THE PRECLINICAL DEVELOPMENT OF NOVEL TREATMENT OPTIONS FOR ADVANCED PROSTATE CANCER · Figure 2: Clinical progression of prostate cancer and current treatment options. At initial

THE PRECLINICAL DEVELOPMENT OF NOVEL TREATMENT OPTIONS FOR

ADVANCED PROSTATE CANCER

Jan Kroon

THE PR

ECLIN

ICA

L DEV

ELOPM

ENT O

F NO

VEL TR

EATMEN

T OPTIO

NS FO

R A

DVA

NC

ED PR

OSTATE C

AN

CER

Jan Kroo

n

PhD-thesis

THE PRECLINICAL DEVELOPMENT OF NOVEL TREATMENT OPTIONS FOR ADVANCED

PROSTATE CANCER

Jan Kroon

The preclinical development of novel treatment options for advanced prostate cancer Jan Kroon Department of Urology, Leiden University Medical Center, Leiden, the Netherlands Department of Targeted Therapeutics, University of Twente, Enschede, the Netherlands

The research described in this thesis was financially supported by a grant from NanoNextNL (03D.01)

Printing of this thesis was financially supported by: Sanofi-Aventis, Astellas, Enceladus Pharmaceuticals and the Faculty of Science and Technology, University of Twente

Cover image was designed by: Tim Rodenburg Printed by: Gildeprint, Enschede

THE PRECLINICAL DEVELOPMENT OF NOVEL TREATMENT OPTIONS FOR ADVANCED

PROSTATE CANCER

PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit Twente,

op gezag van de rector magnificus, Prof. dr. H. Brinksma

volgens besluit van het College voor Promoties in het openbaar te verdedigen

op woensdag 20 januari 2016, 16.45 uur

door

Jan Kroon

Geboren op 29 juni 1988 te Nijmegen

Graduation Committee:

Chairperson: Prof. dr. ir. J.W.M. Hilgenkamp Promoter: Prof. dr. G. Storm Co-Promoter: Dr. G. van der Pluijm Co-Promoter: Dr. J.M. Metselaar Internal member: Prof. dr. D. Grijpma Internal member: Prof. dr. L. Oei-De Geus External member: Prof. dr. ir. G. Jenster External member: Dr. M. Heger External member: Prof. dr. ir. W.E. Hennink External member: Prof. dr. J.A. Schalken

ISBN: 978-94-6233-167-9 © 2015, Jan Kroon. All right reserved. No part of this thesis may be reproduced or transmitted in any form, by any means, electronic or mechanical, without prior written permission of the author

Table of contents

Chapter 1 General Introduction 9

Chapter 2 Liposomal Nanomedicines in the Treatment of Prostate Cancer 29

Published in: Cancer Treatment Rev. 2014 May; 40(4):578-584

Chapter 3 Liposomal Delivery of Dexamethasone Attenuates Prostate 49

Cancer Bone Metastatic Tumor Growth In Vivo

Published in: The Prostate. 2015 Jun;75(8):815-824

Chapter 4 Glucocorticoid Receptor Antagonism Reverts Docetaxel 71

Resistance in Human Prostate Cancer

Published in: Endocrine-Related Cancer. 2016 Jan; 23(1):35-45

Chapter 5 Preclinical Evaluation of Docetaxel-loaded Π-Π-stacking-stabilized 95

Polymeric Micelles in Bone Metastatic Human Prostate Cancer In Vivo

Manuscript in preparation

Chapter 6 Glycogen Synthase Kinase-3β Inhibition Depletes the Population 111

of Prostate Cancer Stem/Progenitor-like Cells and Attenuates

Metastatic Growth

Published in: Oncotarget. 2014 Oct;5(19):8986-8994

Chapter 7 Summary and Perspectives 133

Appendices Nederlandse Samenvatting 150

Curriculum Vitae 155

List of Publications 156

Acknowledgements 157

Chapter 1

General Introduction

Chapter 1

10

In this PhD-thesis entitled: “The preclinical development of novel treatment options for

advanced prostate cancer”, we address the urgent need for novel effective treatment

options for advanced prostate cancer. To this end, we explored several strategies that

acknowledge current clinical challenges: targeted drug delivery, overcoming

chemotherapy resistance, selective depletion of cancer stem cells and targeting of the

supportive tumor microenvironment. The findings of these studies are presented in this

PhD-thesis.


Cancer

Cancer is a pathological condition that is associated with aberrant, uncontrolled cell

growth and can originate from almost every tissue in the human body1. The impact of

the disease is demonstrated by its high mortality rate as cancer is the second most

common cause of death from disease (after cardiovascular diseases) with close to 8

million deaths worldwide in 20102. The majority of cancers, including cancer of the

prostate, are defined by functional characteristics that are acquired throughout

carcinogenesis. These characteristics are defined as: sustained growth signaling,

insensibility to anti-growth signals, limitless proliferative potential, reprogrammed

metabolism, ability to evade cell death and avoidance of antitumor immunity, the

induction of angiogenesis and the acquisition of invasive and metastatic properties3,4.

The transition from healthy cell to cancerous cell is permitted by alterations in tumor

suppressor genes and oncogenes (e.g. mutations, epigenetic events, transformations).

Due to genomic instability5, i.e. high frequency of mutations due to loss of genome

integrity, alterations in DNA accumulate in (pre)-malignant cells and this gives rise to

inactive tumor suppressor genes and activated oncogenes that enable the acquisition of

the above mentioned characteristics that are essential for tumor progression.

Cancer involves a multistep process in which the primary tumor regularly spreads to

distant, metastatic sites throughout the body (Figure 1)6. At the beginning of this

complex cascade of events, tumor cells proliferate locally and induce the rapid

formation of new blood vessels, a process called angiogenesis7. Alongside, malignant

cells start to invade surrounding stroma and in this process, epithelial plasticity plays an

important role as cells are able to dynamically switch from a sessile, round-shaped

epithelial cell shape to a more motile mesenchymal phenotype8. These morphological

alterations enables invasive tumor cells to intravasate into the bloodstream, spread

throughout the systemic circulation and to extravasate at distant sites9. After

colonization at distant organs, micro-metastases may grow out to form overt macro-

metastases in vital organs which often leads to death from cancer.

Chapter 1

12

Figure 1: Multistep process of carcinogenesis (1) Tumor cells (in green) initially display an epithelial phenotype and proliferate locally, for which angiogenesis is essential. (2) Frequently, tumor cells switch to a mesenchymal phenotype and are able to invade surrounding tissue and intravasate into the bloodstream. (3) This allows tumor cells to spread through the systemic circulation and (4) adhere and extravasate at the vasculature of distant organs, (5) leading to established metastases in, for example, the liver, bone marrow or lungs. Adapted from a personal communication by Marco Cecchini.

The prostate and prostate cancer

The prostate is a male reproductive organ located between the bladder and the penis,

and its main function is the production of prostatic fluid that protects and mobilizes

spermatozoa. The human prostate consists of two main cell types: epithelial cells

(comprising of secretory cells, basal cells and neuroendocrine cells) and stromal cells

(comprising of smooth muscle cells, fibroblasts and myofibroblasts) that are scattered

throughout three major zones: the peripheral zone, the central zone and the transition

zone10. The peripheral zone, comprising 70% of the whole prostate surface, is the site in

which the majority of prostate cancers originate11.

Prostate cancer is one of the most common diagnosed malignancies with over 1.1

million cases, and although death rates have declined over the last two decades,

prostate cancer still is a major cause of death from cancer in men with over 300,000


deaths worldwide in 201212,13. Common genes that are altered during prostate

carcinogenesis include: phosphatase and tensin homolog (PTEN), transmembrane

protease serine 2:ETS-related gene (TMPRSS2:ERG) and the androgen receptor (AR)14.

PTEN is involved in cell cycle regulation and is mutated in up to 70% of prostate cancer

cases15. TMPRSS2:ERG is a fusion gene that leads to androgen-independence and is

found in 40-70% of prostate cancer patients16. The AR is a nuclear receptor involved in

the development and maintenance of the healthy prostate and is activated by binding of

androgens (e.g. testosterone or dihydrotestosterone) in the cytoplasm, subsequently

leading to nuclear localization where it stimulates growth and survival of prostate cells.

In prostate cancer, the AR is often amplified or aberrantly activated which contributes to

disease progression as unrestrained AR activity induces growth and survival of prostate

cancer cells17. Therefore, many therapies for prostate cancer aim to inhibit AR

activity18,19. AR signaling induces the expression of prostate-specific antigen (PSA), which

functions as a protease to cleave semenogelin I and II, allowing spermatozoa motility20.

In addition, PSA is a routinely used biochemical biomarker in prostate cancer and serum

levels of PSA are used to observe response to anticancer treatment. This is used in many

clinical studies as the main readout in which a decline in serum PSA indicates tumor

regression and rising serum PSA indicates recurrent or progressive disease21,22.

Prostate cancer is a progressive disease with several phases that all warrant different

treatment options (Figure 2)23. In the early, organ-confined stage disease, surgical

removal of the prostate (i.e. radical prostatectomy) and radiation therapy are generally

used as effective treatment options. However, still 40% of the patients will eventually

develop metastatic disease24. This is generally treated with androgen deprivation

therapy but inevitably tumors will cease to respond to this therapy. At this point, the

disease is referred to as castration-resistant prostate cancer (CRPC) and the remaining

treatment options during this advanced stage of the disease include chemotherapeutic

agents (docetaxel, cabazitaxel) and novel AR-targeting drugs (enzalutamide, abiraterone

acetate)24. Although all these interventions have resulted in a better management of the

disease and prolonged overall survival, tumors will evidently also acquire resistance to

these more aggressive therapeutic modalities, leading to continued tumor growth and

subsequent death25. Hence, it is vital to develop novel treatment strategies that target

therapy-resistant disease.

Chapter 1

14

Figure 2: Clinical progression of prostate cancer and current treatment options At initial stages (i.e. organ-confined disease), prostate cancer is typically treated with prostatectomy or radiotherapy. In 20-30% of the cases, prostate cancer will relapse after 5-10 years, commonly at metastatic site. Although androgen deprivation therapy is effective, tumors will inevitably lose their responsiveness to this therapy, a disease stage referred to as castration-resistant prostate cancer. Although current treatment options (i.e. docetaxel, cabazitaxel, enzalutamide and abiraterone) do slow down tumor growth, patients will die from prostate cancer rapidly. Adapted from a personal communication by Marco Cecchini.

Bone metastasis

The majority of cancer deaths are caused by metastatic tumor growth, i.e. the spread

and subsequent growth of tumor cells in secondary, distant organs26. For prostate

cancer, such metastases are typically found in the bone as post-mortem autopsy

revealed the presence of bone metastases in up to 90% of patients who died from

prostate cancer27. Bone metastases substantially reduce the quality of life as common

complications include severe bone pain, pathological fractures and spinal cord

compression28. Although the target organ of cancer metastasis in many cases can be

explained by the anatomy, i.e. blood flow and lymphatic drainage patterns29, this does

not hold true for prostate cancer cells. As a matter of fact it suggests a predisposition of

cancer cells to metastasize to specific target organs, e.g. colonization of the bone

microenvironment by metastatic prostate cancer cells. It was advocated that the rich

bone marrow niche has unique characteristics (e.g. abundance of growth factors,


cytokines, chemokines) that facilitate such metastatic outgrowth (Figure 3)30.

Additionally, it was found that prostate cancer cells preferentially adhere to bone

marrow endothelial cells as opposed to the endothelium of the vasculature in other

organs, leading to preferential establishment in the bone31. Upon arrival in the bone

microenvironment, metastatic prostate cancer cells compete with hematopoietic stem

cells (HSC) for occupancy of their niche32, which further consists of osteoblasts and

endothelial cells. This HSC niche is thought to temporarily induce dormancy in

metastatic prostate cancer cells thereby protecting them from chemotherapy33,

facilitating their survival and subsequent outgrowth.

Figure 3: The bone metastatic microenvironment Stromal cells in the bone microenvironment are involved in the survival and growth of metastatic bone lesions. Examples of stromal cells include, amongst others: tumor-associated macrophages, osteoblasts and osteoclasts. Adapted from a personal communication by Gabri van der Pluijm.

The residence of prostate cancer cells in the bone microenvironment has a great impact

on bone metabolism as tumor cells are able to modulate osteoblast and osteoclast

activity and this severely disturbs physiological bone homeostasis. For prostate cancer,

bone metastases are predominantly osteosclerotic, although osteolytic and mixed

lesions also occur occasionally34,35. Osteosclerotic bone metastases are mainly the

result of tumor-secreted factors, such as endothelin, platelet-derived growth factor

(PDGF) and bone morphogenic protein-6, that collectively result in the maturation and

Chapter 1

16

activation of osteoblasts. These tumor-instructed osteoblasts then, in turn, secrete

factors such as transforming growth factor-β (TGF-β) that support growth of metastatic

tumor cells36. Conversely, in osteolytic bone metastases, metastatic tumor cells secrete

parathyroid hormone-related protein (PTHrP) which stimulates receptor activator of

nuclear factor kappa-B ligand (RANKL) secretion by osteoblasts. RANKL binds to its

receptor on osteoclast progenitors, stimulating their maturation into functional

osteoclasts that efficiently resorb bone matrix. This resorption leads to the release of

matrix-stored growth factors (i.e. TGF-β, PDGF) that in turn stimulate tumor cell growth

and additionally promote the secretion of PTHrP, which again stimulates RANKL

secretion by osteoblasts. This positive feedback loop is called the vicious cycle of bone

metastasis and strongly contributes to the growth of osteolytic bone lesions37.

As bone metastasis represent a major clinical problem in prostate cancer, bone

metastases-specific treatments were developed to lower this burden and these include

bisphosphonates, denosumab and radium-223 chloride38. Bisphosphonates inhibit

osteoclastic bone resorption and were shown to reduce the risk of skeletal related

events although overall survival was not significantly affected39. Denosumab is a human

monoclonal antibody that specifically targets RANKL, thereby inhibiting osteoclastic

bone resorption and was shown to decrease the number of skeletal related events in

patients with bone metastases40. Radium-223 chloride is an α-emitter that accumulates

specifically and efficiently in areas of high bone turnover (i.e. metastatic bone lesions)

and was shown to increase median overall survival in bone metastatic CRPC41,42.

Despite these advances in the treatment of CRPC-related bone metastases, most

patients with bone metastatic CRPC still die from their disease within 3 years,

underlining the need for novel, effective treatment options.

Cancer stem cells

In all of the above-mentioned processes of carcinogenesis, so-called cancer

stem/progenitor cells (CSC) were described to play a pivotal role. CSC are a small

subpopulation of cells within a tumor and have the capacity to self-renew and give rise

to heterogeneous daughter cells, thereby maintaining the tumor43. CSC were found to

be highly aggressive and are involved in tumor-initiation, invasion, metastasis and


therapy-resistance44 and pathways commonly linked with CSC are the Wnt, Notch and

Hedgehog signaling pathways45. For many antitumor therapies, it is acknowledged that

mainly the fast-dividing cells that form the bulk of the tumors are targeted, whereas CSC

remain relatively unaffected. CSC are able to survive in a quiescent, dormant state and

can cause cancer relapse years after therapy46. Prostate CSC from primary tumors

typically display a basal phenotype and common markers include ALDHhigh, integrin-

α2high, CD44+, CD24- and CD133+ 47-49. In contrast, CSC in CRPC exhibit a luminal

phenotype and markers include Nkx3.1 and CK1850,51. In addition to the activity of

distinct pathways and the expression of specific markers, CSC are associated with

enhanced drug efflux capacity, a population of cells also referred to as the side

population (SP). The SP is more tumorigenic52 and expresses high levels of drugs efflux

pumps such as P-glycoprotein and ABC-G253,54, rendering them less sensitive to

chemotherapeutic treatment. Based on the findings that CSC are the driver cells in

prostate tumor and metastatic growth, it is rationalized that targeting of CSC, as

opposed to the bulk cells in a tumor, provides a promising therapeutic approach in

cancer.

Supportive tumor stroma and tumor-associated inflammation

Although much research has focused on intrinsic mutations in cancer cells and their

involvement in carcinogenesis, it has become evident that also the tumor stroma co-

evolves in parallel and contributes to prostate cancer survival and growth55-57. The

tumor stroma has been extensively characterized and comprises a cellular and an

acellular element. The cellular stromal component involves macrophages58,

fibroblasts59, myofibroblasts60, smooth muscle cells, endothelial cells, pericytes,

neutrophils61 and mast cells62. The acellular stroma mainly involves matrix components

such as fibronectin, collagens, laminin and elastin, collectively termed the extracellular

matrix (ECM). Tumor cells and cells of the supportive stroma influence each other in a

bidirectional manner, mainly by secretion of soluble factors. Many tumor-derived

factors that influence the microenvironment are described and common factors include:

TGF-β, PDGF and colony stimulating factor-1 (CSF-1). TGF-β is a multifunctional cytokine

extensively studied in cancer biology and is known to regulate tumor proliferation,

Chapter 1

18

apoptosis, differentiation and migration. In addition to these effects on tumor cells, TGF-

β induces the reactive stroma as the TGF-β-receptor is highly expressed in non-tumor

cells63. This leads to enhanced stromal expression of growth factors and extracellular

matrix components64, which in turn favor tumor growth. PDGF is another factor that

may influence tumor and stromal cell proliferation and differentiation as both tumor

cells and many cells of the microenvironment express the PDGF-receptor65. CSF-1 is

secreted by tumors cells and leads to the recruitment, differentiation and polarization of

tumor-associated macrophages (TAM)61. TAM, in turn, secrete factors such as TGF-β,

matrix metalloproteinases and vascular endothelial growth factor (VEGF), which results

in numerous tumor-promoting processes including tumor growth induction, matrix

remodeling, angiogenesis and suppression of antitumor immunity66, collectively

facilitating tumor progression.

Figure 4: Tumor-associated inflammation Tumor-associated macrophages stimulate the growth of tumor cells in many ways, namely induction of angiogenesis, extracellular matrix remodelling, secretion of growth factors and dampening antitumor immunity. Adapted from: Galdeiro et. al. Journal of Cellular Physiology (2013).


Tumors have been described as ‘never healing wounds’ since many events in tumor

biology resemble the wound healing response67. Comparable to wound healing, chemo-

attractant cues lead to influx of immune cells to the tumor microenvironment, and this

phenomenon already takes place at a very early tumor stage68. In most cases, however,

these immune cells are unable to eradicate tumor cells, leading to a chronic

inflammatory state that aids tumor progression. This inflammation results in genetic

instability as inflammatory factors impair DNA repair mechanisms resulting in

hypermutation69, which accelerates tumor progression. In parallel, tumor-associated

inflammatory cells activate transcription factors NF-κB and STAT-3 and secrete

inflammatory cytokines IL-6, IL-1β and TNF-α70. Aberrant activation of NF-κB is reported

in many cancers71, likely in response to hypoxia which is a common phenomenon in

cancer72. NF-κB supports tumor growth and survival via upregulation of the above

mentioned inflammatory cytokines, COX-2, anti-apoptotic proteins, adhesion molecules

and angiogenic factors73. STAT-3 is a downstream target of NF-κB and influences cellular

proliferation and survival via modulation of cyclins and anti-apoptotic proteins74. IL-6 is

a multi-functional cytokine that regulates proliferation, apoptosis, migration, invasion

and angiogenesis in prostate cancer75 while IL-1β is overexpressed in prostate cancer

and was shown to enhance skeletal metastases76. TNF-α was shown to functionally

enhance migration and invasion in prostate cancer cells77 and high levels are associated

with shorter overall survival in prostate cancer patients78. Taken together, it is evident

that the supportive stroma, specifically tumor-associated inflammation strongly

contributes to prostate cancer progression.Based on this notion, anti-inflammatory

drugs could be a promising class of drugs for cancer treatment. Proof-of-principle for

this was shown in a clinical study with non-steroidal anti-inflammatory drug (NSAID)

aspirin. Daily administration of aspirin was shown to strongly and significantly reduce

the risk of metastasis development in patients with primary tumors79 , underscoring the

importance of inflammation in tumor biology and metastases. In addition to NSAIDs,

another distinct class of anti-inflammatory drugs widely used in cancer treatment are

the glucocorticoids (GC). GC have potent anti-inflammatory actions and are commonly

used for a wide range of diseases, including asthma, multiple sclerosis, rheumatoid

arthritis, but also in hematologic cancers such as leukemia and lymphoma. In addition,

GC are frequently prescribed in advanced prostate cancer patients as several studies

suggest direct antitumor efficacy of GC80-85 and commonly used examples of GC include

Chapter 1

20

prednisone and dexamethasone. GC bind to the glucocorticoid receptor (GR), a nuclear

receptor expressed in many cells throughout the body. Upon binding of a ligand, GR can

either induce the expression of GR-target genes (‘transactivation’) which are typically

anti-inflammatory proteins, or inhibit the activity of pro-inflammatory proteins

(‘transrepression’). As such, active GR was shown to inhibit transcription factors such as

NF-κB and AP-1, thereby reducing the inflammatory activity of these proteins. Although

these activities of GC make it a valuable drug for many disease interventions, GC use has

been associated with a wide range of side effects (Table 1) which limits prolonged and

extensive therapy86. Hence, ways to overcome these adverse effects should be pursued.

