Tumoricidal Effects of Macrophage-Activating Immunotherapy in … · Tumoricidal Effects of Macrophage-Activating Immunotherapy in a Murine Model of Relapsed/Refractory Multiple Myeloma

$Page 1: Tumoricidal Effects of Macrophage-Activating Immunotherapy in … · Tumoricidal Effects of Macrophage-Activating Immunotherapy in a Murine Model of Relapsed/Refractory Multiple Myeloma$
Research Article

Tumoricidal Effects of Macrophage-ActivatingImmunotherapy in a Murine Model ofRelapsed/Refractory Multiple MyelomaJeffrey Lee Jensen1,2, Alexander Rakhmilevich2,3, Erika Heninger1,2, Aimee Teo Broman4,Chelsea Hope1,2, Funita Phan2,5, Shigeki Miyamoto2,5, Ioanna Maroulakou6,Natalie Callander1,2, Peiman Hematti1,2, Marta Chesi7, P. Leif Bergsagel7, Paul Sondel2,3,8,and Fotis Asimakopoulos1,2

Abstract

Myeloma remains a virtually incurable malignancy. The inev-itable evolution of multidrug-resistant clones and widespreadclonal heterogeneity limit the potential of traditional and noveltherapies to eliminateminimal residual disease (MRD), a reliableharbinger of relapse. Here, we show potent anti-myeloma acti-vity of macrophage-activating immunotherapy (aCD40þCpG)that resulted in prolongation of progression-free survival (PFS)and overall survival (OS) in an immunocompetent, preclinical-ly validated, transplant-based model of multidrug-resistant,relapsed/refractory myeloma (t-Vk�MYC). aCD40þCpG waseffective in vivo in the absence of cytolytic natural killer, T, or Bcells and resulted in expansion ofM1-polarized (cytolytic/tumor-icidal)macrophages in the bonemarrow.Moreover, we show that

concurrent loss/inhibition of Tpl2 kinase (Cot, Map3k8), aMAP3K that is recruited to activated CD40 complex and regulatesmacrophage activation/cytokine production, potentiated direct,ex vivo anti-myeloma tumoricidal activity of aCD40þCpG–acti-vated macrophages, promoted production of antitumor cytokineIL12 in vitro and in vivo, and synergized with aCD40þCpG tofurther prolong PFS and OS in vivo. Our results support thecombination of aCD40-based macrophage activation and TPL2inhibition for myeloma immunotherapy. We propose thataCD40-mediated activation of innate antitumor immunity maybe a promising approach to control/eradicate MRD followingcytoreduction with traditional or novel anti-myeloma therapies.Cancer Immunol Res; 3(8); 881–90. �2015 AACR.

IntroductionDespite the advent of novel therapies for multiple myeloma, a

cancer of mature lymphocytes that produce antibody, the diseaseremains incurable. Only one in three patients diagnosed withmyeloma will be alive 10 years after the diagnosis (1). Lack ofcurative approaches is attributable to early and near-universalclonal heterogeneity (2, 3), and the persistence of minimalresidual disease (MRD) following traditional and novel therapies,including high-dose therapy with autologous stem cell rescue.Recent evidence has confirmed that detectable MRD constitutes a

harbinger for relapse and predicts adverse clinical outcomes(4, 5). Thus, eradication of MRD is a priority in designing curativeapproaches against myeloma.

We have proposed that therapeutic manipulation of themicroenvironment may be an essential component of curativeinterventions in myeloma (6). Proof-of-principle for this con-cept is provided by the fact that the only known potentiallycurative therapy for myeloma, allogeneic transplantation,exerts its effects through modulation of the microenvironmentto produce a graft-versus-myeloma effect, albeit at the cost ofconsiderable toxicity (7). Therefore, strategies to render themicroenvironment inhospitable or overtly hostile to myelomacells are urgently needed.

Macrophages are a crucial, and somewhat neglected, compo-nent of the myeloma niche. We have previously shown thatmyeloma-associated monocytes/macrophages (MAM) are keymodulators of the inflammatory milieu of the myeloma nicheand important producers of cytokines that are known to promotegrowth of nascent myeloma tumors (8). MAM continue to pro-duce inflammatory cytokines (IL1b, IL6, and TNFa) even as theyacquire tumor-promoting ("M2") characteristics. This "mixed" or"intermediate" state of macrophage polarization in vivo is similarto previously described "M2b macrophages" or "MSC-educatedmacrophages" (9–11).

We and others have shown that therapeutic macrophagerepolarization (toward an M1-tumoricidal phenotype) usingCD40 ligation can be harnessed to exert antitumor activity invivo (12–21). Therapeutic activation of macrophages typicallyrequires two sequential signals, a "priming signal" delivered

1Department of Medicine, Division of Hematology/Oncology, Univer-sity of Wisconsin-Madison School of Medicine and Public Health,Madison,Wisconsin. 2University ofWisconsin Carbone Cancer Center,Madison,Wisconsin. 3Department of Human Oncology, University ofWisconsin-Madison, Madison, Wisconsin. 4Department of Biostatis-tics and Medical Informatics, University of Wisconsin-Madison, Madi-son, Wisconsin. 5Department of Oncology, University of Wisconsin-Madison, Madison,Wisconsin. 6Department of Molecular Biology andGenetics, Democritus University of Thrace, Alexandroupolis, Greece.7Mayo Clinic-Scottsdale, Scottsdale, Arizona. 8Department of Pediat-rics, University of Wisconsin-Madison School of Medicine and PublicHealth, Madison,Wisconsin.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

Corresponding Author: Fotis Asimakopoulos, University of Wisconsin Schoolof Medicine and Public Health, 1111 Highland Avenue, Madison, WI 53705. Phone:1-608-265-4835; Fax: 1-608-262-4598; E-mail: [email protected]

doi: 10.1158/2326-6066.CIR-15-0025-T

�2015 American Association for Cancer Research.

CancerImmunologyResearch

www.aacrjournals.org 881

on July 15, 2020. © 2015 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Published OnlineFirst May 4, 2015; DOI: 10.1158/2326-6066.CIR-15-0025-T

http://cancerimmunolres.aacrjournals.org/

through agonistic CD40 stimulation and a secondary "trigger-ing signal" delivered through Toll-like receptor (TLR) stimula-tion. The resultant tumoricidal activity has been shown to beindependent of T cells and has shown promise even in verydifficult cancers: Thus, clinical administration of aCD40 ago-nist monoclonal antibody, without TLR activation, has dem-onstrated clinical benefit in patients with pancreatic cancer,acting through macrophage activation (21). Macrophages areparticularly attractive as anti-myeloma effectors because oftheir association with myeloma lesions outside the bone mar-row (22) where active MRD may localize.

