lavoie TL, Dowell ML, Yuan L, Ai X, Fine A, Aird WC, 

Solway  J,  Fredberg  JJ,  Krishnan  R.  Airway  contractility  in  the  precision‐cut  lung  slice  after 

cryopreservation. Am J Respir Cell Mol Biol 2014;50:876‐881.  

(19) Halwani  R,  Al‐Muhsen  S,  Al‐Jahdali H, Hamid Q.  Role  of  transforming  growth  factor‐beta  in 

airway remodeling in asthma. Am J Respir Cell Mol Biol 2011;44:127‐133.  

(20)  Chew  AD,  Hirota  JA,  Ellis  R, Wattie  J,  Inman MD,  Janssen  LJ.  Effects  of  allergen  on  airway 

narrowing dynamics as assessed by lung‐slice technique. Eur Respir J 2008;31:532‐538.  

(21) Donovan C, Royce SG, Esposito J, Tran J, Ibrahim ZA, Tang ML, Bailey S, Bourke JE. Differential 

effects of allergen challenge on large and small airway reactivity in mice. PLoS One 2013;8:e74101.  

(22) Goldsmith AM, Bentley  JK,  Zhou  L,  Jia  Y, Bitar KN,  Fingar DC, Hershenson MB.  Transforming 

growth  factor‐beta  induces  airway  smooth  muscle  hypertrophy.  Am  J  Respir  Cell  Mol  Biol 

2006;34:247‐254.  

(23) Oenema TA, Mensink G, Smedinga L, Halayko AJ, Zaagsma J, Meurs H, Gosens R, Dekkers BG. 

Cross‐talk  between  transforming  growth  factor‐beta(1)  and muscarinic M(2)  receptors  augments 

airway smooth muscle proliferation. Am J Respir Cell Mol Biol 2013;49:18‐27.  

(24) Oenema TA, Smit M, Smedinga L, Racke K, Halayko AJ, Meurs H, Gosens R. Muscarinic receptor 

stimulation augments TGF‐beta1‐induced  contractile protein expression by airway  smooth muscle 

cells. Am J Physiol Lung Cell Mol Physiol 2012;303:L589‐97.  

(25) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y, Minoguchi K, Ohnishi T, Hirose T, 

Nagase H, Ohta K, Adachi M. Effect of tiotropium bromide on airway inflammation and remodelling 

in a mouse model of asthma. Clin Exp Allergy 2010;40:1266‐1275.  

(26)  Struckmann  N,  Schwering  S,  Wiegand  S,  Gschnell  A,  Yamada  M,  Kummer  W,  Wess  J, 

Haberberger  RV.  Role  of muscarinic  receptor  subtypes  in  the  constriction  of  peripheral  airways: 

studies on receptor‐deficient mice. Mol Pharmacol 2003;64:1444‐1451.  

(27) Roffel AF, Elzinga CR, Van Amsterdam RG, De Zeeuw RA, Zaagsma J. Muscarinic M2 receptors in 

bovine  tracheal  smooth  muscle:  discrepancies  between  binding  and  function.  Eur  J  Pharmacol 

1988;153:73‐82.  

(28) Unno  T, Matsuyama H,  Sakamoto  T, Uchiyama M,  Izumi  Y, Okamoto H,  Yamada M, Wess  J, 

Komori S. M(2) and M(3) muscarinic receptor‐mediated contractions in longitudinal smooth muscle 

of the ileum studied with receptor knockout mice. Br J Pharmacol 2005;146:98‐108.  

Lung slices as a model to study remodeling 

 153 

(29) Ehlert FJ. Pharmacological analysis of the contractile role of M2 and M3 muscarinic receptors in 

smooth muscle. Receptors Channels 2003;9:261‐277.  

(30) Kume H, Mikawa K, Takagi K, Kotlikoff MI. Role of G proteins and KCa channels in the muscarinic 

and beta‐adrenergic regulation of airway smooth muscle. Am J Physiol 1995;268:L221‐9.  

 

 

 

 

 

 

 

 

CHAPTER 8 

TIOTROPIUM ATTENUATES IL‐13‐INDUCED GOBLET CELL 

METAPLASIA OF HUMAN AIRWAY EPITHELIAL CELLS 

 

 

 

 

Loes E.M. Kistemaker 

Pieter S. Hiemstra 

I. Sophie T. Bos 

Susanne Bouwman 

Maarten van den Berge 

Machteld N. Hylkema 

Herman Meurs  

Huib A.M. Kerstjens 

Reinoud Gosens 

 

Thorax, 2015, In revision

Chapter 8 

156 

Abstract 

Rationale 

It has been demonstrated that acetylcholine is not only a neurotransmitter, but also acts 

as  a  local mediator  produced  by  airway  cells,  including  epithelial  cells.  In  vivo  studies 

demonstrate an  indirect role for acetylcholine  in epithelial cell differentiation and goblet 

cell metaplasia. Here, we aimed to investigate direct effects of endogenous non‐neuronal 

acetylcholine on epithelial cell differentiation and possible mechanisms involved. 

Methods 

Human airway epithelial cells were  isolated  from healthy donors and cultured at an air‐

liquid‐interface  (ALI).  During  differentiation  at  the  ALI,  cells  were  exposed  to  the 

muscarinic antagonist tiotropium (10 nM), IL‐13 (1 ng/ml), or the combination of IL‐13 and 

tiotropium.  

Results 

Human airway epithelial cells expressed all components of  the non‐neuronal cholinergic 

system, suggesting acetylcholine production. Tiotropium had no effects on epithelial cell 

differentiation  following  air  exposure,  as  assessed  by  qPCR,  histological  analysis  and 

micro‐array.  Differentiation  towards  goblet  cells  was  barely  induced  following  air 

exposure.  Therefore,  IL‐13  was  used  to  induce  goblet  cell  metaplasia.  IL‐13  induced 

MUC5AC positive  cells  (5‐fold) and goblet cells  (14‐fold), as assessed by histochemistry, 

and  MUC5AC  gene  expression  (105‐fold).  These  effects  were  partly  prevented  by 

tiotropium  (47‐92%).  IL‐13  decreased  FoxA2  expression  (1.6‐fold)  and  increased  FoxA3 

(3.6‐fold) and SPDEF (5.2‐fold) expression. Tiotropium prevented the effects on FoxA2 and 

FoxA3, but not on SPDEF. 

Conclusions 

We demonstrate that tiotropium has no effects on epithelial cell differentiation following 

air  exposure,  but  inhibits  IL‐13‐induced  goblet  cell metaplasia,  possibly  via  FoxA2  and 

FoxA3.  This  indicates  that  non‐neuronal  acetylcholine  contributes  to  goblet  cell 

differentiation by a direct effect on epithelial cells. 

 

Introduction 

Acetylcholine  is  long known as a classical neurotransmitter  in the airways, released from 

parasympathetic  nerve  fibers.  It  induces  bronchoconstriction  and mucus  secretion  via 

muscarinic  receptors.  For  this  reason,  anticholinergic  therapy  has  been  used  for many 

centuries for the treatment of obstructive airway diseases. 

In  addition,  recent  evidence  indicates  that  acetylcholine  can  also  be  synthesized  and 

released from non‐neuronal origins, acting as an autocrine and/or paracrine mediator on 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 157 

airway cells (1). In particular, airway epithelial cells have been shown to express relatively 

high  levels  of  acetylcholine  (2,  3).  Epithelial  cells  express  enzymes  to  synthesize 

acetylcholine,  including  choline  acetyltransferase  (ChAT),  and have  also  been  shown  to 

release non‐neuronal acetylcholine via organic cation transporters (OCTs) (2, 4). 

Epithelial  cells  play  an  important  role  in  obstructive  airway  diseases  including  asthma. 

Epithelial  differentiation  is  altered  in  the  disease  as  there  is  an  increase  in  goblet  cell 

numbers,  leading  to  excessive  mucus  production  (5).  IL‐13  is  the  main  driver  of  this 

response and has been shown to play a central role in asthma (6). From animals models it 

is  known  that  IL‐13  is  sufficient  to  induce  goblet  cell  hyperplasia  (7),  which  can  be 

reproduced  in air‐liquid  interface (ALI) cell cultures  in vitro (8, 9). IL‐13‐induced MUC5AC 

gene expression is mediated via a complex transcriptional network, in which expression of 

the repressor forkhead box protein A2 (FoxA2) is reduced in response to STAT6 activation, 

whereas  the  expression  of  SAM  pointed  domain  containing  ETS  transcription  factor 

(SPDEF) and  forkhead box protein A3  (FoxA3) are  increased and promote MUC5AC gene 

expression (10, 11). 

Interestingly,  several  studies  have  indirectly  demonstrated  a  role  for  acetylcholine  in 

epithelial  cell  differentiation  and  goblet  cell metaplasia.  Tiotropium,  an  anticholinergic 

drug, has been shown to  inhibit ovalbumin‐induced goblet cell metaplasia  in guinea pigs 

and mice  (12,  13),  an  effect  also  observed  after  knock‐out  of  the M3  receptor  in mice 

(chapter  6).  Furthermore,  the  increased  MUC5AC  expression  observed  after  allergen 

exposure was  inhibited by  tiotropium  in guinea pigs and M3 knock‐out mice  (chapter 6, 

12).  Moreover,  in  mild  asthmatic  patients,  repeated  challenges  with  methacholine 

induced epithelial cell proliferation and goblet cell metaplasia (14). Although these studies 

point to a critical role for acetylcholine  in goblet cell metaplasia,  it remains unresolved  if 

this is via direct regulation of goblet cell differentiation of airway epithelial cells, or via the 

indirect regulation of pro‐inflammatory cells and cytokines that drive this response, since 

tiotropium  also  inhibited  the  inflammatory  response  in  the  animal  studies  described 

above. 

Therefore,  in  this  study,  we  investigated  the  role  of  endogenous  non‐neuronal 

acetylcholine in the differentiation of primary human airway epithelial cells, differentiated 

in  an  ALI  cell  culture. We  demonstrate  that  inhibition  of  endogenous  acetylcholine  by 

tiotropium  has  no  effects  on  epithelial  cell  differentiation  following  air  exposure,  but 

inhibits  IL‐13‐induced  goblet  cell metaplasia  and MUC5AC  expression, which might  be 

mediated via FoxA2 and FoxA3. 

 

Chapter 8 

158 

Methods 

Culture of human airway epithelial cells 

The immortal human bronchial epithelial cell line 16HBE14o− was kindly donated by Dr DC 

Gruenert,  University  of  Vermont,  Burlington,  VT,  USA  (15).  Cells  were  cultured  as 

described previously (16) and briefly described in the supplement. 

Primary human airway epithelial  (HAE) cells were obtained  from healthy  lung  transplant 

donors. Selection criteria for transplant donors are listed in the Eurotransplant guidelines 

and include the absence of primary lung disease, such as asthma and COPD, and no more 

than  20  pack  years  of  smoking  history.  Cells were  isolated  by  enzymatic  digestion  and 

cultured as described previously (9), which is also briefly explained in the supplement and 

summarized in figure 1. Cells were exposed to tiotropium (10 nM; provided by Boehringer 

Ingelheim),  IL‐13  (1ng/ml;  Peprotech,  Rocky  Hill,  NJ),  or  the  combination  of  IL‐13  and 

tiotropium during differentiation of two weeks (figure 1).  

RNA analysis 

Total  RNA was  extracted  from  freshly  isolated  airway  epithelial  cells,  or  from  cultured 

16HBE140‐  or  HAE  cells,  either  after  submerged  or  ALI  culture  (HAE  cells),  using  the 

RNeasy  mini  kit  (Qiagen,  Venlo,  The  Netherlands)  according  to  the  manufacturer's 

instructions.  Equal  amounts of  total RNA were  then  reverse  transcribed  and  cDNA was 

subjected  to  real‐time  qPCR  (Westburg,  Leusden,  The  Netherlands)  or  to  micro‐array 

analysis.  Details  concerning  real‐time  qPCR  and  primers  used  can  be  found  in  the 

supplement  (text and  table S1). Data are normalized  to 18S ribosomal RNA. Micro‐array 

analysis was performed using the llumina HT12 version 4 chip. Data was analyzed using R 

software and subjected to gene set enrichment analysis using the Kyoto Encyclopedia of 

Genes and Genomes (KEGG), Biocarta and Reactome definitions. 

 

 Figure 1. Schematic representation of the air‐liquid interface culture model. Human airway epithelial (HAE) cells 

were seeded onto transwell insert and grown to confluence. Thereafter, apical medium was removed to create 

an air‐liquid interface (ALI). Medium and stimuli were refreshed three times per week. After 14 days, cells were 

harvested for PCR analysis or morphology and medium was collected for ELISA. 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 159 

Histochemistry 

The morphology of  the  cultures was  assessed using  light microscopy. After  two weeks, 

transwell inserts were embedded in paraffin according to the manufacturer’s instructions. 

Transverse cross‐sections of 5 µm thick were used for morphometric analyses. Cells were 

stained  with  H&E  staining  (Sigma‐Aldrich,  Zwijndrecht,  The  Netherlands),  MUC5AC 

positive cells were stained with a MUC5AC antibody staining  (Neomarkers, Fremont, CA, 

USA)  and  mucin‐producing  goblet  cells  were  stained  with  Periodic  Acid  Schiff’s  (PAS, 

Sigma‐Aldrich, Zwijndrecht, The Netherlands). Cells were counted in duplicate in a blinded 

fashion. 

Cytokine analysis 

Cytokine  concentrations  in  basal  medium  were  determined  by  a  MILLIPLEX  assay 

(Millipore, Billerica, USA) on  a  Luminex  100  system using  Starstation  software  (Applied 

Cytometry Systems, Sheffield, UK) according to the manufacturer's  instructions. A screen 

for 26 cytokines was performed (see supplement for complete list).  

Statistical analysis 

Data are presented as mean ± standard error of the mean. Statistical differences between 

means  were  calculated  using  one‐way  ANOVA,  followed  by  Newman  Keuls  multiple 

comparison tests. Differences were considered significant at p<0.05. 

 

Results 

Differentiation of epithelial cells 

First,  the  differentiation  state  of  epithelial  cells  was  characterized.  Therefore,  gene 

expression of the differentiation markers MUC5AC, a marker for goblet cells, and tektin, a 

marker  for  ciliated  cells,  was  compared  in  different  cells.  We  compared  submerged 

cultures of the cell line 16HBE14o‐, submerged cultures of HAE cells, freshly isolated HAE 

cells, and ALI‐cultured HAE  cells. Gene expression of MUC5AC and  tektin was higher  in 

freshly isolated and ALI‐cultured HAE cultures compared to submerged cultures (figure 2). 

Whereas tektin levels were comparable in freshly isolated cells and ALI‐cultures, MUC5AC 

levels were considerably higher in freshly isolated cells compared to ALI‐cultures. Together 

this indicates that differentiation of an ALI culture following air exposure induces epithelial 

cell  differentiation  compared  to  submerged  cultures,  which  mimics  ciliated  cell 

differentiation compared to freshly  isolated epithelial cells, and to a  lesser extent goblet 

cell differentiation (figure 2). 

 

Chapter 8 

160 

 Figure 2. Differentiation state of epithelial cells. Expression of the differentiation markers MUC5AC, a marker for 

goblet  cells  (A),  and  tektin,  a  marker  for  ciliated  cells  (B),  was  analyzed  by  real‐time  qPCR  in  submerged 

16HBE14o‐ and  submerged HAE  cell  cultures,  in  freshly  isolated HAE  cells and  in ALI‐cultured HAE  cells. Data 

represent means ± s.e. of the mean, n=3‐5, ** p<0.01; *** p<0.001 compared to submerged culture, ## p<0.01; 

### p<0.001 compared to HBE culture, $$$ p<0.001 compared to freshly isolated cells. 

 

Expression of the non‐neuronal cholinergic system 

Next,  the  expression  of  genes  involved  in  the  non‐neuronal  cholinergic  system  in  ALI‐

cultured HAE  cells was  characterized  and  compared  to 16HBE14o‐  cells.  In  view of  the 

rationale  of  the  study, we  focused  on  genes  involved  in  acetylcholine metabolism  and 

muscarinic receptors. HAE cells expressed all components of the non‐neuronal cholinergic 

system needed for acetylcholine production and release (table 1). This comprises choline 

transporters for uptake of choline, including the high‐affinity choline transporter 1 (CHT1), 

the  choline  transporter‐like  protein  1  (CTL1),  and  CTL4. Unexpectedly,  the  synthesizing 

enzyme  choline  acetyltransferase  (ChAT) was  not  detected  in  any  of  the  epithelial  cell 

cultures,  whereas  the  synthesizing  enzyme  carnitine  acetyltransferase  (CarAT)  was 

abundantly expressed.  In addition, acetylcholinesterase (AChE) and butyrylcholinesterase 

(BChE), two enzymes for degradation of acetylcholine, were expressed. Finally, muscarinic 

M1, M2 and M3  receptors were expressed on  the HAE cells as a  target  for acetylcholine 

(table 1). Compared  to 16HBE14o‐ cells, most components were expressed at similar or 

higher  levels  in  ALI‐cultured  HAE  cells.  The most  prominent  higher  expression  in  ALI‐

cultured HAE cells was observed  for  the M3  receptor and  the choline  transporters CHT1 

and CTL4 (table 1). 

 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 161 

Table 1. Components of the non‐neuronal cholinergic system expressed in HAE cells. Data represent average Ct 

values corrected for 18S (i.e. highest values represent lowest expression levels), n=3. CHT1: high‐affinity choline 

transporter 1; CTL1: choline transporter‐like protein 1; CTL4: choline transporter‐like protein 4; CarAT: carnitine 

acetyltransferase; M1R: muscarinic M1  receptor; M2R: muscarinic M2  receptor; M3R: muscarinic M3  receptor; 

AChE: acetylcholinesterase; BChE: butyrylcholinesterase. 

 

  

 

 

 

 

 

 

 

Effect of tiotropium on epithelial cell differentiation 

Since HAE cells express all components of the non‐neuronal cholinergic system, suggesting 

production of  endogenous non‐neuronal  acetylcholine, we  examined  the  effects of  the 

muscarinic  antagonist  tiotropium.  Tiotropium  was  administered  during  the  two  week 

differentiation period  in a  concentration  (10 nM) binding >99% of muscarinic  receptors 

(17).  As  depicted  in  figure  3A,  tiotropium  had  no  effect  on  gene  expression  of  the 

differentiation  markers  MUC5AC  and  tektin  following  air  exposure.  Moreover,  no 

histological  changes were  observed  after  exposure  to  tiotropium,  as  assessed  by  H&E 

staining  (figure 3B) and PAS  staining  (figure 3C). A micro‐array analysis confirmed  these 

data and showed that no genes were upregulated or downregulated by more than 1.5‐fold 

after  treatment  with  tiotropium  (figure  3D). Moreover,  gene  set  enrichment  analyses 

using  the  KEGG,  Reactome  and  Biocarta  definitions  revealed  no  pathways  that  were 

significantly altered. In an alternative analysis focusing on genes that were upregulated or 

downregulated  by  more  than  1.1‐fold,  eleven  genes  were  selected  based  on  their 

relevance  for epithelial  cell differentiation. These  included  the genes mitogen activated 

protein kinase (MEK) 1, MEK2, MEK4 and rapidly accelerated fibrosarcoma (RAF) 1 of the 

MAP kinase pathway; laminin (LAM) B3 and LAMC2 involved in cell junction organization; 

FoxA2 and FoxA3,  involved  in goblet cell metaplasia; and  the potassium channels KK17, 

KK15 and KJ6. However, upregulation or downregulation of none of these genes could be 

reproduced  by  real‐time  qPCR  (figure  3D,  individual  data  not  shown).  Collectively, we 

were not able to show any effects of tiotropium on epithelial cell differentiation following 

air exposure. 

16HBE14o‐ cells  

(±sem) 

ALI‐cultured HAE cells 

(±sem) 

CHT1  27.7 (±0.5)  24.9 (±0.7) 

CTL1  10.6 (±0.3)  11.7 (±0.5) 

CTL4  23.5 (±0.4)  10.3 (±0.7) 

CarAT  15.5 (±1.5)  15.3 (±0.8) 

M1R  18.7 (±1.4)  21.2 (±0.2) 

M2R  21.5 (±0.5)  21.1 (±0.4) 

M3R  25.9 (±0.9)  17.6 (±0.6) 

AChE  22.4 (±1.0)  21.9 (±0.8) 

BChE  19.7 (±0.8)  19.4 (±0.6) 

Chapter 8 

162 

 Figure 3. Tiotropium does not affect epithelial cell differentiation following air exposure. HAE cells were cultured 

at an air‐liquid interface (ALI) and differentiated with or without tiotropium (10 nM) for two weeks according to 

figure 1. (A) Expression of the differentiation markers MUC5AC and tektin was analyzed by real‐time qPCR. Data 

represent means ± s.e. of the mean. (B) Representative images of H&E staining. (C) Representative images of PAS 

staining. (D) Flow diagram of steps taken after micro‐array analysis. N=4 donors, CTR = control. 