Tissue Side effects

Adrenal gland Adrenal atrophy, Cushing’s syndrome

Bone Bone necrosis, osteoporosis, retardation of longitudinal bone growth

Cardiovascular system Dyslipidemia, hypertension, thrombosis, vasculitis

Central nervous system Cerebral atrophy, Changes in behavior, cognition, memory, mood

Gastrointestinal tract Gastrointestinal bleeding, pancreatitis, peptic ulcer

Immune system Broad immunosuppression, activation of latent viruses

Muscles Muscle atrophy

Eyes Cataract, Glaucoma

Kidney Increased sodium retention and potassium excretion

Reproductive system Fetal growth retardation, hypogonadism

Figure 1: GC-associated side effects Adapted from: Rhen and Cidlowski, New England Journal of Medicine (2005)


Targeted drug delivery

The clinical efficacy of many anticancer drugs is critically hampered due to poor

solubility, a suboptimal pharmacokinetic profile (i.e. rapid clearance), limited tumor

accumulation and adverse effects in healthy tissues. To address such issues, targeted

drug delivery strategies have been developed for several anticancer drugs as an

alternative, improved treatment approach compared to conventional, free drug

administration87. Over the last decades, a wide array of nanocarrier-based anticancer

drug products have been designed and studies ranged from basic formulation, stability

and cellular uptake studies, in vivo pharmacokinetic and antitumor studies to clinical

trials monitoring efficacy and tolerability in cancer patients88,89. Indeed, targeted

nanomedicine was shown to have the potential to enhance the therapeutic index, either

by enhancing tumor localization and tumor cell uptake, or by bypassing healthy

(untargeted) tissues and organs, or a combination of both mechanisms88. Nanocarrier-

based drug delivery systems can vary widely in terms of size,

hydrophobicity/hydrophilicity, charge and stability, thereby generating a broad arsenal

of nanoparticles allowing the incorporation of a variety of anticancer drugs and making

it possible to optimize in vivo behavior for a multitude of applications. The most

extensively studied nanomedicinal vesicles are liposomes and micelles.

Liposomes are self-assembling, biocompatible and versatile drug carriers consisting of

one or more lipid bilayers, mainly composed of phospholipids and cholesterol enclosing

an aqueous interior. Liposomes have most successfully been applied to encapsulate

hydrophilic drugs in their interior, although hydrophobic drugs can also be encapsulated

by association with the lipid bilayer90,91. In contrast to liposomes, micelles are more

frequently used to encapsulate hydrophobic drugs. In aqueous environments, the

hydrophobic tails of the lipid molecules sequester in the micelle center, creating a

compartment for hydrophobic drugs. Both drug delivery vectors are used for tumor-

targeted drug delivery by exploiting typical tumor characteristics for targeted

localization, according to the principle of the enhanced permeability and retention

(EPR)-effect92. During tumor angiogenesis, high levels of VEGF leads to

neovascularization, a chaotic process that often results in poorly aligned defective

endothelial cells with wide fenestrations leaving the tumor tissue accessible for

nanoparticles from the bloodstream93. This leaky tumor vasculature, in combination

Chapter 1

22

with the poor lymphatic drainage of tumors, leads to strong accumulation of long-

circulating nanoparticles in the tumor microenvironment, a phenomenon that is

referred to as passive targeting. Alternatively, the coupling of targeting ligands to

nanoparticles with the aim to enhance uptake by tumor or stromal cells (e.g. endothelial

cells) is referred to as active targeting.

Figure 5: Nanomedicinal drug delivery systems Drug delivery vehicles, such as liposomes and polymeric micelles, can be used to encapsulate both hydrophilic and hydrophobic anticancer drugs. Adapted from: Lammers et. al. Journal of Controlled Release (2012).

The size of liposomes typically ranges from 80-150 nm, while the size spectrum of

micelles generally encompasses 10-80 nm88. Nanoparticle size is a critical parameter and

strongly influences in vivo disposition in many distinct ways94,95. First, sizes above 10 nm


prevent renal clearance leading to enhanced circulation time of nanoparticles95. Second,

bigger particles display enhanced protein adsorption, which facilitates opsonization and

subsequent liver uptake, contributing to the faster clearance of bigger particles

compared to smaller particles96. Third, selective extravasation at the tumor vasculature

requires a particle size that is smaller than the transvascular gap size of tumors, which

has been reported to range from 200-1200 nm, and a bigger particle size than the tight

junctions in the continuous endothelium of healthy tissues, typically 60 nm95,97. Fourth,

in vitro spheroid experiments suggests that a smaller particle size enhances intratumoral

penetration, thereby also allowing access to tumor cells at a substantial distance from

the entry site98-100. Finally, the uptake of nanoparticles by (tumor) macrophages is

influenced by particle size, as bigger particles are taken up more efficiently than smaller

particles101.

Extensive research with liposomes and micelles has led to the clinical approval of some,

mainly chemotherapeutic-based, nanomedicinal drug products for the treatment of

cancer102. For example, different formulations of liposomal doxorubicin were clinically

approved for breast cancer, ovarian cancer, multiple myeloma, Kaposi sarcoma and liver

cancer, and micellar-paclitaxel is clinically used in the treatment of breast, lung, ovarian

and gastric cancer88. In spite of enormous efforts, though, only a limited number of

nanomedicinal formulations have been clinically approved for the treatment of cancer.

Chapter 1

24

Aims and scope of thesis

The effectiveness of current drug therapy for prostate cancer is limited for several

reasons. Firstly, current therapeutics (i.e. chemotherapy, androgen-targeting agents,

GC) are associated with a wide range of adverse effects that prohibit prolonged and

frequent administration. Secondly, initial antitumor activity of current therapeutics is

often lost as tumors acquire therapy resistance over time. Thirdly, current therapeutics

primarily target ‘bulk tumor cells’, rather than cancer stem cells, and the persistence of

the latter generally leads to relapse at metastatic sites. Fourthly, current therapeutics

target tumor cells, while the supportive tumor stroma, i.e. tumor-associated

inflammation, also plays a key role in prostate cancer growth. In order to develop

effective treatment modalities, it is vital to address all of these issues, and in this thesis

we have explored ways to accomplish this:

1) We evaluated the utility of targeted drug carriers (i.e. nanomedicine) to enhance

tumor accumulation while minimizing the exposure of healthy tissues in order to to

obtain an increased therapeutic index.

2) We investigated the effectiveness of anti-inflammatory nanomedicine in prostate

cancer.

3) We aimed to decipher mechanisms involved in docetaxel resistance to explore ways

to regain sensitivity to chemotherapy.

4) We investigated cancer stem cell-targeting drugs for their antitumor efficacy in

prostate cancer.


In chapter 2 of this thesis, we summarize the preclinical and clinical liposomal drug

targeting approaches that have been explored for prostate cancer treatment. Chapter 3

addresses the efficacy and toxicity of anti-inflammatory nanomedicine, i.e. liposomal

dexamethasone, in preclinical models of prostate cancer bone metastases. In chapter 4,

we show that the glucocorticoid receptor is a key player in docetaxel resistance and

examine the utility of glucocorticoid receptor antagonists to overcome chemotherapy

resistance. Chapter 5 reports on the therapeutic applicability of a targeted micellar drug

delivery system for docetaxel in prostate cancer bone metastases. In chapter 6, we

describe the role of GSK-3β in prostate cancer stem cells and provide a proof-of-

principle for cancer stem cell-targeting as a therapeutic strategy. Finally, chapter 7

outlines the clinical feasibility of the above-mentioned treatment strategies and

discusses their current status.

Chapter 1

26

References

1. Weinberg, R.A. How cancer arises. Scientific American 275, 62-70 (1996). 2. Lozano, R., et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic

analysis for the Global Burden of Disease Study 2010. Lancet 380, 2095-2128 (2012). 3. Hanahan, D. & Weinberg, R.A. The hallmarks of cancer. Cell 100, 57-70 (2000). 4. Hanahan, D. & Weinberg, R.A. Hallmarks of cancer: the next generation. Cell 144, 646-674 (2011). 5. Burrell, R.A., McGranahan, N., Bartek, J. & Swanton, C. The causes and consequences of genetic heterogeneity in cancer

evolution. Nature 501, 338-345 (2013). 6. Valastyan, S. & Weinberg, R.A. Tumor metastasis: molecular insights and evolving paradigms. Cell 147, 275-292 (2011). 7. Mukherji, D., Temraz, S., Wehbe, D. & Shamseddine, A. Angiogenesis and anti-angiogenic therapy in prostate cancer. Critical

reviews in oncology/hematology 87, 122-131 (2013). 8. Thiery, J.P. & Sleeman, J.P. Complex networks orchestrate epithelial-mesenchymal transitions. Nature reviews. Molecular cell

biology 7, 131-142 (2006). 9. Weinberg, R.A. Mechanisms of malignant progression. Carcinogenesis 29, 1092-1095 (2008). 10. McNeal, J.E. Normal histology of the prostate. The American journal of surgical pathology 12, 619-633 (1988). 11. Sinnott, J.A., et al. Molecular differences in transition zone and peripheral zone prostate tumors. Carcinogenesis (2015). 12. Torre, L.A., et al. Global cancer statistics, 2012. CA: a cancer journal for clinicians (2015). 13. Siegel, R., Naishadham, D. & Jemal, A. Cancer statistics, 2013. CA: a cancer journal for clinicians 63, 11-30 (2013). 14. Knudsen, B.S. & Vasioukhin, V. Mechanisms of prostate cancer initiation and progression. Advances in cancer research 109, 1-

50 (2010). 15. Yoshimoto, M., et al. Interphase FISH analysis of PTEN in histologic sections shows genomic deletions in 68% of primary

prostate cancer and 23% of high-grade prostatic intra-epithelial neoplasias. Cancer genetics and cytogenetics 169, 128-137 (2006).

16. Mosquera, J.M., et al. Morphological features of TMPRSS2-ERG gene fusion prostate cancer. The Journal of pathology 212, 91-101 (2007).

17. Ryan, C.J. & Tindall, D.J. Androgen receptor rediscovered: the new biology and targeting the androgen receptor therapeutically. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 29, 3651-3658 (2011).

18. Tan, M.H., Li, J., Xu, H.E., Melcher, K. & Yong, E.L. Androgen receptor: structure, role in prostate cancer and drug discovery. Acta pharmacologica Sinica 36, 3-23 (2015).

19. Culig, Z. Targeting the androgen receptor in prostate cancer. Expert opinion on pharmacotherapy 15, 1427-1437 (2014). 20. Lilja, H., Oldbring, J., Rannevik, G. & Laurell, C.B. Seminal vesicle-secreted proteins and their reactions during gelation and

liquefaction of human semen. The Journal of clinical investigation 80, 281-285 (1987). 21. Heinlein, C.A. & Chang, C. Androgen receptor in prostate cancer. Endocrine reviews 25, 276-308 (2004). 22. Balk, S.P., Ko, Y.J. & Bubley, G.J. Biology of prostate-specific antigen. Journal of clinical oncology : official journal of the

American Society of Clinical Oncology 21, 383-391 (2003). 23. Basch, E., et al. Systemic therapy in men with metastatic castration-resistant prostate cancer:American Society of Clinical

Oncology and Cancer Care Ontario clinical practice guideline. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 32, 3436-3448 (2014).

24. Beltran, H., et al. New therapies for castration-resistant prostate cancer: efficacy and safety. European urology 60, 279-290 (2011).

25. Seruga, B., Ocana, A. & Tannock, I.F. Drug resistance in metastatic castration-resistant prostate cancer. Nature reviews. Clinical oncology 8, 12-23 (2011).

26. Mehlen, P. & Puisieux, A. Metastasis: a question of life or death. Nature reviews. Cancer 6, 449-458 (2006). 27. Keller, E.T., et al. Prostate carcinoma skeletal metastases: cross-talk between tumor and bone. Cancer metastasis reviews 20,

333-349 (2001). 28. Coleman, R.E. Skeletal complications of malignancy. Cancer 80, 1588-1594 (1997). 29. MacDonald, I.C., Groom, A.C. & Chambers, A.F. Cancer spread and micrometastasis development: quantitative approaches for

in vivo models. BioEssays : news and reviews in molecular, cellular and developmental biology 24, 885-893 (2002). 30. Paget, S. The distribution of secondary growths in cancer of the breast. 1889. Cancer metastasis reviews 8, 98-101 (1989). 31. Lehr, J.E. & Pienta, K.J. Preferential adhesion of prostate cancer cells to a human bone marrow endothelial cell line. Journal of

the National Cancer Institute 90, 118-123 (1998). 32. Shiozawa, Y., et al. Human prostate cancer metastases target the hematopoietic stem cell niche to establish footholds in

mouse bone marrow. The Journal of clinical investigation 121, 1298-1312 (2011). 33. Shiozawa, Y., et al. GAS6/AXL axis regulates prostate cancer invasion, proliferation, and survival in the bone marrow niche.

Neoplasia 12, 116-127 (2010). 34. Mundy, G.R. Metastasis to bone: causes, consequences and therapeutic opportunities. Nature reviews. Cancer 2, 584-593

(2002). 35. Roodman, G.D. Mechanisms of bone metastasis. The New England journal of medicine 350, 1655-1664 (2004). 36. Ibrahim, T., et al. Pathogenesis of osteoblastic bone metastases from prostate cancer. Cancer 116, 1406-1418 (2010). 37. Dougall, W.C. & Chaisson, M. The RANK/RANKL/OPG triad in cancer-induced bone diseases. Cancer metastasis reviews 25,

541-549 (2006). 38. Deng, X., et al. Recent advances in bone-targeted therapies of metastatic prostate cancer. Cancer treatment reviews 40, 730-

738 (2014).


39. Saad, F., et al. A randomized, placebo-controlled trial of zoledronic acid in patients with hormone-refractory metastatic prostate carcinoma. Journal of the National Cancer Institute 94, 1458-1468 (2002).

40. Fizazi, K., et al. Randomized phase II trial of denosumab in patients with bone metastases from prostate cancer, breast cancer, or other neoplasms after intravenous bisphosphonates. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 1564-1571 (2009).

41. Wissing, M.D., van Leeuwen, F.W., van der Pluijm, G. & Gelderblom, H. Radium-223 chloride: Extending life in prostate cancer patients by treating bone metastases. Clinical cancer research : an official journal of the American Association for Cancer Research 19, 5822-5827 (2013).

42. Parker, C., et al. Alpha emitter radium-223 and survival in metastatic prostate cancer. The New England journal of medicine 369, 213-223 (2013).

43. Clarke, M.F., et al. Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer research 66, 9339-9344 (2006).

44. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 27, 13-24 (2013).

45. Wang, A., Chen, L., Li, C. & Zhu, Y. Heterogeneity in cancer stem cells. Cancer letters 357, 63-68 (2015). 46. Kleffel, S. & Schatton, T. Tumor dormancy and cancer stem cells: two sides of the same coin? Advances in experimental

medicine and biology 734, 145-179 (2013). 47. van den Hoogen, C., et al. High aldehyde dehydrogenase activity identifies tumor-initiating and metastasis-initiating cells in

human prostate cancer. Cancer research 70, 5163-5173 (2010). 48. Collins, A.T., Berry, P.A., Hyde, C., Stower, M.J. & Maitland, N.J. Prospective identification of tumorigenic prostate cancer stem

cells. Cancer research 65, 10946-10951 (2005). 49. Hurt, E.M., Kawasaki, B.T., Klarmann, G.J., Thomas, S.B. & Farrar, W.L. CD44+ CD24(-) prostate cells are early cancer

progenitor/stem cells that provide a model for patients with poor prognosis. British journal of cancer 98, 756-765 (2008). 50. Wang, X., et al. A luminal epithelial stem cell that is a cell of origin for prostate cancer. Nature 461, 495-500 (2009). 51. Germann, M., et al. Stem-like cells with luminal progenitor phenotype survive castration in human prostate cancer. Stem Cells

30, 1076-1086 (2012). 52. Patrawala, L., et al. Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2- cancer

cells are similarly tumorigenic. Cancer research 65, 6207-6219 (2005). 53. Gangavarapu, K.J., et al. Aldehyde dehydrogenase and ATP binding cassette transporter G2 (ABCG2) functional assays isolate

different populations of prostate stem cells where ABCG2 function selects for cells with increased stem cell activity. Stem cell research & therapy 4, 132 (2013).

54. Singh, A., et al. Expression of ABCG2 (BCRP) is regulated by Nrf2 in cancer cells that confers side population and chemoresistance phenotype. Molecular cancer therapeutics 9, 2365-2376 (2010).

55. Pietras, K. & Ostman, A. Hallmarks of cancer: interactions with the tumor stroma. Experimental cell research 316, 1324-1331 (2010).

56. Ozdemir, B.C., et al. The molecular signature of the stroma response in prostate cancer-induced osteoblastic bone metastasis highlights expansion of hematopoietic and prostate epithelial stem cell niches. PloS one 9, e114530 (2014).

57. Niu, Y.N. & Xia, S.J. Stroma-epithelium crosstalk in prostate cancer. Asian journal of andrology 11, 28-35 (2009). 58. Biswas, S.K., Allavena, P. & Mantovani, A. Tumor-associated macrophages: functional diversity, clinical significance, and open

questions. Seminars in immunopathology 35, 585-600 (2013). 59. Cirri, P. & Chiarugi, P. Cancer-associated-fibroblasts and tumour cells: a diabolic liaison driving cancer progression. Cancer

metastasis reviews 31, 195-208 (2012). 60. Tuxhorn, J.A., et al. Reactive stroma in human prostate cancer: induction of myofibroblast phenotype and extracellular matrix

remodeling. Clinical cancer research : an official journal of the American Association for Cancer Research 8, 2912-2923 (2002). 61. Galdiero, M.R., Garlanda, C., Jaillon, S., Marone, G. & Mantovani, A. Tumor associated macrophages and neutrophils in tumor

progression. Journal of cellular physiology 228, 1404-1412 (2013). 62. Ellem, S.J., et al. A pro-tumourigenic loop at the human prostate tumour interface orchestrated by oestrogen, CXCL12 and

mast cell recruitment. The Journal of pathology 234, 86-98 (2014). 63. Gerdes, M.J., et al. Localization of transforming growth factor-beta1 and type II receptor in developing normal human

prostate and carcinoma tissues. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 46, 379-388 (1998).

64. Tuxhorn, J.A., Ayala, G.E. & Rowley, D.R. Reactive stroma in prostate cancer progression. The Journal of urology 166, 2472-2483 (2001).

65. George, D. Targeting PDGF receptors in cancer--rationales and proof of concept clinical trials. Advances in experimental medicine and biology 532, 141-151 (2003).

66. Sica, A. Role of tumour-associated macrophages in cancer-related inflammation. Experimental oncology 32, 153-158 (2010). 67. Dvorak, H.F. Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. The New

England journal of medicine 315, 1650-1659 (1986). 68. Feng, Y., Santoriello, C., Mione, M., Hurlstone, A. & Martin, P. Live imaging of innate immune cell sensing of transformed cells

in zebrafish larvae: parallels between tumor initiation and wound inflammation. PLoS biology 8, e1000562 (2010). 69. Koshiji, M., et al. HIF-1alpha induces genetic instability by transcriptionally downregulating MutSalpha expression. Molecular

cell 17, 793-803 (2005). 70. Colotta, F., Allavena, P., Sica, A., Garlanda, C. & Mantovani, A. Cancer-related inflammation, the seventh hallmark of cancer:

links to genetic instability. Carcinogenesis 30, 1073-1081 (2009). 71. Karin, M. Nuclear factor-kappaB in cancer development and progression. Nature 441, 431-436 (2006).

Chapter 1

28

72. Ravenna, L., et al. Distinct phenotypes of human prostate cancer cells associate with different adaptation to hypoxia and pro-inflammatory gene expression. PloS one 9, e96250 (2014).

73. Karin, M. NF-kappaB as a critical link between inflammation and cancer. Cold Spring Harbor perspectives in biology 1, a000141 (2009).