We have demonstrated a role for control of macrophagepolarization and cytokine production by TPL2, a MAP3K oper-ating at the interface between NFkB and MAPK pathways(8, 23). Moreover, we have attributed roles for Tpl2 in mye-loma progression in vivo and have shown that Tpl2 activitypromotes macrophage polarization toward pro-tumor (M2)phenotype. Tpl2 is activated by stimuli that activate macro-phages (such as TLR ligands and CD40; ref. 24), but its actionslimit the production of crucial antitumor effectors (such asnitric oxide; ref. 25) or antitumor immunomodulatory cyto-kines [such as IL12 (ref. 26) and IFNb (ref. 27)]. At the sametime Tpl2 promotes promyeloma immunomodulatory cyto-kines IL1b, IL6, and IL10 (8). Tpl2 signaling could, therefore, beenvisaged as an "innate immune checkpoint" that modulatesinnate anti-myeloma immunity.

In this article, we show that aCD40-mediated macrophagerepolarization results in potent anti-myeloma activity both exvivo and in vivo. Host Tpl2 loss promoted production of IL12, anM1-polarization agent and a powerful antitumor cytokine (28)and prolonged survival. Our results may open new avenues forcontrolling myeloma relapse by harnessing the power of innateantitumor immunity.

Materials and MethodsAntibodies and reagents

The FGK45.5 hybridoma–producing aCD40 was a gift fromDr. F. Melchers (Basel Institute for Immunology, Switzerland).The endotoxin content of our FGK45.5 preparation was directlyquantified using the E-Toxate Kit (Sigma) and was found to bebelow detection limit [0.05–0.1 endotoxin units (EU) per mL].We have previously reported that FGK45.5-activated macro-phages harvested from endotoxin-resistant C3H/HeJ miceretained potent ex vivo antitumor activity, suggesting that macro-phage activation was not the result of inadvertent endotoxincontamination of aCD40 antibody (20). Endotoxin-freeCpG1826 (TCCATGACGTTCCTGACGTT) was purchased fromColey Pharmaceuticals Group. Monophosphoryl Lipid A (MPL),L-NG-nitroarginine methyl ester (L-NAME; final concentration,5 mmol/L), and rat IgG were purchased from Sigma. Pan-caspaseinhibitor carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoro-methylketone (Z-VAD-FMK; final concentration, 20 mmol/L) waspurchased from Promega.

Ex vivo macrophage cytotoxicity assaysMice received 0.5mgaCD40 FGK45.5 or rat IgG (Sigma, I4131)

i.p. and 3 days later peritoneal exudate cells (PEC) were obtainedby peritoneal elution. Red blood cell lysis was performed by rapidexposure to deionizedwater. PECswere seededonto 96-well platesand allowed to adhere for 90 minutes. MM1.S-mCherry/Luccells and 5 mg/mL of CpG or MPL were subsequently added toadherent PECs. MM1.S-mCherry/Luc cells were a generous giftfrom Dr. Constantine Mitsiades (Dana-Farber Cancer Institute,Boston, MA). Tumor cell viability in PEC/tumor cell co-cultureswas assessed after 48 hours by adding sterile-filtered luciferin(Promega; P1043) diluted in RPMI complete media to a finalconcentration of 250 mg/mL, incubating the co-culture at 37�C 5%CO2 for 30 minutes, and then measuring luminescence using aBioTek Synergy4 plate reader. Supernatant nitrite levels weremeasured using a Griess Reagent-based colorimetric assay (Sigma,G4410). Cytokine levels weremeasured using the bead-based Bio-Plex System (Bio-Rad). Transwell experiments were performedusing inserts with 3.0-mm diameter pores, a polycarbonate con-struction, and a separation distance of 0.127 cm between thebottom of the insert and the top of the plate (Corning; 3385).

In vivo tumor modelVk12598 tumor cells were described previously (29). Tumor

cells were injected via intracardiac injection at a dose of 3� 105

CD138þ cells per recipient mouse, without irradiation (day 0).Mice were treated with intraperitoneal, saline-dissolved injec-tions of 0.25 mg aCD40 or rat IgG on day 5, and 25 mg CpG orPBS on day 8 post-injection, repeated every 2 weeks. Tumorburden was assessed using serum obtained after clotting 20 mLof blood obtained from tail grazes. Sera were analyzed formonoclonal gammopathy using a Sebia Hydrasys/Gelscansystem. M-spike band/total protein ratio was multiplied bythe total protein content of the serum, as determined usingBradford reagent, yielding absolute quantification of mono-clonal gammopathy. Mice were bled and analyzed weeklystarting at day 17. Mice that never showed any gammopathy(potential lack of engraftment) were excluded from analyses.Treatment with aCD40þCpG did not affect the engraftmentrate (�85%).

Statistical analysisAll in vitro experiments were performed in triplicate and

statistical significance between groups in a single experimentwas assessed using the two-tailed Student t test. ANOVA meth-ods were used to test differences between groups across mul-tiple independent experiments. For in vivo experiments, pro-gression-free survival (PFS) was defined by a monoclonalgammopathy <0.5 g/dL. Time to progression was determinedby linearly interpolating between the two measured gammo-pathy time points above and below 0.5 g/dL. Kaplan–Meiersurvival curves were analyzed using the log-rank test and usinga Cox proportional hazards model for estimating the interac-tion between aCD40þCpG and Tpl2 status.

Table 1. Log-rank test comparing survival curves in Fig. 4

Kaplan–Meier curve comparisons OS PFS

Tpl2þ/þ Rat IgGþPBS vs. Tpl2�/� Rat IgGþPBS P ¼ 0.432 P ¼ 0.548Tpl2þ/þ Rat IgGþPBS vs. Tpl2þ/þ aCD40þCpG P ¼ 7.12 � 10�6 P ¼ 7.81 � 10�7

Tpl2þ/þ aCD40þCpG vs. Tpl2�/� aCD40þCpG P ¼ 0.0169 P ¼ 0.00870

Abbreviations: OS, overall survival; PFS, progression-free survival.

Jensen et al.

Cancer Immunol Res; 3(8) August 2015 Cancer Immunology Research882




ResultsMacrophages can be activated to exert tumoricidal activityagainst myeloma cells ex vivo

To confirm that macrophages possess intrinsic anti-myelomaactivity, we collected PECs 3 days after in vivo priming withaCD40 or control rat IgG antibody. We confirmed that adherentPECs represent peritoneal-origin macrophages: CD115 expres-sion was used to confirm their monocytic identity—more than95% of adherent PECs expressed CD115 (data not shown). PECswere seeded in 96-well plates to which luminescent myelomaMM1.S cells (MM1.S-mCherry/Luc) were subsequently added atvarious ratios of PECs to target cells (effector:target, E:T ratio)(30). TLR agonists or PBS were added to the in vitro co-cultures, asdescribed in Materials and Methods. Emitted bioluminescenceexhibited an almost perfectly linear correlation to the absolutenumber ofmyeloma tumor cells in eachwell whenmyeloma cellswere cultured in isolation or in co-cultures with nonluminescentPECs (r2 ¼ 0.99, Fig. 1A).