 

Effect of tiotropium on IL‐13‐induced goblet cell metaplasia 

Since  there  was  no  effect  of  tiotropium  on  epithelial  cell  differentiation  following  air 

exposure, and in view of the limited goblet cell differentiation achieved using this method, 

IL‐13 in a concentration of 1 ng/ml was used in subsequent experiments to induce goblet 

cell metaplasia  (9). Stimulation with  IL‐13 did not affect the expression of receptors and 

enzymes of  the non‐neuronal  cholinergic  system  (table S2) and  induced only a modest, 

non‐significant  increase  in  inflammatory  cytokine  expression  (table  S3).  However, 

stimulation with IL‐13 did induce goblet cell metaplasia as assessed by histochemistry and 

real‐time qPCR (figure 4). IL‐13 induced a 5.3‐fold increase in MUC5AC positive cells, which 

was  prevented  by  tiotropium  (57%;  figure  4A  and  B).  Moreover,  the  IL‐13‐induced 

increase  in goblet  cell number,  assessed by PAS  staining, was  completely prevented by 

tiotropium (figure 4C and D). Furthermore, MUC5AC gene expression was induced by 105‐

fold after  stimulation with  IL‐13  (figure 4D), which was partly prevented by  tiotropium, 

although  not  significant  (47%;  figure  4C).  Interestingly,  the  expression  of  tektin  was 

decreased by 75% after stimulation with IL‐13 (figure 4D). Tiotropium did not affect the IL‐

13‐induced reduction of tektin (figure 4D).  

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 163 

 Figure 4.  Tiotropium  attenuates  IL‐13‐induced  goblet  cell metaplasia. HAE  cells were  cultured  at  an  air‐liquid 

interface  (ALI)  and  differentiated with  or without  IL‐13  (1  ng/ml)  and/or  tiotropium  (10  nM)  for  two weeks 

according to figure 1. MUC5AC positive cells were determined by a MUC5AC antibody staining, quantification (A) 

and representative images (B) are shown. Goblet cells were determined by a PAS staining, quantification (C) and 

representative  images (D) are shown. Expression of the differentiation markers MUC5AC (E) and tektin (F) was 

analyzed by real‐time qPCR. CTR = control. Data represent mean ± s.e. of the mean, n=4‐8 donors, ** p<0.01; *** 

p<0.001 compared to CTR, # p<0.05; ## p<0.01 compared to IL‐13. 

Chapter 8 

164 

In subsequent experiments, we investigated the key transcription factors involved in IL‐13‐

induced  goblet  cell  metaplasia  in  HAE  cells  and  the  effect  of  tiotropium  hereon.  As 

depicted  in  figure  5,  increased  MUC5AC  expression  was  accompanied  by  decreased 

expression  of  FoxA2  (1.6‐fold)  and  increased  expression  of  FoxA3  (3.6‐fold)  and  SPDEF 

(5.2‐fold). Tiotropium had no effect of basal expression of  these  genes, but  completely 

reversed the inhibitory effect of IL‐13 on FoxA2 (figure 5A). Moreover, tiotropium partially 

prevented  IL‐13‐induced  FoxA3  expression  (figure  5B).  IL‐13‐induced  SPDEF  expression 

was not affected by tiotropium (figure 5C). 

  

Figure 5. Effect of tiotropium on transcriptional mechanisms  involved  in goblet cell metaplasia. HAE cells were 

cultured at an air‐liquid interface (ALI) and differentiated with or without IL‐13 (1 ng/ml) and/or tiotropium (10 

nM) for two weeks according to figure 1. Expression of the transcription factors forkhead box protein A2 (FoxA2; 

A), forkhead box protein A3 (FoxA3; B) and SAM pointed domain containing ETS transcription factor (SPDEF; C) 

was analyzed by real‐time qPCR. CTR = control. Data represent mean ± s.e. of the mean, n=8 donors, * p<0.05; ** 

p<0.01; *** p<0.001 compared to CTR, # p<0.05 compared to IL‐13. 

 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 165 

Discussion 

In  this  study we demonstrate  that non‐neuronal acetylcholine contributes  to goblet cell 

differentiation.  Human  airway  epithelial  cells  expressed  all  components  needed  for 

acetylcholine synthesis, and although the muscarinic antagonist tiotropium did not affect 

epithelial  cell differentiation  following air exposure,  tiotropium did  inhibit  IL‐13‐induced 

goblet  cell metaplasia.  Furthermore,  we  provide  evidence  for  the  involvement  of  the 

transcriptional  regulators  FoxA2  and  FoxA3  in  this  effect.  This  study  is  the  first  to 

investigate  the  role of  tiotropium  in ALI‐cultured primary epithelial cells and  the  results 

imply that tiotropium might affect mucus hypersecretion.  

Data  from  this  study  clearly  indicates  that  all  components  needed  for  acetylcholine 

synthesis  are  present  in  cultured  human  airway  epithelial  cells  derived  from  central 

airways. The fact that epithelial cells express components of the non‐neuronal cholinergic 

system is in line with previous studies (3, 4). However, in contrast to previous studies and 

different  from  the  neuronal  cholinergic  system  where  ChAT  is  the  most  prominent 

synthesizing  enzyme  of  acetylcholine  (2,  4),  we  were  unable  to  detect  significant 

expression of ChAT in any of the epithelial cell cultures. Rather, we demonstrate abundant 

expression of the synthesizing enzyme CarAT. The enzyme CarAT was identified already 40 

years ago as an alternative way to synthesize acetylcholine  in rabbit heart by White and 

Wu (18) and has been detected  in multiple non‐neuronal cholinerigc systems since then, 

including  rat  skeletal  muscle  (19),  cat  esophageal  mucosa  (20),  mouse  bladder  and 

abraded urothelium, and human mucosal bladder biopsies (21). 

The  fact  that  acetylcholine  is  not  only  a  neurotransmitter,  but  also  a  local  signaling 

molecule produced by non‐neuronal  cells, has dramatically broadened  the  view on  the 

role  of  acetylcholine.  It  has  been  suggested  that  the  non‐neuronal  cholinergic  system 

might play a role in lung physiology and/or pathophysiology, however, direct evidence for 

such a role  is still  limited.  In this study, human airway epithelial cells, cultured at an ALI, 

were used as a model system. In this way, the role of non‐neuronal acetylcholine can be 

investigated,  since  no  neuronal  system  is  present.  Moreover,  by  using  primary  cells 

cultured at an ALI, the human physiology is reflected more closely compared to cell lines 

like 16HBE14o‐.  Instead of only one basal  cell  type, an ALI‐culture  is a pseudostratified 

mucociliary cell culture with different epithelial cells present, as  is also observed  in vivo. 

Our  data  indicate  that  ciliated  cell  marker  expression  in  ALI‐cultured  HAE  cells  is 

comparable  to  freshly  isolated  airway  epithelial  cells,  whereas MUC5AC  expression,  a 

marker  for  goblet  cells,  is moderately expressed  after ALI‐culture, but  can be markedly 

increased by IL‐13 exposure. Of specific relevance to our study is that components of the 

Chapter 8 

166 

non‐neuronal  cholinergic  system  are  expressed  at  higher  levels  in  primary ALI‐cultured 

cells compared to 16HBE14o‐ cells.  

IL‐13  is  a  central mediator  in  asthma  pathology  leading  to  goblet  cell metaplasia  and 

mucus  hypersecretion  (6). Mucus  secretion  and MUC5AC  expression  are  enhanced  in 

asthma  and  contribute  significantly  to  airflow  limitation  in  asthma  by  obstructing  the 

smaller  airways  (22,  23).  Stimulation  with  IL‐13  increased MUC5AC  expression  in  our 

study, which is in line with previous studies using ALI‐cultures (8, 9). Moreover, expression 

of tektin, a marker of ciliated cells, was reduced at the same time by IL‐13. Indeed goblet 

cell metaplasia was  induced, as MUC5AC antibody staining and PAS staining revealed an 

increase  in mucin‐producing cells compared to control sections. Furthermore, expression 

of the transcription factors SPDEF and FoxA3 was enhanced, whereas expression of FoxA2 

was reduced. This  is  in  line with previous studies aimed at unraveling the transcriptional 

network  involved  in goblet cell metaplasia  (10, 11).  Interestingly,  tiotropium completely 

prevented the reduced expression of FoxA2 and partly prevented the  increase  in FoxA3, 

whereas  increased  expression  of  SPDEF was  not  affected.  This may  explain  the  partial 

effect observed on goblet cell metaplasia after tiotropium exposure. 

Mucus secreting cells in the airways include epithelial goblet cells and submucosal glands. 

It has been convincingly shown  that  the  latter are under cholinergic neural control  (22). 

Vagal  stimulation of  ferret  trachea  in  vitro or  in  vivo enhanced mucus  secretion, which 

was  inhibited  by  the M3  antagonist  4‐DAMP  (24),  and  electrical  field  stimulation  also 

enhanced mucus  release  from human bronchi  (25). This neuronal acetylcholine‐induced 

mucus  release  is probably derived  from airway  submucosal glands. However,  increasing 

evidence  suggests  that  acetylcholine  can  also  induce mucus  secretion  from  goblet  cells 

(22, 26, 27). Whether goblet cells can release mucus  in response  to neuronally released 

acetylcholine  is still a matter of debate, but our data do suggest a role for non‐neuronal 

acetylcholine  in  the  differentiation  towards  this  cell  type.  While  submucosal  glands 

predominate  in  healthy  human  airways,  goblet  cells  undergo metaplasia  under  disease 

conditions  and  predominate  in  asthma  (22),  indicating  the  potential  relevance  for 

inhibition of this differentiation process. 

Therefore, the finding that tiotropium partly prevents IL‐13‐induced goblet cell metaplasia 

in our model implies that this might be beneficial for asthma patients. This is in line with 

evidence from  in vitro and  in vivo studies,  indicating a role for muscarinic antagonists  in 

mucus  hypersecretion.  The muscarinic  antagonist  oxitropium  dose‐dependently  inhibits 

histamine‐induced mucus secretion from airway goblet cells (28). Furthermore, Cortijo et 

al. demonstrated that muscarinic receptor stimulation by carbachol induced an increase in 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 167 

MUC5AC  expression  in  human  bronchus  and  in  cultured  epithelial  cells,  which  was 

inhibited by  the muscarinic antagonist aclidinium  (29). Similar  findings were observed  in 

mild asthma patients, in which repeated challenges with methacholine induced epithelial 

cell  proliferation  and  goblet  cell  metaplasia  (14).  Interestingly,  these  effects  can  be 

prevented  when  bronchoconstriction  is  prevented,  suggesting  that  preventing 

bronchoconstriction with  tiotropium might  have  an  indirect  inhibitory  effect  on mucus 

hypersecretion  (14).  Animal  studies  have  also  provided  indirect  evidence  for  a  role  of 

muscarinic receptors  in allergen‐induced goblet cell metaplasia. In an ovalbumin‐induced 

guinea pig model, tiotropium inhibited MUC5AC expression and mucus gland hypertrophy 

(30).  Moreover,  goblet  cell  metaplasia  was  inhibited  by  tiotropium  in  an  ovalbumin‐

induced mouse model  (13).  Interestingly,  knock‐out of  the muscarinic M3  receptor also 

inhibits  ovalbumin‐induced  goblet  cell metaplasia  and MUC5AC  expression  (chapter  6). 

Notably, IL‐13 expression was enhanced in these same animals, indicating that this effect 

was not via a reduction of the inflammatory response (chapter 6). 

Our findings extend these previous observations as we now demonstrate that the effects 

of  tiotropium  are  not  only  the  result  of  reduced  bronchoconstriction  or  reduced 

inflammatory  cytokine  expression,  but  that  tiotropium  also  has  a  direct  effect  on  the 

epithelium. We  performed  a multiplex  cytokine  analysis  to  verify  the  absence  of  the 

involvement  of  an  inflammatory  response.  Only  a modest,  non‐significant  increase  in 

inflammatory  cytokines was  observed  after  stimulation with  IL‐13,  and  also  tiotropium 

had no significant effect on inflammatory cytokines. Therefore we can conclude from our 

study that airway epithelial cells express non‐neuronal acetylcholine and inhibition of this 

component  by  anticholinergics  is  sufficient  to  prevent  IL‐13‐induced  goblet  cell 

differentiation. This direct effect of tiotropium on airway epithelial cells as observed in our 

study might act synergistically with indirect effects of tiotropium on epithelial cells in vivo, 

including  reduced mechanical  strain and  reduced  inflammation. However,  future clinical 

studies are clearly needed to confirm this hypothesis. 

Tiotropium is currently not included as a chronic therapy for patients with asthma. Recent 

evidence  suggests  that  addition  of  tiotropium  to  standard  therapy with  long‐acting  β‐

agonists and  inhaled corticosteroids might be beneficial  for asthma patients  (31).  In this 

randomized controlled  trial  it was shown  that  tiotropium  induces an  increase  in FEV1  in 

severe asthma patients, on top of the use of β2‐agonists and corticosteroids. Furthermore, 

severe exacerbations and episodes of worsening of asthma were reduced after add‐on of 

tiotropium  (31). Results  from our  study  imply  that mucus hypersecretion might also be 

affected  after  tiotropium  treatment.  Previously,  tiotropium  has  been  shown  to  be 

effective in reducing sputum levels in patients with chronic airway mucus hypersecretion 

Chapter 8 

168 

(32). Although  it has been proposed that anticholinergic treatment might  impair sputum 

clearance, there  is now  increasing evidence that reducing the volume of sputum without 

altering  viscoelasticity  by  anticholinergics  is  beneficial  for  patients with  chronic mucus 

hypersecretion (33). Future studies are needed to directly address this hypothesis in more 

detail. 

In  conclusion, we  demonstrated  that  tiotropium  can  prevent  IL‐13‐induced  goblet  cell 

metaplasia,  indicating  that  non‐neuronal  acetylcholine  contributes  to  goblet  cell 

differentiation.  Modulation  of  FoxA2  and  FoxA3  expression  is  likely  one  of  the 

mechanisms involved. These data imply that this direct effect of tiotropium on the airway 

epithelium,  in  combination  with  its  protective  effects  on  bronchoconstriction  and 

inflammation, may protect from mucus hypersecretion. 

 

Acknowledgements 

The  authors would  like  to  thank  Renate M.  Verhoosel  and Willemieke M. Mudde  for 

technical assistance, and Tinne C.J. Mertens for expert advice on analysis of IL‐13 induced 

mucin production. The authors would  like to thank the Netherlands Lung Foundation for 

financial support (grant 3.2.08.014). Previous research on the ALI‐model in the laboratory 

of P.S. Hiemstra was supported by a grant from Boerhringer Ingelheim. 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 169 

Supplement 

Methods 

Culture of human airway epithelial cells 

The  immortal human bronchial epithelial  cell  line 16HBE14o− was  cultured  in minimum 

essential medium  (ME)),  supplemented with 10% heat‐inactivated  foetal bovine  serum, 

20 U/ml penicillin and 20 μg/ml streptomycin and 2 mM L‐glutamine (Gibco, Grand Island, 

NY). Cells were collected for RNA analysis. 

Primary human airway epithelial  (HAE) cells were obtained  from healthy  lung  transplant 

donors and isolated by enzymatic digestion. Cells from passage 2 were grown submerged 

on collagen‐coated Transwell  inserts until confluence, after which  they were cultured at 

an air‐liquid interface (ALI) and differentiated for two weeks in B/D medium (1:1 mixture 

of  DMEM  [Gibco,  Grand  Island,  NY]  and  bronchial  epithelial  growth  medium  [BEGM; 

Lonza, Walkersville, MD,  USA],  supplemented with  0.4%  [w/v]  bovine  pituitary  extract 

[BPE],  0.5 ng/ml  epidermal  growth  factor  [EGF],  5 μg/ml  insulin,  10 μg/ml  transferrin, 

1 μM  hydrocortisone,  6.5 ng/ml  T3,  0.5 μg/ml  epinephrine  [all  from  Lonza],  15 ng/ml 

retinoic  acid  [Sigma  Chemical,  St.  Louis, MO],  1.5 μg/ml  bovine  serum  albumin  [Sigma 

Chemical,  St.  Louis, MO], 0.5 mM  sodium pyruvate  [Gibco, Grand  Island, NY  ], 20 U/ml 

penicillin and 20 μg/ml streptomycin [Gibco, Grand Island, NY]). Cells were exposed to IL‐

13  (1  ng/ml;  Peprotech,  Rocky  Hill,  NJ),  tiotropium  (10  nM;  provided  by  Boehringer 

Ingelheim)  or  the  combination  of  IL‐13  and  tiotropium  that  was  added  to  the  basal 

medium during  the differentiation process. ALI cultures were maintained  for 14 days at 

37°C  in a humidified atmosphere of 5% CO2. Medium and  stimuli were  refreshed  three 

times per week. The apical side of the epithelial cells was washed with PBS at the same 

time. After  two weeks, cells were collected  for RNA analysis or  fixed  for histochemistry, 

and basal medium was collected for cytokine analysis. 

Real time PCR 

Real time PCR was performed with denaturation at 94°C for 30 seconds, annealing at 59°C 

for 30 seconds and extension at 72°C for 30 seconds for 40 cycles followed by 10 minutes 

at  72°C.  Real‐time  PCR  data were  analyzed  using  the  comparative  cycle  threshold  (Ct: 

amplification cycle number) method. The amount of  target gene was normalized  to  the 

endogenous reference gene 18S ribosomal RNA. The specific forward and reverse primers 

used are listed in Table S1. 

Chapter 8 

170 

Table S1. Primers used for qRT‐PCR analysis. CHT1: high‐affinity choline transporter 1; CTL1: choline transporter‐

like protein 1; CTL4: choline  transporter‐like protein 4; CarAT: carnitine acetyltransferase; M1R: muscarinic M1 

receptor;  M2R:  muscarinic  M2  receptor;  M3R:  muscarinic  M3  receptor;  AChE:  acetylcholinesterase;  BChE: 

butyrylcholinesterase; FoxA2:  forkhead box protein A2; FoxA3:  forkhead box protein A3; SPDEF: SAM pointed 

domain containing ETS transcription factor.  

Gene  Primer sequence  NCBI accession number 

MUC5AC  Forward – ATTTTTTCCCCACTCCTGATG 

Reverse  – AAGACAACCCACTCCCAACC 

XM_006718399.1 

Tektin  Forward – TGGGCTGAAGGATACAAAGG   

Reverse  – GATGGCCTTTTCAAGAGCTG 

NM_053285.1 

 

CHT1  Forward – TGCAGTATCTCTGCCCTGTG 

Reverse  – AGCTGGGGGAAGATAACGAT 

NM_021815.2 

CTL1  Forward – TAGCCGACGGTTATGGAAAC 

Reverse  – CCTTGTAAAAGCCACCCGTA 

NM_080546.4 

CTL4  Forward – GGGATCAGCGGTCTTATTGA 

Reverse  – GGCGCAGAAGCAAGATAAAC 

NM_025257.2 

CarAT  Forward – AAGAAGCTGCGGTTCAACAT 

Reverse  – GGGCTTAGCTTCTCCGACTT 

BT006801.1 

 

M1R  Forward – CCGCTACTTCTCCGTGACTC 

Reverse  – GTGCTCGGTTCTCTGTCTCC 

NM_000738.2 

M2R  Forward – TACGGCTATTGCAGCCTTCT 

Reverse  – GCAACAGGCTCCTTCTTGTC 

NM_001006630.1 

M3R  Forward – GGTCATACCGTCTGGCAAGT 

Reverse  – AGGCCAGGCTTAAGAGGAAG 

NM_000740.2 

AChE  Forward – CCTCCTTGGACGTGTACGAT 

Reverse  – CTGATCCAGGAGACCCACAT 

NM_001282449.1 

BChE  Forward – AAGCTGGCCTGTCTTCAAAA 

Reverse  – CCACTCCCATTCTGCTTCAT 

NM_000055.2 

FoxA2  Forward – ACTACCCCGGCTACGGTTC 

Reverse  – AGGCCCGTTTTGTTCGTGA 

XM_006723562.1 

FoxA3  Forward – CTTCAACCACCCTTTCTCCA 

Reverse  –  GGGAATAGAGGCCCTGGTAG 

NM_004497.2 

 

SPDEF  Forward –  ATGAAAGAGCGGACTTCACCT 

Reverse  – CTGGTCGAGGCACAGTAGTG 

XM_005248988.2 

18S  Forward – CGCCGCTAGAGGTGAAATTC 

Reverse  – TTGGCAAATGCTTTCGCTC 

NR_003286.2 

 

 

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 171 

Table S2. Effect of  IL‐13 on  the expression of  the non‐neuronal cholinergic system. Data  represent average Ct 

values corrected for 18S (i.e. highest values represent lowest expression levels), n=4 donors. CHT1: high‐affinity 

choline  transporter 1; CTL1: choline  transporter‐like protein 1; CTL4: choline  transporter‐like protein 4; CarAT: 

carnitine  acetyltransferase; M1R: muscarinic M1  receptor; M2R: muscarinic M2  receptor; M3R: muscarinic M3 

receptor; AChE: acetylcholinesterase; BChE: butyrylcholinesterase.  

 

 

 

 

 

Table S3. Effect of IL‐13 and tiotropium on  inflammatory cytokine release. Cytokine  levels were measured by a 

Luminex assay on the basal medium. No significant differences were observed. Data represent mean (pg/ml) ± 

s.e. of the mean, n=8 donors. The following cytokines were below the detection limit of 3.2 pg/ml: IFNγ, IL‐1 α, 

IL‐1β, IL‐2, IL‐3, IL‐4, IL‐5, IL‐6, IL‐10, IL‐12 (p40), IL‐12 (p70), IL‐15, IL‐17A, MIP‐1α, TNF‐α, TNF‐β.  