74. Turkson, J. & Jove, R. STAT proteins: novel molecular targets for cancer drug discovery. Oncogene 19, 6613-6626 (2000). 75. Culig, Z. & Puhr, M. Interleukin-6: a multifunctional targetable cytokine in human prostate cancer. Molecular and cellular

endocrinology 360, 52-58 (2012). 76. Liu, Q., et al. Interleukin-1beta promotes skeletal colonization and progression of metastatic prostate cancer cells with

neuroendocrine features. Cancer research 73, 3297-3305 (2013). 77. Radhakrishnan, P., et al. TNFalpha enhances the motility and invasiveness of prostatic cancer cells by stimulating the

expression of selective glycosyl- and sulfotransferase genes involved in the synthesis of selectin ligands. Biochemical and biophysical research communications 409, 436-441 (2011).

78. Sharma, J., et al. Elevated IL-8, TNF-alpha, and MCP-1 in men with metastatic prostate cancer starting androgen-deprivation therapy (ADT) are associated with shorter time to castration-resistance and overall survival. The Prostate 74, 820-828 (2014).

79. Rothwell, P.M., et al. Effect of daily aspirin on risk of cancer metastasis: a study of incident cancers during randomised controlled trials. Lancet 379, 1591-1601 (2012).

80. Tannock, I.F., et al. Chemotherapy with mitoxantrone plus prednisone or prednisone alone for symptomatic hormone-resistant prostate cancer: a Canadian randomized trial with palliative end points. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 14, 1756-1764 (1996).

81. Nishimura, K., et al. Low doses of oral dexamethasone for hormone-refractory prostate carcinoma. Cancer 89, 2570-2576 (2000).

82. Storlie, J.A., et al. Prostate specific antigen levels and clinical response to low dose dexamethasone for hormone-refractory metastatic prostate carcinoma. Cancer 76, 96-100 (1995).

83. Morioka, M., et al. Prostate-specific antigen levels and prognosis in patients with hormone-refractory prostate cancer treated with low-dose dexamethasone. Urologia internationalis 68, 10-15 (2002).

84. Saika, T., et al. Treatment of androgen-independent prostate cancer with dexamethasone: a prospective study in stage D2 patients. International journal of urology : official journal of the Japanese Urological Association 8, 290-294 (2001).

85. Venkitaraman, R., et al. Efficacy of low-dose dexamethasone in castration-refractory prostate cancer. BJU international 101, 440-443 (2008).

86. Rhen, T. & Cidlowski, J.A. Antiinflammatory action of glucocorticoids--new mechanisms for old drugs. The New England journal of medicine 353, 1711-1723 (2005).

87. Ernsting, M.J., Murakami, M., Roy, A. & Li, S.D. Factors controlling the pharmacokinetics, biodistribution and intratumoral penetration of nanoparticles. Journal of controlled release : official journal of the Controlled Release Society 172, 782-794 (2013).

88. Lammers, T., Kiessling, F., Hennink, W.E. & Storm, G. Drug targeting to tumors: principles, pitfalls and (pre-) clinical progress. Journal of controlled release : official journal of the Controlled Release Society 161, 175-187 (2012).

89. Chow, E.K. & Ho, D. Cancer nanomedicine: from drug delivery to imaging. Science translational medicine 5, 216rv214 (2013). 90. Kaasgaard, T. & Andresen, T.L. Liposomal cancer therapy: exploiting tumor characteristics. Expert opinion on drug delivery 7,

225-243 (2010). 91. Sawant, R.R. & Torchilin, V.P. Challenges in development of targeted liposomal therapeutics. AAPS J 14, 303-315 (2012). 92. Heneweer, C., Holland, J.P., Divilov, V., Carlin, S. & Lewis, J.S. Magnitude of enhanced permeability and retention effect in

tumors with different phenotypes: 89Zr-albumin as a model system. Journal of nuclear medicine : official publication, Society of Nuclear Medicine 52, 625-633 (2011).

93. Hashizume, H., et al. Openings between defective endothelial cells explain tumor vessel leakiness. The American journal of pathology 156, 1363-1380 (2000).

94. Almeida, J.P., Chen, A.L., Foster, A. & Drezek, R. In vivo biodistribution of nanoparticles. Nanomedicine (Lond) 6, 815-835 (2011).

95. Alexis, F., Pridgen, E., Molnar, L.K. & Farokhzad, O.C. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Molecular pharmaceutics 5, 505-515 (2008).

96. Fang, C., et al. In vivo tumor targeting of tumor necrosis factor-alpha-loaded stealth nanoparticles: effect of MePEG molecular weight and particle size. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences 27, 27-36 (2006).

97. Hobbs, S.K., et al. Regulation of transport pathways in tumor vessels: role of tumor type and microenvironment. Proceedings of the National Academy of Sciences of the United States of America 95, 4607-4612 (1998).

98. Tsukioka, Y., et al. Pharmaceutical and biomedical differences between micellar doxorubicin (NK911) and liposomal doxorubicin (Doxil). Japanese journal of cancer research : Gann 93, 1145-1153 (2002).

99. Kostarelos, K., et al. Engineering lipid vesicles of enhanced intratumoral transport capabilities: correlating liposome characteristics with penetration into human prostate tumor spheroids. Journal of liposome research 15, 15-27 (2005).

100. Moussa, M., et al. Nanodrug-enhanced radiofrequency tumor ablation: effect of micellar or liposomal carrier on drug delivery and treatment efficacy. PloS one 9, e102727 (2014).

101. Yu, S.S., et al. Size- and charge-dependent non-specific uptake of PEGylated nanoparticles by macrophages. International journal of nanomedicine 7, 799-813 (2012).

102. Gong, J., Chen, M., Zheng, Y., Wang, S. & Wang, Y. Polymeric micelles drug delivery system in oncology. Journal of controlled release : official journal of the Controlled Release Society 159, 312-323 (2012).

Chapter 2

Liposomal Nanomedicines in the Treatment of Prostate Cancer

Jan Kroon1, 2

Josbert M. Metselaar2

Gert Storm2, 3

Gabri van der Pluijm1

1Department of Urology, Leiden University Medical Center, Leiden, the Netherlands

2Deparment of Targeted Therapeutics, MIRA institute for Biomedical Technology and Technical Medicine,

University of Twente, Enschede, the Netherlands

3Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht,

the Netherlands

Cancer Treatment Rev. 2014 May; 40(4):578-84.

Chapter 2

30

Abstract

Prostate cancer is the most common cancer type and the second leading cause of death

from cancer in males. In most cases, no curative treatment option is available for

metastatic castration-resistant prostate cancer as these tumors are highly resistant to

chemotherapy. Targeted drug delivery, using liposomal drug delivery systems, is an

attractive approach to enhance the efficacy of anticancer drugs and prevent side effects,

thereby potentially increasing the therapeutic index. In most preclinical prostate cancer

studies, passive liposomal targeting of anticancer drugs (caused by enhanced

permeability and retention of the therapeutic compound) leads to an increased

antitumor efficacy and decreased side effects compared to non-targeted drugs. As a

result, the total effective dose of anticancer drugs can be substantially decreased. Active

(ligand-mediated) liposomal targeting of tumor cells and/or tumor-associated stromal

cells display beneficial effects, but only limited preclinical studies were reported. To

date, clinical studies in prostate carcinoma have been performed with liposomal

doxorubicin only. These studies showed that long-circulating, PEGylated, liposomal

doxorubicin generally outperforms conventional short-circulating liposomal doxorubicin,

stressing the importance of passive tumor targeting for this drug in prostate carcinoma.

In this review, we provide an overview of the (pre)clinical studies that focus on

liposomal drug delivery in prostate carcinoma.


Introduction on prostate cancer and liposomal drug delivery

Over the past decades, substantial progress has been made in the field of nanomedicinal

drug delivery1,2. In this booming field, liposomes have taken a front-runner position and

have been evaluated extensively in preclinical and clinical cancer settings. Meanwhile, a

few liposomal formulations have been clinically approved for the treatment of cancer3.

Among the extensive amount of studies in the field of liposomal tumor targeting, only a

limited number of investigations have focused on the utility of liposomes in prostate

cancer treatment. It is striking that amongst those studies, castration-resistant prostate

cancer (CRPC) has deserved relatively little attention, as CRPC is one of the most

detrimental among the advanced-stage cancers, with very little effective treatment

options currently available. Many drugs designed for the treatment of CRPC fail at some

point during clinical development due to intrinsic/acquired resistance and/or dose-

limiting side effects. Described mechanisms for therapy resistance include

overexpression of P-glycoprotein4 and enhanced STAT1 expression5. Targeted drug

delivery systems like liposomes may help overcome drug resistance as higher drug levels

are potentially achievable at the tumor site. In addition, targeted drug delivery can

diminish drug exposure of healthy tissues leading to less systemic side effects. In light of

the extensive experience with several liposomal anticancer formulations6, liposomal

targeting of anticancer drugs to tumors in patients with prostate cancer seems a

plausible drug targeting approach.

Liposomes are versatile, self-assembling, carrier materials that contain one or more lipid

bilayers with phospholipids and/or cholesterol as major lipid components, and can be

used to encapsulate hydrophilic drugs in their inner aqueous compartment(s) while

more hydrophobic drugs can associate with the lipid bilayer(s) (Figure 1) (reviewed in 7,8). Compared to other nanocarriers, liposomes are relatively easy to prepare,

biodegradable and essentially nontoxic, although size is usually limited to 50-150 nm if

used for drug delivery purposes9,10. Liposomes have been shown useful for drugs with

unfavorable pharmacokinetic properties that result in a suboptimal therapeutic index.

The addition of a polyethylene glycol (PEG) coating to the outer surface has been a

major breakthrough as this coating opposes detection by the mononuclear phagocyte

system (MPS) and thereby strongly enhances circulation time of intravenously injected

liposome particles. As tumors often display a chaotic and highly permeable vasculature

Chapter 2

32

as a result of angiogenesis, the long circulation time of PEG-liposomes allows enhanced

extravasation of liposomes into the tumor microenvironment compared to healthy

tissues. Generally, an increased liposomal size favors extravasation as long as this size

does not exceed the size of the inter-endothelial fenestrae, which are typically 200-400

nm11-13. After extravasation, liposomes are usually retained since lymphatic drainage is

often impaired in tumors7. Hence, this tumor targeting mechanism is referred to as the

enhanced permeability and retention (EPR) effect. Because no specific targeting ligands

are used to interact with the tumor target site, this tumor localization process is

referred to as “passive targeting” and represents the major targeting principle for

intravenously administered long-circulating liposomes (Figure 2, upper left)7,8.

Conversely, active targeting implies a ligand or antibody bound to the outer surface of

liposomes that selectively target receptors/ligands overexpressed on the tumor cells

(Figure 2, upper right) or the (a)cellular tumor microenvironment (Figure 2, lower

left)7,8,14. Following binding to the receptor, internalization via receptor-mediated

endocytosis can take place. Both the extent of tumor localization and subsequent

cellular internalization determine the therapeutic efficacy of liposome-encapsulated

anticancer agents15.

The aim of this review is to summarize the literature on both passively and actively

targeted liposomes for the treatment of prostate cancer, and to provide a perspective

on the use of targeted liposomes as a new therapeutic option to treat this malignancy.


Figure 1: Structure of a liposome used as drug delivery system

Chapter 2

34

Figure 2: Enhanced permeability and retention (EPR)-effect and different modes of liposomal drug delivery. Tumors often display a chaotic and highly permeable vasculature as a result of angiogenic and vascular permeability factors (e.g. VEGF). The long circulation time of PEG-liposomes allows enhanced extravasation of liposomes into the tumor microenvironment. In addition, the lack of proper lymphatic drainage system further contributes to the EPR-effect. This so-called passive targeting represents a major targeting principle for liposomes (upper left panel). Active targeting involves a ligand bound to the outer surface of liposomes that selectively target receptors receptors/ligands overexpressed on the tumor cells (upper right panel) or the (a)cellular tumor microenvironment (lower left panel). Following binding to the receptor, internalization via receptor-mediated endocytosis can take place.

Preclinical studies

A limited number of studies focused on passive and/or active liposomal targeting of

chemotherapeutic agents in preclinical prostate cancer models. Chemotherapy is widely

used to treat prostate carcinoma, but is reserved only for the later stages of the disease,

when the disease has progressed into the stage of CRPC for which typically a

combination of docetaxel and prednisone is given16,17. Unfortunately, only a small

proportion of patients respond to docetaxel and dose-limiting myelosuppression


prohibits intensification of treatment16. This unfavorable situation provides a strong

rationale for tumor-targeted delivery of chemotherapeutic agents.

A phase I study with liposomal docetaxel was conducted in a cohort of multiple

advanced solid malignancies which revealed higher maximum tolerated dosages of the

liposomal formulation compared to free docetaxel (85 mg/m2, or 110 mg/m2 with G-SCF

support; compared to 75 mg/m2 for free docetaxel)18. Surprisingly, while being the

standard-of-care for CRPC, liposomal docetaxel has not yet been investigated in

preclinical models of prostate cancer. This is even more striking considering the range of

studies that have been performed with liposomal formulations of other

chemotherapeutic agents, including doxorubicin19-23, gemcitabine24,25, paclitaxel26 and

mitoxantrone27.

Doxorubicin, an anthracycline widely used as chemotherapeutic agent, is associated

with several side effects, most notably cardiotoxicity28, and liposomal delivery of

doxorubicin was proven useful to reduce chronic cardiotoxicity. As a result, liposomal

delivery increases the therapeutic index of the drug. Indeed, liposomal doxorubicin has

been clinically approved for the treatment of Kaposi’s sarcoma, ovarian cancer, breast

cancer and multiple myeloma (as PEG-liposomal doxorubicin marketed as Doxil in the

USA and Caelyx outside the USA) and for advanced breast cancer (the non-PEGylated

liposomal doxorubicin version marketed as Myocet)3,29.

Passive delivery of liposomal doxorubicin was examined in multiple human prostate

cancer cell line-based and primary prostate cancer-based in vivo models. Monotherapy

with liposomal doxorubicin resulted in contrasting results, with three studies showing

significant inhibition of subcutaneous tumor growth19-21 while one study showed no

effect22. It is hard to pinpoint the reason for these differential responses, as there were

differences in liposomal compositions, size, tumor models, dosing and time of

treatment. Liposomal delivery of gemcitabine, a nucleoside analog clinically used for

several types of cancer, induced a potent antitumor effect which could only be matched

by 45-fold higher doses of free gemcitabine (8 mg/kg/week versus 360 mg/kg/week,

respectively)24,25. Moreover, decreased numbers of lymph node metastases were

observed upon treatment with liposomal gemcitabine compared to free gemcitabine25.

Liposomal delivery of mitoxantrone, the previous second-line treatment for CRPC,

Chapter 2

36

showed an inhibition of prostate xenograft growth but was not compared to free

mitoxantrone27.

In contrast to doxorubicin and gemcitabine, liposomal delivery of paclitaxel does not

lead to a better outcome, as was evidenced by a study in a rat prostate cancer xenograft

model. Here, efficient tumor inhibition by liposomal paclitaxel was observed at the cost

of severe weight loss26, indicative of excessive systemic toxicity. It may therefore be

doubtful whether or not liposomal delivery will increase the therapeutic index of

paclitaxel in advanced prostate cancer.

In the attempts to further enhance the efficacy of liposomal anticancer drug targeting,

two approaches deserve attention: combination therapy and active targeting.

Combination therapy of liposomal doxorubicin with radiation19 or low frequency

ultrasound22 enhanced the antitumor efficacy compared to liposomal doxorubicin alone.

In addition, ultrasound was shown to enhance the penetration of released doxorubicin

throughout the prostate xenograft, thereby also reaching tumor cells further removed

from the blood vessels23.

Active targeting of receptors on tumor cells and on cancer-associated cells has been

pursued, as both tumor and stromal cells may have distinct cellular characteristics which

enable selective targeting. In a prostate cancer xenograft model, active targeting of

liposomal doxorubicin with an anasamide-PEG derivate to sigma receptors

(overexpressed in prostate cancer-derived cell lines30) displayed improved antitumor

efficacy compared to passively targeted doxorubicin, while free doxorubicin treatment

was associated with severe systemic toxicity and treatment-related death20. Another

active targeting approach focused on fibroblast growth factor receptors (FGFRs),

frequently overexpressed in tumor cells and tumor-associated vasculature. In a TRAMP-

C1 xenograft model, active FGF-based liposomal delivery of doxorubicin led to a massive

reduction in tumor growth and prolonged survival when compared with passively

targeted doxorubicin and free doxorubicin21. It is unclear to what extent the enhanced

antitumor effects were mediated by direct (tumor), indirect (supportive stroma) or

combined effects on FGFR-expression cells. Furthermore, active targeting of tumor

vasculature with aspargine-glycine-argenine-(NGR)-targeted liposomes has been

explored for prostate carcinoma. NGR selectively binds a tumor endothelium-specific


CD13 isoform and displays a high binding capacity to cultured human vascular

endothelial cells (HUVEC) in vitro. Active, NGR-based targeting of doxorubicin induced a

dose-dependent inhibition of prostate tumor growth (1-6 mg/kg/week) but was not

compared to passively targeted liposomes31.

In addition to chemotherapeutics, bisphosphonates provide a group of antiresorptive

drugs clinically relevant for the treatment of prostate cancer patients with metastatic

bone disease. Bisphosphonates home to bone very efficiently due to high affinity for

hydroxyapatite which is abundantly present in the calcified bone matrix. At this site,

osteoclastic bone resorption is inhibited and for this reason bisphosphonates are widely

used in the clinic to prevent tumor-induced bone loss32. More recently, several studies

highlight the depleting effect of free and liposomal bisphosphonates on tumor-

associated macrophages (TAM) from the tumor microenvironment33-35. TAM are

involved in tumor-associated inflammation by secretion of a wide range of cytokines

and other inflammatory factors including VEGF, EGF and MMP-9, and they contribute to

tumor progression, invasion and angiogenesis32. Thus, liposomal targeting of

bisphosphonates provides a potential approach to dampen tumor-associated

inflammation and tumor progression. Indeed, intravenous injection of liposomal

bisphosphonate zoledronic acid resulted in decreased levels of TAM, reduced

angiogenesis and inhibition of prostate xenograft growth36,37. In metastatic xenograft

models, liposomal delivery of another bisphosphonate, clodronate, led to inhibited

metastatic growth and reduced numbers of bone metastases which were accounted to a

reduction in TAM38,39, reduced levels of inflammatory cytokine IL-639 and a reduction of

osteoclast activity39.

Besides therapeutic potential of bisphosphonates, they can also be used as active

targeting devices to selectively deliver anticancer drugs to bone metastases. As

mentioned earlier, hydroxyapatite is abundantly exposed in the microenvironment of

bone metastases leading to enhanced binding by bisphosphonate structures. Indeed,

liposomes with a bisphosphonate-moiety display efficient binding to hydroxyapatite in

vitro40-42. However, hydroxyapatite binding was decreased at increasing serum levels,

pointing to competition between serum proteins and bisphosphonate-decorated

liposomes42. Despite serum competition, it was recently confirmed that

bisphosphonate-decorated liposomes display in vivo affinity for collagen/hydroxyapatite

Chapter 2

38

scaffolds transplanted in rats42. These findings indicate that bisphosphonate-decorated

liposomes may provide a means to target anticancer drugs to bone, but active delivery

of anticancer drugs has not yet been substantiated and the approach warrants further

investigation.

Finally, liposomal delivery of antisense oligonucleotides, which inhibit the translation of

target messenger RNAs, was evaluated. Antisense oligonucleotides against nucleic acids

coding for oncogenic proteins may block the production of pivotal proteins for tumor

growth. Using such an approach, Bcl-2 provides a promising target since it inhibits

apoptosis and is associated with therapy resistance43. Targeted knockdown of Bcl-2 may

lead to apoptosis induction or sensitization in tumor cells. Promisingly, intravenous

administration of PEGylated cationic liposomes containing Bcl-2 antisense RNA resulted

in a dose-dependent inhibition of prostate cancer xenograft growth44. These findings

indicate successful knockdown of Bcl-2 in vivo, though the intra-tumoral proteins levels

of Bcl-2 were not reported44. In a similar way, liposomes were used to selectively knock

down PKN3, Raf-1 and TMPRSS2/ERG; proteins associated with prostate cancer

growth45-48. As such, intravenous liposomal administration of si-PKN3 led to a significant

decrease in tumor size, as well as a strong reduction in the number of affected lymph

nodes but, unfortunately, also downregulated PKN3 in healthy tissues46. This may point

at suboptimal tumor-specificity of the liposomal system. Liposomal delivery of Raf

antisense oligonucleotides led to a 50% knockdown of Raf-1 in tumor tissues, which

resulted in an enhanced antitumor activity of docetaxel, cisplatin, epirubicin and

mitoxantrone on prostate cancer xenografts48. This indicates that liposomal siRNA-

mediated protein silencing can sensitize prostate xenografts to chemotherapeutics.