Addition of TLR agonists CpG (TLR9) or MPL (TLR4) tomyeloma cell mono-cultures did not result in appreciabletoxicity (Fig. 1B). By contrast, tumoricidal effects of activatedPECs were observed in PEC–myeloma cell co-cultures. TLRstimulation alone, in the absence of prior aCD40 stimulation,was only effective at higher E:T ratios, particularly with thepotent TLR4 agonist MPL (Fig. 1B). Prior stimulation of PECswith aCD40 significantly enhanced the tumoricidal activity ofPECs, at lower E:T ratios, in the presence of either CpG or MPL.The most potent antitumor cytotoxicity was obtained byaCD40-primed macrophages that were stimulated with MPL.However, CpG stimulation also produced significant antitumorcytotoxic effects in a dose-dependent manner (Fig. 1B). Mye-loma cell demise was associated with apoptosis induction.Macrophage-mediated cytotoxicity was abrogated in the pres-ence of the pan-caspase inhibitor Z-VAD-FMK (SupplementaryFig. S1A) and Annexin V/propidium iodide (PI) staining cor-roborated apoptotic mechanisms (Supplementary Fig. S1B).

The observed cytotoxic effects of different combinations ofstimuli correlatedwith the degree of nitric oxide (NO) productionby activated macrophages. Thus, the most potent tumoricidalcombination (aCD40 and MPL at 20:1 E:T ratio) also resulted inthe most enhanced NO production (Fig. 1B). To determinewhether NO was necessary for the observed antitumor activitiesby PECs, we blocked NO production with L-NAME, a pan-NOsynthase inhibitor. Treatment with L-NAME resulted in attenua-tion of NO production in conjunction with attenuation of anti-tumor cytotoxic effects (Fig. 1C). We conclude that activatedmacrophages can exert cytotoxic effects against myeloma cells exvivo that are partially NO dependent.

Prior reports have suggested a role for cell-to-cell contact inmediating protective effects of macrophages toward myelomacells (31). Moreover, direct phagocytosis of myeloma cells by

Figure 1.Ex vivo tumoricidal activity of activated macrophages against myeloma cells.A, linear correlation between detectable luminescence and numberof viable myeloma MM1.S-mCherry/Luc cells, both in myeloma cell mono-cultures and in co-cultures with nonluminescent peritoneal macrophages(PEC). B, top, potent anti-myeloma tumoricidal effects of activated PECs.PECswere either preactivated following in vivo administration of an agonisticaCD40 antibody 3 days before collection or following control IgGadministration (IgG). Following collection, PECs were plated withluminescent (MM1.S-mCherry/Luc) myeloma cells at various effector:target(E:T) ratios. TLR agonists CpG orMPL (or PBS, as a control) were added to co-cultures. Control myeloma cell mono-cultures (no M�) are shown to the left.Dashed line shows the number of MM1.S-mCherry/Luc cells at start of culture.B, bottom, nitrite, a byproduct of NO processing, was measured in eachcondition as a surrogate of NO production. C, left, the pan-NO synthaseinhibitor, L-NAME, partially reversed macrophage-mediated cytotoxicity ateach condition tested. Right, L-NAME effectively reduced NO production ateach condition tested. D, top, physical separation between PECs and target(myeloma) cells resulted in partial abrogation of the tumoricidal effect. Left,standard co-cultures between PECs andmyeloma cells at E:T¼ 20:1 (contact

occurs between PECs and myeloma cells). Right, physical separation by aTranswell separator, keeping PECs separated frommyeloma cells, resulted inpartial abrogation of anti-myeloma tumoricidal effects. Dashed line shows thenumber of MM1.S-mCherry/Luc cells at start of culture. D, bottom, nitriteproduction by standard (left) and transwell-separated co-cultures werecomparable at each condition tested. Statistical significance was determinedusing the Student t test and is denoted as follows: ns, not statisticallysignificant; � , P < 0.05; �� , P < 0.01; ��, P < 0.001.

Macrophage-Activating Immunotherapy in Myeloma

www.aacrjournals.org Cancer Immunol Res; 3(8) August 2015 883




macrophages has also been shown (32). We tested the hypothesisthat cell–cell contact or juxtacrine interactions may be necessaryfor the observed antitumor effects of activated macrophages. Totest this hypothesis we repeated the experiments shown in Fig. 1Bwith the addition of a Transwell separator that prevents contactbetween PECs andmyeloma cells. As shown in Fig. 1D, separationof PECs from myeloma cells attenuated the antitumor effect.These results demonstrate that activated macrophages exertanti-myeloma activity through direct cell–cell contact or alterna-tively/additionally, through juxtacrine interactions.

Tpl2 loss enhances tumoricidal activity of activatedmacrophages ex vivo

Because Tpl2 loss promotes spontaneous macrophage repolar-ization in themyelomamicroenvironment in vivo (8), we hypoth-esized that Tpl2 loss/inhibition might synergize with therapeuticmacrophage repolarization to enhance myeloma cell killing byactivated macrophages. Initially, we tested this hypothesis in theex vivo cytotoxicity assay described above. We compared therelative cytotoxic activity of Tpl2þ/þ PECs with Tpl2�/� PECs. As

shown in Fig. 2A, Tpl2�/� macrophages exhibited enhancedcytotoxicity compared with Tpl2þ/þ macrophages at each condi-tion tested. Both TLR4 stimulation (MPL) and TLR9 stimulation(CpG) enhanced cytotoxicity by Tpl2�/� PECs relative to cyto-toxicity by Tpl2þ/þ PECs.

Tpl2 activity has been shown to repress transcription of induc-ible NO synthase (iNOS) following TLR stimulation in vitro (25).We found that Tpl2 loss also enhanced NO produced byaCD40þTLR–stimulated PECs (Fig. 2B). Moreover, NO levelsdirectly correlated with enhanced cytotoxicity exhibited byaCD40þTLR ligand-treated PECs (Fig. 2A and B).

We next tested the hypothesis that Tpl2 loss might enhanceproduction of antitumor cytokine IL12 by aCD40þTLR–stimu-lated macrophages. IL12 and IL10 have been considered markersof M1 and M2 macrophage polarization, respectively. Tpl2 sig-naling has been shown to exert repressive effects on IL12 tran-scription following TLR9 stimulation in vitro (26), but the impactof this observation on antitumor immunity has been unclear. Wefound that TLR9 (CpG) but not TLR4 (MPL) stimulation led toincreased IL12p40 production by aCD40-activated macrophages

Figure 2.Tpl2 loss enhances anti-myelomatumoricidal effects of aCD40-activated macrophages ex vivo.A, ex vivo tumoricidal activities werecompared between wild-type(Tpl2þ/þ) and Tpl2-null (Tpl2�/�)PECs in experiments analogous tothose delineated in Fig. 1. Tpl2 lossenhances the tumoricidal effects ofactivated macrophages at eachcondition tested. Dashed line showsthe number of MM1.S-mCherry/Luccells at start of culture. B, Tpl2�/�

PECs produce quantitatively highernitrite amounts than Tpl2þ/þ PECs ateach condition tested. C, top, TLR9(CpG), but not TLR4 (MPL),stimulation promotes IL12p40production by aCD40-activated PECsin vitro. Tpl2 loss enhances IL12p40production by TLR9, but not by TLR4-stimulated PECs. C, bottom, Tpl2status does not influence IL10production following TLR9 or TLR4stimulation of aCD40-activated PECsin vitro. Note, for all conditions shownin A–C, cultures testing media, CpGand MPL were set up in parallel, anddata for all three are shownthroughout all subfigures; if specificbars are not apparent, it is because thevalues determined (with the SD) forthat particular in vitro condition wereso close to the y-axis as to not bereadily seen at the scale plotted.Statistical significance wasdetermined using the Student t testand is denoted as follows: ns,not statistically significant; � , P < 0.05;��, P < 0.01; ��, P < 0.001.