   

CTR  

IL‐13  

Tiotropium IL‐13 + 

tiotropium 

Eotaxin  22.3 (±2.2)  25.6 (±2.3)  22.0 (±2.3)  25.2 (±2.9) 

G‐CSF  378.4 (±262.7)  415.7 (±208.6)  503.7 (±259.9)  206.4 (±118.3) 

GM‐CSF  48.2 (±13.9)  61.8 (±21.3)  30.0 (±6.6)  70.8 (±26.5) 

IFNα2  38.2 (±7.2)  39.4 (±7.0)  36.5 (±7.8)  39.9 (±8.2) 

IL‐7  12.5 (±2.5)  15.3 (±2.4)  11.7 (±2.2)  15.8 (±3.1) 

IL‐8  1740.5 (±276.7)  2065.5 (±123.8)  1737.9 (±236.4)  1822.9 (±190.9) 

IP‐10  24.9 (±6.4)  41.5 (±12.4)  26.9 (±5.8)  59.2 (±17.5) 

MCP‐1  30.7 (±18.6)  77.6 (±56.9)  35.2 (±18.5)  142.9 (±87.5) 

MIP‐1β  11.0 (±0.1)  11.3 (±0.2)  11.1 (±0.1)  11.2 (±0.2) 

 

   

  CTR (±sem)  IL‐13 (±sem) 

CHT1  24.4 (±1.0)  24.7 (±0.5) 

CTL1  13.1 (±0.4)  13.0 (±0.2) 

CTL4  11.5 (±0.2)  11.2 (±0.1) 

CarAT  14.3 (±0.4)  14.6 (±0.2) 

M1R  20.4 (±0.4)  20.3 (±0.4) 

M2R  22.5 (±0.6)  22.4 (±0.7) 

M3R  18.1 (±0.1)  18.4 (±0.1) 

AChE  21.7 (±0.4)  21.6 (±0.3) 

BChE  20.2 (±0.9)  21.2 (±0.4) 

Chapter 8 

172 

References  

(1) Wessler I, Kirkpatrick CJ. Acetylcholine beyond neurons: the non‐neuronal cholinergic system in 

humans. Br J Pharmacol 2008;154:1558‐1571.  

(2) Klapproth H, Reinheimer T, Metzen J, Munch M, Bittinger F, Kirkpatrick CJ, Hohle KD, Schemann 

M, Racke K, Wessler I. Non‐neuronal acetylcholine, a signalling molecule synthezised by surface cells 

of rat and man. Naunyn Schmiedebergs Arch Pharmacol 1997;355:515‐523.  

(3) Proskocil BJ, Sekhon HS, Jia Y, Savchenko V, Blakely RD, Lindstrom J, Spindel ER. Acetylcholine is 

an  autocrine or paracrine hormone  synthesized  and  secreted by  airway bronchial epithelial  cells. 

Endocrinology 2004;145:2498‐2506.  

(4) Kummer W, Lips KS, Pfeil U. The epithelial cholinergic system of the airways. Histochem Cell Biol 

2008;130:219‐234.  

(5) Lambrecht BN, Hammad H. The airway epithelium in asthma. Nat Med 2012;18:684‐692.  

(6) Corren J. Role of interleukin‐13 in asthma. Curr Allergy Asthma Rep 2013;13:415‐420.  

(7) Zhu Z, Homer RJ, Wang Z, Chen Q, Geba GP, Wang J, Zhang Y, Elias JA. Pulmonary expression of 

interleukin‐13  causes  inflammation,  mucus  hypersecretion,  subepithelial  fibrosis,  physiologic 

abnormalities, and eotaxin production. J Clin Invest 1999;103:779‐788.  

(8) Laoukili J, Perret E, Willems T, Minty A, Parthoens E, Houcine O, Coste A, Jorissen M, Marano F, 

Caput D, Tournier F. IL‐13 alters mucociliary differentiation and ciliary beating of human respiratory 

epithelial cells. J Clin Invest 2001;108:1817‐1824.  

(9)  Zuyderduyn  S,  Ninaber  DK,  Schrumpf  JA,  van  Sterkenburg MA,  Verhoosel  RM,  Prins  FA,  van 

Wetering  S,  Rabe  KF,  Hiemstra  PS.  IL‐4  and  IL‐13  exposure  during mucociliary  differentiation  of 

bronchial epithelial  cells  increases antimicrobial activity and expression of antimicrobial peptides. 

Respir Res 2011;12:59‐9921‐12‐59.  

(10) Whitsett JA, Haitchi HM, Maeda Y. Intersections between pulmonary development and disease. 

Am J Respir Crit Care Med 2011;184:401‐406.  

(11) Chen G, Korfhagen TR, Xu Y, Kitzmiller J, Wert SE, Maeda Y, Gregorieff A, Clevers H, Whitsett JA. 

SPDEF is required for mouse pulmonary goblet cell differentiation and regulates a network of genes 

associated with mucus production. J Clin Invest 2009;119:2914‐2924.  

(12)  Bos  IS,  Gosens  R,  Zuidhof  AB,  Schaafsma  D,  Halayko  AJ, Meurs  H,  Zaagsma  J.  Inhibition  of 

allergen‐induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J 

2007;30:653‐661.  

(13) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y, Minoguchi K, Ohnishi T, Hirose T, 

Nagase H, Ohta K, Adachi M. Effect of tiotropium bromide on airway inflammation and remodelling 

in a mouse model of asthma. Clin Exp Allergy 2010;40:1266‐1275.  

(14) Grainge CL,  Lau  LC, Ward  JA, Dulay V,  Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. 

Effect of bronchoconstriction on airway remodeling in asthma. N Engl J Med 2011;364:2006‐2015.  

(15) Cozens AL,  Yezzi MJ, Kunzelmann K, Ohrui  T, Chin  L,  Eng K,  Finkbeiner WE, Widdicombe  JH, 

Gruenert  DC.  CFTR  expression  and  chloride  secretion  in  polarized  immortal  human  bronchial 

epithelial cells. Am J Respir Cell Mol Biol 1994;10:38‐47.  

Tiotropium inhibits IL‐13‐induced goblet cell metaplasia 

 173 

(16) Gkoumassi E, Dekkers BG, Droge MJ, Elzinga CR, Schmidt M, Meurs H, Zaagsma J, Nelemans SA. 

Virodhamine  and  CP55,940  modulate  cAMP  production  and  IL‐8  release  in  human  bronchial 

epithelial cells. Br J Pharmacol 2007;151:1041‐1048.  

(17) Disse B,  Speck GA, Rominger KL, Witek TJ,Jr., Hammer R.  Tiotropium  (Spiriva): mechanistical 

considerations and clinical profile in obstructive lung disease. Life Sci 1999;64:457‐464.  

(18) White HL, Wu JC. Choline and carnitine acetyltransferases of heart. Biochemistry 1973;12:841‐

846.  

(19) Tucek S. The synthesis of acetylcholine in skeletal muscles of the rat. J Physiol 1982;322:53‐69.  

(20) Wolf‐Johnston AS, Hanna‐Mitchell AT, Buffington CA, Shinde S, Roppolo JR, Mayer E, Birder LA. 

Alterations  in  the  non‐neuronal  acetylcholine  synthesis  and  release  machinery  in  esophageal 

epithelium. Life Sci 2012;91:1065‐1069.  

(21) Lips KS, Wunsch J, Zarghooni S, Bschleipfer T, Schukowski K, Weidner W, Wessler I, Schwantes 

U,  Koepsell H,  Kummer W. Acetylcholine  and molecular  components  of  its  synthesis  and  release 

machinery in the urothelium. Eur Urol 2007;51:1042‐1053.  

(22) Rogers DF. Motor control of airway goblet cells and glands. Respir Physiol 2001;125:129‐144.  

(23) Morcillo EJ, Cortijo J. Mucus and MUC in asthma. Curr Opin Pulm Med 2006;12:1‐6.  

(24) Ramnarine SI, Haddad EB, Khawaja AM, Mak JC, Rogers DF. On muscarinic control of neurogenic 

mucus secretion in ferret trachea. J Physiol 1996;494 ( Pt 2):577‐586.  

(25) Baker B, Peatfield AC, Richardson PS. Nervous control of mucin secretion into human bronchi. J 

Physiol 1985;365:297‐305.  

(26) Bolduc P, Reid  L. The effect of  isoprenaline and pilocarpine on mitotic  index and goblet  cell 

number in rat respiratory epithelium. Br J Exp Pathol 1978;59:311‐318.  

(27)  Steel  DM,  Hanrahan  JW. Muscarinic‐induced mucin  secretion  and  intracellular  signaling  by 

hamster tracheal goblet cells. Am J Physiol 1997;272:L230‐7.  

(28) Takeyama K, Tamaoki J, Nakata J, Konno K. Effect of oxitropium bromide on histamine‐induced 

airway goblet cell secretion. Am J Respir Crit Care Med 1996;154:231‐236.  

(29) Cortijo  J, Mata M, Milara  J, Donet E, Gavalda A, Miralpeix M, Morcillo EJ. Aclidinium  inhibits 

cholinergic and tobacco smoke‐induced MUC5AC in human airways. Eur Respir J 2011;37:244‐254.  

(30)  Bos  IS,  Gosens  R,  Zuidhof  AB,  Schaafsma  D,  Halayko  AJ, Meurs  H,  Zaagsma  J.  Inhibition  of 

allergen‐induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J 

2007;30:653‐661.  

(31)  Kerstjens HA,  Engel M, Dahl  R,  Paggiaro  P,  Beck  E,  Vandewalker M,  Sigmund  R,  Seibold W, 

Moroni‐Zentgraf P, Bateman ED. Tiotropium in asthma poorly controlled with standard combination 

therapy. N Engl J Med 2012;367:1198‐1207.  

(32)  Saito  Y,  Azuma  A,  Morimoto  T,  Fujita  K,  Abe  S,  Motegi  T,  Usuki  J,  Kudoh  S.  Tiotropium 

ameliorates symptoms  in patients with chronic airway mucus hypersecretion which  is  resistant  to 

macrolide therapy. Intern Med 2008;47:585‐591.  

(33) Bateman ED, Rennard S, Barnes PJ, Dicpinigaitis PV, Gosens R, Gross NJ, Nadel  JA, Pfeifer M, 

Racke  K,  Rabe  KF,  Rubin  BK, Welte  T, Wessler  I.  Alternative mechanisms  for  tiotropium.  Pulm 

Pharmacol Ther 2009;22:533‐542.  

 

 

 

 

 

 

 

 

CHAPTER 9 

GENERAL DISCUSSION AND SUMMARY 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Trends Pharmacol Sci, 2014, Epub 

Chapter 9 

176 

Preface 

The  objective  of  this  thesis  was  to  establish  the  role  of  acetylcholine  in  airway 

inflammation and remodeling  in COPD and asthma. We aimed  to  investigate  the role of 

individual muscarinic  receptor  subtypes,  as well  as  the  contribution of neuronal  versus 

non‐neuronal acetylcholine to inflammation and remodeling. The studies described in this 

thesis reveal that there is a critical regulatory role for the M3 receptor in these processes, 

which  is  mediated  via  neuronal  acetylcholine,  but  also  involves  non‐neuronal 

acetylcholine. 

 

Anticholinergics as bronchodilators in COPD and asthma 

COPD  and  asthma  are  chronic  obstructive  airway  diseases,  and  the  incidence  of  both 

diseases  is  increasing  (1). COPD  is a  leading cause of morbidity and mortality worldwide 

and  is  expected  to  become  the  third  leading  cause  of  death  in  2020.  This  results  in  a 

substantial economic and social burden (2). With 180,000 deaths  in the world each year, 

mortality from asthma  is considerably  lower, but around 300 million people  in the world 

currently have asthma and its greatest burden lies in the morbidity and invalidity it causes, 

also in children (3). Inflammation and remodeling are hallmark features of both diseases, 

which  contribute  to  the  decline  in  lung  function  and  the  severity  of  the  disease  (4‐6). 

Acetylcholine  is  the  primary  parasympathetic  neurotransmitter  in  the  airways,  and 

induces  bronchoconstriction  and  mucus  secretion  via  M3  receptors  (chapter  2).  The 

activity of  the neuronal  system  is altered  in asthma and COPD via  several mechanisms, 

which can originate early in life or develop as an acute or chronic response after allergen 

challenge or stimuli such as cigarette smoke, leading to exaggerated acetylcholine release 

and airway narrowing  (chapter 1). Strikingly,  the  increased cholinergic  tone  is  the major 

reversible component of airflow  limitation  in COPD (7, 8). Therefore, anticholinergics are 

effective  bronchodilators  in  this  disease,  and  represent  a  first  line  of  treatment  (2).  In 

asthma, use of anticholinergics is currently limited to the treatment of exacerbations (9), 

however, recent clinical trials indicate that anticholinergic therapy might also be beneficial 

for chronic treatment of moderate and severe asthma patients (10, 11). 

 

   

General discussion and summary 

 177 

Muscarinic  receptor  subtypes  in  the  lung  –  is  there  a  need  for  M3  selective 

anticholinergics? 

Increasing evidence suggests that the role of acetylcholine in the airways is not limited to 

bronchoconstriction  and  mucus  secretion.  In  animal  models  of  COPD  and  asthma, 

anticholinergics  inhibit  both  airway  inflammation  and  airway  remodeling  (chapter  2). 

However,  it  is  not  known  which  muscarinic  receptor  subtypes  are  involved  in  these 

responses. Multiple muscarinic receptor subtypes are expressed in the airways, that have 

differential  roles  in  regulating  bronchoconstriction, mucus  secretion,  inflammation  and 

remodeling  (chapter  2).  Muscarinic  receptor  agonists  and  antagonists  have  limited 

selectivity towards  individual muscarinic receptors, which  limits the  interpretation of the 

effects  of  these  agents  on  functional  parameters.  Therefore,  in  this  thesis,  we  used 

muscarinic  receptor  specific  knock‐out  animals  to  investigate  the  role  of  individual 

muscarinic receptor subtypes in inflammation and remodeling. Here, we present evidence 

that the potentiating effects of acetylcholine on airway inflammation and remodeling are 

solely mediated via M3 receptors in animal models of both COPD (chapter 3) and asthma 

(chapter 6). 

COPD 

In chapter 3, we investigated the contribution of individual muscarinic receptor subtypes 

to  cigarette  smoke‐induced  inflammation.  Exposure  to  cigarette  smoke  results  in 

neutrophilic  inflammation, as  is observed  in patients with COPD. From different animals 

models  of  COPD,  it  was  already  known  that  neutrophilic  inflammation,  induced  by 

cigarette smoke or LPS, can be prevented by pretreatment with anticholinergics, including 

tiotropium (12, 13), glycopyrrolate (14) and aclidinium (15). Here, we demonstrated that 

the pro‐inflammatory effects of acetylcholine are mediated via the M3 receptor. Inhibition 

of the M3 receptor, by total knock‐out of the receptor or by a pharmacological approach 

using  the  M3  antagonist  4‐DAMP,  prevented  the  inflammatory  response  induced  by 

cigarette  smoke.  Thus, whole  body  exposure  of wild‐type  animals  for  four  days  to  an 

increasing number of cigarettes induced neutrophilic inflammation in the airways of wild‐

type animals, which was accompanied by an  increase  in the release of pro‐inflammatory 

cytokines, including IL‐8. This inflammatory response was almost completely prevented by 

inhibition  of  the  M3  receptor,  suggesting  that  acetylcholine  potentiates  airway 

inflammation  via  this  receptor  subtype.  This  is  further  supported  by  the  fact  that  the 

inflammatory  response was  enhanced  after  knock‐out  of  the M2  receptor.  Loss  of  this 

autoinhibitory  receptor  results  in  enhanced  acetylcholine  release.  With  acetylcholine 

acting as a pro‐inflammatory mediator,  increased  levels of acetylcholine  in M2  receptor 

knock‐out  (M2R‐/‐) animals  can explain  the observed aggravated  inflammatory  response. 

Surprisingly,  inflammation was  also  enhanced  after  knock‐out  of  the M1  receptor.  This 

Chapter 9 

178 

might be  explained  via  the  role of  the M1  receptor on  the  airway  epithelium, where  it 

contributes to mucus production, by controlling electrolyte and water secretion. Impaired 

clearance  of  detrimental  smoke  particles  from  the  airways  after  knock‐out  of  the M1 

receptor could therefore underlie the enhanced inflammatory response observed in M1R‐/‐ 

animals. This is further supported by a marked induction in the release of the cytokines IL‐

6 and MCP‐1 in M1R‐/‐ animals compared to wild‐type animals. Taken together, the results 

described in chapter 3 indicate a pro‐inflammatory role for acetylcholine via M3 receptors.  

The fact that acetylcholine has a pro‐inflammatory effect on neutrophilic inflammation via 

M3  receptors  is  supported  by  various  in  vitro  studies. Muscarinic  receptor  stimulation 

induced  the  release  of  IL‐6  and  IL‐8  from  airway  smooth muscle  cells, which  has  been 

shown  to  be  mediated  via  M3  receptors,  and  not  via  M2  receptors  (16).  Moreover, 

tiotropium  and  the  M3  selective  antagonists  4‐DAMP  and  DAU5884  inhibited 

methacholine and cigarette smoke‐induced IL‐8 release from airway smooth muscle cells, 

whereas  there  was  no  effect  of  the  M2  antagonist  gallamine  (16).  Furthermore, 

acetylcholine can induce IL‐8 release from bronchial epithelial cells, which can be inhibited 

by  tiotropium  and  4‐DAMP,  and  not  by  the  M1  antagonist  telenzepine  or  the  M2 

antagonist  gallamine  (17).  In  addition,  acetylcholine‐induced  neutrophil  chemotactic 

activity  from macrophages  can be  inhibited  by  4‐DAMP,  and  not by  the M1  antagonist 

pirenzepine  or  the M2  antagonist  gallamine  (18). More  recently,  this was  confirmed  in 

macrophages from COPD patients. Thus, neutrophil chemotaxis  induced by LPS‐activated 

alveolar  macrophages  could  be  inhibited  by  tiotropium  and  4‐DAMP,  and  not  by 

telenzepine,  gallamine  or  tubocurarine  (19).  These  in  vitro  findings,  suggesting  an 

important role  for the M3 receptor  in  inflammation, are now supported by conclusive  in 

vivo findings, confirming the pro‐inflammatory role of the M3 receptor. 

M3  receptors  are  expressed on  almost  all  cell  types  in  the  airways,  including  structural 

cells, like airway smooth muscle cells and epithelial cells, as well as inflammatory cells, like 

macrophages  and  neutrophils  (table  1,  chapter  1).  As  is  evident  from  various  in  vitro 

studies,  both  structural  cells  and  inflammatory  cells  can  contribute  to  the  pro‐

inflammatory effects of acetylcholine. Studies using airway structural cells demonstrated 

that muscarinic receptor stimulation can  induce  IL‐8 release from airway smooth muscle 

cells  and  epithelial  cells  (16,  17). Moreover,  acetylcholine  can  induce  neutrophil  and 

monocyte  chemotactic activity  from bronchial epithelial  cells  (20), as well as neutrophil 

migration by activating alveolar epithelial cells (21). In the latter study, acetylcholine also 

induced  neutrophil  migration  by  activating  monocytes  and  alveolar  macrophages, 

suggesting a direct effect of muscarinic  receptor  stimulation on  inflammatory cells  (21). 

Similar effects of muscarinic receptor stimulation on macrophages were observed  in the 

General discussion and summary 

 179 

studies described above (18, 19). Moreover, proliferation of macrophages and T‐cells has 

also been shown  to be regulated by muscarinic receptors  (22, 23). Thus, both structural 

and  inflammatory  cells  can  contribute  to  the  pro‐inflammatory  effects  of  acetylcholine 

and  it  is  not  known  whether  this  effect  is  primarily  mediated  via  M3  receptors  on 

structural cells or via M3 receptors on inflammatory cells. 

Therefore, in chapter 4, we investigated the contribution of the M3 receptor on structural 

cells  versus  inflammatory  cells  to  cigarette  smoke‐induced  inflammation.  To distinguish 

between both cell types, bone marrow chimeric mice were generated. Bone marrow cells 

from M3R‐/‐ animals were transplanted into irradiated wild‐type animals, to investigate the 

contribution of the M3 receptor on inflammatory cells, and bone marrow cells from wild‐

type  animals  were  transplanted  into  irradiated  M3R‐/‐  animals,  to  investigate  the 

contribution of the M3 receptor on structural cells.  Irradiated and transplanted wild‐type 

animals and non‐irradiated wild‐type animals were used as controls. Mice were exposed 

to  cigarette  smoke,  using  a  similar  protocol  as  described  in  chapter  3.  Exposure  to 

cigarette  smoke  induced  neutrophilic  inflammation  in  non‐irradiated  and  irradiated 

control  animals.  Interestingly,  wild‐type  animals  receiving  M3R‐/‐  bone  marrow  cells 

showed  a  similar  increase  in  neutrophil  number,  suggesting  that  the M3  receptor  on 

inflammatory  cells  is  not  involved  in  the  pro‐inflammatory  effect  of  acetylcholine.  In 

contrast,  no  increase  in  the  number  of  neutrophils  was  observed  in  M3R‐/‐  animals 

receiving wild‐type bone marrow cells, suggesting a critical role for airway structural cells 

in the pro‐inflammatory effect of acetylcholine. Surprisingly, the increase in the release of 

IL‐8 was similar among all smoke‐exposed groups, both on mRNA and protein level. Thus, 

although  the  neutrophil  chemoattractant  is  present  in  the  airways  of  M3R‐/‐  animals 

receiving wild‐type bone marrow cells, no increase in neutrophil number is observed when 

compared  to  control  animals.  This  suggests  that  neutrophil  adhesion might  be  altered 

after knock‐out of the M3 receptor. Using a micro‐array analysis, fibrinogen α and CD177 

were identified as genes which might be involved in this process. Both genes are recently 

linked to neutrophil adhesion and transmigration  (24‐27).  Interestingly, fibrinogen α and 

CD177 are both  identified as  inflammatory biomarkers for COPD,  indicating the potential 

relevance  of  both  genes  for  COPD  pathophysiology  (28‐30).  IL‐8  can  be  released  from 

structural  cells,  including  epithelial  cells,  and  from  inflammatory  cells,  including 

macrophages. Our  results suggest  that  the  release of  IL‐8  from both structural cells and 

inflammatory cells is mediated via M3 receptors, since IL‐8 release is prevented after total 

knock‐out of the M3 receptor as demonstrated in chapter 3, but not after knock‐out of the 

M3 receptor on structural cells or inflammatory cells only. Moreover, this indicates a role 

for M3  receptors on  inflammatory  cells,  and  suggests  that  acetylcholine  can  induce  the 

release of IL‐8 from inflammatory cells via M3 receptors, as is described for macrophages 

Chapter 9 

180 

in  vitro  (18,  19).  However,  knock‐out  of  the M3  receptor  on  inflammatory  cells  in  not 

sufficient  to  prevent  neutrophilia, whereas  knock‐out  of  the M3  receptor  on  structural 

cells only is sufficient to prevent neutrophilia. This suggest that the contribution of the M3 

receptor  on  inflammatory  cells  to  the  pro‐inflammatory  effect  of  acetylcholine  is  only 

small,  and  that  this  is  mainly  mediated  via  M3  receptors  on  structural  cells.  Taken 

together, the results from chapter 4 highlight the important role of airway structural cells 

in neutrophilic  inflammation and  the pathophysiology of COPD, and  the  involvement of 

acetylcholine in this response. 