Another study monitored the effect of liposomal delivery of si-RNA targeted against the

TMPRSS2/ERG fusion gene which revealed a significantly inhibition of subcutaneous and

intraprostatic xenograft growth while no toxicity was observed49.

Active targeting of prostate cancer cells to selectively deliver siRNA was explored in a

prostate xenograft model, in which potent in vivo knockdown of target Plk-1 was

achieved using PSA-responsive, prostate-specific membrane antigen (PSMA)-targeted

liposomes, subsequently leading to decreased tumor growth50. These multifunctional

liposomes offer enhanced selectivity for prostate cancer cells as both PSA and PSMA

should be present to facilitate receptor-mediated endocytosis.


As can be deducted from the examples above, targeting proteins that are involved in

growth and survival of prostate cancer cells may represent a viable treatment approach.

In addition, proteins that are involved in the interaction between tumor cells, stromal

cells and the extracellular matrix may provide interesting targets. An important protein

involved in this communication is αv-integrin. It was shown that intra-tumoral injection

of liposome-encapsulated αv-integrin-si-RNA resulted in potent in vivo knockdown and

consequently hampered intra-osseous growth of prostate tumor cells51. However, intra-

tumoral injection is less relevant from a clinical perspective since metastases often

present themselves at poorly accessible sites. Targeted delivery of αv-integrin-si-RNA

after systemic administration was not explored in this study51.

Chapter 2

40

Antitumor

drug Liposome composition Dose & Administration

Mean

liposome

size

Passive/

active targeting

In vivo model:

animals, cells, tumor

inoculation site

REF

Doxorubicin DSPE, DSPC, DSPE-PEG2000,

CHOL (e.g. Caelyx) 3.5 mg/kg, i.v. 96nm Passive

Balb-c nu/nu, human

primary cells, s.c. 19

Doxorubicin PC, CHOL, DSPE-PEG-SP2-AA 7.5 mg/kg/week, i.v. Not shown Active,

Anisamide

Female athymic nude

mice, Du145, s.c. 20

Doxorubicin DOTAP, CHOL, tbFGF 5 mg/kg/2x week, i.v. 162nm Active, tbFGF C57BL/6J, TRAMP-C1,

s.c. 21

Doxorubicin DSPE, DSPC, DSPE-PEG-2000,

CHOL (e.g. Caelyx) 3.5 mg/kg, i.v. 85nm Passive

Balb-c nu/nu, human

primary cells, s.c. 22

Doxorubicin DEPC, DSPC, DSPE-PEG, CHOL 16 mg/kg, i.v. 90nm Passive Female Balb-c nu/nu,

PC-3, s.c. 23

Doxorubicin PC, DSPE-PEG-NGR, CHOL 1-6 mg/kg/week, i.v. Not shown Active, NGR Male athymic nude

mice, PC-3, s.c. 31

Gemcitabine PC, CHOL, no PEG 6-8 mg/kg/week, i.v. Not shown Passive SCID, Du145/PC-3, s.c. 24

Gemcitabine PC, CHOL, no PEG 8 mg/kg/week, i.v. 36nm Passive SCID, LNCaP,

intraprostatic 25

Paclitaxel Not shown 5 mg/kg/4 times in 8 days,

i.v. Not shown Passive

Copenhagen rats,

MatLu, s.c. 26

Imatinib-

mitoxantrone DSPC, CHOL, no PEG 0.5-2 mg/kg/week, i.v. Not shown Passive

Swiss mice nu/nu, PC-

3, s.c. 27

Zoledronic acid PC, DSPE-PEG2000, CHOL 10-20 µg, i.v. 265nm,

331nm Passive

CD-1 nu/nu, PC-3,

intramuscular 36-37

Clodronate PC, CHOL, no PEG Every 3 days, s.c. Not shown Passive Balb-c nu/nu, HARA-

B, intracardiac 38

Clodronate PC, CHOL, no PEG 3x every 5 days, i.p. Not shown Passive NCI-nu, PC-3,

intraosseous 39

Bcl-2 si-RNA PC, CHOL, PEG-CLZ 1-10 mg/mL, i.v.; 0.1

mg/two 5 day cycles, s.c. 90nm Passive

Balb-c nu/nu, PC-3,

s.c. 44

PKN3 si-RNA DPhyPE, DSPE-PEG 2.8 mg/kg, i.v. 118nm Passive NMRI nu/nu, PC-3,

intraprostatic 46


Raf antisense DDAB, PC, CHOL, no PEG i.v. Not shown Passive Male athymic nu/nu,

PC-3, s.c. 47-48

TMPRSS2/ERG

si-RNA DOTAP, DOPC

Twice weekly, 150 µg/kg,

i.v. 65nm Passive

SCID, VCaP, s.c.,

intraprostatic 49

PLK-1 si-RNA

SPC, DSPE-PEG2000, DSPE-

PEG2000-ACPP, DSPE-

PEG5000-Folate, CHOL, DC-

CHOL

1.5 mg/kg/every 2 days,

i.v. 208nm Active, Folate

Balc-c nu/nu, 22Rv1,

s.c. 50

αv-integrin

si-RNA DPPC, DPE, DPPE, PEG 1 µg, i.t. Not shown Passive

Balb-c nu/nu, PC-3,

intraosseous/s.c. 51

Table 1: Overview of preclinical studies on liposomal drug targeting in prostate carcinoma models

Abbreviations: si-RNA, small interfering RNA; i.v., intravenous; s.c., subcutaneous; i.t., intratumoral; CHOL, cholesterol; PC, Phosphocholine; DOTAP, Dioleoyl trimethylammonium propane; DDAB, Dimethyldioctadecylammoniumbromide; SPC, Soybean phosphatidylcholine.

Clinical studies

With promising preclinical research results with liposomal doxorubicin in prostate

cancer models, and the clinical approval of PEGylated and non-PEGylated liposomal

doxorubicin in other cancer types, it comes as no surprise that clinical trials with

liposomal doxorubicin have also been carried out in CRPC. Indeed, several phase I and

phase II trials have been performed evaluating treatment with non-PEGylated52-54 and

PEGylated55-58 liposomal doxorubicin, either as a monotherapy or in combination with

docetaxel59. In these studies, serum levels of PSA were used as a read out and a decline

of at least 50% was classified as a clinical response. In studies focusing on monotherapy

with liposomal doxorubicin, it was notable that patients treated with PEGylated

liposomal doxorubicin seemed to respond better compared to patients treated with

non-PEGylated liposomal doxorubicin. For example, in the study of McMenemin et al,

treatment with PEGylated liposomal doxorubicin leads to a clinical response in 4 out of

14 patients with hormone refractory prostate carcinoma and bone metastases. In

another study of Flaherty et al, no clinical responses were seen in 9 hormone refractory

prostate cancer patients treated with non-PEGylated liposomal doxorubicin52. Taken

Chapter 2

42

together, at least 50% reduction in PSA levels was observed in 18/88 patients (20%,

range 11-28%) versus 10/77 patients (13%, range 0-15%) upon treatment with

PEGylated and non-PEGylated liposomal doxorubicin, respectively. Of note, different

dosing regimens were used in different studies, in which infrequent treatment with

high-dose PEGylated liposomal doxorubicin (every 3 or 4 weeks)55-58 resulted in PSA

responses while frequent low-dose treatment (every week) did not56. This is exemplified

by a phase II trial in which 50 mg/m2 every 4 weeks led to substantial PSA decreases

whereas 25 mg/m2 every 2 weeks did not56. Even with the most effective dosing

schedule of PEGylated doxorubicin, however, only a small proportion of the patient

population shows an antitumor response (ranging from 11-28%).

As synergistic effects of doxorubicin and docetaxel were described in human prostate

cancer cells in vitro60, combination treatment of liposomal doxorubicin with (non-

liposomal) docetaxel was evaluated, which shows a ≥50% decline in PSA level in 50% of

the patients with prostate cancer59. Treatment with docetaxel alone, however, already

results in a PSA decline in 45-48% of the patients16, so it is doubtful if addition of

liposomal doxorubicin adds much value.

In addition to clinical responses, treatment-associated toxicities were monitored.

Compared to free doxorubicin, liposomal encapsulation of doxorubicin resulted in

reduced cardiotoxicity and less severe myelosuppression, but led to increased dose-

limiting skin and mucosal toxicities55,61 including hand-food syndrome and

stomatitis55,62,63. This shift in safety profile for liposomal doxorubicin seems favorable, as

skin toxicities, unlike cardiotoxicity, are not life threatening and manageable63.

Treatment with liposomal doxorubicin also infrequently presented with some grade III

toxicities including neutropenia53,54,57,59, leukopenia56, anemia59 and

thrombocytopenia58,59. Nevertheless, for the majority of patients liposomal doxorubicin

was well-tolerated, even in combination with docetaxel59.


Therapeutic PEGylated Dose intensity

(/week) Regimen

PSA≥50%

decline Toxicities REF

Liposomal doxorubicin No 10-20 mg/m2 10-20 mg/m2 weekly for 4 weeks

out of a 6-week cycle 0/9 (0%) No Grade III or IV 52

Liposomal doxorubicin No 12.5 mg/m2 50 mg/m2 every 4 weeks 2/14 (14%) Grade III neutropenia, mucositis

and hand-food syndrome 53

Liposomal doxorubicin No 25 mg/m2 25 mg/m2 weekly 8/54 (15%) Grade III neutropenia 54

Liposomal doxorubicin Yes 15 mg/m2 45 mg/m2 every 3 weeks or 60

mg/m2 every 4 weeks 3/15 (20%)

Grade III/IV stomatitis and

hand-foot syndrome 55

Liposomal doxorubicin Yes 12.5 mg/m2 25 mg/m2 every 2 weeks or 50

mg/m2 every 4 weeks 8/31 (26%)

Grade III/IV tachycardia, hepatic

toxicity and hemoglobin toxicity 56

Liposomal doxorubicin Yes 12.5 mg/m2 50 mg/m2 every 4 weeks 4/14 (28%) Grade III/IV neutropenia,

mucositis and skin toxicity

57

Liposomal doxorubicin Yes 10 mg/m2 40 mg/m2 every 4 weeks 3/28 (11%) Grade III thrombocytopenia 58

Liposomal doxorubicin,

Docetaxel Yes

6-16 mg/m2,

20-35 mg/m2

6-16 mg/m2, 20-35 mg/m2 every

week for 3 weeks out of a 4-week

cycle

12/24 (50%) Grade III hematological toxicity,

mucositis and ashenia 59

Table 2: Overview of clinical studies on liposomal drug targeting for prostate cancer treatment

Conclusions

This review aims to provide a summary of the studies done so far with liposomal drug

delivery to prostate carcinoma and its bone metastases. Different potential anticancer

drugs were studied including several chemotherapeutics, bisphosphonates and

antisense nucleotides (Table 1). In general, passive liposomal targeting of

chemotherapeutic doxorubicin displays increased antitumor efficacy compared to free

doxorubicin, as well as a decrease of side effects. This antitumor effect can potentially

be further enhanced by combination therapy or active targeting. Here, targeting of both

Chapter 2

44

tumor and stromal cells offers a valuable approach, as exemplified by FGFR-targeted

doxorubicin liposomes that show a highly potent antitumor response in a preclinical

study.

Amongst the performed passive targeting studies, liposomal delivery of gemcitabine

seems highly promising as it allows a massive dose reduction while yielding similar

antitumor effects as a 45-fold higher free gemcitabine dosage. Liposomal gemcitabine

almost completely arrests prostate cancer xenograft growth whereas liposomal

doxorubicin only seems to slow it down. Based on this, further investigation on targeted

delivery of gemcitabine in preclinical prostate cancer models is warranted.

It is important to note, though, that most studies use subcutaneous tumor models to

monitor prostate cancer growth in vivo. Although these studies can be useful, the

models may not be representative of drug delivery to the relevant biological site, e.g.

(bone) metastatic tumor, as tumor microenvironment, vascularization and other

properties may differ between subcutaneous and orthotopically implanted tumors.

Hence, the use of more clinically relevant in vivo models is key, specifically models that

mimic metastatic tumor growth (especially in the bone), as they represent the clinical

stage of advanced, incurable, prostate cancer. Indeed, intra-bone and intracardiac

tumor inoculation, which appear most useful in this regard, were sporadically used in

literature as models for experimentally-induced prostate cancer metastases to evaluate

liposomal targeting approaches.

The bone/bone-marrow microenvironment, the main site of prostate cancer metastasis,

has unique features that can be exploited to selectively deliver anticancer drugs to bone

metastases. As such, bisphosphonate-coated liposomes provide a promising, yet

underexplored, platform with effective targeting affinity for active bone surfaces

(hydroxyapatite), which is abundantly exposed in the local bone metastatic

environment. At this site, tumor-associated macrophages promote tumor growth by

direct release of growth and inflammatory factors (EGF, VEGF, IL-10, IL-12, TNF-α,

amongst others)64,65 while osteoclasts mediate bone resorption, which leads to the

release of bone-matrix bound growth factors (for example, TGF-β)66. In a broader

perspective, we believe that targeting the supportive bone stroma has clear therapeutic

potential, as exemplified by the preclinical studies that show that depletion of tumor-


associated macrophages by liposomal delivery of bisphosphonates effectively inhibits

bone metastatic growth.

Although preclinical studies with a range of anticancer drugs show the potential of

liposomal drug delivery in prostate cancer treatment, passive targeting studies were

only performed with four chemotherapeutic agents so far while only one (doxorubicin)

was evaluated in an active targeting approach. Also, despite these and other promising

preclinical studies with a range of anticancer drugs, only liposomal doxorubicin has been

tested in phase I and II trials for the treatment of prostate cancer (Table 2). Hence, we

believe that many challenges remain in the field of liposomal drug delivery for prostate

cancer. For the development of such targeting approaches, it is of pivotal importance to

exploit prostate tumor and tumor environmental specific characteristics which will likely

result in the identification of numerous potential new targets, for which novel liposomal

anticancer drugs can be designed and developed. Ultimately, this may lead to the

development of highly efficient and specific liposomal drug carriers for the treatment of

advanced prostate cancer.

Acknowledgements

This study was supported by a grant from the NanoNextNL Drug Delivery Programme (3-

D), project number 03D.01.

Chapter 2

46

References

1. Lammers, T., Kiessling, F., Hennink, W.E. & Storm, G. Drug targeting to tumors: principles, pitfalls and (pre-) clinical progress. Journal of controlled release : official journal of the Controlled Release Society 161, 175-187 (2012).

2. Arias, J.L. Liposomes in drug delivery: a patent review (2007 - present). Expert opinion on therapeutic patents (2013). 3. Slingerland, M., Guchelaar, H.J. & Gelderblom, H. Liposomal drug formulations in cancer therapy: 15 years along the road.

Drug Discov Today 17, 160-166 (2012). 4. Iyer, A.K., Singh, A., Ganta, S. & Amiji, M.M. Role of integrated cancer nanomedicine in overcoming drug resistance. Advanced

drug delivery reviews (2013). 5. Patterson, S.G., et al. Novel role of Stat1 in the development of docetaxel resistance in prostate tumor cells. Oncogene 25,

6113-6122 (2006). 6. de Barros, A.L., et al. Long-circulating, pH-sensitive liposomes versus long-circulating, non-pH-sensitive liposomes as a delivery

system for tumor identification. Journal of biomedical nanotechnology 9, 1636-1643 (2013). 7. Kaasgaard, T. & Andresen, T.L. Liposomal cancer therapy: exploiting tumor characteristics. Expert opinion on drug delivery 7,

225-243 (2010). 8. Sawant, R.R. & Torchilin, V.P. Challenges in development of targeted liposomal therapeutics. AAPS J 14, 303-315 (2012). 9. Fenske, D.B., Chonn, A. & Cullis, P.R. Liposomal nanomedicines: an emerging field. Toxicologic pathology 36, 21-29 (2008). 10. Maurer, N., Fenske, D.B. & Cullis, P.R. Developments in liposomal drug delivery systems. Expert opinion on biological therapy

1, 923-947 (2001). 11. Peer, D., et al. Nanocarriers as an emerging platform for cancer therapy. Nat Nanotechnol 2, 751-760 (2007). 12. Yuan, F., et al. Vascular permeability in a human tumor xenograft: molecular size dependence and cutoff size. Cancer research

55, 3752-3756 (1995). 13. Hashizume, H., et al. Openings between defective endothelial cells explain tumor vessel leakiness. The American journal of

pathology 156, 1363-1380 (2000). 14. Katsogiannou, M., Peng, L., Catapano, C.V. & Rocchi, P. Active-targeted nanotherapy strategies for prostate cancer. Current

cancer drug targets 11, 954-965 (2011). 15. Kirpotin, D.B., et al. Antibody targeting of long-circulating lipidic nanoparticles does not increase tumor localization but does

increase internalization in animal models. Cancer research 66, 6732-6740 (2006). 16. Tannock, I.F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New

England journal of medicine 351, 1502-1512 (2004). 17. Carles, J., et al. Castration-resistant metastatic prostate cancer: current status and treatment possibilities. Clin Transl Oncol

14, 169-176 (2012). 18. Deeken, J.F., et al. A phase I study of liposomal-encapsulated docetaxel (LE-DT) in patients with advanced solid tumor

malignancies. Cancer chemotherapy and pharmacology 71, 627-633 (2013). 19. Hagtvet, E., Roe, K. & Olsen, D.R. Liposomal doxorubicin improves radiotherapy response in hypoxic prostate cancer

xenografts. Radiat Oncol 6, 135 (2011). 20. Banerjee, R., Tyagi, P., Li, S. & Huang, L. Anisamide-targeted stealth liposomes: a potent carrier for targeting doxorubicin to

human prostate cancer cells. International journal of cancer. Journal international du cancer 112, 693-700 (2004). 21. Chen, X., et al. Improved tumor-targeting drug delivery and therapeutic efficacy by cationic liposome modified with truncated

bFGF peptide. Journal of controlled release : official journal of the Controlled Release Society 145, 17-25 (2010). 22. Hagtvet, E., Evjen, T.J., Olsen, D.R., Fossheim, S.L. & Nilssen, E.A. Ultrasound enhanced antitumor activity of liposomal

doxorubicin in mice. J Drug Target 19, 701-708 (2011). 23. Eggen, S., et al. Ultrasound improves the uptake and distribution of liposomal Doxorubicin in prostate cancer xenografts.

Ultrasound Med Biol 39, 1255-1266 (2013). 24. Jantscheff, P., et al. Liposomal gemcitabine (GemLip)-efficient drug against hormone-refractory Du145 and PC-3 prostate

cancer xenografts. The Prostate 69, 1151-1163 (2009). 25. Jantscheff, P., et al. Anti-metastatic effects of liposomal gemcitabine in a human orthotopic LNCaP prostate cancer xenograft

model. Clin Exp Metastasis 26, 981-992 (2009). 26. Bode, C., et al. Paclitaxel encapsulated in cationic liposomes: a new option for neovascular targeting for the treatment of

prostate cancer. Oncology reports 22, 321-326 (2009). 27. Pinto, A.C., Moreira, J.N. & Simoes, S. Liposomal imatinib-mitoxantrone combination: formulation development and

therapeutic evaluation in an animal model of prostate cancer. The Prostate 71, 81-90 (2011). 28. Smith, L.A., et al. Cardiotoxicity of anthracycline agents for the treatment of cancer: systematic review and meta-analysis of

randomised controlled trials. BMC cancer 10, 337 (2010). 29. Chang, H.I. & Yeh, M.K. Clinical development of liposome-based drugs: formulation, characterization, and therapeutic efficacy.

International journal of nanomedicine 7, 49-60 (2012). 30. Vilner, B.J., John, C.S. & Bowen, W.D. Sigma-1 and sigma-2 receptors are expressed in a wide variety of human and rodent

tumor cell lines. Cancer research 55, 408-413 (1995). 31. Garde, S.V., et al. Binding and internalization of NGR-peptide-targeted liposomal doxorubicin (TVT-DOX) in CD13-expressing

cells and its antitumor effects. Anticancer Drugs 18, 1189-1200 (2007). 32. Rogers, T.L. & Holen, I. Tumour macrophages as potential targets of bisphosphonates. J Transl Med 9, 177 (2011). 33. Miselis, N.R., Wu, Z.J., Van Rooijen, N. & Kane, A.B. Targeting tumor-associated macrophages in an orthotopic murine model

of diffuse malignant mesothelioma. Molecular cancer therapeutics 7, 788-799 (2008). 34. Banciu, M., Metselaar, J.M., Schiffelers, R.M. & Storm, G. Antitumor activity of liposomal prednisolone phosphate depends on

the presence of functional tumor-associated macrophages in tumor tissue. Neoplasia 10, 108-117 (2008).