Jensen et al.





that exert anti-myeloma activity ex vivo (Fig. 2C). Whereas Tpl2loss enhanced IL12p40 in both macrophage mono-cultures andmacrophage–myeloma cell co-cultures, no IL12p40 productionwas found in myeloma cell mono-cultures. IL10 production wasnot affected by Tpl2 genotype (Fig. 2C).

Tumoricidal effects of aCD40þCpG-activated macrophagesrequire intact Nfkb1 activity

Tpl2 associates with Nfkb1 (p105), a core component of theNFkB canonical signaling pathway (33). p105 is the precursor ofthe active NFkB subunit p50. Tpl2 kinase activity is repressedwhen Tpl2 is bound to p105. Signals that activate the canonicalNFkB pathway lead to p105 degradation, and thus to Tpl2 releaseand activation. Because Tpl2 is only stable in association withp105,Nfkb1-null animals are also functionally Tpl2-null (Fig. 3A).

We askedwhether both components of the p105/Tpl2 complexmodulate therapeutic macrophage activation. To this end, weusedNfkb1-null (p105/p50-null)macrophages in our in vitro anti-myeloma assay. We found that macrophage-mediated tumorici-dal activity was impaired by the loss/deletion of Nfkb1, particu-larly when TLR9 (CpG) costimulation was used (Fig. 3B). Con-currently, with attenuation of tumoricidal activity, NO produc-

tion (Fig. 3C) as well as IL12 and IL10 production (Fig. 3D) werereduced in aCD40þCpG–stimulated Nfkb1�/� PECs.

Our results show that Nfkb1 (p105/p50) is involved inthe activation of macrophages in response to aCD40þCpGstimulation. Because Tpl2 loss enhances antitumor potentialonly in the presence of functional Nfkb1, we conclude thatp105/p50 acts upstream of Tpl2 in macrophages that respondto aCD40þCpG. In other words, Tpl2 modulates the effectsof p105/p50-mediated signaling in aCD40þCpG–activatedmacrophages.

Therapeutic macrophage activation results in prolongedsurvival in a model of drug-resistant, relapsed/refractorymyeloma

We hypothesized that therapeutic macrophage activationmay exert antitumor effects in "minimal disease" states inmyeloma. To model the growth and progression of MRD inan immunocompetent host, we used a transplant-based modelin which a threshold inoculum of tumor cells was delivered5 days before beginning of treatment. Engraftment and pro-gression of t-Vk�MYC (Vk12598), a model for relapsed/refrac-tory myeloma (29), recapitulates high-risk, drug-resistant

Figure 3.Nfkb1 (p105/p50), a stabilizing bindingpartner of Tpl2, is involved in the ex vivoanti-myeloma tumoricidal activity ofactivated macrophages. A, Westernblots of splenocyte lysates fromdifferentgenotypes are shown. In steady-stateconditions, Tpl2 exists in a stablecomplex with Nfkb1 (p105). Tpl2 isunstable in the absence of p105. Tpl2�/�

macrophages contain normal amountsof p105 and its active cleavage product,p50. By contrast,Nfkb1�/�macrophagesare functional Tpl2-null. B, Nfkb1 losspartially abrogates ex vivo anti-myelomatumoricidal effects of aCD40þTLR-activated macrophages, particularlywhen CpG is used. Dashed line shows thenumber of MM1.S-mCherry/Luc cells atstart of culture. C, Nfkb1 loss partiallyabrogates NO production byaCD40þTLR-activated macrophages,particularly when CpG is used. D, Nfkb1loss reduces IL12 and IL10 production byaCD40þCpG-activated macrophagesex vivo. Note, for all conditions shown inA–D, cultures testing media, CpG andMPL were set up in parallel, and data forall three are shown throughout allsubfigures; if specific bars are notapparent, it is because the valuesdetermined (with the SD) for thatparticular in vitro conditionwere so closeto the y-axis as to not be readily seen atthe scale plotted. Statistical significancewas determined using the Student t testand is denoted as follows: ns, notstatistically significant; � , P < 0.05;�� , P < 0.01; �� , P < 0.001.






myeloma growth. Injection of Vk12598 cells through theintracardiac route into immunocompetent syngeneic C57BL/6Jrecipients, without preconditioning irradiation, results in uni-versal death in engrafted animals (median, 32 days, 95%confidence interval, 30–37) from progressive myeloma (Fig.4A). The rapid clinical course allowed overall survival (OS) tobe determined as a study endpoint. Moreover, the multidrug-resistant profile of Vk12598 (29) offers an ideal vehicle to testthe concept that therapeutic macrophage activation can inhibitdrug-resistant, proliferative myeloma.

Treatment of animals with aCD40þCpGwas initiated 5 daysafter intracardiac injection to avoid any confounding effects oftreatment on tumor-cell engraftment rate. As shown in Fig. 4A,treatment of animals with aCD40þCpG resulted in significantprolongation of OS that was further enhanced in Tpl2-nullrecipients. Figure 4B shows a significant positive effect oftreatment on prolongation of PFS (progression defined as M-spike >0.5 g/dL), which was further enhanced by recipient Tpl2loss. Log-rank statistical significance values are given in Table 1.Cox proportional hazard analysis (as detailed in the Supple-mentary Data) estimated that, among aCD40þCpG-treatedanimals, wild-type genotype conferred a relative risk of 2.21

for death (P ¼ 0.02) and 2.22 for progression (P ¼ 0.02),compared with that of the Tpl2-null genotype (SupplementaryTables S1 and S2).

We hypothesized that the improvement in PFS and OSconferred by recipient Tpl2 loss may be related to enhancedIL12 production in vivo. To test this hypothesis, we measur-ed serum levels of IL12p40 at 4 hours and 24 hours followingadministration of aCD40þCpG in tumor-bearing mice.We found that administration of aCD40þCpG led to amodest increase in IL12p40 in Tpl2þ/þ animals. By contrast,Tpl2 loss led to sustained production of significantly higheramounts of IL12p40 that persisted 24 hours after treatment(Fig. 4C). IL10 levels did not differ significantly betweenTpl2þ/þ and Tpl2�/� treated animals (Fig. 4D). Consistentwith our hypothesis, treatment with aCD40þCpG did notsignificantly affect levels of pro-myeloma inflammatory cyto-kines IL1b and IL6 (Supplementary Fig. S2), demonstratingthat macrophage-activating immunotherapy did not leadto a surge of pro-myeloma inflammatory cytokines. More-over Vk12598 myeloma cells express low levels of CD40, afeature typical of human advanced myeloma (34; Supple-mentary Fig. S3).