Asthma 

In chapter 6, we demonstrated  that  the effects of acetylcholine  in  response  to allergen 

exposure are also mediated via  the M3  receptor. From animal models of asthma  it was 

already known that acetylcholine plays a role in allergen‐induced airway inflammation and 

remodeling. Pretreatment of guinea pigs with tiotropium partly prevented airway smooth 

muscle  thickening,  mucous  gland  hypertrophy  and  goblet  cell  metaplasia,  as  well  as 

eosinophilic inflammation in response to allergen exposure (31, 32). Similar findings were 

observed  in  allergen‐exposed  mice,  in  which  tiotropium  partly  prevented  features  of 

airway  remodeling  and  airway  inflammation.  In  addition  to  the  findings  in  guinea pigs, 

tiotropium  was  also  shown  to  inhibit  excessive  extracellular matrix  deposition  and  to 

inhibit TH2 cytokine release in mice (33). To investigate the effects of individual muscarinic 

receptor subtypes on allergen‐induced inflammation and remodeling, muscarinic receptor 

subtype specific knock‐out animals were exposed to ovalbumin, and lungs were collected 

for  analysis  of  inflammation  and  remodeling.  Allergen  exposure  induced  features  of 

remodeling, including goblet cell metaplasia, airway smooth muscle thickening, pulmonary 

vascular  smooth  muscle  remodeling  and  enhanced  deposition  of  extracellular  matrix 

proteins in the airway wall of wild‐type mice. These effects were absent or markedly lower 

in M3R‐/‐ mice, whereas M1R

‐/‐ and M2R‐/‐ mice  responded similar  to wild‐type mice with 

respect  to  remodeling.  This  suggests  that  the  remodeling‐promoting  effects  of 

acetylcholine  in  vivo  in  response  to  allergen  exposure  are  solely  mediated  via  M3 

receptors, and not via M1 or M2 receptors.  

Evidence  from  in  vitro  studies  supports  a  role  for  acetylcholine  in  remodeling  of  the 

airways. It is known that muscarinic receptor stimulation can induce MUC5AC expression 

in  epithelial  cells, which  can  be  inhibited  by  aclidinium  (34). Moreover,  tiotropium  can 

inhibit  IL‐13‐induced  goblet  cell metaplasia,  as  demonstrated  in  chapter  8. Muscarinic 

receptor stimulation is also shown to be involved in airway smooth muscle thickening and 

airway fibrosis, as  it can enhance growth factor‐induced proliferation (35, 36) contractile 

protein expression (37), and extracellular matrix deposition of airway smooth muscle cells 

General discussion and summary 

 181 

and  fibroblasts  (38, 39). Furthermore, aclidinium has been shown to  inhibit  fibroblast to 

myofibroblast  transition  (40).  Although  some  of  these  in  vitro  studies  point  to  an 

important  role  for  the M2  receptor  in  remodeling  responses, we  did  not  observe  any 

effects of knock‐out of the M2 receptor on allergen‐induced remodeling. It  is known that 

presynaptic  M2  receptors  on  parasympathetic  nerves  are  dysfunctional  in  asthmatic 

airways. This has been shown  in animal models of allergen exposure, viral  infection and 

ozone exposure, and also in patients with asthma (41‐43). Although this effect is less well 

described  for  postsynaptic  M2  receptors,  dysfunction  of  M2  receptors  after  allergen 

challenge might  explain  why  we  did  not  observe  any  effects  of  knock‐out  of  the M2 

receptor. M2‐mediated responses observed in vitro might therefore be less relevant to the 

in vivo  situation. Moreover, M2  receptor dysfunction  in  response  to allergen might also 

explain why there is no effect of M2 receptor knock‐out on allergen‐induced inflammation, 

whereas  there  is  an  effect  of  M2  receptor  knock‐out  on  cigarette  smoke‐induced 

inflammation.  Furthermore,  we  did  not  observe  any  effects  of  knock‐out  of  the  M1 

receptor  on  allergen‐induced  airway  inflammation  or  remodeling.  Whereas  in  the 

cigarette smoke model used  in chapter 3, detrimental smoke particles had to be cleared 

from  the  airways  in which  the M1  receptor might  be  involved,  this  effect  is  likely  less 

pronounced after  inhalation of an allergen. Together, this might explain why there  is no 

role for M1 or M2 receptors in allergen‐induced airway remodeling, which is shown to be 

solely mediated by M3 receptors in vivo. 

Next to its role in airway remodeling, the M3 receptor also seems to be involved in basal 

maintenance  of  airway  structure.  In  chapter  3, we  observed  a  decrease  in  basal  gene 

expression of TGF‐β1 and the extracellular matrix proteins collagen Iα1 and fibronectin in 

lung  homogenates  of M3R‐/‐ mice  compared  to WT mice. Moreover,  in  chapter  6, we 

observed a decrease in basal levels of α‐sm‐actin in the airways and arteries of M3R‐/‐ mice 

compared to WT mice. This may suggest that cholinergic regulation of airway tone, which 

is  almost  completely  absent  in M3R‐/‐ mice,  is  important  for  the  development  and/or 

maintenance  of  airway  structure,  including  the  airway  smooth  muscle  and  the 

extracellular matrix. 

 

   

Chapter 9 

182 

Bronchoconstriction as a driver of airway remodeling 

Lack  of  bronchoconstriction  in  M3R‐/‐  mice  might  also  have  other,  far‐reaching 

consequences  in our model. We observed  a marked  inhibition of  airway  remodeling  in 

M3R‐/‐ mice compared  to wild‐type mice, without  inhibition of  the allergic  inflammatory 

response  (chapter  6). Generally,  airway  structural  changes  after  allergen  challenge  are 

attributed to eosinophilic inflammation (44), and tiotropium has previously been shown to 

inhibit  eosinophilic  inflammation  in  animal models of  asthma  (32, 33).  The observation 

that  there  is  no  inhibition  of  the  eosinophilic  inflammation  after  knock‐out  of  the M3 

receptor might  be  explained  by  the  fact  that  this  is  orchestrated  by  both M1  and M3 

receptors. Tiotropium also has a substantial dissociation half‐life for the M1 receptor (45), 

and we observed a trend towards lower eosinophil numbers in M1R‐/‐ mice. However, the 

finding  that  remodeling  can  be  inhibited  after  knock  out  of  the M3  receptor, without 

affecting inflammation, has significant implications. Recently, Grainge et al. demonstrated 

that  repeated methacholine challenges  in mild asthmatic patients  is sufficient  to  induce 

airway  remodeling,  without  affecting  inflammation.  Thus,  methacholine  challenge 

promoted  TGF‐β  release,  collagen  deposition,  goblet  cell metaplasia  and  epithelial  cell 

proliferation  in airway biopsies, with no effect on eosinophil numbers (46).  Interestingly, 

these  effects on  airway  remodeling were  similar  to  those  induced by house dust mite, 

administered  in  an  equi‐effective  dose  with  respect  to  bronchoconstriction  but  also 

causing  eosinophilic  inflammation.  Moreover,  effects  on  remodeling  were  prevented 

when methacholine was administered together with the β2‐agonist albuterol, to prevent 

methacholine‐induced  bronchoconstriction  (46).  These  findings,  together  with  our 

observations from chapter 6, raise the hypothesis that bronchoconstriction by itself might 

be sufficient to induce airway remodeling, and that the origin of airway remodeling is not 

inflammatory, but mechanical in nature.  

Therefore,  in  chapter 7, we  aimed  to  investigate  the  effects of bronchoconstriction on 

airway  remodeling,  and  the  involvement  of  the M3  receptor  in  this  response,  by  using 

mouse  precision  cut  lung  slices  (PCLS).  PCLS  are  a  valuable  tool  to  study 

bronchoconstriction‐induced remodeling, since all lung cell types are present and cell‐cell 

contacts and  cell‐matrix  interactions are preserved,  in  contrast  to  cell  cultures of  single 

airway cell types. This was confirmed previously by our lab using guinea pig PCLS (47). In 

this study, Oenema et al. demonstrated that the effects of bronchoconstriction induced by 

methacholine on airway remodeling were similar to those of TGF‐β, a pleiotropic cytokine 

known to be an important mediator of airway remodeling. Thus, stimulation of guinea pig 

PCLS for two days with TGF‐β induced features of airway remodeling, including enhanced 

contractile  protein  expression,  as  assessed  by  Western  Blot  analysis  and 

General discussion and summary 

 183 

immunohistochemistry.  Interestingly,  stimulation  of  guinea  pig  PCLS  for  two  days with 

methacholine had similar effects on airway remodeling, which was shown to be mediated 

via enhanced release of TGF‐β (47). In chapter 7, we aimed to investigate the involvement 

of the M3 receptor  in this response, by exposing PCLS from wild‐type and M3R‐/‐ mice to 

TGF‐β  and methacholine.  First,  we  confirmed  that  bronchoconstriction  in  response  to 

methacholine  is  almost  completely  abolished  in M3R‐/‐ mice, which  is  in  line with  the 

literature (48, 49). Next, PCLS from wild‐type and M3R‐/‐ mice were exposed to TGF‐β and 

methacholine  for  two days. Exposure of PCLS  from wild‐type mice  to TGF‐β  induced an 

increase  in  the  expression  of  the  contractile  protein  α‐sm‐actin  and  the  extracellular 

matrix proteins fibronectin and collagen type I. A similar increase in TGF‐β‐induced airway 

remodeling  was  observed  in  M3R‐/‐  mice,  suggesting  that  the  muscarinic  receptor 

regulation  of  airway  remodeling  occurs  upstream  of  TGF‐β  signaling.  In  contrast  to 

findings in guinea pigs PCLS, exposure to methacholine did not induce airway remodeling 

in murine PCLS. Species differences might underlie the differences observed in guinea pig 

PCLS versus murine PCLS. Whereas airway constriction  in guinea pig PCLS  is maintained 

over  days  in  the  presence  of  methacholine,  unpublished  observations  from  our  lab 

indicate  that  the  methacholine‐induced  constriction  is  rapidly  lost  in  murine  PCLS. 

Moreover, the contraction rate  in response to methacholine  is also greater  in guinea pig 

PCLS compared to murine PCLS. Further studies, using different experimental approaches, 

are  therefore  needed  to  fully  elucidate  the  effect  of M3  receptor  activation  on  airway 

remodeling.  Next, we  analyzed whether  TGF‐β‐induced  remodeling  altered  the  airway 

contractility. We did not observe any  functional effects of exposure of PCLS  to TGF‐β or 

methacholine,  since  contraction  against  the  thromboxane  A2  agonist  U46619 was  not 

altered  in wild‐type  or M3R‐/‐ mice  after  stimulation  for  two  days.  Thus,  despite  clear 

effects of TGF‐β on the expression of fibronectin, collagen Iα1 and α‐sm‐actin, this did not 

translate into changes in airway contractility, suggesting that it is difficult to demonstrate 

a direct link between airway remodeling and airway contractility using lung slices.  

The  hypothesis  that  bronchoconstriction  by  itself  might  be  sufficient  to  induce 

remodeling, independent of the inflammatory response, is still ongoing, and an increasing 

number of  studies  support  this hypothesis.  In  vitro,  it has been  shown  that muscarinic 

receptor  stimulation,  in  combination with mechanical  strain,  can  induce  α‐sm‐actin and 

sm‐myosin mRNA expression  in bovine  tracheal smooth muscle strips, and myosin  light‐

chain  kinase  expression  in  human  airway  smooth  muscle  cells  (50,  51).  Moreover, 

contraction of airway smooth muscle cells induces TGF‐β activation (52). In intact airways, 

the epithelium  is compressed by bronchoconstriction, and  this  induces  the activation of 

epidermal  growth  factor  (EGF)  (53).  Compression  of  epithelial  cells  in  vitro  results  in 

enhanced TGF‐β expression  (54) and an  increase  in epithelial  thickness  (55). Moreover, 

Chapter 9 

184 

mechanical stress applied to the epithelium has been shown to increase the expression of 

fibronectin, collagen and matrix metalloproteinase type 9 (MMP‐9) in airway fibroblasts in 

a  co‐culture  system  (56).  Taken  together,  the  studies  outlined  above  suggest  that 

bronchoconstriction may  lead  to airway remodeling  in asthma via  the release of growth 

factors  from epithelial and smooth muscle cells  in response to mechanical stress. This  is 

important  from  a  therapeutic  perspective,  as  this  would  imply  that  prevention  of 

bronchoconstriction, probably already  in an early stage of disease, might prevent airway 

remodeling in asthma. 

 

Neuronal and non‐neuronal acetylcholine 

In  the  last  decades,  it  has  become  clear  that  acetylcholine  is  not  only  released  as  a 

neurotransmitter  from nerve  terminals, but also as a hormone  from non‐neuronal cells, 

including cells in the airways, acting in an autocrine and/or paracrine manner. However, it 

is not known to which extent the pro‐inflammatory and remodeling‐promoting effects of 

acetylcholine  in  the  airways  as  discussed  above  are mediated  by  neuronal  or  by  non‐

neuronal acetylcholine. It has been suggested that non‐neuronal acetylcholine contributes 

to these effects, however, evidence for such a role is still limited (chapter 2, 57, 58). In this 

thesis, we present evidence that both neuronal (chapter 5) and non‐neuronal (chapter 8) 

acetylcholine contribute to airway inflammation and remodeling in COPD and asthma. 

COPD 

In  chapter  5,  we  investigated  the  effect  of  targeted  lung  denervation  (TLD)  on 

inflammation  in patients with COPD.  TLD  is  a novel potential  therapy  for patients with 

COPD,  in  which  parasympathetic  airway  nerves  are  ablated  by  locally  applying 

radiofrequency energy in the main bronchi using bronchoscopy. Inhibition of acetylcholine 

by  ablating  airway  nerves  is  expected  to  inhibit  bronchoconstriction  and  the  first 

experimental data  support  this notion.  In a  small  group of patients, TLD was  shown  to 

increase FEV1, 6 minute walk‐test distance and the St. George’s Respiratory Questionnaire 

score  (59).  We  hypothesized  that  TLD  would  also  inhibit  airway  inflammation.  We 

demonstrated that 30 days after TLD of the right lung, airway inflammation is attenuated. 

TLD  resulted  in  a  reduction of  inflammatory  cells  and  cytokine  release  in  the bronchial 

wash,  and  a  reduction  in  gene  expression  of  inflammatory  mediators,  including  the 

expression of IL‐6, IL‐8, TGF‐β and MUC5AC, in bronchial brush specimen. This is the first 

study reporting a direct inhibitory effect of acetylcholine on inflammation in patients with 

COPD and  suggests  that  this  is mediated by neuronally  released acetylcholine. The  fact 

that TGF‐β levels were significantly reduced after TLD suggests that TLD might also affect 

remodeling  in  COPD.  This  implies  that  airway  remodeling  in  COPD  is  also mediated  by 

General discussion and summary 

 185 

neuronal  acetylcholine.  However,  evidence  for  such  a  role  is  still  limited,  and  clearly 

further  studies  are  needed  to  elucidate  the  role  of  neuronal  versus  non‐neuronal 

acetylcholine in airway remodeling in COPD.  

A  role  for  neuronal  acetylcholine  in  inflammation  in  COPD  is  further  supported  by  the 

results from chapter 3, in which the cigarette smoke‐induced inflammatory response was 

enhanced  in  M2R‐/‐  mice  compared  to  wild‐type  mice.  Knock‐out  of  prejunctional 

autoinhibitory M2 receptors results in enhanced acetylcholine release. With acetylcholine 

acting  as  a  pro‐inflammatory  mediator,  knock‐out  of  the  autoinhibitory  receptors 

enhances the inflammatory response. A similar autoinhibitory mechanism for the release 

of non‐neuronal acetylcholine has not been demonstrated until now, thereby suggesting 

that neuronally  released acetylcholine  is  the main driver of  this  inflammatory  response. 

Furthermore, we did not observe any regulation of expression of components of the non‐

neuronal cholinergic system after exposure to cigarette smoke. Moreover, the importance 

of  structural  cells  over  inflammatory  cells  in  cigarette  smoke‐induced  inflammation,  as 

observed  in chapter 4, might  further support a role  for neuronal acetylcholine  in airway 

inflammation in COPD. 

Asthma 

The hypothesis  that bronchoconstriction might be  the driver of allergen‐induced airway 

remodeling  suggests  that  also  in  allergic  asthma,  neuronal  acetylcholine  plays  an 

important role. Moreover, we did not observe any regulation of expression of components 

of  the  non‐neuronal  cholinergic  system  after  allergen  challenge.  Thereby,  we  cannot 

confirm a role for non‐neuronal acetylcholine in allergen‐induced remodeling (chapter 6). 

However,  we  did  observe  a  clear  role  for  non‐neuronal  acetylcholine  in  goblet  cell 

metaplasia in chapter 8. In this chapter, we investigated the direct effects of endogenous 

non‐neuronal  acetylcholine  on  epithelial  cell  differentiation.  It was  already  known  that 

tiotropium can inhibit allergen‐induced goblet cell metaplasia and MUC5AC expression in 

vivo  (32, 33),  an  effect  also observed  after  knock‐out of  the M3  receptor  in  chapter 6. 

Epithelial cells have been shown to produce and release acetylcholine (60). Therefore, the 

observed  effects  on  epithelial  cell  differentiation  might  be  mediated  by  neuronal 

acetylcholine,  or  by  a  direct  effect  of  non‐neuronal  acetylcholine  on  the  airway 

epithelium. To investigate the latter hypothesis, human airway epithelial (HAE) cells were 

cultured  at  an  air‐liquid‐interface  (ALI)  and  exposed  to  tiotropium  and/or  IL‐13  during 

differentiation. IL‐13 is a main driver of goblet cell metaplasia, and plays a central role in 

the  pathogenesis  of  asthma  (61).  Epithelial  cells  used  for  this  study  expressed  all 

components  of  the  non‐neuronal  cholinergic  system,  suggesting  production  of 

acetylcholine by these cells. Previously, it has been shown that epithelial cells can indeed 

Chapter 9 

186 

release acetylcholine (60). Interestingly, carnitine acetyltransferase (CarAT) was identified 

as  the synthesizing enzyme of acetylcholine. Tiotropium had no effects on epithelial cell 

differentiation  following  air  exposure,  however,  significantly  inhibited  IL‐13‐induced 

goblet  cell metaplasia.  Tiotropium  inhibited  the  increase  in MUC5AC  positive  cells  and 

goblet cells, and  the  increase  in MUC5AC gene expression. Moreover, we demonstrated 

that the effects of tiotropium might be mediated via effects on the transcription  factors 

FoxA2 and FoxA3, whereas  increased expression of SPDEF by  IL‐13 was not affected by 

tiotropium.  This  indicates  that  non‐neuronal  acetylcholine  contributes  to  goblet  cell 

metaplasia by a direct effect on epithelial cells. In the airways, mucus is secreted by goblet 

cells and submucosal glands. Submucosal glands are innervated by airway nerves (chapter 

1) and the release of mucus from glands is under cholinergic neural control (62). It is still a 

matter  debate  whether  goblet  cells  can  also  release  mucus  in  response  to  neuronal 

acetylcholine,  but  data  from  our  study  suggest  at  least  a  role  for  non‐neuronal 

acetylcholine in this response. 

Based on the in vivo studies described in this thesis, I propose that the potentiating effects 

of  acetylcholine  on  airway  inflammation  and  remodeling  are  mainly  mediated  by 

neuronally  released  acetylcholine. However,  a number of  in  vitro  studies,  including  the 

study described in chapter 8, indicate that non‐neuronal acetylcholine might contribute to 

the effects of acetylcholine. Tiotropium and 4‐DAMP have been shown to inhibit alveolar 

macrophage  mediated  migration  of  neutrophils  from  COPD  patients  (19).  Moreover, 

tiotropium  inhibited  TGF‐β‐induced  MMP‐1  and  MMP‐2  expression  in  human  lung 

fibroblasts  (63),  and  aclidinium  has  been  shown  to  inhibit  TGF‐β  and  cigarette  smoke‐

induced  fibroblast  to myofibroblast  differentiation  (40,  64).  These  studies  indicate  that 

non‐neuronal acetylcholine might  contribute  to airway  inflammation and  remodeling of 

airways cells  in an autocrine or paracrine manner. However,  the relative contribution of 

these effects to the effects of neuronal acetylcholine in vivo is still uncertain. Vagotomy of 

animals  under  controlled  experimental  conditions  might  definitely  establish  the 

contribution  of  neuronal  versus  non‐neuronal  acetylcholine  to  inflammation  and 

remodeling in disease models. Bilateral vagotomy is, however, not possible in the mouse 

(unpublished  observations).  In  the  literature,  bilateral  vagotomy  of  bigger  laboratory 

animals has been reported, and this might be a way to answer this question. Moreover, 

targeted  lung  denervation  in  patients  with  asthma  can  answer  whether  neuronal 

acetylcholine is also the main contributor to airway inflammation in asthma.  