35. Roelofs, A.J., Thompson, K., Ebetino, F.H., Rogers, M.J. & Coxon, F.P. Bisphosphonates: molecular mechanisms of action and effects on bone cells, monocytes and macrophages. Current pharmaceutical design 16, 2950-2960 (2010).

36. Marra, M., et al. New self-assembly nanoparticles and stealth liposomes for the delivery of zoledronic acid: a comparative study. Biotechnol Adv 30, 302-309 (2012).

37. Marra, M., et al. Nanotechnologies to use bisphosphonates as potent anticancer agents: the effects of zoledronic acid encapsulated into liposomes. Nanomedicine : nanotechnology, biology, and medicine 7, 955-964 (2011).

38. Hiraoka, K., et al. Inhibition of bone and muscle metastases of lung cancer cells by a decrease in the number of monocytes/macrophages. Cancer science 99, 1595-1602 (2008).

39. Kim, S.W., et al. Consistent interactions between tumor cell IL-6 and macrophage TNF-alpha enhance the growth of human prostate cancer cells in the bone of nude mouse. International immunopharmacology 11, 862-872 (2011).

40. Hengst, V., Oussoren, C., Kissel, T. & Storm, G. Bone targeting potential of bisphosphonate-targeted liposomes. Preparation, characterization and hydroxyapatite binding in vitro. International journal of pharmaceutics 331, 224-227 (2007).

41. Anada, T., Takeda, Y., Honda, Y., Sakurai, K. & Suzuki, O. Synthesis of calcium phosphate-binding liposome for drug delivery. Bioorg Med Chem Lett 19, 4148-4150 (2009).

42. Wang, G., Mostafa, N.Z., Incani, V., Kucharski, C. & Uludag, H. Bisphosphonate-decorated lipid nanoparticles designed as drug carriers for bone diseases. J Biomed Mater Res A 100, 684-693 (2012).

43. Reed, J.C. Dysregulation of apoptosis in cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 17, 2941-2953 (1999).

44. Sonoke, S., et al. Tumor regression in mice by delivery of Bcl-2 small interfering RNA with pegylated cationic liposomes. Cancer research 68, 8843-8851 (2008).

45. Leenders, F., et al. PKN3 is required for malignant prostate cell growth downstream of activated PI 3-kinase. The EMBO journal 23, 3303-3313 (2004).

46. Aleku, M., et al. Atu027, a liposomal small interfering RNA formulation targeting protein kinase N3, inhibits cancer progression. Cancer research 68, 9788-9798 (2008).

47. Pal, A., et al. Systemic delivery of RafsiRNA using cationic cardiolipin liposomes silences Raf-1 expression and inhibits tumor growth in xenograft model of human prostate cancer. International journal of oncology 26, 1087-1091 (2005).

48. Pei, J., et al. Combination with liposome-entrapped, ends-modified raf antisense oligonucleotide (LErafAON) improves the anti-tumor efficacies of cisplatin, epirubicin, mitoxantrone, docetaxel and gemcitabine. Anticancer Drugs 15, 243-253 (2004).

49. Shao, L., et al. Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors. Clinical cancer research : an official journal of the American Association for Cancer Research 18, 6648-6657 (2012).

50. Xiang, B., et al. PSA-responsive and PSMA-mediated multifunctional liposomes for targeted therapy of prostate cancer. Biomaterials 34, 6976-6991 (2013).

51. Bisanz, K., et al. Targeting ECM-integrin interaction with liposome-encapsulated small interfering RNAs inhibits the growth of human prostate cancer in a bone xenograft imaging model. Mol Ther 12, 634-643 (2005).

52. Flaherty, K.T., Malkowicz, S.B. & Vaughn, D.J. Phase I study of weekly liposome-encapsulated doxorubicin in patients with advanced, androgen-independent prostate cancer. Am J Clin Oncol 27, 136-139 (2004).

53. Harris, K.A., Harney, E. & Small, E.J. Liposomal doxorubicin for the treatment of hormone-refractory prostate cancer. Clin Prostate Cancer 1, 37-41 (2002).

54. Montanari, M., et al. Phase II trial of non-pegylated liposomal doxorubicin and low-dose prednisone in second-line chemotherapy for hormone-refractory prostate cancer. Tumori 98, 696-701 (2012).

55. Hubert, A., Lyass, O., Pode, D. & Gabizon, A. Doxil (Caelyx): an exploratory study with pharmacokinetics in patients with hormone-refractory prostate cancer. Anticancer Drugs 11, 123-127 (2000).

56. Heidenreich, A., et al. Prospective randomized Phase II trial of pegylated doxorubicin in the management of symptomatic hormone-refractory prostate carcinoma. Cancer 101, 948-956 (2004).

57. McMenemin, R., Macdonald, G., Moffat, L. & Bissett, D. A phase II study of caelyx (liposomal doxorubicin) in metastatic carcinoma of the prostate: tolerability and efficacy modification by liposomal encapsulation. Investigational new drugs 20, 331-337 (2002).

58. Fossa, S.D., et al. Liposomal doxorubicin (Caelyx) in symptomatic androgen-independent prostate cancer (AIPC)--delayed response and flare phenomenon should be considered. Scand J Urol Nephrol 36, 34-39 (2002).

59. Kouroussis, C., et al. Phase I study of weekly docetaxel and liposomal doxorubicin in patients with advanced solid tumors. Oncology 69, 202-207 (2005).

60. Budman, D.R., Calabro, A. & Kreis, W. Synergistic and antagonistic combinations of drugs in human prostate cancer cell lines in vitro. Anticancer Drugs 13, 1011-1016 (2002).

61. Lotem, M., et al. Skin toxic effects of polyethylene glycol-coated liposomal doxorubicin. Arch Dermatol 136, 1475-1480 (2000). 62. Uziely, B., et al. Liposomal doxorubicin: antitumor activity and unique toxicities during two complementary phase I studies.

Journal of clinical oncology : official journal of the American Society of Clinical Oncology 13, 1777-1785 (1995). 63. O'Brien, M.E., et al. Reduced cardiotoxicity and comparable efficacy in a phase III trial of pegylated liposomal doxorubicin HCl

(CAELYX/Doxil) versus conventional doxorubicin for first-line treatment of metastatic breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO 15, 440-449 (2004).

64. Liu, C.Y., et al. M2-polarized tumor-associated macrophages promoted epithelial-mesenchymal transition in pancreatic cancer cells, partially through TLR4/IL-10 signaling pathway. Lab Invest 93, 844-854 (2013).

65. Qian, B.Z. & Pollard, J.W. Macrophage diversity enhances tumor progression and metastasis. Cell 141, 39-51 (2010). 66. Sturge, J., Caley, M.P. & Waxman, J. Bone metastasis in prostate cancer: emerging therapeutic strategies. Nature reviews.

Clinical oncology 8, 357-368 (2011).

Chapter 2

48

Chapter 3

Liposomal Delivery of Dexamethasone Attenuates Prostate Cancer Bone

Metastatic Tumor Growth In Vivo

Jan Kroon1,2

Jeroen T. Buijs1

Geertje van der Horst1

Henry Cheung1

Maaike van der Mark1

Louis van Bloois3

Larissa Y. Rizzo4

Twan Lammers2,3,4

Rob C. Pelger1

Gert Storm2,3



1 Department of Urology, Leiden University Medical Center, Leiden, the Netherlands

2 Department of Targeted Therapeutics, MIRA Institute for Biological Technology and Technical Medicine, University of Twente, Enschede, the Netherlands

3 Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, the Netherlands

4 Department of Experimental Molecular Imaging, University Clinic and Helmholtz Institute for Biomedical Engineering, RWTH-Aachen University, Aachen, Germany

The Prostate. 2015 Jun; 75(8):815-24.

Chapter 3

50

Abstract

The inflammatory tumor microenvironment, and more specifically the tumor-associated

macrophages, plays an essential role in the development and progression of prostate

cancer towards metastatic bone disease. Tumors are often characterized by a leaky

vasculature, which - combined with the prolonged circulation kinetics of liposomes -

leads to efficient tumor localization of these drug carriers, via the so-called enhanced

permeability and retention (EPR) -effect. In this study, we evaluated the utility of

targeted, liposomal drug delivery of the glucocorticoid dexamethasone in a model of

prostate cancer bone metastases. Tumor-bearing Balb-c nu/nu mice were treated

intravenously with 0.2-1.0-5.0 mg/kg/week free- and liposomal DEX for 3-4 weeks and

tumor growth was monitored by bioluminescent imaging. Intravenously administered

liposomes localize efficiently to bone metastases in vivo and treatment of established

bone metastases with (liposomal) dexamethasone resulted in a significant inhibition of

tumor growth up to 26 days after initiation of treatment. Furthermore, 1.0 mg/kg

liposomal dexamethasone significantly outperformed 1.0 mg/kg free dexamethasone,

and was found to be well tolerated at clinically relevant dosages that display potent

anti-tumor efficacy. In conclusion, liposomal delivery of the glucocorticoid

dexamethasone inhibits the growth of malignant bone lesions. We believe that

liposomal encapsulation of dexamethasone offers a promising new treatment option for

advanced, metastatic prostate cancer which supports further clinical evaluation.

Liposomal Delivery of Dexamethasone Attenuates Prostate Cancer Bone Metastatic Tumor Growth In Vivo

Introduction

Prostate cancer is the most common cancer type in males and the second leading cause

of death from cancer1. If detected in early stage (i.e. exclusively localized in the

prostate), prostatectomy and radiotherapy provide efficient treatment options. Bone

metastases are prevalent in approximately 90% of patients with advanced prostate

cancer, and for this stage, no curative treatment options are currently available,

stressing the need for novel treatment options.

In primary and metastatic cancers, tumor cells closely interact with different cell types

and the extracellular matrix constituting the stromal compartment. It is increasingly

recognized that tumor-associated inflammation plays a pivotal role in several stages of

cancer carcinogenesis, dissemination and metastasis2-4, and multiple types of

inflammatory cells have been described to contribute to prostate cancer tumorigenesis5.

Neoplastic cells may activate various types of stromal cells and, conversely, activated

stromal cells secrete additional growth factors, which further favor cancer cell

proliferation and invasion. For instance, tumor-associated macrophages (TAM) have

been shown to contribute to migration6, angiogenesis7 and chemotherapy-resistance8.

Based on this tumor growth-stimulating nature of pro-inflammatory stromal cells,

interference with tumor-associated inflammation provides a promising, yet

underexplored, approach to combat cancer9. For this purpose, glucocorticoids (GC)10,

such as dexamethasone (DEX), are highly effective anti-inflammatory drugs that are also

used as add-on in chemotherapy for palliative purposes in prostate cancer treatment.

Strikingly, it has remained unclear whether GC indeed confer an additional therapeutic

benefit by modulating tumor-associated inflammation. It has been speculated that high

tumor concentrations of GC are needed to achieve such a specific antitumor effect11.

Clearly, such tissue concentrations can only be achieved by high and frequent GC dosing,

which inevitably entails the well-known range of detrimental GC-related side effects,

providing a possible explanation for their limited use in cancer therapy10.

Over the last few decades, tumor-targeted liposomal drug delivery has become an

emerging therapeutic strategy. Many tumors are characterized by a leaky vasculature

and poor lymphatic drainage. Specifically designed long-circulating liposomes have the

ability to extravasate and slowly accumulate in tumor tissue after intravenous

Chapter 3

52

administration which is commonly referred to as the enhanced permeability and

retention (EPR)-effect12. The abundance of TAM and their efficient phagocytizing

capacity provide the rationale for the use of liposomes for the efficient delivery of anti-

inflammatory drugs to the supportive tumor microenvironment. Liposomes typically

reduce the exposure of healthy tissues to the encapsulated drug, which can significantly

reduce the toxicity of the therapeutic. These characteristics therefore justify the use of

long-circulating liposome drugs in the treatment of cancer, as exemplified e.g. by

liposomal doxorubicin (i.e. Doxil/Caelyx)13. For prostate cancer, antitumor responses of

liposomal cytotoxic drugs were observed in several relevant preclinical models in vivo14

and in clinical studies15 (reviewed in 16).

Long-circulating liposomal delivery of GC is a therapeutic strategy that is under

development for inflammatory diseases and has been demonstrated to exert beneficial

effects in experimentally-induced arthritis17 and preclinical models of cancer11,18.

Surprisingly, the utility of liposomal GC in (pre)clinical prostate cancer studies has not

been explored to date. Given the current use of GC in advanced prostate cancer as a

chemotherapy add-on, the clinical translation of liposomal GC could be straightforward

if proven efficacious. In this study, we evaluated the efficacy of liposomal vs free DEX in

a preclinical model of metastatic bone disease in human prostate cancer. Furthermore,

the pharmacokinetic profile and toxicology of liposomal and free DEX were established.

Materials & Methods

Preparation of liposomes

Liposomal DEX was prepared using the ethanol injection method19, encapsulating

dexamethasone disodium phosphate (Buma, Uitgeest, the Netherlands) with

poly(ethylene glycol) 2000-distearoylphosphatidylethanolamine (DSPE-PEG-2000),

dipalmitoylphosphati-dylcholine (DPPC), (both Lipoid GmbH, Ludwigshafen, Germany)

and cholesterol (CHOL; Sigma, St Louis, USA) in a 0.15:1.85:1.00 molar ratio. Multiple

rounds of extrusion through polycarbonate membranes (final pore sizes of 100 nm/100

nm; Nuclepore, Pleasanton, USA) were performed and unencapsulated DEX was

removed with the tangential flow filtration unit (Pall minimate, Pall Millipore,


Mijdrecht, the Netherlands). Mean particle size was determined using dynamic light

scattering and the amount of encapsulated DEX was determined with high performance

liquid chromatography as described previously17.

Alexa-750-labeled liposomes were prepared by post-insertion of micelles. Briefly,

micelles were prepared by mixing DSPE-NH2-PEG-2000 and DSPE-PEG-2000 (both Avanti

Polar Lipids, Birmingham, USA) in a 1:1 molar ratio to enable covalent attachment of

Alexa-750-succinimidyl to the NH2-terminus of the PEG-conjugates. Subsequently,

micelles were incubated with the liposomes at 60ᵒC degrees to allow post-insertion of

the PEG-conjugates.

Cell lines and culture conditions

The human osteotropic prostate cancer cell line PC-3M-Pro4luc2, that stably express

firefly luciferase-2, was cultured in Dulbecco’s modified Eagle’s medium

(LifeTechnologies, Bleiswijk, the Netherlands) supplemented 10% FCII (ThermoScientific,

Waltham, USA) and 800 µg/mL G-418/neomycin (LifeTechnologies). Cell lines were

maintained in a humidified incubator at 37⁰C and 5% CO2.

Animal studies

Seven week old male athymic mice (Balb/c nu/nu, Charles River, L’Arbresle, France)

were housed under sterile conditions. All animal experiments were approved by the

local committee for animal health, ethics and research of Leiden University (DEC12013).

Single cell suspensions of PC-3M-Pro4luc2 cells (50000 cells/10 µL PBS) were injected in

both tibiae as described previously20. Tumor growth was monitored by bioluminescent

imaging (BLI). Liposomal localization was examined by fluorescent imaging after

intravenous injection of Alexa-750-labeled liposomes both using the Caliper Lumina

imaging system (PerkinElmer, Groningen, the Netherlands). Tumors and other organs

were measured ex vivo directly after sacrifice.

In the therapeutic studies, treatment with free- and liposomal DEX was initiated 15 days

after tumor inoculation and administered by weekly intravenous injection (N=5 mice per

group with a tumor in both tibiae). Tumor growth was monitored for up to 21-26 days

Chapter 3

54

post-treatment. At the end of the experiment, mice were sacrificed and tibiae were

collected for further histological analysis.

Histological analysis

After fixation with 4% PFA for 24 hours, tibiae were decalcified in 10% EDTA for 10 days

and tissues were paraffin-embedded. F4/80 and Goldner stainings were performed on 5

µM thick decalcified tissue sections20. For the F4/80 staining, sections were

deparaffinated, rehydrated and treated with H2O2 before antigen retrieval using

proteinase-K. After blocking, sections were incubated with rat-anti-mouse F4/80

primary antibody (Serotec, Oxford, UK) and secondary anti-rat immPRESS reagent

(Vectorlabs, Burlingame, USA). Goldner staining was performed as described

previously21.

Toxicology and pharmacokinetic studies

Toxicity and pharmacokinetic studies were performed at Bracco Imaging SpA (Colleretto

Giacosa, TO, Italy). Male, 5 week old, CD Sprague Dawley IGS BR rats were treated

intravenously with vehicle, liposomal DEX (0.2-1.0-5.0 mg/kg/week) or free DEX

(5x1.0mg/kg/week) for a total of four weeks. Clinical signs, body weight and clinical

pathology were evaluated and blood was collected at several time points. Plasma

concentrations of DEX were measured using a validated bioanalytical UPLC-MS assay. At

the end of the study, animals were subjected to gross pathology examination and

tissues were collected for histopathological analysis.

Results

Liposomes localize to malignant bone lesions in vivo

Liposomes have the propensity to localize to solid tumors due to the EPR-effect. In mice

with established bone lesions (with presence of F4/80+ TAM, Fig. 1a), we confirmed the

EPR-effect in real-time by sensitive, non-invasive fluorescence imaging of intravenously

administered Alexa-750-labeled liposomes (Fig . 1b). Besides metastatic lesions, also

known sites for liposomal localization (i.e. liver and spleen) showed strong accumulation

while other non-target organs were largely negative (Fig. 1c).


Figure 1: The presence of tumor-associated macrophages (TAM) and localization of fluorescent liposomes in bone lesions of human prostate cancer (A) Immunolocalization of F4/80+ TAM in the tumor microenvironment of prostate cancer cells growing in bone (arrows). T=tumor, B=bone. (B) Alexa-750-labeled liposomes localize efficiently to malignant bone lesions (tibiae) at 6, 24 and 48 hours after intravenous injection. BLI=bioluminescent imaging. (C) Ex vivo fluorescence in organs of mice injected with Alexa-750-labeled liposomes show strong tumor, liver and spleen localization.

Liposomal DEX in an intra-bone tumor model in mice

Treatment of established malignant bone lesions in mice was performed by intravenous

administration of vehicle, free- and liposomal DEX at day 15 after the intratibial

inoculation of PC-3M-Pro4luc2 tumor cells (Fig. 2a). At all dose levels (i.e. 0.2, 1.0 and

5.0 mg/kg), both free- and liposomal DEX led to a significant inhibition of intra-bone

tumor growth (Figure 2b-d). For free DEX treatment, only the 5.0 mg/kg dosage seemed

to stand out against the moderate effect seen at lower dosages, whereas liposomal DEX

administration already demonstrated a peak response at 1.0 mg/kg. Strikingly, liposomal

DEX outperformed free DEX administration at the 1.0 mg/kg dosage (p<0.01 at d26, Fig.

2c, Fig. 3a), while similar (non-significant) effects were observed at the 0.2 and 5.0

mg/kg dosages (Fig. 2b, Fig. 2d). Histological evaluation confirmed the profound

antitumor efficacy of (liposomal) DEX at the 1.0 mg/kg dosage, in which low tumor

burden and intact trabeculae were observed in (liposomal) DEX-treated mice compared

to vehicle-treated mice (Fig. 3b).

Chapter 3

56

Figure 2: Treatment with (liposomal) DEX attenuates the growth of experimentally-induced bone metastases (A) Experimental schedule; arrows indicate time of treatment. The antitumor effect of liposomal- and free DEX was compared for the doses (B) 0.2 mg/kg, (C) 1.0 mg/kg and (D) 5.0 mg/kg. ** p<0.01 vs. vehicle; *** p<0.001 vs. vehicle; $$ p<0.01; N.S. = not significant.


Figure 3: Representative whole-body bioluminescent images and Goldner staining of tumor-bearing tibiae treatment with 1.0 mg/kg (liposomal) DEX (A) Bioluminescent images and (B) Goldner staining of tibiae upon treatment with (liposomal) DEX reveal decreased intra-bone tumor burden. T=tumor.

In parallel with the evaluation of the antitumor efficacy of free- and liposomal DEX in

mice, changes in body weight were studied to assess the systemic adverse effect of GC.