Figure 4.In vivo tumoricidal effects of aCD40þCpG in a model of relapsed/refractory myeloma. A and B, t-Vk�MYC (Vk12598) cells were injected at day 0 into Tpl2þ/þ orTpl2�/� recipients. Treatment with aCD40þCpG or vehicle was initiated at day 5 according to the treatment schedule delineated in Materials and Methods.In the absence of treatment, animals succumbed rapidly to progressivemyeloma, irrespective of Tpl2 status.aCD40þCpG treatment significantly prolonged PFS (B)and OS (A). Recipient Tpl2 loss led to further prolongation in PFS and OS. PFS is defined as time to M-spike greater than 0.5 g/dL. The log-rank test Pvalues for comparisons of survival curves are listed in Table 1. C, recipient Tpl2 loss leads to sustained high levels of serum IL12p40 following aCD40þCpG in vivo.Serum was collected at either 4 hours (left) or 24 hours (right) after CpG injection. D, recipient Tpl2 loss has no effects on serum concentrations of IL10following aCD40þCpG treatment in vivo. Serumwas collected at either 4 hours (left) or 24 hours (right) after CpG injection. For C and D, statistical significance wasdetermined using ANOVA analysis on logarithmically transformed values obtained from multiple independent experiments and is denoted as follows: ns, notstatistically significant; � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001.

Jensen et al.





In vivo activity ofaCD40þCpG is independent of cytolyticNKorT-cell activity

Although we have shown that macrophages can exert anti-myeloma activity ex vivo following aCD40þTLR stimulation, weaskedwhetheraCD40þCpG acts primarily throughmacrophagesin vivo. To this end, we transplanted Vk12598 cells into SCID/Beige animals, characterized by defective NK-cell cytolytic activityand absence of mature T or B cells, the latter due to the SCIDmutation (35). Vk12598 cells were injected on day 0 and treat-mentwas administered as per the schedule delineated inMaterialsand Methods. Tumor burden was assessed by serum proteinelectrophoresis and quantification of M-spike on days 24 and31 and compared with wild-type C57BL/6J immunocompetentrecipients.

The results are shown in Fig. 5. aCD40þCpG treatment was atleast partially effective in the absence of cytolytic NK, T, and B cellsin SCID/Beige animals. The degree of delay in monoclonal gam-mopathy (myeloma tumor burden) between aCD40þCpG-trea-

ted SCID/Beige and C57BL/6J recipients was comparable at eachtimepoint tested. These data are consistent with the hypothesisthat the anti-myeloma effects of aCD40þCpG treatment in vivoare mediated, in a large part, through macrophages.

aCD40þCpG leads to expansionofM1-polarized bonemarrowmacrophages in vivo

aCD40þCpG and aCD40þMPL mediate macrophage repo-larization and macrophage-mediated anti-myeloma cell toxicityex vivo (Fig. 1). Moreover, in vivo anti-myeloma effects ofaCD40þCpG are detected in the absence of cytolytic NK, T, orB cells (Fig. 5), strongly supporting a central role formacrophagesin mediating the in vivo anti-myeloma effects of aCD40-basedimmunotherapy. We sought to directly determine whetheraCD40þCpG treatment actively leads to myeloma-associatedmacrophage repolarization in vivo. To this end, we compared thepolarization status of myeloma-associated macrophagesobtained from bone marrows of myeloma tumor-bearing micefollowing administration of control IgGþPBS or aCD40þCpG.

We have previously demonstrated that macrophages in de novoVk�MYC tumor-bearing animals partition into a CD68int/Ly6Cint

population that expresses iNOS and is consistent with M1-likemacrophages and a CD68hi/LyC6hi population that does notexpress iNOS and is consistent with M2-like macrophages (8).A similar immunophenotyping strategy was used for analysis ofmyeloid cell subpopulations in the present study with somemodifications: First, we eliminated F4/80 staining for the initialgating on the basis of a recent report favoring Ly6C and Ly6G inlieu of F4/80 for analysis of mouse splenic myeloid cell popula-tions (36). Second, we introduced IL4Ra (CD124) to bettercharacterize the M2-like subpopulation (37).

Treatment with aCD40þCpG led to expansion of theCD68int/Ly6Cint population expressing iNOS (M1-like)(Fig. 6). Figure 6 also shows the data from analysis of allanimals in the untreated and aCD40þCpG–treated cohorts intwo independent experiments. These results demonstrate thataCD40þCpG leads to expansion of the M1-like macrophagepopulation in myeloma-infiltrated bone marrow in vivo.

DiscussionThe incidence of multiple myeloma continues to rise, with an

estimated 24,050 new cases in 2014 in the United States (1). Itsprecursor form, monoclonal gammopathy of undetermined sig-nificance (MGUS), is the most common hematologic disorderwith a prevalence of 4% in the general population over the age of40 years. Despite the advent of novel therapies that have revolu-tionized the treatment landscape, most patients diagnosed withmyeloma will die of their disease. Novel therapies and stem-celltransplantation confer excellent cytoreduction and may prolongsurvival. Whereas current clinical research aims to define the roleof autologous transplant in the era of novel therapies, it is clearthat none of these approaches are routinely curative (38).

The lack of curative approaches in this disease reflects thepersistence of residual myeloma acting as a nidus for regrowthand clinical relapse. In recent years, quantification and character-ization of this MRD have received more attention (39). It is nowgenerally accepted that the detection of measurable MRD por-tends an ominous prognosis (4, 5).

Although there is growing appreciation for the correlationbetween MRD and clinical outcome, biologic characterization is

Figure 5.In vivo tumoricidal effects of aCD40þCpG are independent of cytolyticNK, T, or B cells. aCD40þCpG controls myeloma progression both A, inthe presence (wild-type immunocompetent recipients), and B, in the absenceof cytolytic NK, T, and B cells (SCID/Beige recipients). Levels of monoclonalgammopathy for days 24 and31 timepoints followingVk12598 inoculation areshown. C, treatment with aCD40þCpG prolongs OS in SCID/Beige recipientsinoculated with Vk12598 cells. For A and B, statistical significance wasdetermined using ANOVA analysis acrossmultiple independent experiments.The log-rank test was used to compare the survival curves in C.






still incomplete. Characterization of MRD is likely to be compli-cated by significant inter- and intrapatient heterogeneity. We haveenvisaged distinct types of MRD that may be further complicatedby overlapping mechanisms: First, MRD may reflect the persis-tence of cells that have acquired genetic or epigenetic attributes ofdrug resistance through a process of classical, linear clonal evo-lution. Second, MRD may represent "tides" involving subclonesthat have arisen through a process of "branching" evolution (40).Third, MRD may reflect the specific biologic attributes of clono-genic precursors of the disease. Although the nature of these"myeloma stem cells" is hotly debated, they are likely to berelatively resistant to the effects of therapy (41, 42). Alternatively,MRD may reflect the stochastic persistence of residual myelomacells with tumor-protective niches.