General discussion and summary 

 187 

Clinical implications 

COPD 

Evidence for a role of acetylcholine as a driver of airway inflammation and remodeling in 

patients with COPD or asthma  is still  limited.  In this thesis, we demonstrate  for the  first 

time that acetylcholine might act as a pro‐inflammatory mediator  in patients with COPD, 

since airway inflammation is attenuated after TLD (chapter 5). There are some limitations 

to this study, of which the major limitations are the limited number of subjects included in 

the study and the  lack of a control arm. However, we believe that the findings from this 

small study are very promising. A large‐scale, multicenter, sham‐controlled study into the 

effectiveness of TLD is planned and this will provide more conclusive evidence on the role 

of neuronal acetylcholine as a pro‐inflammatory mediator. There is no additional evidence 

until now  that demonstrates direct effects of acetylcholine on  inflammation  in patients 

with COPD. From different trials, including the UPLIFT (Understanding Potential Long‐term 

Impacts  on  Function  with  Tiotropium)  trial,  it  is  known  that  tiotropium  reduces  the 

number of exacerbations  (65). Treatment with glycopyrrolate or aclidinium, albeit  for a 

shorter  period,  was  also  shown  to  affect  exacerbations,  as  the  time  to  the  first 

exacerbation was  increased  (66,  67).  This might  suggest  an  anti‐inflammatory  effect  of 

anticholinergic  therapy,  since  the  inflammatory  response  is  enhanced  during 

exacerbations, with increased expression of pro‐inflammatory cytokines like IL‐8 (68, 69). 

Moreover,  patients  who  have  more  exacerbations  demonstrate  increased  levels  of 

inflammatory  markers  at  stable  state  (70,  71).  Until  now,  methodological  problems 

complicated the evaluation of airway inflammation in drug studies. In a study by Powrie et 

al., treatment with anticholinergics reduced the amount of sputum, which might result in 

increased cytokine concentrations in the sputum. This has been suggested to explain why 

no  reduction  in  IL‐6  or  IL‐8  sputum  levels  was  observed  in  patients  with  COPD  after 

tiotropium treatment (72, 73). In chapter 5, we used a bronchoscopic intervention, which 

enabled us to collect a bronchial wash and brush and examine the effects of acetylcholine 

on  airway  inflammation  in  a  direct manner.  Here,  we  demonstrate  that  acetylcholine 

might  indeed affect airway  inflammation  in patients with COPD, as  is expected from the 

increasing body of evidence from  in vitro and  in vivo studies reviewed  in chapter 2, and 

from  the  studies  described  in  this  thesis. Moreover,  TLD  reduced  the  levels  of  TGF‐β, 

suggesting  effects of  acetylcholine on  airway  remodeling  in patients with COPD.  In  the 

overall study population of the UPLIFT trial, tiotropium did not affect the rate of decline in 

lung function (65). However, tiotropium did inhibit the accelerated decline in lung function 

in  specific  subgroups of  the  trial,  including  young patients  and patients with moderate 

disease (74, 75). Interestingly, young patients are also highly represented in the TLD study. 

Clearly,  future  studies are needed  to understand  the effects of acetylcholine on airway 

Chapter 9 

188 

remodeling  in patients with COPD. Accelerated decline  in  lung function might not be the 

optimal outcome parameter  for  future  studies  to analyze  remodeling,  since  it  is known 

from the ECLIPSE study that this is highly variable between patients with COPD, and lung 

function  might  even  increase  in  a  subset  of  patients,  irrespective  of  treatment  (76). 

Instead, more direct measurements of remodeling parameters, using airway biopsies from 

patients,  taken  before  and  after  long‐term  anticholinergic  therapy,  either  after  TLD  or 

anticholinergic  treatment, might  help  to  elucidate  the  role  of  acetylcholine  in  airway 

remodeling in patients with COPD. 

Asthma 

Anticholinergics  are  currently  not  included  as  controller  therapy  for  the  treatment  of 

asthma.  However,  recent  trials  suggest  that  patients  with  asthma might  benefit  from 

anticholinergic  controller  therapy,  since  tiotropium  has  been  shown  to  induce 

bronchodilation  in  moderate  and  severe  asthma  patients  (10,  11).  In  severe  asthma 

patients, addition of tiotropium to standard therapy with inhaled glucocorticosteroids and 

long‐acting  β2‐agonists  did  not  only  induce  bronchodilation,  but  was  also  shown  to 

increase the time to the first exacerbation, and reduce the risk of a severe exacerbation 

(10). This suggests that acetylcholine also exerts pro‐inflammatory effects in patients with 

asthma.  However,  direct  evidence  for  such  a  role  is  still  lacking. Moreover,  long‐term 

studies  into  the  effects  of  anticholinergic  therapy  on  airway  remodeling  in  asthma  are 

needed to confirm the remodeling‐promoting effects of acetylcholine as described in this 

thesis. Repeated challenges with methacholine  in mild asthma patients did demonstrate 

that  muscarinic  receptor  stimulation  can  induce  airway  remodeling  (46).  Moreover, 

methacholine  challenge  induced  epithelial  cell  proliferation  and  goblet  cell metaplasia, 

suggesting a role  for acetylcholine  in mucus hypersecretion. This  is supported by results 

from  chapter  8,  in which  tiotropium  inhibited  goblet  cell metaplasia  of  human  airway 

epithelial  cells.  Tiotropium  has  been  shown  to  reduce  sputum  levels  in  patients  with 

chronic  mucus  hypersecretion  (77).  Although  the  concern  has  been  expressed  that 

anticholinergics desiccate mucus, thereby  increasing the viscosity and making the mucus 

more  difficult  to  clear,  there  is  now  some  data  to  support  that  anticholinergics  are 

beneficial for patients with mucus hypersecretion (78). This is relevant for both COPD and 

asthma,  in  which  mucus  hypersecretion  can  occur,  which  contributes  to  airflow 

obstruction of the smaller airways and increases the risk of exacerbations. 

 

   

General discussion and summary 

 189 

M3 selective anticholinergics 

The studies described in this thesis point to a critical regulatory role for the M3 receptor in 

airway  inflammation  and  remodeling.  Although  current  anticholinergics  are  kinetically 

selective  for  the M3 receptor,  they also have a substantial dissociation half‐life  from the 

M1 receptor (table 2, chapter 1). For example, dissociation half‐life of tiotropium from the 

M1 receptor is 10.5 hours (45). Our studies suggest that an even more selective muscarinic 

antagonist, solely  inhibiting M3 receptors,  is desirable and may  lead  to  improved effects 

on airway  inflammation and remodeling. Inhibition of acetylcholine release by TLD might 

also further enhance outcomes on  inflammation and remodeling, however, this does not 

inhibit non‐neuronal acetylcholine release.  

 

Conclusions 

In conclusion, the described studies have revealed that acetylcholine contributes to airway 

inflammation and remodeling  in COPD and asthma, which  is mediated via M3 receptors. 

This  involves  neuronally  released  acetylcholine,  but  also  non‐neuronal  acetylcholine, 

which was shown to contribute to goblet cell metaplasia (figure 1). Together, this suggests 

that patients with COPD or asthma might benefit from anticholinergic therapy to a much 

larger extent than previously appreciated. Moreover, as bronchodilators, anticholinergics 

might also affect airway remodeling by preventing mechanical stress. Therefore, I believe 

that  the  combined  effects  of  anticholinergic  therapy  on  bronchoconstriction,  mucus 

secretion,  inflammation  and  remodeling may  together  lead  to  a  positive  outcome  for 

patients with COPD or asthma.  

   

Chapter 9 

190 

  

Figure  1.  Acetylcholine  released  from  nerve  terminals  and  airway  cells  contributes  to  inflammation  and 

remodeling  of  the  airways  via M3  receptors.  Environmental  factors,  including  [1]  cigarette  smoke  (CS),  [2] 

allergens  and  [3]  bronchoconstricting  agents,  can  induce  or  enhance  acetylcholine  release,  and  thereby 

contribute  to  inflammation  and  remodeling  (chapter  2).  CS  exposure  results  in  enhanced  cytokine  release, 

including  IL‐8,  IL‐6  and MCP‐1,  and  TGF‐β  release, mediated  via M3  receptors  (chapter  3).  This  is  primarily 

mediated  via M3  receptors on  structural  cells, although M3  receptors on  inflammatory  cells are also  involved 

(chapter 4). The CS‐induced  inflammatory  response  is  inhibited by M1 and M2  receptors. M1  receptors on  the 

airway  epithelium  control  electrolyte  and water  secretion,  and might  affect  the  clearance of  smoke particles 

from  the  airways.  M2  receptors  on  nerve  endings  are  auto‐inhibitory  receptors,  and  might  inhibit  the 

inflammation  by  inhibition  of  acetylcholine  release  (chapter  3).  Exposure  to  allergens  also  enhances 

inflammation and remodeling of the airways. Enhanced goblet cell metaplasia, airway smooth muscle thickening 

and extracellular matrix deposition  is mediated via M3 receptors. No role for M1 and M2 receptors  is observed, 

and the  latter might be dysfunctional after allergen exposure (chapter 6). Allergen‐induced  inflammation is not 

affected by knock‐out of the M3 receptor. This suggests that bronchoconstriction might drive airway remodeling, 

independent  of  the  inflammatory  response.  Bronchoconstriction  induces mechanical  strain, which  results  in 

enhanced  expression  of  airway  smooth  muscle  α‐actin  and  extracellular  matrix  proteins  (chapter  7).  Both 

neuronally released acetylcholine (chapter 5) and non‐neuronally released acetylcholine (chapter 8) contribute 

to inflammation and remodeling processes in the airways. 

 

   

General discussion and summary 

 191 

Taken together, the studies described in this thesis have revealed that: 

The  neurotransmitter  acetylcholine  is  not  only  involved  in  bronchoconstriction 

and mucus secretion in the airways, but also contributes to airway inflammation 

and  remodeling  (chapter 2). Like  the effects on bronchoconstriction and mucus 

secretion, effects on inflammation and remodeling are primarily mediated via M3 

receptors (chapter 3 and chapter 6). 

The  M3  receptor  plays  a  pro‐inflammatory  role  in  cigarette  smoke‐induced 

inflammation, whereas M1  and M2  receptors  exert  an  anti‐inflammatory  effect 

(chapter 3). This suggests that M3 selective antagonists can reduce neutrophilia. 

The  pro‐inflammatory  effect  of  acetylcholine  on  cigarette  smoke‐induced 

inflammation  is primarily mediated via M3  receptors  located on  structural  cells 

(chapter 4). 

The M3 receptor contributes to allergen‐induced airway remodeling, whereas no 

role  for M3  receptors  in allergen‐induced  inflammation  is observed  (chapter 6). 

This  suggests  that  bronchoconstriction  might  drive  airway  remodeling, 

independent of the inflammatory response (chapter 6 and chapter 7). 

M1  and M2  receptors  are  not  involved  in  allergen‐induced  inflammation  and 

remodeling (chapter 6). 

Targeted  lung  denervation  attenuates  inflammation  in  patients  with  COPD, 

providing the first direct evidence that acetylcholine might affect inflammation in 

humans.  This  implies  an  important  role  for  neuronal  acetylcholine  in  the 

inflammatory response (chapter 5). 

Tiotropium  prevents  IL‐13‐induced  goblet  cell  metaplasia  of  human  airway 

epithelial  cells, which  indicates  that  non‐neuronal  acetylcholine  contributes  to 

epithelial cell differentiation (chapter 8). 

Patients with COPD  and  asthma may benefit  from  anticholinergic  therapy  to  a 

much broader extent  than previously appreciated, since anticholinergic  therapy 

might  also  inhibit  inflammation  and  remodeling  of  the  airways.  This  can  be 

achieved via TLD or via anticholinergic treatment. Treatment with an even more 

selective  muscarinic  antagonist,  solely  inhibiting  M3  receptors,  might  further 

enhance this beneficial effect (this thesis). 

Chapter 9 

192 

References 

(1)  Ferkol  T,  Schraufnagel  D.  The  global  burden  of  respiratory  disease.  Ann  Am  Thorac  Soc 

2014;11:404‐406.  

(2) Global Initiative for Chronic Obstructive Lung Disease (GOLD). Global Strategy for the Diagnosis, 

Management  and  Prevention  of  COPD  (GOLD)  2013.  Available  from: 

http://www.goldcopd.org/uploads/users/files/GOLD_Report_2014_Jan23.pdf. ;June 4, 2014.  

(3)  Global  Initiative  for  Asthma  (GINA).  GINA  Report,  Global  Burden  of  Asthma.  Available  from: 

www.ginasthma.org. May, 2004;June 4, 2014.  

(4) Jeffery PK. Remodeling in asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 

2001;164:S28‐S38.  

(5) Rabe KF, Hurd S, Anzueto A, Barnes PJ, Buist SA, Calverley P, Fukuchi Y,  Jenkins C, Rodriguez‐

Roisin  R,  van Weel  C,  Zielinski  J,  Global  Initiative  for  Chronic  Obstructive  Lung  Disease.  Global 

strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: 

GOLD executive summary. Am J Respir Crit Care Med 2007;176:532‐555.  

(6)  Pare PD, Roberts CR, Bai  TR, Wiggs BJ.  The  functional  consequences of  airway  remodeling  in 

asthma. Monaldi Arch Chest Dis 1997;52:589‐596.  

(7)  Gross  NJ,  Skorodin  MS.  Role  of  the  parasympathetic  system  in  airway  obstruction  due  to 

emphysema. N Engl J Med 1984;311:421‐425.  

(8)  Barnes  PJ.  The  role  of  anticholinergics  in  chronic  obstructive  pulmonary  disease.  Am  J Med 

2004;117 Suppl 12A:24S‐32S.  

(9) Global  Initiative for Asthma (GINA). GINA Report, Global Strategy for Asthma Management and 

Prevention. Available from: www.ginasthma.org. 2014;June 4, 2014.  

(10)  Kerstjens HA,  Engel M, Dahl  R,  Paggiaro  P,  Beck  E,  Vandewalker M,  Sigmund  R,  Seibold W, 

Moroni‐Zentgraf P, Bateman ED. Tiotropium in asthma poorly controlled with standard combination 

therapy. N Engl J Med 2012;367:1198‐1207.  

(11)  Beeh  KM,  Moroni‐Zentgraf  P,  Ablinger  O,  Hollaenderova  Z,  Unseld  A,  Engel  M,  Korn  S. 

Tiotropium Respimat(R) in asthma: a double‐blind, randomised, dose‐ranging study in adult patients 

with moderate asthma. Respir Res 2014;15:61.  

(12) Pera T, Zuidhof A, Valadas J, Smit M, Schoemaker RG, Gosens R, Maarsingh H, Zaagsma J, Meurs 

H. Tiotropium inhibits pulmonary inflammation and remodelling in a guinea pig model of COPD. Eur 

Respir J 2011;38:789‐796.  

(13) Wollin L, Pieper MP. Tiotropium bromide exerts anti‐inflammatory activity in a cigarette smoke 

mouse model of COPD. Pulm Pharmacol Ther 2010;23:345‐354.  

(14) Shen LL, Liu YN, Shen HJ, Wen C, Jia YL, Dong XW, Jin F, Chen XP, Sun Y, Xie QM. Inhalation of 

glycopyrronium  inhibits  cigarette  smoke‐induced  acute  lung  inflammation  in  a murine model  of 

COPD. Int Immunopharmacol 2014;18:358‐364.  

(15) Dominguez‐Fandos D, Ferrer E, Puig‐Pey R, Carreno C, Prats N, Aparici M, Musri MM, Gavalda A, 

Peinado VI, Miralpeix M, Barbera  JA.  Effects of  aclidinium bromide  in  a  cigarette  smoke‐exposed 

Guinea pig model of chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 2014;50:337‐

346.  

General discussion and summary 

 193 

(16) Gosens R, Rieks D, Meurs H, Ninaber DK, Rabe KF, Nanninga J, Kolahian S, Halayko AJ, Hiemstra 

PS,  Zuyderduyn  S.  Muscarinic  M3  receptor  stimulation  increases  cigarette  smoke‐induced  IL‐8 

secretion by human airway smooth muscle cells. Eur Respir J 2009;34:1436‐1443.  

(17) Profita M, Bonanno A, Siena L, Ferraro M, Montalbano AM, Pompeo F, Riccobono L, Pieper MP, 

Gjomarkaj M. Acetylcholine mediates  the  release  of  IL‐8  in human  bronchial  epithelial  cells  by  a 

NFkB/ERK‐dependent mechanism. Eur J Pharmacol 2008;582:145‐153.  

(18) Sato E, Koyama S, Okubo Y, Kubo K, Sekiguchi M. Acetylcholine stimulates alveolar macrophages 

to release inflammatory cell chemotactic activity. Am J Physiol 1998;274:L970‐L979.  

(19) Vacca G, Randerath WJ, Gillissen A. Inhibition of granulocyte migration by tiotropium bromide. 

Respir Res 2011;12:24.  

(20) Koyama S, Rennard SI, Robbins RA. Acetylcholine stimulates bronchial epithelial cells to release 

neutrophil and monocyte chemotactic activity. Am J Physiol 1992;262:L466‐L471.  

(21) Buhling F, Lieder N, Kuhlmann UC, Waldburg N, Welte T. Tiotropium suppresses acetylcholine‐

induced release of chemotactic mediators in vitro. Respir Med 2007;101:2386‐2394.  

(22) de la Torre E, Genaro AM, Ribeiro ML, Pagotto R, Pignataro OP, Sales ME. Proliferative actions 

of muscarinic  receptors expressed  in macrophages derived  from normal and  tumor bearing mice. 

Biochim Biophys Acta 2008;1782:82‐89.  

(23) Razani‐Boroujerdi S, Behl M, Hahn FF, Pena‐Philippides JC, Hutt J, Sopori ML. Role of muscarinic 

receptors  in the regulation of  immune and  inflammatory responses. J Neuroimmunol 2008;194:83‐

88.  

(24)  de  Almeida  VV,  Silva‐Herdade  A,  Calado  A,  Rosario  HS,  Saldanha  C.  Fibrinogen modulates 

leukocyte  recruitment  in  vivo during  the  acute  inflammatory  response. Clin Hemorheol Microcirc 

2012.  

(25) Flick MJ, Du X, Witte DP, Jirouskova M, Soloviev DA, Busuttil SJ, Plow EF, Degen JL. Leukocyte 

engagement  of  fibrin(ogen)  via  the  integrin  receptor  alphaMbeta2/Mac‐1  is  critical  for  host 

inflammatory response in vivo. J Clin Invest 2004;113:1596‐1606.  

(26) Sachs UJ, Andrei‐Selmer CL, Maniar A, Weiss T, Paddock C, Orlova VV, Choi EY, Newman PJ, 

Preissner KT, Chavakis T, Santoso S. The neutrophil‐specific antigen CD177 is a counter‐receptor for 

platelet endothelial cell adhesion molecule‐1 (CD31). J Biol Chem 2007;282:23603‐23612.  

(27) Kuckleburg CJ, Tilkens SB, Santoso S, Newman PJ. Proteinase 3 contributes to transendothelial 

migration of NB1‐positive neutrophils. J Immunol 2012;188:2419‐2426.  

(28) Dickens  JA, Miller BE, Edwards LD, Silverman EK, Lomas DA, Tal‐Singer R, Evaluation of COPD 

Longitudinally  to  Identify Surrogate Endpoints  (ECLIPSE) study  investigators. COPD association and 

repeatability of blood biomarkers in the ECLIPSE cohort. Respir Res 2011;12:146‐9921‐12‐146.  

(29) Celli BR, Locantore N, Yates  J, Tal‐Singer R, Miller BE, Bakke P, Calverley P, Coxson H, Crim C, 

Edwards LD, Lomas DA, Duvoix A, MacNee W, Rennard S, Silverman E, Vestbo J, Wouters E, Agusti A, 

ECLIPSE  Investigators.  Inflammatory biomarkers  improve  clinical prediction of mortality  in  chronic 

obstructive pulmonary disease. Am J Respir Crit Care Med 2012;185:1065‐1072.  

(30) Hicks A, Kourteva G, Hilton H, Li H, Lin TA, Liao W, Li Y, Wei X, March T, Benson J, Renzetti LM. 

Cellular  and  molecular  characterization  of  ozone‐induced  pulmonary  inflammation  in  the 

Cynomolgus monkey. Inflammation 2010;33:144‐156.  

Chapter 9 

194 

(31)  Gosens  R,  Bos  IS,  Zaagsma  J,  Meurs  H.  Protective  effects  of  tiotropium  bromide  in  the 

progression of airway smooth muscle remodeling. Am J Respir Crit Care Med 2005;171:1096‐1102.  

(32)  Bos  IS,  Gosens  R,  Zuidhof  AB,  Schaafsma  D,  Halayko  AJ, Meurs  H,  Zaagsma  J.  Inhibition  of 

allergen‐induced  airway  remodelling  by  tiotropium  and  budesonide:  a  comparison.  Eur  Respir  J 

2007;30:653‐661.  

(33) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y, Minoguchi K, Ohnishi T, Hirose T, 

Nagase H, Ohta K, Adachi M. Effect of tiotropium bromide on airway inflammation and remodelling 

in a mouse model of asthma. Clin Exp Allergy 2010;40:1266‐1275.  