At clinically relevant, lower doses (i.e. 0.2 and 1.0 mg/kg), no significant differences

between treatment groups were observed in mice (Fig. 4a-b), with the exception of 1.0

mg/kg liposomal DEX at day 9 of treatment. This, however, recovered at later time

points (Fig. 4b). At the highest 5.0 mg/kg dose level, significant weight loss was observed

in mice treated with liposomal DEX, but not free DEX (p<0.001 at day 19, Fig. 4c). This

enhanced weight loss of liposomal DEX at high dosages compared to free DEX may be

explained by the delayed clearance of liposomal DEX, as opposed to the rapid clearance

of free DEX (Table 1).

Chapter 3

58

Figure 4: The effect of (liposomal) DEX on body weight of nude mice The effect of (A) 0.2 mg/kg, (B) 1.0 mg/kg and (C) 5.0 mg/kg (liposomal) DEX on the body weight of nude mice. Treatment at day 0, 7 and 14. ** p<0.01 vs. vehicle; $ p<0.05 vs. free DEX; $$ p<0.01 vs. free DEX; $$$ p<0.001 vs. free DEX.

Pharmacokinetics and toxicity assessment of liposomal DEX in rats

In order to characterize the pharmacokinetics and the toxicology of liposomal DEX, we

subsequently performed a multiple-dose study in healthy rats comparing weekly

administration of liposomal DEX (0.2, 1.0 and 5.0 mg/kg) with daily administration of 1.0

mg/kg free DEX (cumulative dose 5.0 mg/kg weekly; equal to highest dose level of


liposomal DEX) (Suppl. Table 1). When comparing the pharmacokinetics of 1.0 mg/kg

liposomal DEX with a single dose of 1.0 mg/kg free DEX, a strong increase in initial

plasma concentration (Cmax, 3-fold increase), circulation half-life (t½) and the area under

the curve (AUC, 100 times larger) was observed (Table 1).

Liposomal DEX Free DEX

1.0 mg/kg 1.0 mg/kg

Male Female Male Female

Day 1 (first treatment)

Tmax (hours)

0.083 0.083 0.083 0.083

Cmax (µg/mL)

17.5 21.0 6.48 5.91

AUC0-t (µg*min/mL)

10581 8071 103.8 89.6

Terminal half-life (T½) (mins) 439 283 0.083 0.42

Clearance (mL min-1 kg-1) 439 0.124 8543 3968

Volume of distribution Vz (mL/kg) 62.0 50.2 688 2161

Day 22/28 (last treatment)

Tmax (hours)

0.083 0.083 0.083 0.083

Cmax (µg/mL)

23.0 20.9 7.94 5.92

AUC0-t (µg*min/mL)

15089 9890 129.0 86.6

AUC0-t/dose (µg*h/mL) (mg/kg) 914 700 0.143 0.207

Clearance (mL min-1 kg-1) 0.0663 0.1011 6885 4104

Volume of distribution Vz (mL/kg) 48.2 47.6 27.6 26.2

Table 1: Pharmacokinetics of (liposomal) DEX in a multiple dose study in CD Sprague Dawley rats

Chapter 3

60

Despite the increase in total exposure to DEX, our study did not reveal increased toxicity

attributable to the liposomal DEX formulation: both 5.0 mg/kg liposomal DEX and

5x1.0mg/kg free DEX showed comparable GC-related toxicity in terms of reduced weight

gain (Suppl. Fig. 1), creatinine levels (Suppl. Table 2), white blood cell count (WBC)

(Suppl. Table 3), and organ weight (Suppl. Table 4), which were all anticipated at these

dose levels. Compared to equal doses of free DEX, high dose (5.0mg/kg) liposomal DEX

increased serum levels of liver enzymes (Glutamic-pyruvic transaminase (GPT) and

glutamic-oxaloacetic transaminase (GOT)) (Suppl. Table 2) and showed slightly higher

liver toxicity in histopathologic evaluation (‘increased mild infarct and necrosis’) (Suppl.

Table 5), which likely is a consequence of the well-known redistribution and preferred

localization of intravenously administered liposomes to the liver. Taken together,

liposomal DEX induces a similar toxicity profile compared to free DEX while enhancing

the antitumor efficacy in experimentally-induced bone metastases, thus increasing the

therapeutic index.

Discussion

In this study we show, for the first time, a pronounced and sustained antitumor efficacy

of liposome-encapsulated DEX in a preclinical model of metastatic prostate cancer. We

demonstrate a considerable EPR-effect in experimentally-induced bone metastases as

liposomes preferentially and efficiently localize at the site of malignant bone lesions.

Furthermore, liposomal encapsulation of DEX significantly enhanced its antitumor

efficacy at dose level 1.0 mg/kg/week (compared to non-encapsulated DEX), whereas

similar trends were observed for other dosages. Our data in metastatic disease are in

line with the enhanced antitumor efficacy of liposomal GC reported in other unrelated

tumor models11,22. In those studies, liposomes predominantly localize to TAM, indicating

a key role of these cells in mediating the antitumor activity of liposomal GC11,23. The

glucocorticoid receptor (GR), the receptor for dexamethasone, was highly expressed in

50% of prostate cancer specimens24, but is predominantly associated with cancer-

associated stromal cells, while the actual prostate cancer cells only expressed low levels

of GR25. This supports the notion that mainly stromal cells, including TAM, are targeted

with liposomal drug delivery.


TAM are known to secrete a wide range of cytokines that support tumor growth, and a

notable example is interleukin-6 (IL-6)4. In addition to production of IL-6 by cancer

cells26, malignant cells can also induce IL-6 secretion by reactive stromal cells in the

bone microenvironment, which in turn facilitates metastatic outgrowth27. Generally, IL-6

is involved in proliferation, apoptosis, migration, invasion, angiogenesis and the

maintenance of prostate cancer stem cells28,29, thereby strongly contributing to prostate

carcinogenesis. It has been documented that DEX30 and liposomal DEX31,32 inhibit

expression and secretion of IL-6 in macrophages and monocyte-like cells. Decreased IL-6

secretion by stromal could contribute to the antitumor effect on malignant bone lesions

we observe with liposomal DEX.

In the context of bone metastases, the effects of DEX on cells of the bone

microenvironment are of special interest. GC have been described to reduce osteoblast

function, induce osteocyte apoptosis and enhance osteoclast differentiation33. In

contrast to the antitumor effect observed in our studies, DEX may thus be potentially

stimulatory for tumor growth by enhancing osteoclastic bone resorption, leading to the

release of bone matrix-bound growth factors beneficial for bone metastasis growth34.

Interestingly, liposomal encapsulation of GC was previously found to block osteoclast

differentiation and to reduce osteoclastic bone resorption35, which may also contribute

to the superior antitumor effects of our liposomal formulation of DEX vs free DEX

administration.

Although the apparent uptake of liposomal DEX in the bone lesions seems to be

mediated by TAM, direct effects of (liposomal) DEX on tumor cells cannot be fully

excluded as PC-3M-Pro4luc2 cells express the glucocorticoid receptor (GR). At present,

the use of free GC in the treatment of prostate cancer is controversial and subject of a

vivid clinical debate. On the one hand, direct, growth-inhibitory effects of GR agonists

(including DEX) have been found in GR-positive prostate tumors36 and clinical studies

demonstrated antitumor efficacy of DEX treatment in advanced prostate cancer

patients37. Recent contrasting evidence indicates that resistance to anti-androgens may

be mediated by GR overexpression38 and that (non-liposomal) GC can induce resistance

to chemotherapy39. Liposomal encapsulation may, however, prevent this as TAM are the

main target cells. Despite potential involvement in therapy resistance, GC are still the

standard-of-care in advanced prostate cancer in combination with chemotherapy.

Chapter 3

62

In general, liposomal delivery can reduce toxicity of the encapsulated drug. However,

one needs to be aware of the manifestation of potential new toxicities due to the

altered drug distribution as a result of liposomal encapsulation. An illustration of this is

the use of PEGylated liposomal doxorubicin (i.e. Doxil/Caelyx) in clinical prostate cancer.

Typically, increased skin- and mucosal toxicities are observed upon liposomal

encapsulation of doxorubicin, whereas a decrease of cardiotoxicity was found, which is

the major problem with systemic free doxorubicin treatment40. Based on this, it is

imperative to monitor new toxicities related to liposomal GC. So far, our results show

that liposomal encapsulation of DEX does not yield unexpected safety issues beyond the

well-known toxicity of exogenous GC exposure. Lower dosages (0.2-1.0 mg/kg) of

liposomal DEX were generally well tolerated in both mice and rats. Indeed, toxicities

with high dosages of liposomal GC were reported (i.e. body weight loss, decreased

number of WBC)22,23, but these can mostly be attributed to systemic GC exposure in

general. Our toxicity studies in rats showed comparable toxicity (changes in several

serum parameters and organ sizes) with equal cumulative dosages of free and liposomal

DEX (5.0 mg/kg).

Only for the liver, an organ with substantial liposome uptake via Kupffer cells, increased

toxicity was observed. Despite the dramatically increased AUCs of liposomal DEX, there

was no significant increase of overall toxicity of liposomal DEX versus an equal

cumulative dose of free DEX. These observations support the notion that the majority of

the liposomal DEX measured in plasma indeed remains entrapped in inactive form

within the liposomes thus avoiding potential systemic adverse effects. Anticipating that

the tumor tissue is directly accessible from the blood compartment (a consequence of

enhanced local vascular permeability) we postulate that the elevated plasma levels of

liposomal DEX also lead to increased DEX concentrations in the tumor

microenvironment (i.e. TAM), thus explaining the augmented antitumor response in our

study. Locally present enzymes may be responsible for release and conversion of the

inactive liposomal drug into high tissue levels of active DEX. These high levels of DEX in

the tumor microenvironment may subsequently dampen tumor-associated

inflammation and thereby inhibit the growth of bone metastatic disease.

In conclusion, our preclinical study shows more potent, and sustained, antitumor effects

of liposomal DEX versus free DEX in metastatic bone disease from human prostate


cancer. The beneficial effects of DEX in a liposomal formulation are presumably

mediated via the supportive tumor microenvironment, in particular TAM, rather than

via a direct effect on the metastatic tumor cells. Moreover, liposomal DEX delivery is

well tolerated at dose levels that display strong antitumor efficacy. We believe these

experimental data warrant the clinical evaluation of liposomal DEX in metastatic

prostate cancer.

Acknowledgements

This study was supported by a grant from the NanoNextNL Drug Delivery programme

03D.01 and by the European Research Council (ERC Starting Grant-309494:NeoNaNo).

JTB was supported by the Netherlands Organisation for Scientific Research (NWO, VENI-

grant-916.131.10). GH and MM were supported by the Dutch Cancer Society (UL-2011-

4030). HC was supported by PRONET (International innovation grant).

Chapter 3

64

References

1. Siegel, R., Naishadham, D. & Jemal, A. Cancer statistics, 2013. CA: a cancer journal for clinicians 63, 11-30 (2013). 2. Mantovani, A., Allavena, P., Sica, A. & Balkwill, F. Cancer-related inflammation. Nature 454, 436-444 (2008). 3. Pietras, K. & Ostman, A. Hallmarks of cancer: interactions with the tumor stroma. Experimental cell research 316, 1324-1331

(2010). 4. Vendramini-Costa, D.B. & Carvalho, J.E. Molecular link mechanisms between inflammation and cancer. Current

pharmaceutical design 18, 3831-3852 (2012). 5. Fang, L.Y., et al. Infiltrating macrophages promote prostate tumorigenesis via modulating androgen receptor-mediated CCL4-

STAT3 signaling. Cancer research 73, 5633-5646 (2013). 6. Liu, C.Y., et al. M2-polarized tumor-associated macrophages promoted epithelial-mesenchymal transition in pancreatic cancer

cells, partially through TLR4/IL-10 signaling pathway. Lab Invest 93, 844-854 (2013). 7. Ono, M. Molecular links between tumor angiogenesis and inflammation: inflammatory stimuli of macrophages and cancer

cells as targets for therapeutic strategy. Cancer science 99, 1501-1506 (2008). 8. Zheng, Y., et al. Macrophages are an abundant component of myeloma microenvironment and protect myeloma cells from

chemotherapy drug-induced apoptosis. Blood 114, 3625-3628 (2009). 9. Tang, X., Mo, C., Wang, Y., Wei, D. & Xiao, H. Anti-tumour strategies aiming to target tumour-associated macrophages.

Immunology 138, 93-104 (2013). 10. Rhen, T. & Cidlowski, J.A. Antiinflammatory action of glucocorticoids--new mechanisms for old drugs. The New England

journal of medicine 353, 1711-1723 (2005). 11. Schiffelers, R.M., et al. Liposome-encapsulated prednisolone phosphate inhibits growth of established tumors in mice.

Neoplasia 7, 118-127 (2005). 12. Lammers, T., Kiessling, F., Hennink, W.E. & Storm, G. Drug targeting to tumors: principles, pitfalls and (pre-) clinical progress.

Journal of controlled release : official journal of the Controlled Release Society 161, 175-187 (2012). 13. Lyseng-Williamson, K.A., Duggan, S.T. & Keating, G.M. Pegylated liposomal doxorubicin: a guide to its use in various

malignancies. BioDrugs : clinical immunotherapeutics, biopharmaceuticals and gene therapy 27, 533-540 (2013). 14. Jantscheff, P., et al. Anti-metastatic effects of liposomal gemcitabine in a human orthotopic LNCaP prostate cancer xenograft

model. Clin Exp Metastasis 26, 981-992 (2009). 15. McMenemin, R., Macdonald, G., Moffat, L. & Bissett, D. A phase II study of caelyx (liposomal doxorubicin) in metastatic

carcinoma of the prostate: tolerability and efficacy modification by liposomal encapsulation. Investigational new drugs 20, 331-337 (2002).

16. Kroon, J., Metselaar, J.M., Storm, G. & van der Pluijm, G. Liposomal nanomedicines in the treatment of prostate cancer. Cancer treatment reviews (2013).

17. Metselaar, J.M., Wauben, M.H., Wagenaar-Hilbers, J.P., Boerman, O.C. & Storm, G. Complete remission of experimental arthritis by joint targeting of glucocorticoids with long-circulating liposomes. Arthritis and rheumatism 48, 2059-2066 (2003).

18. Banciu, M., Schiffelers, R.M., Metselaar, J.M. & Storm, G. Utility of targeted glucocorticoids in cancer therapy. Journal of liposome research 18, 47-57 (2008).

19. Jaafar-Maalej, C., Diab, R., Andrieu, V., Elaissari, A. & Fessi, H. Ethanol injection method for hydrophilic and lipophilic drug-loaded liposome preparation. Journal of liposome research 20, 228-243 (2010).

20. Buijs, J.T., Que, I., Lowik, C.W., Papapoulos, S.E. & van der Pluijm, G. Inhibition of bone resorption and growth of breast cancer in the bone microenvironment. Bone 44, 380-386 (2009).

21. Buijs, J.T., et al. Bone morphogenetic protein 7 in the development and treatment of bone metastases from breast cancer. Cancer research 67, 8742-8751 (2007).

22. Banciu, M., Fens, M.H., Storm, G. & Schiffelers, R.M. Antitumor activity and tumor localization of liposomal glucocorticoids in B16 melanoma-bearing mice. Journal of controlled release : official journal of the Controlled Release Society 127, 131-136 (2008).

23. Kluza, E., et al. Anti-tumor activity of liposomal glucocorticoids: The relevance of liposome-mediated drug delivery, intratumoral localization and systemic activity. Journal of controlled release : official journal of the Controlled Release Society 151, 10-17 (2011).

24. Nishimura, K., et al. Potential mechanism for the effects of dexamethasone on growth of androgen-independent prostate cancer. Journal of the National Cancer Institute 93, 1739-1746 (2001).

25. Mohler, J.L., et al. Androgen and glucocorticoid receptors in the stroma and epithelium of prostatic hyperplasia and carcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research 2, 889-895 (1996).

26. Kim, S.W., et al. Consistent interactions between tumor cell IL-6 and macrophage TNF-alpha enhance the growth of human prostate cancer cells in the bone of nude mouse. International immunopharmacology 11, 862-872 (2011).

27. Tawara, K., Oxford, J.T. & Jorcyk, C.L. Clinical significance of interleukin (IL)-6 in cancer metastasis to bone: potential of anti-IL-6 therapies. Cancer management and research 3, 177-189 (2011).

28. Culig, Z. & Puhr, M. Interleukin-6: a multifunctional targetable cytokine in human prostate cancer. Molecular and cellular endocrinology 360, 52-58 (2012).

29. Kroon, P., et al. JAK-STAT blockade inhibits tumor initiation and clonogenic recovery of prostate cancer stem-like cells. Cancer research 73, 5288-5298 (2013).

30. Varga, G., et al. Glucocorticoids induce an activated, anti-inflammatory monocyte subset in mice that resembles myeloid-derived suppressor cells. Journal of leukocyte biology 84, 644-650 (2008).


31. Hofkens, W., Schelbergen, R., Storm, G., van den Berg, W.B. & van Lent, P.L. Liposomal targeting of prednisolone phosphate to synovial lining macrophages during experimental arthritis inhibits M1 activation but does not favor M2 differentiation. PloS one 8, e54016 (2013).

32. Bartneck, M., et al. Liposomal encapsulation of dexamethasone modulates cytotoxicity, inflammatory cytokine response, and migratory properties of primary human macrophages. Nanomedicine : nanotechnology, biology, and medicine 10, 1209-1220 (2014).

33. Henneicke, H., Gasparini, S.J., Brennan-Speranza, T.C., Zhou, H. & Seibel, M.J. Glucocorticoids and bone: local effects and systemic implications. Trends in endocrinology and metabolism: TEM (2014).

34. Casimiro, S., Guise, T.A. & Chirgwin, J. The critical role of the bone microenvironment in cancer metastases. Molecular and cellular endocrinology 310, 71-81 (2009).

35. Hofkens, W., et al. Intravenously delivered glucocorticoid liposomes inhibit osteoclast activity and bone erosion in murine antigen-induced arthritis. Journal of controlled release : official journal of the Controlled Release Society 152, 363-369 (2011).

36. Yemelyanov, A., et al. Novel steroid receptor phyto-modulator compound a inhibits growth and survival of prostate cancer cells. Cancer research 68, 4763-4773 (2008).


38. Arora, V.K., et al. Glucocorticoid receptor confers resistance to antiandrogens by bypassing androgen receptor blockade. Cell 155, 1309-1322 (2013).

39. Zhang, C., et al. Corticosteroid-induced chemotherapy resistance in urological cancers. Cancer biology & therapy 5, 59-64 (2006).

40. Hubert, A., Lyass, O., Pode, D. & Gabizon, A. Doxil (Caelyx): an exploratory study with pharmacokinetics in patients with hormone-refractory prostate cancer. Anticancer Drugs 11, 123-127 (2000).

Chapter 3

66

Supplementary information

Supplementary Figure 1: The effect of (liposomal) DEX on the weight of CD Sprague Dawley rats The effect of 0.2-1.0-5.0 mg/kg liposomal DEX and 5x1.0 mg/kg free DEX on the body weight of healthy rats. Treatment liposomal DEX on day 0, 7, 14 and 21. ** p<0.01 vs. vehicle; *** p<0.001 vs. vehicle.

Treatment group Frequency of dosing Number of animals

Pharmacokinetic Toxicity

Male Female Male Female

1. Vehicle Daily 5 consecutive days per week 8 8 3 3

2. LipoDEX 0.2 mg/kg Weekly 8 8 3 3



5. Free DEX 1.0 mg/kg Daily 5 consecutive days per week 8 8 3 3

Supplementary Table 1: Treatment schedule and group allocation in a multiple-dose study in CD Sprague Dawley rats


Group/Dose

GLUC

(mmol/L)

UREA

(mmol/L)

TRI

(mmol/L)

ALB

(G/L)

AP

(I.U./L)

GPT

(I.U./L)

GOT

(I.U./L)

CREAT

(µmol/L)

TPT

(g/L)

1 - Vehicle MEAN 7.21 4.77 0.42 28.2 137 20.5 65 33.5 0.82

SD 0.85 0.46 0.11 1.1 38 2.8 31 1.9 0.88

2 - LipoDEX 0.2 mg/kg MEAN 7.92 4.4 0.61 29.2 151 19.1 54 30.9 0.23

SD 0.9 0.52 0.19 1.7 33 2.8 6.8 2.2 0.37

3 - LipoDEX 1.0 mg/kg MEAN 6.47 4.64 0.65 28.1 164 25.1 58 26.4*** 0.9

SD 0.87 0.65 0.2 1.1 47 5.3 17 2.2 1.1

4 - LipoDEX 5.0 mg/kg MEAN 8.87** 4.63 0.94 33.2*** 91 59* 99** 24.6*** 0.36

SD 0.97 0.96 0.41 3.7 23 27 20 1.4 0.43

5. Free DEX 5x1.0 mg/kg MEAN 6.18 4.29 0.49 31.2 92 24 59 27.6*** 0.82

SD 0.73 0.58 0.11 2.1 17 6.7 11 2.4 0.87

Supplementary Table 2: Blood chemistry of male CD Sprague Dawley rats treated with (liposomal) DEX ** p<0.01 vs. vehicle; *** p<0.001 vs. vehicle.