Activation of selected components of the tumor's microenvi-ronment to maximize efficacy and minimize toxicity may be anessential component of approaches aiming at eradication ofMRDand achievement of cures. Strategies to mobilize the microenvi-ronment against residual myeloma should work with little regardto the clonal composition of MRD. Among various componentsof innate immunity in the myeloma niche, our work has focusedonmonocytes/macrophages (6).Whereas the concepts governingpolarization and plasticity of macrophages in solid tumors havebeen well formulated (43, 44), the mechanisms governing mac-rophage behavior in hematologic malignancies are not as wellunderstood. Multiple myeloma, a malignancy in which tumorcells are critically dependent on cross-talk with diverse compo-nents of the bone marrow microenvironment, provides an excel-lentmodel to study interactions betweenmacrophages and tumorcells and evaluate the potential of their therapeutic exploitation.

We have previously shown that monocytes/macrophages pro-vide essential support to tumor cells in the nascent myelomalesion through the elaboration of critical promyeloma cytokinessuch as IL1b and IL6 (8). We have proposed that approaches tolimit production of these cytokines may be useful in controllingindolent myeloma. The Weissman laboratory has previouslyshown that macrophages may exist in a state of precarious equi-libriumwithmyeloma cells: Simple blockade onprotective "don't-eat-me" signals on the surface of the myeloma tumor cells sufficesto elicit potent anti-myeloma, macrophage-mediated cytotoxicity(32). Whereas blocking "don't-eat-me" signals constitutes a "pas-sive" approach in turning macrophages into anti-myeloma effec-tors, "active" methods to repolarize macrophages may hold evenbetter therapeutic promise. We have previously demonstrated thatactive repolarization of macrophages to elicit tumoricidal activitycan be achieved through the administration of sequential CD40-mediated activation and TLR ligation (12, 19). CD40-inducedmacrophage activation has been shown to result in meaningfulclinical tumor regressions in recalcitrant solid tumors (e.g., pan-creatic cancer; ref. 21) and in a model of chronic lymphocyticleukemia, a tumor of mature B lymphocytes (15).

In this study, we demonstrate that macrophages can beinduced to elicit potent anti-myeloma tumoricidal activity bothex vivo and in vivo. Activation of murine macrophages throughadministration of CD40 with sequential TLR activation in vitroled to dose-dependent cytotoxic activity against myeloma cells.Gene loss of the MAP3K, Tpl2, promoted the tumoricidalactivity of activated macrophages. The increased cytotoxicpotential of Tpl2-null macrophages correlated with higherproduction of tumoricidal effectors, such as NO. Importantly,

Figure 6.aCD40þCpG treatment promotes expansion of M1-like macrophages in t-Vk�MYC animals. A, representative flow cytometric plots of CD11bhi/Ly6Glo

–gatedbone marrow cells are shown from both control-treated and aCD40þCpG–treated, myeloma tumor-bearing animals. We have previously demonstrated that theCD68int/Ly6Cint population expresses iNOS (consistent with M1-like macrophages; ref. 10). By contrast, CD68hi/Ly6Chi cells express low levels of iNOS andhigh levels of CD124 (IL4Ra), consistent with an M2-like phenotype. aCD40þCpG treatment results in expansion of the CD68int/Ly6Cint population inmyeloma-bearingmice. B, proportion ofM1-like CD68int/Ly6Cint cells over total CD11bhi/Ly6Glo cells in individual animals, treatedwithaCD40þCpGorwith IgGþPBScontrol. For B, statistical significance was determined using ANOVA analysis across two independent experiments.

Jensen et al.





Tpl2 loss led to enhanced production of IL12, both in vitro andin vivo. IL12 is a powerful antitumor cytokine with pleiotropicantitumor effects, encompassing both innate and adaptiveantitumor immunity whose clinical utility has not yet beenfully harnessed (28). Therefore, Tpl2 loss not only promotedmacrophage-mediated tumor cell killing, but may have also ledto amplification of anti-myeloma response through additionaleffects on NK and T-cell–mediated antitumor immunity.

Therapeutic macrophage activation led to prolongation ofdisease PFS and OS in a model of relapsed/refractory myeloma,t-Vk�MYC (29, 45). We have demonstrated that the high prolif-erative rate, aggressive clinical course, and drug resistance of t-Vk�MYC accurately model end-stage, relapsed/refractory myelo-ma (29). The use of a drug-resistant t-Vk�MYCmodel allowed usto test the hypothesis that therapeuticmacrophage activationmaybe effective in controlling drug-resistant myeloma. This modelmay have important clinical implications given the paucity ofclinical approaches to treat drug-resistant, end-stage myeloma.

Weakly agonistic or antagonistic aCD40 antibodies have shownmodest clinical activity and an acceptable safety profile in multiplemyeloma (46, 47). In this article, we provide a rationale for stronglyagonistic aCD40 immunotherapy in myeloma. TPL2 inhibitioncould provide an ideal adjunct to strongly agonistic aCD40 immu-notherapy when the tumor cells express CD40. CD40-mediatedMAPK pathway activation is dependent upon TPL2 activity: B cellsfrom Tpl2�/� mice fail to activate ERK in response to CD40stimulation (48). Therefore, TPL2 inhibition may prevent a cell-autonomous growth-promoting effect of aCD40 on CD40-expres-sing myeloma cells, while also further activating aCD40-bearingmacrophages to elicit tumoricidal activity.

In summary, we propose that therapeutic macrophage repo-larization coupled with TPL2 inhibition may be a promisingapproach to control drug-resistant residual disease in myeloma.TPL2 inhibitors are in advanced pharmaceutical development(49). We have previously proposed single-agent TPL2 inhibitionas monotherapy to delay progression of indolent myelo-ma through interference with elaboration of pro-myeloma cyto-kines byMAM (8) and potentially other microenvironmental celltypes. Advanced myelomamay be less responsive to TPL2 mono-therapy because of acquisition of autocrine cytokine support and/or mutations in crucial signaling pathways, for example, NF-kBmutations, considered to be progression events (50). Therapeuticactivation of macrophages may be an effective means to controlprogression of relapsed/refractory myeloma relapse. Moreover,TPL2 inhibition offers an attractive adjunct to therapeutic mac-rophage activation in multiple myeloma.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConceptionanddesign: J.L. Jensen, I.Maroulakou, P. Sondel, F. AsimakopoulosDevelopment of methodology: J.L. Jensen, E. Heninger, P. Hematti, M. Chesi,F. AsimakopoulosAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J.L. Jensen, E. Heninger, C. Hope, I. Maroulakou,M. Chesi, P.L. Bergsagel, F. AsimakopoulosAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J.L. Jensen, A. Rakhmilevich, E. Heninger, A.T.Broman, F. AsimakopoulosWriting, review, and/or revision of the manuscript: J.L. Jensen, A. Rakhmile-vich, A.T. Broman, C. Hope, F. Phan, S.Miyamoto, I. Maroulakou, N. Callander,P. Hematti, P.L. Bergsagel, P. Sondel, F. AsimakopoulosAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): F. Phan, P. HemattiStudy supervision: F. AsimakopoulosOther (wrote the first draft of the article): J.L. JensenOther (design of experiments): A. RakhmilevichOther (provided support, feedback, and exchange of ideas through weeklygroup meetings): F. Phan

AcknowledgmentsThe authors thank the Emery Bresnick and Lixin Rui laboratories for help

with experiments and equipment. The authors thank Tyler Van De Voort andXiaoyi Qu for help with the experiments. The authors thank Dr. ConstantineMitsiades (Dana-Farber Cancer Institute) for providing MM1.S-mCherry/Luccells and advice. The authors thank Dr. Robert Blank (Medical College ofWisconsin, Milwaukee, WI) for valuable input and advice.