(34) Cortijo  J, Mata M, Milara  J, Donet E, Gavalda A, Miralpeix M, Morcillo EJ. Aclidinium  inhibits 

cholinergic and tobacco smoke‐induced MUC5AC in human airways. Eur Respir J 2011;37:244‐254.  

(35) Gosens R, Dueck G, Rector E, Nunes RO, Gerthoffer WT, Unruh H, Zaagsma J, Meurs H, Halayko 

AJ.  Cooperative  regulation  of GSK‐3  by muscarinic  and  PDGF  receptors  is  associated with  airway 

myocyte proliferation. Am J Physiol Lung Cell Mol Physiol 2007;293:L1348‐L1358.  

(36) Matthiesen S, Bahulayan A, Kempkens S, Haag S, Fuhrmann M, Stichnote C, Juergens UR, Racke 

K. Muscarinic receptors mediate stimulation of human lung fibroblast proliferation. Am J Respir Cell 

Mol Biol 2006;35:621‐627.  

(37) Oenema TA, Smit M, Smedinga L, Racke K, Halayko AJ, Meurs H, Gosens R. Muscarinic receptor 

stimulation augments TGF‐beta1‐induced  contractile protein expression by airway  smooth muscle 

cells. Am J Physiol Lung Cell Mol Physiol 2012;303:L589‐97.  

(38) Oenema TA, Mensink G, Smedinga L, Halayko AJ, Zaagsma J, Meurs H, Gosens R, Dekkers BG. 

Cross‐talk  between  transforming  growth  factor‐beta(1)  and muscarinic M(2)  receptors  augments 

airway smooth muscle proliferation. Am J Respir Cell Mol Biol 2013;49:18‐27.  

(39)  Haag  S, Matthiesen  S,  Juergens  UR,  Racke  K. Muscarinic  receptors mediate  stimulation  of 

collagen synthesis in human lung fibroblasts. Eur Respir J 2008;32:555‐562.  

(40) Milara  J, Serrano A, Peiro T, Gavalda A, Miralpeix M, Morcillo EJ, Cortijo  J. Aclidinium  inhibits 

human lung fibroblast to myofibroblast transition. Thorax 2012;67:229‐237.  

(41)  ten  Berge  RE,  Santing  RE,  Hamstra  JJ,  Roffel  AF,  Zaagsma  J.  Dysfunction  of muscarinic M2 

receptors after the early allergic reaction: possible contribution to bronchial hyperresponsiveness in 

allergic guinea‐pigs. Br J Pharmacol 1995;114:881‐887.  

(42) Minette PA,  Lammers  JW, Dixon CM, McCusker MT, Barnes PJ. A muscarinic agonist  inhibits 

reflex  bronchoconstriction  in  normal  but  not  in  asthmatic  subjects.  J  Appl  Physiol  (1985) 

1989;67:2461‐2465.  

(43) Gosens R, Zaagsma J, Meurs H, Halayko AJ. Muscarinic receptor signaling in the pathophysiology 

of asthma and COPD. Respir.Res. 2006;7:73.  

(44) Kelly MM, O'Connor TM, Leigh R, Otis J, Gwozd C, Gauvreau GM, Gauldie J, O'Byrne PM. Effects 

of  budesonide  and  formoterol  on  allergen‐induced  airway  responses,  inflammation,  and  airway 

remodeling in asthma. J Allergy Clin Immunol 2010;125:349‐356.e13.  

(45) Casarosa P, Bouyssou T, Germeyer S, Schnapp A, Gantner F, Pieper M. Preclinical evaluation of 

long‐acting muscarinic antagonists: comparison of tiotropium and investigational drugs. J Pharmacol 

Exp Ther 2009;330:660‐668.  

(46) Grainge CL,  Lau  LC, Ward  JA, Dulay V,  Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. 

Effect of bronchoconstriction on airway remodeling in asthma. N Engl J Med 2011;364:2006‐2015.  

General discussion and summary 

 195 

(47) Oenema  TA, Maarsingh H,  Smit M, Groothuis GM, Meurs H, Gosens  R.  Bronchoconstriction 

Induces  TGF‐beta  Release  and  Airway  Remodelling  in  Guinea  Pig  Lung  Slices.  PLoS  One 

2013;8:e65580.  

(48) Fisher JT, Vincent SG, Gomeza J, Yamada M, Wess J. Loss of vagally mediated bradycardia and 

bronchoconstriction  in  mice  lacking  M2  or  M3  muscarinic  acetylcholine  receptors.  FASEB  J 

2004;18:711‐713.  

(49)  Struckmann  N,  Schwering  S,  Wiegand  S,  Gschnell  A,  Yamada  M,  Kummer  W,  Wess  J, 

Haberberger  RV.  Role  of muscarinic  receptor  subtypes  in  the  constriction  of  peripheral  airways: 

studies on receptor‐deficient mice. Mol Pharmacol 2003;64:1444‐1451.  

(50) Fairbank NJ, Connolly SC, Mackinnon JD, Wehry K, Deng L, Maksym GN. Airway smooth muscle 

cell tone amplifies contractile function in the presence of chronic cyclic strain. Am J Physiol Lung Cell 

Mol Physiol 2008;295:L479‐88.  

(51) Wahl M,  Eddinger  TJ,  Hai  CM.  Sinusoidal  length  oscillation‐  and  receptor‐mediated mRNA 

expression  of myosin  isoforms  and  alpha‐SM  actin  in  airway  smooth muscle.  Am  J  Physiol  Cell 

Physiol 2004;287:C1697‐708.  

(52) Tatler AL, John AE, Jolly L, Habgood A, Porte J, Brightling C, Knox AJ, Pang L, Sheppard D, Huang 

X,  Jenkins G.  Integrin alphavbeta5‐mediated TGF‐beta activation by airway smooth muscle cells  in 

asthma. J Immunol 2011;187:6094‐6107.  

(53) Tschumperlin DJ, Dai G, Maly  IV, Kikuchi T,  Laiho  LH, McVittie AK, Haley KJ,  Lilly CM,  So PT, 

Lauffenburger  DA,  Kamm  RD,  Drazen  JM. Mechanotransduction  through  growth‐factor  shedding 

into the extracellular space. Nature 2004;429:83‐86.  

(54)  Ressler  B,  Lee  RT,  Randell  SH,  Drazen  JM,  Kamm  RD. Molecular  responses  of  rat  tracheal 

epithelial cells to transmembrane pressure. Am J Physiol Lung Cell Mol Physiol 2000;278:L1264‐72.  

(55) Choe MM, Sporn PH, Swartz MA. An in vitro airway wall model of remodeling. Am J Physiol Lung 

Cell Mol Physiol 2003;285:L427‐33.  

(56)  Swartz  MA,  Tschumperlin  DJ,  Kamm  RD,  Drazen  JM.  Mechanical  stress  is  communicated 

between different  cell  types  to elicit matrix  remodeling. Proc Natl Acad  Sci U  S A  2001;98:6180‐

6185.  

(57)  Gwilt  CR,  Donnelly  LE,  Rogers  DF.  The  non‐neuronal  cholinergic  system  in  the  airways:  an 

unappreciated regulatory role in pulmonary inflammation? Pharmacol Ther 2007;115:208‐222.  

(58) Pieper MP. The non‐neuronal  cholinergic  system as novel drug  target  in  the airways.  Life Sci 

2012;91:1113‐1118.  

(59) Slebos DJ, Klooster K, Koegelenberg CFN, Theron J, Steyn D, Mayse M. Efficacy of targeted lung 

denervation on patients with moderate to severe COPD [abstract]. ERJ 2014:1774.  

(60) Proskocil BJ, Sekhon HS, Jia Y, Savchenko V, Blakely RD, Lindstrom J, Spindel ER. Acetylcholine is 

an  autocrine or paracrine hormone  synthesized  and  secreted by  airway bronchial epithelial  cells. 

Endocrinology 2004;145:2498‐2506.  

(61) Corren J. Role of interleukin‐13 in asthma. Curr Allergy Asthma Rep 2013;13:415‐420.  

(62) Rogers DF. Motor control of airway goblet cells and glands. Respir Physiol 2001;125:129‐144.  

(63) Asano K, Shikama Y, Shoji N, Hirano K, Suzaki H, Nakajima H. Tiotropium bromide inhibits TGF‐

beta‐induced MMP production from lung fibroblasts by interfering with Smad and MAPK pathways 

in vitro. Int J Chron Obstruct Pulmon Dis 2010;5:277‐286.  

Chapter 9 

196 

(64) Milara J, Serrano A, Peiro T, Artigues E, Gavalda A, Miralpeix M, Morcillo EJ, Cortijo J. Aclidinium 

inhibits  cigarette  smoke‐induced  lung  fibroblast‐to‐myofibroblast  transition.  Eur  Respir  J 

2013;41:1264‐1274.  

(65)  Tashkin  DP,  Celli  B,  Senn  S,  Burkhart  D,  Kesten  S, Menjoge  S,  Decramer M,  UPLIFT  Study 

Investigators. A 4‐year  trial of  tiotropium  in  chronic obstructive pulmonary disease. N Engl  J Med 

2008;359:1543‐1554.  

(66) D'Urzo A, Ferguson GT, van Noord JA, Hirata K, Martin C, Horton R, Lu Y, Banerji D, Overend T. 

Efficacy and  safety of once‐daily NVA237  in patients with moderate‐to‐severe COPD:  the GLOW1 

trial. Respir Res 2011;12:156‐9921‐12‐156.  

(67)  Jones PW, Rennard SI, Agusti A, Chanez P, Magnussen H, Fabbri L, Donohue  JF, Bateman ED, 

Gross  NJ,  Lamarca  R,  Caracta  C,  Gil  EG.  Efficacy  and  safety  of  once‐daily  aclidinium  in  chronic 

obstructive pulmonary disease. Respir Res 2011;12:55‐9921‐12‐55.  

(68) Wedzicha  JA, Donaldson GC.  Exacerbations of  chronic obstructive pulmonary disease. Respir 

Care 2003;48:1204‐13; discussion 1213‐5.  

(69) Qiu Y, Zhu  J, Bandi V, Atmar RL, Hattotuwa K, Guntupalli KK,  Jeffery PK. Biopsy neutrophilia, 

neutrophil chemokine and receptor gene expression in severe exacerbations of chronic obstructive 

pulmonary disease. Am J Respir Crit Care Med 2003;168:968‐975.  

(70) Bhowmik A, Seemungal TA, Sapsford RJ, Wedzicha JA. Relation of sputum inflammatory markers 

to symptoms and lung function changes in COPD exacerbations. Thorax 2000;55:114‐120.  

(71)  Liesker  JJ, Bathoorn  E, Postma DS, Vonk  JM,  Timens W, Kerstjens HA.  Sputum  inflammation 

predicts  exacerbations  after  cessation  of  inhaled  corticosteroids  in  COPD.  Respir  Med 

2011;105:1853‐1860.  

(72)  Perng  DW,  Tao  CW,  Su  KC,  Tsai  CC,  Liu  LY,  Lee  YC.  Anti‐inflammatory  effects  of 

salmeterol/fluticasone, tiotropium/fluticasone or tiotropium in COPD. Eur Respir J 2009;33:778‐784.  

(73) Powrie DJ, Wilkinson TM, Donaldson GC, Jones P, Scrine K, Viel K, Kesten S, Wedzicha JA. Effect 

of tiotropium on sputum and serum inflammatory markers and exacerbations in COPD. Eur Respir J 

2007;30:472‐478.  

(74) Decramer M, Celli B, Kesten S, Lystig T, Mehra S, Tashkin DP. Effect of tiotropium on outcomes 

in patients with moderate chronic obstructive pulmonary disease (UPLIFT): a prespecified subgroup 

analysis of a randomised controlled trial. Lancet 2009;374:1171‐1178.  

(75) Morice AH, Celli B, Kesten S, Lystig T, Tashkin D, Decramer M. COPD  in young patients: a pre‐

specified analysis of the four‐year trial of tiotropium (UPLIFT). Respir Med 2010;104:1659‐1667.  

(76) Vestbo J, Edwards LD, Scanlon PD, Yates JC, Agusti A, Bakke P, Calverley PM, Celli B, Coxson HO, 

Crim C, Lomas DA, MacNee W, Miller BE, Silverman EK, Tal‐Singer R, Wouters E, Rennard SI, ECLIPSE 

Investigators. Changes  in  forced expiratory volume  in 1  second over  time  in COPD. N Engl  J Med 

2011;365:1184‐1192.  

(77)  Saito  Y,  Azuma  A,  Morimoto  T,  Fujita  K,  Abe  S,  Motegi  T,  Usuki  J,  Kudoh  S.  Tiotropium 

ameliorates symptoms  in patients with chronic airway mucus hypersecretion which  is  resistant  to 

macrolide therapy. Intern Med 2008;47:585‐591.  

(78) Bateman ED, Rennard S, Barnes PJ, Dicpinigaitis PV, Gosens R, Gross NJ, Nadel  JA, Pfeifer M, 

Racke  K,  Rabe  KF,  Rubin  BK, Welte  T, Wessler  I.  Alternative mechanisms  for  tiotropium.  Pulm 

Pharmacol Ther 2009;22:533‐542.  

 

 

 

 

 

 

 

199 

Nederlandse samenvatting 

Introductie

Chronisch  obstructief  longlijden  (COPD)  en  astma  zijn  veel  voorkomende  longziekten, 

waarvan de  incidentie de afgelopen decennia sterk  is  toegenomen. Het  is voorspeld dat 

COPD wereldwijd de derde doodsoorzaak zal zijn  in 2020. Astma heeft veel minder vaak 

een dodelijke afloop, maar kan een grote impact hebben op iemands leven en is één van 

de meest  voorkomende  chronische  ziekten  in  kinderen.  COPD  en  astma worden  beide 

gekenmerkt door toegenomen vernauwing van de luchtwegen, wat leidt tot ademhalings‐ 

problemen.  

Er  zijn  een  aantal  factoren  die  kunnen  leiden  tot  een  vernauwing  van  de  luchtwegen: 

voorbeelden  daarvan  zijn  belemmering  van  de  luchtstroom  door  aanwezig  sputum, 

verdikking van de luchtwegwand, verlies van elastische kracht om de luchtweg van buiten 

opengetrokken  te houden en  tenslotte  samentrekking van  spieren  in de  luchtwegwand. 

Deze  samentrekking van de  spieren  rondom de  luchtwegen kan het gevolg  zijn van het 

rechtstreekse  aangrijpen  van  een  stof uit de  zenuwuiteinden op het  spierweefsel.  Zo’n 

stof  heet  een  neurotransmitter.  Acetylcholine  is  de  primaire  neurotransmitter  in  de 

luchtwegen  die  zorgt  voor  vernauwing  van  de  luchtwegen  door  te  binden  aan  haar 

aangrijpingspunten;  de  zogenaamde  muscarinereceptoren.  Veranderingen  in  het 

neuronale  systeem, met  verhoogde  acetylcholine  afgifte  als  gevolg,  dragen  bij  aan  de 

toegenomen vernauwing van de  luchtwegen. Patiënten met COPD, en  in mindere mate 

ook die met  astma, worden daarom behandeld met  anticholinergica, welke de werking 

van acetylcholine tegengaan door middel van het blokkeren van de muscarinereceptoren.  

Tot  voor  kort  werd  aangenomen  dat  acetylcholine  uitsluitend  luchtwegvernauwing  en 

slijmsecretie veroorzaakt. Er zijn echter aanwijzingen dat acetylcholine ook bijdraagt aan 

chronische luchtwegontsteking en structurele veranderingen in de luchtwegen. Dit laatste 

wordt  ook wel  ‘luchtwegremodeling’  genoemd.  Luchtwegontsteking  en  remodeling  zijn 

twee belangrijke pathologische processen die zowel bij COPD als astma een rol spelen en 

bijdragen  aan  de  afname  van  de  longfunctie  en  aan  de  ernst  van  de  ziekte.  In 

diermodellen voor zowel COPD als astma is aangetoond dat anticholinergica ontsteking en 

remodeling van de  luchtwegen kunnen  remmen. De  rol van acetylcholine  in  longziekten 

zou  daarom  veel  breder  kunnen  zijn  dan  aanvankelijk werd  gedacht.  Het  doel  van  dit 

proefschrift was om dat te onderzoeken. 

 

 

 

200 

Muscarine receptor subtypes 

In  de  luchtwegen  worden  verschillende  muscarinereceptorsubtypes  tot  expressie 

gebracht, te weten muscarine M1, M2 en M3 receptoren. Luchtweg‐gladde spiercontractie 

en  slijmsecretie  worden  voornamelijk  gemedieerd  via M3  receptoren.  Dit  is  de  reden 

waarom  men  anticholinergica  het  liefst  zo  selectief  mogelijk  voor  M3  receptoren 

ontwerpt. Het  is  echter  niet  bekend  of de  effecten  van  acetylcholine op  ontsteking  en 

remodeling  ook  gemedieerd  worden  via  M3  receptoren.  Daarom  hebben  we  in  dit 

proefschrift onderzocht wat de bijdrage is van individuele muscarinereceptorsubtypes aan 

luchtwegontsteking  en  luchtwegremodeling.  Dit  hebben  we  gedaan  met  behulp  van 

muizen welke één van de muscarinereceptoren niet  tot expressie brengen, zogenaamde 

muscarinereceptor knock‐out muizen.  In hoofdstuk 3 hebben we de  rol van  individuele 

muscarinereceptorsubtypes onderzocht  in een muismodel voor COPD, en  in hoofdstuk 6 

hebben we dit gedaan in een muismodel voor astma.  

COPD 

In  hoofdstuk  3  hebben  we  controle  muizen,  zogenaamde  wild‐type  muizen,  en 

muscarinereceptor  knock‐out  muizen  blootgesteld  aan  sigarettenrook,  omdat  dit  de 

belangrijkste  oorzaak  is  voor  het  ontwikkelen  van  COPD.  Net  als  in  COPD  patiënten 

ontstaat  er  ontsteking  in  de  longen  van  wild‐type  muizen  na  blootstelling  aan 

sigarettenrook.  Deze  ontsteking  wordt  gekenmerkt  door  een  toename  in  neutrofiele 

granulocyten (een type witte bloedcellen) en ontstekingsbevorderende stoffen, zoals het 

cytokine interleukine (IL)‐8 dat neutrofielen aantrekt in de long. Eerder was al aangetoond 

dat  voorbehandeling  met  anticholinergica  neutrofiele  ontsteking  kan  remmen  in 

diermodellen  van  COPD.  In  hoofdstuk  3  laten  we  zien  dat  deze  effecten  gemedieerd 

worden  via  M3  receptoren.  Knock‐out  van  de  M3  receptor  kon  voorkomen  dat 

sigarettenrook neutrofiele ontsteking en cytokine afgifte veroorzaakte. Daarnaast hebben 

we  aangetoond  dat  vergelijkbare  effecten  verkregen worden wanneer  de M3  receptor 

geblokkeerd  wordt  met  een  selectieve  M3‐receptorblokker.  Dit  suggereert  dat 

acetylcholine  luchtwegontsteking  bevordert  via  de  M3  receptor.  Dit  wordt  verder 

ondersteund  door  het  feit  dat  de  ontsteking  was  verhoogd  na  knock‐out  van  de M2 

receptor. De M2 receptor functioneert als een receptor met een remmende werking op de 

afgifte van acetylcholine. Verlies van deze receptor resulteert dus in verhoogde afgifte van 

acetylcholine,  wat  leidt  tot  verhoogde  luchtwegontsteking.  Opvallend  was  dat  de 

ontsteking ook verhoogd was na knock‐out van de M1 receptor. Dit zou verklaard kunnen 

worden door de rol van de M1 receptor bij de productie van slijm. De M1 receptor draagt 

bij aan de afgifte van water en elektrolyten door slijmproducerende cellen, en kan zo de 

samenstelling van het slijm veranderen. Slijm  is belangrijk om deeltjes  in de  luchtwegen 

op  te  ruimen. Het  opruimen  van  de  schadelijke  rookdeeltjes  zou minder  goed  kunnen 

Nederlandse samenvatting 

 201 

verlopen  na  knock‐out  van  de  M1  receptor,  bijvoorbeeld  doordat  het  slijm  dikker  is. 

Samengevat  laat hoofdstuk 3  zien dat  acetylcholine de  luchtwegontsteking  veroorzaakt 

door roken bevordert via M3 receptoren, en niet via M1 en M2 receptoren. 

Studies die gebruik maken van  luchtwegcellen  in kweek ondersteunen onze bevindingen 

dat acetylcholine luchtwegontsteking bevordert via M3 receptoren. M3 receptoren worden 

op bijna alle cellen  in de  luchtwegen tot expressie gebracht  (zie tabel 1  in hoofdstuk 1). 