Chapter 3

68

Group/Dose

RBC

106/mm3

MCV

µm3

HCT

%

PLT

103/mm3

MPV

µm3

WBC

103/mm3

HB

g/dL

MCH

pg

MCHC

g/dL

1 - Vehicle MEAN 6.31 55.5 34.9 671 5.3 4.3 12.96 20.61 37.2

SD 0.43 2.7 1.2 31 0.11 1.6 0.48 0.93 1

2 - LipoDEX 0.2 mg/kg MEAN 6.72 54 36.21 634 5.38 3.6 13.65 20.32 37.62

SD 0.24 1.9 0.94 62 0.17 1.3 0.46 0.64 0.53

3 - LipoDEX 1.0 mg/kg MEAN 6.78 53.36 36.2 537*** 5.17 1.61*** 13.78 20.3 38.06*

SD 0.32 0.84 1.5 39 0.17 0.53 0.48 0.4 0.46

4 - LipoDEX 5.0 mg/kg MEAN 6.94* 54.8 38.0* 420*** 5.3 1.64*** 14.4** 20.9 38.11*

SD 0.72 3.1 3.2 68 0.15 0.73 1.1 1.1 0.54

5. Free DEX 5x1.0 mg/kg MEAN 7.22** 54.3 39.2*** 517*** 5.22 1.30*** 14.71*** 20.35 37.51

SD 0.26 1.1 1.8 77 0.17 0.39 0.74 0.5 0.32

Supplementary Table 3: Hematology of male CD Sprague Dawley rats treated with (liposomal) DEX * p<0.05 vs. vehcle; ** p<0.01 vs. vehicle; *** p<0.001 vs. vehicle.


Group/Dose

Liver Spleen Kidneys Adrenals Testes Epididymides Thymus Heart

1 - Vehicle MEAN 8.1 0.6 2.33 0.0572 3.08 0.998 0.479 1.1

SD 1.2 0.092 0.36 0.0075 0.36 0.086 0.084 0.13

2 - LipoDEX 0.2 mg/kg MEAN 8.9 0.53 2.44 0.053 3.04 1.018 0.398 1.102

SD 0.54 0.052 0.19 0.006 0.23 0.06 0.032 0.098

3 - LipoDEX 1.0 mg/kg MEAN 7.30 0.34*** 2.27 0.0375*** 2.99 0.925 0.216*** 0.989

SD 0.79 0.059 0.14 0.0076 0.19 0.065 0.056 0.081

4 - LipoDEX 5.0 mg/kg MEAN 6.80* 0.223*** 1.91 0.0180*** 2.95 0.806*** 0.150*** 0.89***

SD 0.75 0.074 0.13 0.0315 0.23 0.066 0.036 0.11

5. Free DEX 5x1.0 mg/kg MEAN 5.77*** 0.271*** 1.89 0.0315*** 2.8 0.786*** 0.238*** 0.870***

SD 0.44 0.038 0.17 0.0055 0.29 0.064 0.086 0.051

Supplementary Table 4: Organ weight of male Sprague Dawley rats treated with (liposomal) DEX

* p<0.05 vs. vehcle; *** p<0.001 vs. vehicle.

Chapter 3

70

Organ Abnormality Vehicle LipoDEX (weekly) Free DEX (daily)

0.2 mg/kg 1.0 mg/kg 5.0 mg/kg 1.0 mg/kg

Male Female Male Female Male Female Male Female Male Female

Adrenal cortex Hypoplasia - - - - - - 6 4 5 1

Bone marrow Fatty change - - - - 7 7 8 8 8 8

Epididymis Vacuolation - - - - - - - - 1 -

Kidney Cyst or cast - - - - - - 2 - - 1

Minimal WBC

infiltration - - - - - - - 1 - -

Liver Hepatocellular

vacuolation - 6 - 4 - 1 5 5 4 5

Mild infarct or

necrosis - - - - - - 1 2 - -

Mandibular lymph

node Atrophy - - - - 1 - 7 8 7 7

Pancreas Islet cell hyperplasia - - 1 - 4 - 8 6 6 5

Spleen Depopulated white

pulp - - 3 - 6 1 8 8 8 8

Stomach Duodenal ulcer - - - - - - - - 1 -

Cell vacuolation

glandular st - - - - - - - - 1 2

Testis Vacuolation - - - - - - - - 1 -

Thymus Involution - - - - 4 3 8 8 8 8

Supplementary Table 5: Necroscopic evaluation of organs and tissues: incidence of abnormalities out of 8 rats per group

Chapter 4

Glucocorticoid Receptor Antagonism Reverts Docetaxel Resistance in

Human Prostate Cancer

Jan Kroon1,2

Martin Puhr3

Jeroen T. Buijs1


Daniëlle M. Hemmer1

Koen A. Marijt4

Ming S. Hwang5

Motasim Masood5

Stefan Grimm5

Gert Storm2,6


Onno C. Meijer7

Zoran Culig3


1 Department of Urology, Leiden University Medical Center, Leiden, the Netherlands; 2 Department of Targeted Therapeutics, MIRA Institute for Biological Technology and Technical Medicine, University of Twente, Enschede, the Netherlands; 3 Department of Urology, Medical University of Innsbruck, Innsbruck, Austria 4 Division of Clinical Oncology, Leiden University Medical Center, Leiden, the Netherlands; 5 Division of Experimental Medicine, Imperial College London, London, United Kingdom; 6 Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, the Netherlands; 7 Department of Endocrinology, Leiden University Medical Center, Leiden, the Netherlands

Endocrine-Related Cancer. 2016 Jan; 23(1):35-45.

Chapter 4

72

Abstract

Resistance to docetaxel is a major clinical problem in advanced prostate cancer.

Although glucocorticoids are frequently used in combination with docetaxel, it is unclear

to what extent glucocorticoids and their receptor, the glucocorticoid receptor (GR),

contribute to chemotherapy resistance. In this study, we aim to elucidate the role of the

GR in docetaxel-resistant prostate cancer in order to improve current prostate cancer

therapies. GR expression was analyzed in a tissue microarray of primary prostate cancer

specimens from chemo-naïve and docetaxel-treated patients, and in cultured prostate

cancer cell lines with acquired docetaxel-resistance (PC3-DR, DU145-DR, 22Rv1-DR). We

found a robust overexpression of GR in primary prostate cancer from docetaxel-treated

patients and enhanced GR levels in cultured docetaxel-resistant human prostate cancer

cells, indicating a key role of GR in docetaxel resistance. The capability of GR antagonists

(RU-486 and cyproterone acetate) to revert docetaxel resistance was investigated and

revealed significant re-sensitization of docetaxel-resistant prostate cancer cells for

docetaxel treatment in a dose- and time-dependent manner, in which a complete

restoration of docetaxel sensitivity was achieved in both AR-negative and AR-positive

cell lines. Mechanistically, we demonstrated down-regulation of Bcl-xL and Bcl-2 upon

GR-antagonism, thereby defining potential treatment targets. In conclusion, we describe

the involvement of the GR in the acquisition of docetaxel resistance in human prostate

cancer. Therapeutic targeting of GR effectively re-sensitizes docetaxel-resistant prostate

cancer cells. These findings warrant further investigation of the clinical utility of GR

antagonists in the management of patients with advanced, docetaxel-resistant prostate

cancer.

Glucocorticoid Receptor Antagonism Reverts Docetaxel Resistance in Human Prostate Cancer

Introduction

Resistance to chemotherapy is a major hurdle in prostate cancer treatment. Although

chemotherapeutic treatments typically display initial benefit, cancer cells frequently

acquire novel characteristics that will render these unresponsive to current cytotoxic

treatments. Docetaxel (Taxotere) is a microtubule-stabilizing agent that is clinically

approved for a range of malignancies, including castration-resistant prostate cancer

(CRPC) for which it is the standard-of-care and prolongs survival of patients1.

Unfortunately, tumors inevitably progress due to acquired docetaxel resistance2. In

addition, docetaxel resistance is often accompanied with cross-resistance, i.e.

dampened efficacy of other antitumor therapeutics and conversely, the use of other

therapeutic agents, e.g. anti-androgens, appears to be associated with emergence of

resistance to docetaxel3. Therefore, the identification of underlying molecular

mechanisms of docetaxel resistance is of pivotal importance to combat docetaxel

resistance in the clinics4.

The glucocorticoid receptor (GR) is a receptor that, upon binding of glucocorticoids (GC)

(e.g. dexamethasone; DEX), regulates gene expression. GC binding to the GR leads to

rapid GR dimerization and subsequent nuclear translocation where it interacts with

glucocorticoid response elements or transcription factors5. Although GCs are frequently

administered to patients with advanced prostate cancer, mainly for anti-emetic

purposes, their usage remains controversial as both pro- and antitumor effects have

been described6. On the one hand, direct antitumor efficacy of DEX has been described

in preclinical7 and clinical studies8. On the other hand, GC use seems associated with

resistance to anti-androgen therapy9,10 and chemotherapy11. Simultaneous DEX

administration was shown to undermine the antitumor effects of paclitaxel in vitro and

in vivo, thus giving rise to chemotherapy resistance11. Our hypothesis holds that GR

antagonism may lead to the reversal of chemotherapy resistance. In this study we

describe that elevated GR expression can mediate chemotherapy resistance and that

interference with canonical GR signaling counteracts docetaxel resistance in prostate

cancer, thus re-sensitizing prostate cancer cells for this chemotherapeutic agent.

Chapter 4

74

Materials and methods

Tissue microarray (TMA) and immunohistochemistry

To examine GR expression in docetaxel-treated PCa tissue specimens, a TMA of

formalin-fixed, paraffin-embedded tissue blocks of 14 PCa patients who underwent neo-

adjuvant chemotherapy with docetaxel before radical prostatectomy and 14 untreated

PCa patients was used12,13. Every patient is represented with 3 cancer and 3 benign

cores on the TMA. The use of archived material was approved by the Ethics Committee

of Medical University of Innsbruck (Study no. AM 3174 including amendment 2).

Patients received no other chemotherapeutics or anti-androgens prior to the radical

prostatectomy and both groups were matched for Gleason score and age. Patient

characteristics, TMA assembling and staining protocols were as previously described13.

The TMA was stained with anti-GR (1:200, D6H2L, Cell Signaling).

Immunohistochemistry was performed with a Discovery – XT staining device (Ventana,

Tuscon, AZ) and images were captured with a Zeiss Imager Z2 microscope (Zeiss, Vienna)

equipped with Pixelink PL-B622-CU camera (Canimpex Enterprises Ltd., Halifax, Canada).

The scoring of GR expression was performed as follows. The cores were scored for GR

intensity (no signal (0), weak signal (1), moderate signal (2) and strong signal (3)) and the

percentage of positive cells (0% (0), 0-25% (1), 25-50% (2), 50-75% (3) and over 75% (4)).

The immune reactivity score (IRS) was calculated with the following formula: intensity

score * positive cell score and the average of three cores per patient is depicted.

Statistical differences between both groups were calculated with the Mann Whitney

test.

Cell culture and reagents

PC3, DU145 and 22Rv1 cells were cultured in RPMI1640 supplemented with FCS,

penicillin/streptomycin and glutamine. Docetaxel-resistant cells (PC3-DR, DU145-DR,

22Rv1-DR) were generated by increasing exposure to docetaxel and subsequently

cultured under the presence of 12.5 nM docetaxel2,13. The identity of cell lines was

confirmed by short tandem repeat analysis and cell line passages used in all experiments

ranged from p2 to p17. Docetaxel, RU-486 (mifepristone), verapamil (all Sigma-Aldrich,

Zwijndrecht, the Netherlands) and ABT-263 (Selleckchem, Huissen, the Netherlands)


were dissolved in EtOH, DEX (Buma, Uitgeest, the Netherlands) in PBS and cyproterone

acetate (CPA, Sigma-Aldrich) in MeOH.

CRISPR/CAS9

sgRNA sequences (sgRNA_GR1: ACGGCTGGTCGACCTATTG) were designed using the

CRISPR Design Tool (http://crispr.mit.edu) to specifically target exon 2 of the GR-1 gene

and were cloned into a pCR expression vector (Addgene: 41824). PC3-DR were

transiently transfected with CAS9 WT (Addgene: 41815) and sgRNA-GR1 plasmid (2 μg

per plasmid) using Fugene (Promega) and knockdown efficiency was determined using

western blotting. The sensitivity to docetaxel was assessed in transiently transfected

cells and in stable cell lines, generated by expansion of single cells. Knockdown

efficiency was determined using western blot.

Real-time qPCR

Cells were incubated with DEX in combination with RU-486 or CPA for 6 h and mRNA

was isolated using Tripure (Invitrogen). cDNA was synthesized by reverse transcription

(Promega, Madison, USA). Real-time qPCR was performed on the BioRad IQ5 cycler and

gene expression was normalized to the expression of GAPDH. The primer sequences are:

GAPDH Fwd: GACAGTCAGCCGCATCTTC; GAPDH Rev: GCAACAATATCCACTTTACCAGAG;

GILZ Fwd: GCACAATTTCTCCATCTCCTTCTT; GILZ Rev: TCAGATGATTCTTCACCAGATCCA;

FKBP5 Fwd: GAATGGTGAGGAAACGCCGAT; FKBP5 Rev: TGCCAAGACTAAAGACAAATGGT;

P-gp Fwd: CCCATCATTGCAATAGCAGG; P-gp Rev: GTTAAACTTCTGCTCCTGA.

Western blot

Cells were lysed in RIPA buffer and protein was loaded on a SDS-page gel and

subsequently transferred to a nitrocellulose membrane. Membranes were incubated

with the primary antibody overnight at 4ᵒC and with the secondary antibody for 1 h at

RT. The following antibodies were used: anti-GR (1:500, sc-8992, Santa Cruz

Biotechnology), anti-GAPDH (1:10000, Chemicon), anti-β-actin (1:5000, Sigma), anti-Bcl-

xL (1:1000, sc-23958, Santa Cruz Biotechnology) and anti-Bcl-2 (1:1000, sc-7382, Santa

Cruz Biotechnology).

https://mail.lumc.nl/owa/redir.aspx?C=Qdr-sf-_1EqU5_UNwNX6UpyUICVKctIIR1LI-Y0-0YvAPgzNT3fpO4gCW9wHN-gV29SmhDP90nQ.&URL=http%3a%2f%2fcrispr.mit.edu

Chapter 4

76

Viability assay and clonogenic assay

For the viability assay, cells were seeded 1500 cells per well and were exposed to

docetaxel in combination with RU-486 and/or CPA. Cell viability was measured using the

MTS assay (Celltiter 96 Aqueous One Solution Cell Proliferation Assay; Promega). For the

clonogenic assay, cells were seeded 100 cells per well and exposed to a combination of

docetaxel and RU-486. After 10-14 days, wells were fixed with 4% paraformaldehyde

and colonies were stained using crystal violet.

Cell death analysis

Cell death was assessed using an Annexin V/propidium iodine (PI) assay (Invitrogen).

PC3-DR or DU145-DR cells were seeded 200000 per well and treated with a combination

of 30 nM docetaxel and 3 µM RU-486. Floating and adherent cells were harvested and

incubated with FITC-Annexin V and PI before analysis with flow cytometry. Viable cells

were defined as Annexin V-/PI-, early apoptotic cells as Annexin V+/PI- and late

apoptotic/necrotic cells as Annexin V+/PI+.

Side population

The drugs efflux properties of cells were determined as previously described14. In short,

cells were incubated with 3 µM RU-486, 10 µM CPA or 0.05-5.0 µM P-gp inhibitor

verapamil prior to addition of Hoechst33342 (5 µg/mL, Sigma-Aldrich). To-Pro-3 (0.5

μM, Life Technologies) was added to exclude dead cells. Hoechst33342 exclusion was

measured with the LSRII using 450 nm (Hoechst blue) and 675 nm (Hoechst red) filters

after excitation with a 350 nm UV light.


Results

Glucocorticoid receptor expression is enhanced in prostate tumors of docetaxel-

treated patients and functionally involved in docetaxel resistance in vitro

In this study, we aim to elucidate the role of the GR in docetaxel resistance. To this end,

a TMA of 14 docetaxel-treated patients and 14 chemo-naive patients was evaluated.

Immunohistochemical analysis revealed a significant up-regulation of GR in PCa cells of

docetaxel-treated patients compared to chemo-naïve patients (p<0.01) (Fig. 1a). In

addition, docetaxel-resistant cell lines PC3-DR, DU145-DR and 22Rv1-DR, largely

unresponsive to docetaxel concentrations of up to 30 nM (independent of serum GC;

Suppl. Fig. 1), displayed elevated expression of GR protein levels when compared to

their chemo-naïve counterparts (Fig. 1b). To evaluate the functional involvement of GR

in docetaxel resistance, we employed the CRISPR/CAS9-mediated knockout technology.

Transient transfection of PC3-DR cells with GR-1-targeted sgRNA resulted in reduced GR

expression (Fig. 1c) and, strikingly, enhanced sensitivity to docetaxel (-39% viability in

PC3-DR CRISPR GR compared to PC3-DR wt upon treatment with 30 nM docetaxel,

p<0.05) (Fig. 1d). In addition, in PC3-DR cells with stable GR knockout (Suppl. Fig. 2a),

that exhibit similar basal growth rates (Suppl. Fig. 2b), docetaxel displays enhanced

antitumor efficacy compared to PC3-DR wt cells (Suppl. Fig. 2c).

Chapter 4

78


Figure 1: Glucocorticoid receptor (GR) expression is enhanced in docetaxel-treated patients and docetaxel-resistant cell lines and is functionally involved in chemotherapy resistance (A) Tissue microarray analysis revealed GR overexpression in the prostate cancer tissue in patients treated with neoadjuvant docetaxel compared to chemo-naïve patients. **p<0.01. (B) Protein expression analysis revealed that GR is overexpressed in docetaxel-resistant cell lines PC3-DR, DU145-DR and 22Rv1-DR compared to their parental counterparts. *p<0.05 vs. parental; **p<0.01 vs. parental. (C) Transient CRISPR/CAS9-directed deletion of GR-1 results in reduced GR expression. **p<0.01 vs. PC3-DR. (D) Enhanced docetaxel sensitivity in PC3-DR GR CRISPR cells. *p<0.05 vs. PC3-DR.

Chapter 4

80

Therapeutic targeting of the glucocorticoid receptor completely antagonize

dexamethasone-induced transcriptional activity and strongly re-sensitizes docetaxel-

resistant cells to docetaxel treatment

The induction of GR signaling upon exposure with GR agonist DEX was examined by

expression analysis of the GR-target genes glucocorticoid-induced leucine zipper (GILZ)

and FK506 binding protein 5 (FKBP5). DEX effectively induced GILZ and FKBP5 expression

which was fully reversed by co-incubation with RU-486 (3 µM) and CPA (10 µM) (Fig. 2),

indicating of a complete blockage of GR activity by the GR antagonists. To examine if

modulation of GR activity affects sensitivity to docetaxel, docetaxel-resistant cell lines

were incubated with treated with GR antagonists RU-486 or CPA. Exposure to RU-486 or

CPA alone did not influence cell viability of parental (PC3 and DU145) and docetaxel-

resistant cell lines (PC3-DR and DU145-DR) (Suppl. Fig. 2a). Strikingly, incubation with

both GR antagonists strongly sensitized docetaxel-resistant cells to docetaxel treatment

at doses 0.3-3 μM for RU-486 and 3-10 μM for CPA (Fig. 3a). For further experiments,

the doses 3 μM RU-486 and 10 μM CPA were chosen as these showed a strong

reduction in cell viability of PC3-DR cells (-80% and -70% respectively) upon treatment

with 30 nM docetaxel (p<0.001) (Fig. 3a). Antagonizing GR-mediated signaling activity

significantly re-sensitized docetaxel-resistant cells to docetaxel treatment dose-

dependently (Fig. 3b) and in a time-dependent fashion (p<0.001 at 48-72 h) (Fig. 3c)

while no effect was observed in docetaxel sensitive tumor cells (Fig. 3b). In concordance

with these findings, combination treatment with RU-486 and docetaxel largely

diminished the clonogenic potential of both docetaxel-resistant cell lines (Suppl. Fig. 3c).