Grant SupportF. Asimakopoulos is the recipient of an American Society of Hematology

Bridge Grant and a Brian D. Novis grant by the International MyelomaFoundation. J.L. Jensen is a recipient of a grant from the Wisconsin AlumniResearch Foundation through the UW Graduate School and a TL1 traineeaward from the UW Clinical and Translational Science Award (CTSA)program (TL1TR000429: PI, Marc Drezner). C. Hope is the recipient of aKirschstein National Research Service Award (T32HL007899-Hematologyin Training: PI, John Sheehan) and a grant from the Wisconsin AlumniResearch Foundation through the UW Graduate School. This work wassupported in part by funds from the UWCCC Trillium Fund for MultipleMyeloma Research, the UW Department of Medicine, the UW CarboneCancer Center (Core Grant P30 CA014520), the UW-Madison School ofMedicine and Public Health, the Clinical and Translational Science Award(CTSA) program, through the NIH National Center for Advancing Trans-lational Sciences (NCATS), grant UL1TR000427, NIH-NCI grants CA87025and CA32685, and a grant from the Midwest Athletes Against ChildhoodCancer (MACC) Fund.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received January 20, 2015; revised April 8, 2015; accepted April 22, 2015;published OnlineFirst May 4, 2015.

References1. Palumbo A, Anderson K. Multiple myeloma. N Engl J Med 2011;364:

1046–60.2. Keats JJ, Chesi M, Egan JB, Garbitt VM, Palmer SE, Braggio E, et al. Clonal

competition with alternating dominance in multiple myeloma. Blood2012;120:1067–76.

3. Walker BA, Wardell CP, Melchor L, Brioli A, Johnson DC, Kaiser MF, et al.Intraclonal heterogeneity is a critical early event in the development ofmyeloma and precedes the development of clinical symptoms. Leukemia2014;28:384–90.

4. Kumar SK, Rajkumar SV. The current status of minimal residual diseaseassessment in myeloma. Leukemia 2014;28:239–40.

5. Landgren O, Gormley N, Turley D, Owen RG, Rawstron A, Paiva B, et al.Flow cytometry detection of minimal residual disease in multiple myelo-ma: lessons learned at FDA-NCI roundtable symposium. Am J Hematol2014;89:1159–60.

6. Asimakopoulos F, Kim J, Denu RA, Hope C, Jensen JL, Ollar SJ, et al.Macrophages in multiple myeloma: emerging concepts and therapeuticimplications. Leuk Lymphoma 2013;54:2112–21.






7. Bensinger W. Allogeneic stem cell transplantation for multiple myeloma.Hematol Oncol Clin North Am 2014;28:891–902.

8. Hope C, Ollar SJ, Heninger E, Hebron E, Jensen JL, Kim J, et al. TPL2 kinaseregulates the inflammatory milieu of the myeloma niche. Blood 2014;123:3305–15.

9. Kim J, Hematti P. Mesenchymal stem cell-educated macrophages: anovel type of alternatively activated macrophages. Exp Hematol 2009;37:1445–53.

10. Martinez FO, Sica A, Mantovani A, Locati M. Macrophage activation andpolarization. Front Biosci 2008;13:453–61.

11. Edwards JP, Zhang X, Frauwirth KA, Mosser DM. Biochemical and func-tional characterization of three activated macrophage populations. J Leu-koc Biol 2006;80:1298–307.

12. Rakhmilevich AL, Alderson KL, Sondel PM. T-cell-independent antitumoreffects of CD40 ligation. Int Rev Immunol 2012;31:267–78.

13. Rakhmilevich AL, Baldeshwiler MJ, Van De Voort TJ, Felder MA, Yang RK,Kalogriopoulos NA, et al. Tumor-associated myeloid cells can be activatedin vitro and in vivo to mediate antitumor effects. Cancer Immunol Immun-other 2012;61:1683–97.

14. Buhtoiarov IN, Sondel PM, Wigginton JM, Buhtoiarova TN, Yanke EM,Mahvi DA, et al. Anti-tumour synergy of cytotoxic chemotherapy and anti-CD40 plus CpG-ODN immunotherapy through repolarization of tumour-associated macrophages. Immunology 2011;132:226–39.

15. Wu QL, Buhtoiarov IN, Sondel PM, Rakhmilevich AL, Ranheim EA.Tumoricidal effects of activatedmacrophages in amousemodel of chroniclymphocytic leukemia. J Immunol 2009;182:6771–8.

16. Rakhmilevich AL, Buhtoiarov IN, Malkovsky M, Sondel PM. CD40ligation in vivo can induce T-cell independent antitumor effects evenagainst immunogenic tumors. Cancer Immunol Immunother 2008;57:1151–60.

17. Buhtoiarov IN, Sondel PM, Eickhoff JC, RakhmilevichAL.Macrophages areessential for antitumour effects against weakly immunogenic murinetumours induced by class B CpG-oligodeoxynucleotides. Immunology2007;120:412–23.

18. Lum HD, Buhtoiarov IN, Schmidt BE, Berke G, Paulnock DM, Sondel PM,et al. In vivoCD40 ligation can induce T-cell-independent antitumor effectsthat involve macrophages. J Leukoc Biol 2006;79:1181–92.

19. Buhtoiarov IN, LumHD,BerkeG, Sondel PM, RakhmilevichAL. Synergisticactivationofmacrophages viaCD40andTLR9 results in T-cell independentantitumor effects. J Immunol 2006;176:309–18.

20. Buhtoiarov IN, Lum H, Berke G, Paulnock DM, Sondel PM, RakhmilevichAL. CD40 ligation activates murine macrophages via an IFN-gamma-dependent mechanism resulting in tumor cell destruction in vitro. J Immu-nol 2005;174:6013–22.

21. Beatty GL, Chiorean EG, Fishman MP, Saboury B, Teitelbaum UR, Sun W,et al. CD40 agonists alter tumor stroma and show efficacy against pan-creatic carcinoma in mice and humans. Science 2011;331:1612–6.

22. Peng KW, Dogan A, Vrana J, Liu C, Ong HT, Kumar S, et al. Tumor-associated macrophages infiltrate plasmacytomas and can serve as cellcarriers for oncolytic measles virotherapy of disseminated myeloma. Am JHematol 2009;84:401–7.

23. Hebron E, Hope C, Kim J, Jensen JL, Flanagan C, Bhatia N, et al. MAP3K8kinase regulates myeloma growth by cell-autonomous and non-autono-mous mechanisms involving myeloma-associated monocytes/macro-phages. Br J Haematol 2013;160:779–84.

24. Vougioukalaki M, Kanellis DC, Gkouskou K, Eliopoulos AG. Tpl2kinase signal transduction in inflammation and cancer. Cancer Lett2011;304:80–9.