Dit  omvat  ontstekingscellen,  zoals  neutrofielen  en  macrofagen,  alsmede  structurele 

cellen,  zoals  luchtweg‐gladde  spiercellen  en  epitheelcellen  en  endotheelcellen  welke 

respectievelijk de luchtwegen en de bloedvaten bekleden. In kweekcondities kan activatie 

van  muscarinereceptoren  op  zowel  ontstekingscellen  als  structurele  cellen  de 

luchtwegontsteking  bevorderen  door  het  vrijzetten  van  ontstekingsbevorderende 

cytokines  uit  deze  cellen.  Het  is  echter  niet  bekend  wat  de  relatieve  bijdrage  is  van 

ontstekingscellen  ten  opzichte  van  structurele  cellen  aan  het  ontstekingsbevorderende 

effect van acetylcholine  in het  levende organisme. Dit hebben we daarom onderzocht  in 

hoofdstuk 4. Om onderscheid  te kunnen maken  tussen ontstekingscellen en  structurele 

cellen hebben we beenmergtransplantaties uitgevoerd in muizen. Door transplantatie van 

beenmergcellen van M3 receptor knock‐out dieren  in bestraalde wild‐type dieren kan de 

bijdrage  van  de  M3  receptor  op  ontstekingscellen,  die  ontstaan  in  het  beenmerg, 

onderzocht  worden.  Deze  dieren  hebben  namelijk  normale  structurele  cellen  en 

ontstekingscellen  zonder  M3  receptor.  Omgekeerd  kan  door  de  transplantatie  van 

beenmergcellen  van  wild‐type  dieren  in  bestraalde  M3  receptor  knock‐out  dieren  de 

bijdrage van de M3 receptor op structurele cellen onderzocht worden. Deze dieren hebben 

juist  structurele  cellen  zonder M3  receptor en normale ontstekingscellen. Bestraalde en 

niet bestraalde wild‐type dieren werden gebruikt als controle dieren. De muizen werden 

blootgesteld aan sigarettenrook, op dezelfde manier als in hoofdstuk 3. Dit leidde tot een 

toename  van  het  aantal  neutrofielen  in  controle  dieren.  Dieren met  ontstekingscellen 

zonder M3 receptor hadden een vergelijkbare toename in neutrofielen. Dit suggereert dat 

ontstekingscellen  geen  bijdrage  leveren  aan  het  ontstekingsbevorderende  effect  van 

acetylcholine.  In dieren met  structurele  cellen  zonder M3  receptor werd  geen  toename 

van neutrofielen waargenomen. Dit suggereert dat de M3  receptor op structurele cellen 

bijdraagt  aan  het  ontstekingsbevorderende  effect  van  acetylcholine. De  afgifte  van  het 

ontstekingsbevorderende  cytokine  IL‐8, dat  zorgt  voor  het  aantrekken  van  neutrofielen 

naar de plek van ontsteking, was vergelijkbaar in alle groepen. Dit suggereert dat hoewel 

neutrofielen wel aangetrokken konden worden door dit cytokine, de migratie vanuit de 

bloedbaan naar de luchtwegen verhinderd was na knock‐out van de M3 receptor. Hiervoor 

was  inderdaad bewijs.  Twee  genen die betrokken  zijn bij de migratie  van neutrofielen, 

fibrinogeen α en CD177, kwamen  lager  tot expressie  in M3 receptor knock‐out dieren  in 

 

202 

vergelijking  met  wild‐type  dieren.  Samengevat  laat  hoofdstuk  4  zien  dat  de 

ontstekingsbevorderende  effecten  van  acetylcholine  worden  gemedieerd  via  M3 

receptoren  op  structurele  cellen,  doordat  er  verminderde  migratie  van  neutrofielen 

optreedt. Dit wijst op een belangrijke rol voor structurele cellen in de pathofysiologie van 

COPD, en een bijdrage van acetylcholine aan dit proces. 

Astma 

Vervolgens hebben we  in hoofdstuk 6 de rol van  individuele muscarinereceptorsubtypes 

in  astma  onderzocht.  Hiervoor  zijn  wild‐type  en muscarinereceptor  knock‐out muizen 

blootgesteld aan een allergeen, om zo een allergische reactie  te  induceren vergelijkbaar 

met  die  bij  allergische  astmapatiënten.  Blootstelling  van  wild‐type  dieren  aan  het 

allergeen  resulteerde  in  luchtwegremodeling  in  de  vorm  van  een  toename  in 

slijmproducerende  cellen,  verdikking  van  de  spierlaag  rondom  de  luchtwegen  en  de 

bloedvaten  in  de  long  en  toegenomen  afzetting  van  bindweefseleiwitten  in  de 

luchtwegwand. Deze effecten werden niet of slechts  in beperkte mate waargenomen  in 

M3  receptor  knock‐out muizen. De  remodeling  in M1 en M2  receptor  knock‐out muizen 

was  vergelijkbaar met die  in wild‐type muizen. Dit  suggereert dat de  remodelingbevor‐

derende  eigenschappen  van  acetylcholine  na  blootstelling  aan  allergeen  gemedieerd 

worden via M3 receptoren, en niet via M1 en M2 receptoren. Dit  is dus vergelijkbaar met 

de  ontstekingsbevorderende  eigenschappen  van  acetylcholine  na  rookblootstelling 

beschreven  in  hoofdstuk  3,  welke  ook  via  de  M3  receptor  gemedieerd  werden.  In 

tegenstelling  tot  de  resultaten  in  hoofdstuk  3  hebben we  in  hoofdstuk  6  geen  effect 

gevonden van knock‐out van de M2 receptor. Het is bekend dat de M2 receptor niet meer 

functioneel  is  in  astma;  dit  is  zowel  voor  diermodellen  als  voor  patiënten met  astma 

gerapporteerd. Dit  zou kunnen verklaren waarom de  remodeling vergelijkbaar  is  in wild 

type en M2  receptor knock‐out dieren. Daarnaast hebben we ook geen effect gevonden 

van knock‐out van de M1 receptor. Terwijl  in hoofdstuk 3 schadelijke rookdeeltjes uit de 

longen verwijderd moesten worden, wordt zo’n effect niet verwacht na inhalatie van een 

allergeen. Dit zou kunnen verklaren waarom de remodeling vergelijkbaar is in wild type en 

M1  receptor  knock‐out  dieren.  Samengevat  laat  hoofdstuk  6  zien  dat  acetylcholine 

luchtwegremodeling bevordert via M3 receptoren, en niet via M1 en M2 receptoren. 

Naast het effect van allergeen op luchtwegremodeling, hebben we in hoofdstuk 6 ook het 

effect van allergeen op luchtwegontsteking onderzocht. Blootstelling van wild‐type dieren 

aan het  allergeen  resulteerde  in  luchtwegontsteking,  gekenmerkt door  een  toename  in 

eosinofielen (een type witte bloedcellen) en ontstekingsbevorderende cytokines zoals  IL‐

13. Eenzelfde mate van ontsteking werd waargenomen  in muscarinereceptor knock‐out 

dieren,  inclusief  M3  receptor  knock‐out  dieren.  Dit  is  opvallend,  omdat  deze  dieren 

Nederlandse samenvatting 

 203 

nauwelijks luchtwegremodeling vertonen. Er werd altijd gedacht dat luchtwegremodeling 

het gevolg is van luchtwegontsteking. Onze resultaten suggereren echter dat hier ook een 

ander mechanisme aan ten grondslag zou kunnen  liggen. Het  is bekend dat mechanische 

compressie, zoals veroorzaakt door gladde spiercontractie, kan leiden tot remodeling. Dit 

is  aangetoond  voor  luchtwegepitheelcellen  in  kweek,  maar  ook  in  astmapatiënten. 

Wanneer  in  deze  patiënten  gladde  spiercontractie  veroorzaakt  wordt  door  de  stof 

methacholine leidt dit tot remodeling zonder dat er effecten zijn op de ontsteking. Gladde 

spiercontractie wordt gemedieerd via M3 receptoren en  in M3 receptor knock‐out dieren 

treedt  er  minder  luchtwegvernauwing  op,  wat  we  ook  laten  zien  in  hoofdstuk  7. 

Samengevat suggereert dit dus dat  luchtwegvernauwing, door gladde spiercontractie via 

M3  receptoren,  een  belangrijke  oorzaak  zou  kunnen  zijn  van  het  ontstaan  van 

luchtwegremodeling bij allergisch astma. Dit impliceert dat het zinvol zou kunnen zijn om 

toegenomen  luchtwegvernauwing  in  patiënten met  astma  al  in  een  vroeg  stadium  te 

behandelen, om zo luchtwegremodeling gedeeltelijk te voorkomen. 

In  hoofdstuk  7  hebben  we  daarom  verder  onderzocht  of  luchtwegvernauwing  via M3 

receptoren kan  leiden tot  luchtwegremodeling. Hiertoe hebben we gebruik gemaakt van 

longplakjes van muizen. Eerder was al aangetoond dat luchtwegvernauwing in longplakjes 

van cavia’s kan leiden tot luchtwegremodeling. In hoofdstuk 7 wilden we de bijdrage van 

de M3 receptor  in deze respons onderzoeken met behulp van de M3 receptor knock‐out 

muizen. Hoewel luchtwegremodeling veroorzaakt werd door de potente groeifactor TGF‐

β, vonden we geen effect van  luchtwegvernauwing op remodeling. Dit suggereert dat de 

cavia een beter model  is om het effect van  luchtwegvernauwing op  luchtwegremodeling 

te onderzoeken, en dat de muis hier niet geschikt voor is. 

 

Neuronaal en non‐neuronaal acetylcholine 

Acetylcholine functioneert als een neurotransmitter in de luchtwegen, maar kan daarnaast 

ook aangemaakt worden door verschillende cellen  in de  luchtwegen, zoals epitheelcellen 

en ontstekingscellen. Dit wordt non‐neuronaal acetylcholine genoemd.  In dit proefschrift 

hebben we onderzocht wat de bijdrage is van non‐neuronaal acetylcholine aan ontsteking 

en  remodeling.  In  hoofdstuk  5  hebben we  de  rol  van  neuronaal  versus  non‐neuronaal 

acetylcholine onderzocht in ontsteking bij COPD, en in hoofdstuk 8 hebben we de bijdrage 

van non‐neuronaal acetylcholine aan slijmbekerceldifferentiatie onderzocht.  

 

 

 

204 

COPD 

In  hoofdstuk  5  hebben  we  het  effect  onderzocht  van  denervatie  op  ontsteking  in 

patiënten met COPD. Denervatie  is een potentiële nieuwe  therapie  voor patiënten met 

COPD. Door het uitschakelen van de zenuwen komt er geen acetylcholine meer vrij uit de 

zenuwuiteinden,  waardoor  er  minder  luchtwegvernauwing  optreedt.  Wij  hebben 

onderzocht of dit ook effect heeft op de ontsteking in de luchtwegen. We zagen inderdaad 

een afname van de ontsteking na denervatie  in patiënten,  in de vorm van verminderde 

neutrofielen  en  ontstekingsbevorderende  cytokines  zoals  IL‐8.  Dit  is  slechts  in  zeven 

patiënten  uitgevoerd,  omdat  deze  therapie  voor  het  eerst werd  toegepast  in mensen, 

maar  toch  suggereert  dit  dat  acetylcholine  luchtwegontsteking  bevordert,  en  dat  dit 

geremd kan worden door het remmen van de afgifte van acetylcholine door denervatie. 

Daarnaast namen we ook een vermindering van TGF‐β waar, een remodelingbevorderen‐ 

de groeifactor. Dit suggereert dat denervatie op de  lange termijn ook effect zou kunnen 

hebben op remodeling. Uit dit hoofdstuk blijkt dat de effecten van acetylcholine in COPD 

in  ieder  geval  gedeeltelijk  gemedieerd  worden  via  neuronaal  acetylcholine.  Dit  wordt 

verder  ondersteund  door  de  resultaten  uit  hoofdstuk  3,  waar  we  een  toegenomen 

ontsteking waarnamen na knock‐out van de M2 receptor, welke neuronaal acetylcholine 

remt, terwijl een soortgelijk mechanisme voor non‐neuronaal acetylcholine niet bekend is.  

Astma 

In hoofdstuk 8 hebben we de rol van acetylcholine bij de vorming van slijmbekercellen in 

het  luchtwegepitheel onderzocht. Epitheelcellen maken  zelf acetylcholine aan,  zodat de 

bijdrage  van  non‐neuronaal  acetylcholine  hierbij  onderzocht  kan  worden. We  hebben 

hiertoe gebruik gemaakt van epitheelcellen uit luchtwegen van gezonde donorlongen, wat 

als  restmateriaal  overblijft  bij  een  longtransplantatie.  Door  het  blootstellen  van  deze 

cellen aan  IL‐13 ontstaat er een  toename  in het aantal  slijmbekercellen.  In hoofdstuk 8 

tonen we aan dat het blokkeren van muscarinereceptoren deze toename kan voorkomen. 

Hieruit  blijkt  dat  non‐neuronaal  acetylcholine  bijdraagt  aan  de  toename  in 

slijmbekercellen. De  resultaten uit hoofdstuk  6  suggereren dat neuronaal  acetylcholine 

een belangrijke  rol speelt bij  luchtwegremodeling  in astma, omdat er hier waarschijnlijk 

remodeling  optreedt  door  luchtwegconstrictie,  wat  gemedieerd  wordt  via  neuronaal 

acetylcholine. Samengevat  laat dit proefschrift dus zien dat er een belangrijke rol  is voor 

neuronaal  acetylcholine  in  luchtwegontsteking  en  remodeling,  maar  dat  ook  non‐

neuronaal  acetylcholine  hier  aan  bij  kan  dragen.  Denervatie  in  dieren  onder 

gecontroleerde omstandigheden  zou uitsluitsel kunnen geven over de  relatieve bijdrage 

van  non‐neuronaal  acetylcholine  in  het  levende  organisme.  In  het  kader  van  dit 

proefschrift  hebben  we  geprobeerd  dit  uit  te  voeren  in  muizen,  maar  dit  bleek  niet 

mogelijk. Uit de literatuur blijkt echter dat denervatie in grotere proefdieren wel mogelijk 

Nederlandse samenvatting 

 205 

is, zodat door deze dieren bloot te stellen aan bijvoorbeeld sigarettenrook of allergeen de 

bijdrage van neuronaal versus non‐neuronaal acetylcholine aan ontsteking en remodeling 

onderzocht kan worden. Daarnaast zouden studies waarin denervatie  in grotere groepen 

patiënten met COPD of astma wordt uitgevoerd ook meer informatie kunnen geven. 

 

Klinische implicaties 

COPD 

De resultaten  in dit proefschrift  tonen aan dat acetylcholine bijdraagt aan ontsteking en 

remodeling in modellen voor COPD en astma. Er is echter nog weinig bekend over de rol 

van acetylcholine bij ontsteking en remodeling  in patiënten.  In dit proefschrift tonen we 

voor de eerste keer aan dat het remmen van de afgifte van acetylcholine, door middel van 

denervatie, ontsteking remt bij COPD patiënten. Een geplande vervolgstudie, waarin meer 

patiënten geïncludeerd zullen worden, zal meer licht werpen op de vraag of acetylcholine 

in de  luchtwegen ontstekingsbevorderend werkt. Het  is wel bekend dat behandeling van 

COPD  patiënten  met  anticholinergica  het  optreden  van  exacerbaties  remt.  Een 

exacerbatie  is  een  toename  van  ziektesymptomen,  welke  gepaard  gaat  met  een 

toegenomen ontsteking. Dit suggereert dat anticholinergica de ontstekingsreactie zouden 

kunnen  remmen.  De  resultaten  uit  hoofdstuk  5  zijn  de  eerste  directe  aanwijzing  dat 

acetylcholine  effect heeft op de ontsteking bij deze patiënten.  Er  zijn  echter nog meer 

studies nodig om dit onomstotelijk aan te tonen. Daarnaast zijn er nog studies nodig die 

het effect van acetylcholine op remodeling bij COPD onderzoeken.  In hoofdstuk 5 zagen 

we  een  afname  van  TGF‐β  na  denervatie.  Ook  is  bekend  dat  behandeling  met 

anticholinergica  de  versnelde  afname  in  longfunctie  in  beperkte mate  kan  remmen  bij 

bepaalde patiëntengroepen met COPD. Studies waarin  remodeling op een meer directe 

manier gemeten wordt, bijvoorbeeld door remodeling  in biopten van COPD patiënten na 

langdurige  behandeling  met  anticholinergica  te  onderzoeken,  zouden  helpen  bij  het 

ophelderen van de rol van acetylcholine bij remodeling bij COPD. 

Astma 

Het anticholinergicum tiotropium is recent geregistreerd voor de chronische behandeling 

van  astmapatiënten.  Er  zijn  steeds meer  studies  die  aangeven  dat  anticholinergica wel 

degelijk een positief effect hebben op longfunctie in deze patiëntengroep. Uit deze studies 

blijkt ook dat, net als bij COPD, het aantal exacerbaties geremd wordt na behandeling met 

anticholinergica.  Dit  is  dus  opnieuw  indirect  bewijs  voor  een  rol  van  acetylcholine  bij 

astma, en mogelijk bij ontsteking. Daarnaast zijn er ook indicaties dat acetylcholine een rol 

zou  kunnen  spelen  bij  remodeling  in  patiënten  met  astma.  Een  studie  waarin 

muscarinereceptoren geactiveerd werden in astmapatiënten toonde aan dat dit leidde tot 

 

206 

meer remodeling. Ook hier geldt dat er in de toekomst meer studies nodig zullen zijn om 

definitief  te  bewijzen  wat  de  rol  is  van  acetylcholine  in  ontsteking  en  remodeling  in 

patiënten met astma. 

 

M3 selectieve anticholinergica 

Klinisch beschikbare anticholinergica binden aan zowel M1, M2 als M3 receptoren. Ze zijn 

selectief  doordat  ze  langer  binden  aan M3  receptoren  dan  aan M2  receptoren,  en  in 

mindere mate M1 receptoren. Uit de resultaten van dit proefschrift blijkt dat het gewenst 

is om een anticholinergicum te ontwikkelen dat nog selectiever is, en alleen bindt aan M3 

receptoren. Dit zou, afhankelijk van de aandoening, kunnen leiden tot verbeterde effecten 

op ontsteking en remodeling. 

 

Conclusies 

Samengevat  laat  dit  proefschrift  zien  dat  acetylcholine  bijdraagt  aan  ontsteking  en 

remodeling  bij  COPD  en  astma.  Dit  omvat  zowel  neuronaal  als  niet‐neuronaal 

acetylcholine.  De  effecten  van  acetylcholine  op  ontsteking  en  remodeling  worden 

gemedieerd via M3  receptoren. Samen suggereert dit dat patiënten met COPD of astma 

meer baat zouden kunnen hebben bij anticholinergica dan aanvankelijk gedacht.  

   

Nederlandse samenvatting 

 207 

 

Figuur 1. Acetylcholine wordt afgegeven uit zenuwuiteinden en uit luchtweg cellen. Dit draagt bij aan ontsteking en  remodeling van de  luchtwegen  via M3  receptoren. Omgevingsfactoren,  zoals  sigarettenrook, allergenen en 

luchtwegvernauwende  stoffen,  kunnen  zorgen  voor  verhoogde  afgifte  van  acetylcholine  en  op  deze manier 

bijdragen aan ontsteking en  remodeling  (hoofdstuk 2). Blootstelling aan  sigarettenrook  zorgt voor verhoogde 

afgifte  van  cytokines,  zoals  IL‐8,  IL‐6, MCP‐1  en  TGF‐β,  gemedieerd  via M3  receptoren  op  structurele  cellen 

(hoofdstuk  3  en  4).  Ontsteking  geïnduceerd  door  sigarettenrook  neemt  toe  na  knock‐out  van  M1  en  M2 

receptoren. M1 receptoren op het epitheel dragen bij aan slijm secretie, en knock‐out van deze receptor zou dus 

effect  kunnen  hebben  op  het  opruimen  van  schadelijke  rookdeeltjes  uit  de  luchtwegen. M2  receptoren  op 

zenuwuiteinden zijn auto‐inhibitoire  receptoren en knock‐out van deze  receptorzou de ontsteking dus kunnen 

bevorderen  via  verhoogde  acetylcholine  afgifte  (hoofdstuk  3).  Blootstelling  aan  allergenen  resulteert  in 

ontsteking en remodeling  in de luchtwegen. Remodeling, gemeten als een toename  in het aantal goblet cellen, 

verdikking  van  de  spier  (α‐actine  depositie)  en  depositie  van  extracellulaire matrix  eiwitten  (ECM  depositie), 

wordt  gemedieerd  via  M3  receptoren.  Er  is  geen  rol  waargenomen  voor  M1  en  M2  receptoren,  en 

laatstgenoemde zou dysfunctioneel kunnen zijn na allergeen blootstelling (hoofdstuk 6). Ontsteking geïndueerd 

door allergeen wordt niet beïnvloed door knock‐out van de M3 receptor. Dit suggereert dat luchtwegvernauwing 

en  de  daaropvolgende  toename  in  spanning  remodeling  kan  induceren,  onafhankelijk  van  de  ontsteking 

(hoofdstuk 6 en 7). Zowel neuronaal (hoofdstuk 5) als non‐neuronal acetylcholine (hoofdstuk 8) draagt bij aan 

ontstekings‐ en remodelingsprocessen in de luchtwegen.   

   

 

208 

De belangrijkste conclusies van dit proefschrift zijn de volgende: 

Acetylcholine  is  niet  alleen  betrokken  bij  luchtwegconstrictie  en  slijmsecretie, 

maar draagt ook bij aan luchtwegontsteking en remodeling (hoofdstuk 2). Net als 

de  effecten  op  luchtwegconstrictie  en  slijmsecretie  worden  de  effecten  op 

ontsteking  en  remodeling  voornamelijk  gemedieerd  via  M3  receptoren 

(hoofdstuk 3 en 6). 

De  M3  receptor  speelt  een  ontstekingsbevorderende  rol  bij  ontsteking 

veroorzaakt  door  sigarettenrook,  terwijl  de  M1  en  M2  receptoren 

ontstekingsremmend  werken  (hoofdstuk  3).  Dit  suggereert  dat M3  selectieve 

anticholinergica de ontsteking bij COPD kunnen remmen. 

Het ontstekingsbevorderende effect van acetylcholine bij ontsteking veroorzaakt 

door  sigarettenrook  wordt  voornamelijk  gemedieerd  door  M3  receptoren 

aanwezig op structurele cellen van de luchtwegen (hoofdstuk 4). 