25. Lopez-PelaezM, Soria-Castro I, Bosca L, FernandezM, Alemany S. Cot/tpl2activity is required for TLR-induced activation of the Akt p70 S6k pathwayin macrophages: implications for NO synthase 2 expression. Eur J Immu-nol 2011;41:1733–41.

26. Sugimoto K, Ohata M, Miyoshi J, Ishizaki H, Tsuboi N, Masuda A, et al.A serine/threonine kinase, Cot/Tpl2, modulates bacterial DNA-inducedIL-12 production and Th cell differentiation. J Clin Invest 2004;114:857–66.

27. Kaiser F, Cook D, Papoutsopoulou S, Rajsbaum R, Wu X, Yang HT, et al.TPL-2 negatively regulates interferon-beta production inmacrophages andmyeloid dendritic cells. J Exp Med 2009;206:1863–71.

28. Tugues S, Burkhard SH, Ohs I, VrohlingsM, Nussbaum K, VomBerg J, et al.New insights into IL-12-mediated tumor suppression. Cell Death Differ2015;22:237–46.

29. Chesi M, Matthews GM, Garbitt VM, Palmer SE, Shortt J, Lefebure M, et al.Drug response in a genetically engineered mouse model of multiplemyeloma is predictive of clinical efficacy. Blood 2012;120:376–85.

30. McMillin DW, Delmore J, Negri JM, Vanneman M, Koyama S, SchlossmanRL, et al. Compartment-Specific Bioluminescence Imaging platform for thehigh-throughput evaluation of antitumor immune function. Blood2012;119:e131–8.

31. ZhengY, Yang J,Qian J,QiuP,Hanabuchi S, LuY, et al. PSGL-1/selectin andICAM-1/CD18 interactions are involved in macrophage-induced drugresistance in myeloma. Leukemia 2013;27:702–10.

32. Kim D, Wang J, Willingham SB, Martin R, Wernig G, Weissman IL. Anti-CD47 antibodies promote phagocytosis and inhibit the growth of humanmyeloma cells. Leukemia 2012;26:2538–45.

33. Gantke T, Sriskantharajah S, Ley SC. Regulation and function of TPL-2, anIkappaB kinase-regulated MAP kinase kinase kinase. Cell Res 2011;21:131–45.

34. Perez-Andres M, Almeida J, Martin-Ayuso M, Moro MJ, Martin-Nunez G,Galende J, et al. Clonal plasma cells from monoclonal gammopathy ofundetermined significance, multiple myeloma and plasma cell leukemiashow different expression profiles of molecules involved in the interactionwith the immunological bone marrow microenvironment. Leukemia2005;19:449–55.

35. Roder J, Duwe A. The beige mutation in the mouse selectively impairsnatural killer cell function. Nature 1979;278:451–3.

36. Rose S, Misharin A, Perlman H. A novel Ly6C/Ly6G-based strategy toanalyze the mouse splenic myeloid compartment. Cytometry A 2012;81:343–50.

37. Gabrilovich DI, Ostrand-Rosenberg S, Bronte V. Coordinated regulation ofmyeloid cells by tumours. Nat Rev Immunol 2012;12:253–68.

38. van Rhee F, Giralt S, Barlogie B. The future of autologous stem celltransplantation in myeloma. Blood 2014;124:328–33.

39. Hart AJ, Jagasia MH, Kim AS, Mosse CA, Savani BN, Kassim A. Minimalresidual disease in myeloma: are we there yet? Biol Blood Marrow Trans-plant 2012;18:1790–9.

40. Morgan GJ, Walker BA, Davies FE. The genetic architecture of multiplemyeloma. Nat Rev Cancer 2012;12:335–48.

41. MatsuiW, Borrello I,MitsiadesC. Autologous stemcell transplantation andmultiple myeloma cancer stem cells. Biol Blood Marrow Transplant2012;18(Suppl 1):S27–32.

42. KimD, ParkCY,Medeiros BC,Weissman IL. CD19(�)CD45(low/�)CD38(high)/CD138(þ) plasma cells enrich for human tumorigenic myelomacells. Leukemia 2012;26:2530–7.

43. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progressionand metastasis. Cell 2010;141:39–51.

44. Mantovani A, Germano G, Marchesi F, Locatelli M, Biswas SK. Cancer-promoting tumor-associatedmacrophages: newvistas andopenquestions.Eur J Immunol 2011;41:2522–5.

45. ChesiM, RobbianiDF, SebagM,ChngWJ, AfferM, TiedemannR, et al. AID-dependent activation of a MYC transgene induces multiple myeloma in aconditional mouse model of post-germinal center malignancies. CancerCell 2008;13:167–80.

46. HusseinM, Berenson JR, Niesvizky R,Munshi N,Matous J, Sobecks R, et al.A phase I multidose study of dacetuzumab (SGN-40; humanized anti-CD40 monoclonal antibody) in patients with multiple myeloma. Hae-matologica 2010;95:845–8.

47. Vonderheide RH, Glennie MJ. Agonistic CD40 antibodies and cancertherapy. Clin Cancer Res 2013;19:1035–43.

48. Eliopoulos AG,WangCC,DumitruCD, Tsichlis PN. Tpl2 transduces CD40and TNF signals that activate ERK and regulates IgE induction by CD40.EMBO J 2003;22:3855–64.

49. Hall JP, Kurdi Y, Hsu S, Cuozzo J, Liu J, Telliez JB, et al. Pharmacologicinhibition of tpl2 blocks inflammatory responses in primary humanmonocytes, synoviocytes, and blood. J Biol Chem 2007;282:33295–304.

50. Demchenko YN, Glebov OK, Zingone A, Keats JJ, Bergsagel PL, Kuehl WM.Classical and/or alternative NF-kappaB pathway activation in multiplemyeloma. Blood 2010;115:3541–52.


Jensen et al.




2015;3:881-890. Published OnlineFirst May 4, 2015.Cancer Immunol Res Jeffrey Lee Jensen, Alexander Rakhmilevich, Erika Heninger, et al. Murine Model of Relapsed/Refractory Multiple MyelomaTumoricidal Effects of Macrophage-Activating Immunotherapy in a

Updated version

10.1158/2326-6066.CIR-15-0025-Tdoi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2015/05/02/2326-6066.CIR-15-0025-T.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerimmunolres.aacrjournals.org/content/3/8/881.full#ref-list-1

This article cites 50 articles, 15 of which you can access for free at:

Citing articles

http://cancerimmunolres.aacrjournals.org/content/3/8/881.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/3/8/881To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-15-0025-T

http://cancerimmunolres.aacrjournals.org/content/suppl/2015/05/02/2326-6066.CIR-15-0025-T.DC1

http://cancerimmunolres.aacrjournals.org/content/3/8/881.full#ref-list-1

http://cancerimmunolres.aacrjournals.org/content/3/8/881.full#related-urls

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/3/8/881


Documents

Tumoricidal Effects of Macrophage-Activating Immunotherapy in … · Tumoricidal Effects of Macrophage-Activating Immunotherapy in a Murine Model of Relapsed/Refractory Multiple Myeloma