De M3 receptor draagt bij aan remodeling veroorzaakt door allergeen, terwijl de 

M3 receptor geen rol speelt bij ontsteking veroorzaakt door allergeen (hoofdstuk 

6).  Dit  suggereert  dat  luchtwegconstrictie  remodeling  kan  veroorzaken, 

onafhankelijk van de ontsteking (hoofdstuk 6 en 7). 

M1  en  M2  receptoren  zijn  niet  betrokken  bij  ontsteking  en  remodeling 

veroorzaakt door allergeen (hoofdstuk 6). 

Denervatie vermindert de  luchtwegontsteking  in patiënten met COPD. Dit  is de 

eerste directe aanwijzing dat acetylcholine bijdraagt aan ontsteking  in patiënten 

en impliceert een belangrijke rol voor neuronaal acetylcholine (hoofdstuk 5). 

Anticholinergica  kunnen  de  differentiatie  naar  slijmbekercellen  in  het  epitheel 

voorkomen.  Dit  suggereert  dat  non‐neuronaal  acetylcholine  bijdraagt  aan 

remodeling bij astma (hoofdstuk 8). 

Patiënten  met  COPD  of  astma  zouden  meer  baat  kunnen  hebben  bij 

anticholinerge therapie dan aanvankelijk gedacht, omdat anticholinerge therapie 

luchtwegontsteking  en  luchtwegremodeling  zou  kunnen  remmen.  Dit  kan 

bewerkstelligd  worden  via  denervatie  of  via  inhalatie  van  anticholinergica. 

Behandeling met  selectievere M3  receptor‐specifieke  anticholinergica  zou  nog 

meer voordeel op kunnen leveren (dit proefschrift).  

 

 

 

 

 

 

211 

Dankwoord 

Ik kijk met een ontzettend goed gevoel terug op de afgelopen vier  jaren en ben trots op 

het werk beschreven in dit proefschrift. Dit had ik natuurlijk nooit kunnen bereiken zonder 

de hulp van alle mensen om me heen. Aan elk hoofdstuk  ligt een andere samenwerking 

ten grondslag en ik heb veel geleerd van de verschillende mensen met wie ik heb kunnen 

samen werken. Graag wil ik daarom iedereen bedanken die, op welke wijze dan ook, heeft 

geholpen bij het tot stand komen van dit proefschrift. Een aantal mensen wil  ik graag  in 

het bijzonder noemen. 

Als eerste wil ik graag mijn promotores bedanken.  

Reinoud, het moment waarop  jij me vroeg voor dit project kan  ik me nog herinneren als 

de dag van gisteren.  Ik was enigszins verrast en had mijn keuze voor het onderzoek dan 

wel de apotheek eigenlijk nog niet gemaakt. Na enig beraad koos  ik voor de uitdagingen 

van  het  onderzoek  en  achteraf  kan  ik met  zekerheid  stellen  dat  dit  de  juiste  keuze  is 

geweest.  Niet  in  de  laatste  plaats  omdat  dit  project  en  onze  samenwerking  zo  goed 

verliep. Hoewel we elkaar niet goed kenden op het moment dat ik aan dit project begon, 

merkte  ik al snel dat dit wel goed zat. Ik wil  je bedanken voor de prettige begeleiding,  je 

positieve kijk op de dingen, de ruimte die  je me hebt gegeven binnen het project, maar 

ook voor de gezelligheid en leuke gesprekken tijdens onder andere de congressen die we 

hebben  bezocht  en  op  de  vrijdagmiddagborrels  in  de  Pintelier.  Je  was  een  perfecte 

dagelijkse begeleider, maar ik ben natuurlijk helemaal trots dat je uiteindelijk mijn eerste 

promotor bent geworden.  Ik kijk met vertrouwen uit naar de  toekomst en hoop dat we 

nog lang zullen samenwerken. 

Herman, als promotor was  jij ook betrokken bij mijn project. Nadat  jij  jouw kritische blik 

op mijn  stukken had geworpen wist  ik  zeker dat er geen  fouten meer  in  zouden  zitten. 

Bovendien  kon  je mij  door  al  je  kennis  en  ervaring  anders  naar  de  data  laten  kijken, 

bedankt daarvoor. 

Huib, ook jij keek met een totaal andere blik naar mijn data, wat erg nuttig was. Na onze 

maandelijkse overleggen was ik soms minder zeker over mijn data of de betekenis hiervan 

dan voordat ik je kamer binnen stapte, maar ik denk dat zowel ik als mijn stukken hierdoor 

alleen maar beter zijn geworden. Bedankt. 

I  would  also  like  to  thank  the members  of  the  reading  committee,  Prof.  dr.  Andrew 

Halayko, Prof. dr. Wolfgang Kummer and Prof. dr. Dirkje Postma. Thank you for your time 

and effort to critically review my thesis. 

 

212 

Martina, jij bent degene die mij kennis heeft laten maken met het onderzoek. Jouw passie 

en enthousiasme voor het onderzoek hebben er zeker aan bijgedragen dat ik heb gekozen 

voor deze weg, bedankt daarvoor. 

Hans, hoewel  je officieel niet betrokken was bij mijn project,  kwam  je  toch  regelmatig 

even polsen hoe het er voor stond en of ik al nieuwe resultaten had, bijvoorbeeld over de 

rol van de M1 receptor. Bedankt dat je altijd voor me klaar stond en staat met advies. 

Machteld, ook  jij was betrokken bij mijn project en hebt me veel kunnen  leren. Bedankt 

voor  je bijdrage. Hopelijk ben  je enigszins tevreden met de hoeveelheid puntengrafieken 

die er uiteindelijk in mijn proefschrift terecht zijn gekomen. 

Sophie, mijn project begon direct met proefdierwerk, en onveraren  (en onhandig) als  ik 

was, kon  ik  jouw hulp hierbij goed gebruiken. Doordat we veel tijd doorbrachten op het 

dierenlab leerden we elkaar snel beter kennen, en werd het dus ook snel gezellig. Vooral 

onze eerste  ’opofferdag‘ zal  ik niet gauw vergeten; hoewel alles veel  langer duurde dan 

gepland heb  ik nog nooit  zo hard gelachen op het  lab. Bedankt voor  je hulp gedurende 

mijn hele project, maar zeker ook voor de gezelligheid. 

Ronald en Bertien, zonder jullie had hoofdstuk 4 nooit bewerkstelligd kunnen worden. We 

hadden het idee opgepakt om de rol van de M3 receptor verder uit te zoeken met behulp 

van  beenmerg  chimeren.  Vervolgens  moesten  we  op  zoek  naar  iemand  die  dit 

daadwerkelijk  kon,  en  daar waren  jullie. De  samenwerking  verliep  vanaf  het  begin  erg 

prettig en ik wil jullie bedanken voor jullie bijdrage. Zowel in de opzet als in de uitvoering 

was jullie hulp onmisbaar en ook op jullie lab voelde ik me altijd erg welkom, en dat terwijl 

elke mogelijke deur van jullie lab op slot zat. 

Dirk‐Jan en Karin, bedankt  voor  jullie bijdrage  aan de  totstandkoming  van hoofdstuk 5. 

Hoewel het voor  jullie de normaalste zaak van de wereld  is, had  ik bij aanvang van mijn 

project nooit verwacht dat ik een patiëntenstudie in mijn proefschrift kon opnemen. Voor 

mij was  dit  een  unieke  kans  en  het  bijwonen  van  de  ingrepen was  een  hele  ervaring. 

Bedankt  voor  de  prettige  samenwerking  en  ik  kijk  erg  uit  naar  onze  toekomstige 

samenwerking waarbij we een vervolg zullen geven aan de resultaten uit hoofdstuk 5. 

Cécile, you were of great help  for chapter 7. Although your stay  in the Netherlands and 

our  lab was only short, we had a really good time, bot scientifically and socially. We  just 

started  experiments  using  lung  slices,  and  it was  really  fun  to work  together with  an 

engineer,  and  to  share  our  totally  different  views  on  the  lung  slice. But  also  at  all  the 

Dankwoord 

 213 

different drinks you were really good company.  It was great  to visit you  in Boston and  I 

wish you all the best in Grenoble. 

Pieter,  Ik ben  jou en  je  lab ook dank  verschuldigd. Hoewel op afstand was  je altijd erg 

geïnteresseerd in mijn project en gaf je waardevolle feedback. Dit bleef zeker niet beperkt 

tot hoofdstuk 8, het hoofdstuk over epitheelcellen, waar de samenwerking op gebaseerd 

was. Voor het opzetten van de zogenaamde ALI‐kweken kwam ik al direct bij aanvang van 

mijn  project  regelmatig  naar  jullie  lab  om  deze  techniek  te  leren.  Suzanne  en  Renate, 

bedankt voor  jullie hartelijke ontvangst en de  fijne samenwerking.  Ik denk graag dat dit 

ook  te maken had met mij  als persoon,  en niet  alleen met het  kostbare  stukje  gezond  

longweefsel dat ik bij me had. Tinne, jij werd in een later stadium betrokken bij dit project 

en ook jou wil ik graag bedanken voor je hulp. Ik wens je veel succes bij het afronden van 

je promotie. 

Anita, het leek me direct gezellig toen ik hoorde dat jij mijn collega zou worden, en niets 

bleek minder waar. Je enthousiasme werkt aanstekelijk, het is erg prettig om zo’n collega 

te hebben. Daarnaast was je een erg leuke kamergenoot tijdens congresbezoeken en dan 

met  name  de  bezoeken  aan  de  ATS.  Ook  onze  daaropvolgende  USA  tripjes,  inclusief 

pannenkoeken  als  ontbijt  en  bergwandelingen  (het  leven  bestaat  uit  compromissen 

sluiten), zal ik me altijd blijven herinneren. Bedankt dat je mijn paranimf wilt zijn. 

Ook al mijn andere (oud‐)collega’s van de afdeling Moleculaire Farmacologie wil  ik graag 

bedanken. Annet, Anouk, Bart, Bing, Boy, Carolina, Christa, David, Eline, Hana, Haoxiao, 

Harm, Hoeke, Jacques,  Janneke, Kuldeep, Marieke, Mark, Pablo, Sara, Sepp, Tim, Tjitske, 

Tonio, Vessa en Wilfred; bedankt voor de gezelligheid. Sara, thank you for introducing me 

to science and the department of Molecular Pharmacology. Tonio, net als Sara duurde het 

niet  lang of  je was vertrokken nadat  ik met mijn promotie was begonnen, maar  ik wil  je 

bedanken voor de gezelligheid op de toch nog vele vrijdagmiddagborrels. Gelukkig zien we 

elkaar  nog  af  en  toe  in  Amerika.  Anouk,  Eline, Marieke;  hoewel  theepauzes  vaak wat 

langer  duren  dan  de  bedoeling  is,  zijn  ze  een  heerlijke  onderbreking  van  de middag, 

bedankt daarvoor. Mark, bedankt voor  je  flauwe grappen,  ik hou er van. Tjitske,  samen 

werkten wij  aan muscarine  receptoren en  in navolging  van  jou werkte  ik  later ook  aan 

slices.  Ik  kan  zeggen  dat  ik  je  miste  toen  je  weg  was,  bedankt  voor  de  prettige 

samenwerking en je eerlijke mening. 

Daarnaast  wil  ik  ook  graag  alle  collega’s  binnen  GRIAC  bedanken.  De  GRIAC  lezingen 

hebben ervoor gezorgd dat  ik een brede kijk op  longziekten heb kunnen ontwikkelen en 

hier wil ik iedereen voor bedanken. Ook wil ik jullie bedanken voor de goede sfeer tijdens 

vrijdagmiddagborrels en op congressen. 

 

214 

Tijdens  mijn  project  ben  ik  geholpen  door  verschillende  studenten.  Susanne  en 

Willemieke,  jullie hebben beiden  je masteronderzoek onder mijn begeleiding uitgevoerd. 

Bedankt voor jullie inzet, toewijding en enthousiasme. Ook de bachelor studenten Nienke, 

Esma, Fleur, Karen, Rosalie, Virginia en Sjoerd wil  ik graag bedanken voor hun bijdrage. 

Jullie bleven wat minder lang, maar jullie inzet wordt hierom niet minder gewaardeerd. 

Ook  wil  ik  graag  de  Centrale  Dienst  Proefdieren  (CDP)  noemen.  Bedankt  voor  jullie 

uitstekende zorg voor de proefdieren en de prettige samenwerking. Het Longfonds wil ik 

graag bedanken voor hun financiële steun. 

Als laatste wil ik graag iedereen uit mijn persoonlijke omgeving bedanken. Gelukkig lukte 

het goed om naast mijn werk  tijd vrij  te maken voor  sport, vrienden en  familie. Er was 

voor mij geen betere manier om mijn werk even  los  te  laten dan door  te hockeyen en 

daarna een welverdiend biertje te drinken. Teamgenoten, bedankt voor de gezelligheid.  

Daarnaast  wil  ik  ook  al  mijn  vrienden  bedanken,  van  de  basisschool  tot  aan  mijn 

studententijd,  jullie  vriendschap  betekent  veel  voor  me.  Bedankt  voor  alle  gezellige 

borrels, weekendjes weg, dagjes sauna en avondjes stappen.  

Ook mijn familie is erg belangrijk voor me. Pap en mam, bedankt voor jullie steun. Het is 

erg prettig om  te weten dat  jullie altijd  in me vertrouwen en dit heeft mij ook van het 

begin af aan het vertrouwen gegeven dat  ik dit tot een goed einde zou kunnen brengen. 

Jullie zijn de beste ouders die ik me kan wensen. Jos en Hans, ik vind het erg stoer dat we 

alle drie promotieonderzoek doen. Ik wens jullie veel succes met de laatste loodjes en met 

jullie keuzes voor de toekomst. Ik heb er alle vertrouwen in dat dit goed komt. Els, ik vind 

het leuk om te merken hoe we in de afgelopen jaren naar elkaar zijn toegegroeid. Waren 

we  vroeger  erg  verschillend,  tegenwoordig  lijken we  steeds meer hetzelfde  te worden. 

Bedankt dat  je er altijd voor me bent.  Ik ben trots op  je en vind het erg  leuk dat  je mijn 

paranimf wilt zijn. 

En  tot  slot Coen.  Zonder  jouw onvoorwaardelijke  steun was het  voor mij niet mogelijk 

geweest om te promoveren. Er zullen ongetwijfeld moment zijn geweest waarop jij je hebt 

afgevraagd waar  je aan begonnen bent door voor mij naar Groningen te verhuizen en of 

dit het allemaal wel waard is. Ik denk dat we inmiddels zeker weten dat het dat absoluut 

was en  ik ben  je erg dankbaar dat  je deze stap hebt genomen voor mij.  Ik kijk met veel 

vertrouwen en plezier uit naar de toekomst samen met jou. 

 

Loes 

Groningen, januari 2015 

 

 

 

 

 

 

 217 

Curriculum Vitae 

The author of this thesis was born in Oldenzaal, the Netherlands, on the 4th of September 

1986. After  finishing her pre‐university education  (Twents Carmel Lyceum, Oldenzaal)  in 

2004, she studied Pharmacy at the University of Groningen. During her studies she was a 

student assistant for the pharmacological practical course for year 3 pharmacy students at 

the University of Groningen. She obtained her BSc degree  in 2007 and her MSc degree 

(PharmD)  in 2010  (cum  laude). Her master  thesis on  the effects of bradykinin and cyclic 

AMP on  interleukin‐8 production  in human airway  smooth muscle cells, and  the  role of 

Epac  and  PKA  hereon, was  completed  at  the  Department  of Molecular  Pharmacology, 

University of Groningen. After her  graduation,  she  initiated her PhD‐study  at  the  same 

department, where  she worked on  a  research project  funded by  the Netherlands  Lung 

Foundation  (grant: 3.2.08.014) on  the  role of acetylcholine  in  chronic  inflammation and 

remodeling of the airways, the results of which are presented in this thesis. 

 

 

 

 219 

List of publications 

Full papers 

LEM Kistemaker, DJ Slebos, H Meurs, HAM Kerstjens, R Gosens. Anti‐inflammatory effects 

of targeted lung denervation in patients with COPD. Submitted to Thorax, 2015. 

LEM  Kistemaker,  PS Hiemstra,  S  Bouwman, M  van  den Berge, MN Hylkema, H Meurs, 

HAM Kerstjens, R Gosens. Tiotropium attenuates  IL‐13‐induced goblet cell metaplasia of 

human airway epithelial cells. Thorax, 2015: In Revision. 

LEM  Kistemaker,  R  Gosens.  Acetylcholine  beyond  bronchoconstriction:  roles  in 

inflammation and remodeling. Trends Pharmacol Sci, 2014: Epub. 

LEM  Kistemaker,  R  van Os,  A  Ausema,  IST  Bos, MN  Hylkema,  PS  Hiemstra,  J Wess,  H 

Meurs,  HAM  Kerstjens,  R Gosens. Muscarinic M3  receptors  on  structural  cells  regulate 

neutrophilic inflammation in mice. Am J Physiol Lung Cell Mol Physiol, 2014: 308(1); L96‐

L103. 

PB Noble, CD Pascoe, B Lan, S Ito, LEM Kistemaker, AL Tatler, T Pera, BS Brook, R Gosens, 

AR West. Airway smooth muscle in asthma: linking contraction and mechanotransduction 

to  disease  pathogenesis  and  remodelling.  Pulmonary  Pharmacology  and  Therapeutics, 

2014: 29(2); 96‐107. 

LEM Kistemaker, IST Bos, WM Mudde, MN Hylkema, PS Hiemstra, J Wess, H Meurs, HAM 

Kerstjens,  R  Gosens.  Muscarinic  M₃  receptors  contribute  to  allergen‐induced  airway remodeling in mice. Am J Respir Cell Mol Biol, 2014: 50(4); 690‐8. 

H Meurs,  TA  Oenema,  LEM  Kistemaker,  R  Gosens.  A  new  perspective  on  muscarinic 

receptor antagonism  in obstructive airways diseases. Curr Opin Pharmacol, 2013: 13(3); 

316‐23. 

LEM Kistemaker,  IST Bos, MN Hylkema, MC Nawijn, PS Hiemstra, J Wess, H Meurs, HAM 

Kerstjens,  R  Gosens. Muscarinic  receptor  subtype‐specific  effects  on  cigarette  smoke‐

induced inflammation in mice. Eur Respir J, 2013: 42(6); 1677‐88.  

LEM Kistemaker, TA Oenema, H Meurs, R Gosens. Regulation of airway inflammation and 

remodeling  by muscarinic  receptors:  perspectives  on  anticholinergic  therapy  in  asthma 

and COPD. Life Sci, 2012: 91(21‐22); 1126‐33. 

 

220 

SS Roscioni, LEM Kistemaker, MH Menzen, CRS Elzinga, R Gosens, AJ Halayko, H Meurs, M 

Schmidt.  PKA  and  Epac  cooperate  to  augment  bradykinin‐induced  interleukin‐8  release 

from human airway smooth muscle cells. Respir Res, 2009: 10; 88‐105. 

 

Published abstracts   

LEM Kistemaker, DJ Slebos, H Meurs, HAM Kerstjens, R Gosens. Anti‐inflammatory effects 

of  targeted  lung  denervation  in  patients with  COPD.  Eur  Respir  J,  2014:  44;  Suppl.  58: 

P3333.

LEM  Kistemaker,  R  van Os,  A  Ausema,  IST  Bos, MN  Hylkema,  PS  Hiemstra,  J Wess,  H 

Meurs,  HAM  Kerstjens,  R Gosens. Muscarinic M3  receptors  on  structural  cells  regulate 

neutrophilic inflammation in mice. Eur Respir J, 2014: 44; Suppl. 58: P869.

LEM  Kistemaker,  PS Hiemstra,  TCJ Mertens, MN Hylkema, H Meurs, HAM  Kerstjens,  R 

Gosens. Effects Of Tiotropium On Il‐13‐Induced Differentiation Of Human Airway Epithelial 

Cells. Am J Respir Crit Care Med, 2014: 189; A2050. 

LEM Kistemaker, IST Bos, MN Hylkema, PS Hiemstra, J Wess, H Meurs, HAM Kerstjens, R 

Gosens.  The  muscarinic  M3  receptor  regulates  allergen‐induced  airway  remodeling  in 

mice. Eur Respir J, 2013: 42; Suppl. 57: P875. 

LEM Kistemaker, IST Bos, MN Hylkema, PS Hiemstra, J Wess, H Meurs, HAM Kerstjens, R 

Gosens. Allergen Induced Remodeling Requires The Muscarinic M3 Receptor In Mice. Am J 

Respir Crit Care Med, 2013: 187; A5267. 

LEM Kistemaker,  IST Bos, H Meurs, MN Hylkema, MC Nawijn, PS Hiemstra, J Wess, HAM 

Kerstjens,  R.  Gosens.  Cigarette  Smoke  Induced  Inflammation  And  Remodeling  In 

Muscarinic  Receptor  Subtype  Deficient  Mice.  Am  J  Respir  Crit  Care Med,  2012:  185; 

A1306. 

SS  Roscioni,  LEM  Kistemaker,  CRS  Elzinga,  R  Gosens,  M  Schmidt.  NAUNYN‐

SCHMIEDEBERGS ARCHIVES OF PHARMACOLOGY, 2009: 380; 3: 270‐271.  

SS Roscioni, LEM Kistemaker, MH Menzen, CRS Elzinga, R Gosens, AJ Halayko, H Meurs, M 

Schmidt. A Role  for Epac and PKA  in GPCR−Mediated  IL−8 Release  from Airway Smooth 

Muscle Cells. Am J Respir Crit Care Med, 2009: 179; A3899.