As PCa is fundamentally androgen receptor (AR)-driven, we performed similar studies in

AR-positive docetaxel-resistant cells. To this end, we utilized the 22Rv1 lineage, which

expresses both full length AR as well as splice variant AR-V7 15. In concordance with our

results in AR-negative cell lines, 22Rv1-DR cells are also re-sensitized to docetaxel upon

RU-486 and CPA treatment in a dose-dependent (Fig. 3d) and time-dependent manner

(Fig. 3e). These observations support a general role of GR in the development of

docetaxel resistance independently of AR-status.


Figure 2: Dexamethasone (DEX)-induced transcriptional activity of GR-target genes GILZ and FKBP5 is inhibited by RU-486 and CPA Expression of GR-target genes GILZ and FKBP5 in PC3-(DR) and DU145-(DR) cells upon treatment with DEX and/or RU-486 or CPA. * p<0.05 vs. vehicle; **p<0.01 vs. vehicle; ***p<0.001 vs. vehicle; $ p<0.05 vs. 1.0µM DEX; $$ p<0.01 vs. 1.0µM DEX.

Chapter 4

82


Figure 3: Therapeutic targeting of the glucocorticoid receptor (GR) re-sensitizes docetaxel-resistant cell lines to docetaxel (A) GR antagonism with RU-486 or CPA re-sensitizes PC3-DR cells for docetaxel treatment after 72 h of treatment. *p<0.05 vs. vehicle; **p<0.01 vs. vehicle; ***p<0.001 vs. vehicle. (B) Dose-dependent (72 h) and (C) time-dependent (30 nM) antitumor effect of docetaxel upon simultaneous treatment with 3 μM RU-486/10 μM CPA and docetaxel in PC3-(DR) and DU145-(DR) cells. $ p<0.05 vs. parental; $$ p<0.01 vs. parental; $$$ p<0.001 vs. parental; **p<0.01 vs. docetaxel-resistant line; ***p<0.001 vs. docetaxel-resistant line. (D) GR antagonism with RU-486 or CPA re-sensitizes AR-positive cell line 22Rv1-DR for docetaxel treatment after 72 hours of treatment. $ p<0.05 vs. parental; $$ p<0.01 vs. parental; $$$ p<0.001 vs. parental; *p<0.05 vs. docetaxel-resistant line **p<0.01 vs. docetaxel-resistant line; ***p<0.001 vs. docetaxel-resistant line. (E) Time-dependent (30 nM) antitumor effect of docetaxel upon simultaneous treatment with 3 μM RU-486. *p<0.05 vs. vehicle; ***p<0.001 vs. vehicle.

Chapter 4

84

Glucocorticoid receptor antagonism downregulates anti-apoptotic Bcl-2 and Bcl-xL

proteins

To further elucidate the mechanism of cell death observed above, we performed an

Annexin V/PI analysis. Treatment of docetaxel-resistant cells with 3 μM RU-486 and 30

nM docetaxel resulted in a decrease of viable cells and an increase in early and late

apoptotic cells (p<0.001) (Fig. 4a). Western blot analysis of anti-apoptotic proteins

revealed an up-regulation of Bcl-2 and Bcl-xL, well-known for their inhibitory role in

Bak/Bax-mediated Cytochrome C release in the intrinsic apoptotic pathway, in

docetaxel-resistant cell lines compared to their chemo-naïve counterparts (Fig. 4b).

Interestingly, GR antagonism resulted in decreased expression of anti-apoptotic Bcl-xL

and Bcl-2 in both docetaxel-resistant cells (Fig. 4b). This suggests that the sensitizing

effects of GR antagonism may be partially mediated via modulation of the Bcl-2/Bcl-xL

axis. To further explore this, a selective antagonist for Bcl-2 and Bcl-xL was investigated:

ABT-263. Treatment with ABT-263 already induced cell death in PC3-DR and DU145-DR

cell lines (Fig. 4c). On top of this, ABT-263 significantly re-sensitized both docetaxel-

resistant cell lines to docetaxel treatment (Fig. 4c). Since this effect with ABT-263 was

not as potent as the effect observed with RU-486, other mechanisms in addition to Bcl-

xL/Bcl-2 downregulation are presumably involved in the re-sensitization upon GR

inhibition. This notion is supported by the observation that the sensitivity to docetaxel is

enhanced in both docetaxel-resistant cell lines if treated with both RU-486 and ABT-263

compared to RU-486 or ABT-263 alone (Fig. 4c).


Figure 4: Glucocorticoid receptor (GR) antagonism down-regulates the expression of anti-apoptotic Bcl-2 and Bcl-xL proteins (A) Docetaxel-resistant cells undergo apoptosis upon treatment with RU-486 (3 μM) and docetaxel (30 nM). ***p<0.001 vs. Veh. (B) Bcl-2 and Bcl-xL are upregulated in docetaxel-resistant cell lines. Treatment with RU-486 (3 μM) reverses the elevated expression of Bcl-2 and Bcl-xL in docetaxel-resistant prostate cancer cells. (C) Co-incubation with an antagonist for Bcl-2 and Bcl-xL, ABT-263 (9 μM), sensitizes PC3-DR and DU145-DR cells to docetaxel treatment. *p<0.05; **p<0.01; ***p<0.001; $ p<0.05 vs. Veh; $$ p<0.01 vs. Veh; $$$ p<0.001 vs. Veh.

Chapter 4

86

Chemotherapy re-sensitization with RU-486 and CPA cannot be attributed solely to

inhibition of P-glycoprotein activity

Previously, an inhibitory effect of RU-486 16 and CPA17 on P-glycoprotein (P-gp) activity

was described, which could potentially underlie the observed re-sensitization with the

GR antagonists as both PC3-DR and DU145-DR display enhanced P-gp expression (Fig.

5a). To address this, we examined the so-called side population, a population of stem-

like tumor cells with high P-gp activity leading to the exclusion of P-gp substrate

Hoechst. This revealed an enhanced P-gp activity in both docetaxel-resistant cell lines

compared to their parental counterparts (Fig. 5b). As expected, RU-486 and CPA display

an inhibitory effect on P-gp activity (Fig. 5c). To dissect the re-sensitizing activities of RU-

486 and CPA, we compared their re-sensitizing capacity to verapamil, a known P-gp

inhibitor. Verapamil dosages with equal P-gp inhibitory activity as RU-486 (1.5 μM in

PC3-DR and 0.5 μM in DU145-DR) and CPA (0.5 μM in PC3-DR; 0.15 μM in DU145-DR)

(Fig. 5c) were compared head-to-head in a viability assay. This revealed a significantly

stronger sensitization capacity of both RU-486 and CPA compared to the corresponding

verapamil dosages (Fig. 5d), suggesting that a significant proportion of sensitization is

indeed mediated via direct inhibition of the GR rather than via P-gp.


Figure 5: RU-486 and CPA outperform verapamil at doses with similar P-glycoprotein inhibitory action (A) P-gp mRNA expression and (B) basal activity in docetaxel-resistant and sensitive prostate cancer cells. *p<0.05; **p<0.01; ***p<0.001. (C) Head-to-head comparison of GR antagonists and verapamil on P-gp activity. *p<0.05 vs. vehicle; **p<0.01 vs. vehicle; ***p<0.001 vs. vehicle. (D) Head-to-head comparison of GR antagonists and verapamil on cell viability. *p<0.05 vs. vehicle; **p<0.01 vs. vehicle; ***p<0.001 vs. vehicle; $$$ p<0.001 vs. verapamil.

Chapter 4

88

Discussion

In this study, we describe a key role of the GR in PCa docetaxel resistance. We show that

the GR is overexpressed in clinical PCa specimens treated with neo-adjuvant docetaxel,

as well as in docetaxel-resistant PCa cell lines in vitro. While untreated PCa specimens

only display modest GR levels18,19, androgen ablation therapy or chemotherapy result in

upregulation and nuclear localization of GR19,20, suggesting the functional involvement

of GR in PCa therapy resistance. Our data fully supports this notion, and prompted us to

further investigate the GR as a therapeutic target in docetaxel-resistant PCa.

Our study reveals a strong re-sensitizing effect to docetaxel in both AR-negative and AR-

positive cell lines upon treatment with GR antagonists (at dosages that fully antagonize

DEX-induced expression of GR-target genes), suggesting functional involvement of the

GR in mediating clinical docetaxel resistance in human PCa. This is supported by recent

studies describing the ability of GR antagonist RU-486 to potentiate the antitumor

efficacy of chemotherapeutics in triple-negative breast cancer (paclitaxel)21 and cervical

cancer (cisplatin)22. Conversely, stimulation of GR activity by glucocorticoid exposure23

or stress induction24 confers resistance to chemotherapeutics, supporting the notion of

GR involvement in chemotherapy resistance.

A range of mechanisms underlying docetaxel resistance have been described including:

upregulation of anti-apoptotic proteins25, overexpression of ABC-transporters26,

aberrant activation of NF-κB2, alterations in β-tubulin isotypes27 and expression of AR-V7 28. GCs were shown to contribute to chemotherapy resistance via up-regulation of anti-

apoptotic proteins29. As such, GR-target gene GILZ was shown to induce Bcl-xL

expression thereby protecting cardiomyocytes for doxorubicin cytotoxicity30. In contrast

to hematological malignancies, where GCs may reduce Bcl-xL expression thereby

favoring apoptosis31, in PCa it was shown that GCs upregulate Bcl-xL resulting in

resistance to apoptosis-inducers32. We confirmed the upregulation of Bcl-xL in our

docetaxel-resistant PCa cells, in line with a previous study2, and show here that GR

antagonism leads to a reduction in Bcl-xL expression, providing a potential mechanistic

explanation for the restored sensitivity to docetaxel in resistant PCa cells.

Yet, we cannot fully attribute the re-sensitizing capacity of GR antagonists to the GR, as

both steroidal drugs (RU-486 and CPA) were reported to directly inhibit P-gp


function16,17. In our studies, we compared RU-486 and CPA head-to-head to known P-gp

inhibitor verapamil. Interestingly, at dosages with equal P-gp inhibition, both RU-486

and CPA outperformed verapamil, suggesting that mechanisms other than P-gp

inhibition are responsible, i.e. the GR pathway. It is unclear, however, if an inhibitory

effect on P-gp function underlies the sensitizing effects of RU-486 on paclitaxel and

cisplatin reported in literature21,22. P-gp was shown to be expressed in the cell lines used

(MDA-MB-231 33 and HeLa34 respectively) but the issue is not discussed in these reports.

DEX is routinely used in the treatment of patients with advanced PCa, although it

actually may contribute to resistance to therapy. Indeed, the functional involvement of

the GR in resistance to anti-AR therapy (i.e. enzalutamide) was demonstrated9,10.

Enhanced GR expression was observed in enzalutamide-resistant tumors in vivo and in

tumor biopsies from enzalutamide-pretreated PCa patients9. AR was shown to directly

repress GR expression in PCa via a negative androgen receptor response element in the

GR-promoter35. It was proposed that GR is able to take over AR function due to a

significant overlap in transcriptome. As a consequence, stimulation of GR activity can

rescue cells from enzalutamide-induced cell death9.

We now demonstrate that the GR is upregulated in PCa tumors of patients treated with

docetaxel. As GCs are frequently administered in combination with docetaxel, GC usage

may counteract the antitumor efficacy of this chemotherapeutic agent. Alternatively, GC

administration prior to treatment with chemotherapeutics agents may actually increase

sensitivity to chemotherapeutics due to homologous down-regulation of the GR36.

Hence, phased timing (i.e. precise treatment sequencing) of GCs in combination with

other treatment options (chemotherapy or anti-AR therapy) should be carefully

considered. Reassuringly, a recent meta-analysis on the usage of GC prednisone showed

no difference in overall survival in prednisone versus non-prednisone treated patients37.

Based on our preclinical results, combinational treatment with docetaxel and GR

antagonists may be a promising therapeutic approach in docetaxel-resistant disease.

Currently, CRPC patients that progress on docetaxel are routinely treated with AR- or

AR-axis targeting drugs (i.e. abiraterone acetate or enzalutamide)38,39. Not all patients,

however, respond to therapeutic targeting of the AR-axis, in particular those with AR-

V7-expressing tumors40. Although the clinical importance of AR-V7 in resistance to

Chapter 4

90

docetaxel is not confirmed41,42, preclinical studies do suggest that expression of AR-V7

promotes resistance to taxane-based chemotherapeutics28,43. We now show that

combined GR antagonism and docetaxel treatment may also be effective in AR-V7-

expressing, docetaxel-resistant PCa cells. Our study also reveals enhanced GR levels as a

result of docetaxel treatment, and augmented GR may significantly undermine the

efficacy of AR-targeting agents in patients that progress on docetaxel treatment9. Based

on this, GR antagonism may also be useful in combination with AR-targeting drugs. A

Phase I/II clinical study assessing combined treatment with enzalutamide and RU-486 is

currently ongoing (NCT02012296) to identify the recommended dose of RU-486 and to

monitor adverse effects and antitumor activity of this drug combination. It is interesting

to note that RU-486 (as a mono treatment) was already assessed in a Phase II clinical

trial in CRPC patients in which a treatment schedule of 200 mg/day orally was very well

tolerated44. In addition, other parameters influenced by GR activity, e.g. bone mineral

density, were not influenced upon RU-486 treatment45. Taken together, the use of GR

inhibitors in CRPC patients is well tolerated and preclinical studies endorse further

development towards clinical translation.

In summary, we believe that the clinical use of GR antagonists could be beneficial in

advanced PCa patients, as GR is often overexpressed. Combination treatment of GR

antagonists with docetaxel is worthwhile pursuing in order to enhance the antitumor

efficacy of docetaxel in the treatment of patients with chemotherapy resistant PCa.

Acknowledgements

The authors thank Hetty Sips for technical assistance and Sander Kooijman for critical

reading of the manuscript. We thank Prof. Dr. William Watson (University College

Dublin) for providing the 22Rv1 parental and 22Rv1 docetaxel-resistant cell lines.


References

1. Tannock, I.F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine 351, 1502-1512 (2004).

2. O'Neill, A.J., et al. Characterisation and manipulation of docetaxel resistant prostate cancer cell lines. Molecular cancer 10, 126 (2011).

3. van Soest, R.J., et al. Targeting the Androgen Receptor Confers In Vivo Cross-resistance Between Enzalutamide and Docetaxel, But Not Cabazitaxel, in Castration-resistant Prostate Cancer. European urology (2014).

4. Madan, R.A., Pal, S.K., Sartor, O. & Dahut, W.L. Overcoming chemotherapy resistance in prostate cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 17, 3892-3902 (2011).

5. Lewis-Tuffin, L.J. & Cidlowski, J.A. The physiology of human glucocorticoid receptor beta (hGRbeta) and glucocorticoid resistance. Annals of the New York Academy of Sciences 1069, 1-9 (2006).

6. Montgomery, B., Cheng, H.H., Drechsler, J. & Mostaghel, E.A. Glucocorticoids and prostate cancer treatment: friend or foe? Asian journal of andrology 16, 354-358 (2014).

7. Kroon, J., et al. Liposomal delivery of dexamethasone attenuates prostate cancer bone metastatic tumor growth In Vivo. The Prostate (2015).



10. Isikbay, M., et al. Glucocorticoid receptor activity contributes to resistance to androgen-targeted therapy in prostate cancer. Hormones & cancer 5, 72-89 (2014).

11. Zhang, C., et al. Clinical and mechanistic aspects of glucocorticoid-induced chemotherapy resistance in the majority of solid tumors. Cancer biology & therapy 6, 278-287 (2007).

12. Puhr, M., et al. PIAS1 is a crucial factor for prostate cancer cell survival and a valid target in docetaxel resistant cells. Oncotarget 5, 12043-12056 (2014).

13. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology 181, 2188-2201 (2012).

14. Golebiewska, A., Brons, N.H., Bjerkvig, R. & Niclou, S.P. Critical appraisal of the side population assay in stem cell and cancer stem cell research. Cell stem cell 8, 136-147 (2011).

15. Shiota, M., et al. Inhibition of protein kinase C/Twist1 signaling augments anticancer effects of androgen deprivation and enzalutamide in prostate cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 20, 951-961 (2014).

16. Gruol, D.J., Zee, M.C., Trotter, J. & Bourgeois, S. Reversal of multidrug resistance by RU 486. Cancer research 54, 3088-3091 (1994).

17. Frohlich, M., et al. In vitro and ex vivo evidence for modulation of P-glycoprotein activity by progestins. Biochemical pharmacology 68, 2409-2416 (2004).

18. Yemelyanov, A., et al. Tumor suppressor activity of glucocorticoid receptor in the prostate. Oncogene 26, 1885-1896 (2007). 19. Szmulewitz, R.Z., et al. Serum/glucocorticoid-regulated kinase 1 expression in primary human prostate cancers. The Prostate

72, 157-164 (2012). 20. Yemelyanov, A., et al. Differential targeting of androgen and glucocorticoid receptors induces ER stress and apoptosis in

prostate cancer cells: a novel therapeutic modality. Cell cycle 11, 395-406 (2012). 21. Skor, M.N., et al. Glucocorticoid receptor antagonism as a novel therapy for triple-negative breast cancer. Clinical cancer

research : an official journal of the American Association for Cancer Research 19, 6163-6172 (2013). 22. Jurado, R., Lopez-Flores, A., Alvarez, A. & Garcia-Lopez, P. Cisplatin cytotoxicity is increased by mifepristone in cervical

carcinoma: an in vitro and in vivo study. Oncology reports 22, 1237-1245 (2009). 23. Herr, I., et al. Glucocorticoid cotreatment induces apoptosis resistance toward cancer therapy in carcinomas. Cancer research

63, 3112-3120 (2003). 24. Reeder, A., et al. Stress hormones reduce the efficacy of paclitaxel in triple negative breast cancer through induction of DNA

damage. British journal of cancer 112, 1461-1470 (2015). 25. Yoshino, T., et al. Bcl-2 expression as a predictive marker of hormone-refractory prostate cancer treated with taxane-based

chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research 12, 6116-6124 (2006).

26. Sanchez, C., et al. Expression of multidrug resistance proteins in prostate cancer is related with cell sensitivity to chemotherapeutic drugs. The Prostate 69, 1448-1459 (2009).

27. Galletti, E., Magnani, M., Renzulli, M.L. & Botta, M. Paclitaxel and docetaxel resistance: molecular mechanisms and development of new generation taxanes. ChemMedChem 2, 920-942 (2007).

28. Thadani-Mulero, M., et al. Androgen receptor splice variants determine taxane sensitivity in prostate cancer. Cancer research 74, 2270-2282 (2014).

29. Herr, I., Gassler, N., Friess, H. & Buchler, M.W. Regulation of differential pro- and anti-apoptotic signaling by glucocorticoids. Apoptosis : an international journal on programmed cell death 12, 271-291 (2007).

30. Aguilar, D., Strom, J. & Chen, Q.M. Glucocorticoid induced leucine zipper inhibits apoptosis of cardiomyocytes by doxorubicin. Toxicology and applied pharmacology 276, 55-62 (2014).

31. Laane, E., et al. Dexamethasone-induced apoptosis in acute lymphoblastic leukemia involves differential regulation of Bcl-2 family members. Haematologica 92, 1460-1469 (2007).

Chapter 4

92

32. Petrella, A., et al. Dexamethasone inhibits TRAIL-induced apoptosis of thyroid cancer cells via Bcl-xL induction. European journal of cancer 42, 3287-3293 (2006).

33. Zhang, Q., et al. Trametenolic acid B reverses multidrug resistance in breast cancer cells through regulating the expression level of P-glycoprotein. Phytotherapy research : PTR 28, 1037-1044 (2014).

34. Al-Abd, A.M., et al. Resveratrol enhances the cytotoxic profile of docetaxel and doxorubicin in solid tumour cell lines in vitro. Cell proliferation 44, 591-601 (2011).

35. Xie, N., et al. The expression of glucocorticoid receptor is negatively regulated by active androgen receptor signaling in prostate tumors. International journal of cancer. Journal international du cancer 136, E27-38 (2015).

36. Rosewicz, S., et al. Mechanism of glucocorticoid receptor down-regulation by glucocorticoids. The Journal of biological chemistry 263, 2581-2584 (1988).

37. Morgan, C.J., Oh, W.K., Naik, G., Galsky, M.D. & Sonpavde, G. Impact of prednisone on toxicities and survival in metastatic castration-resistant prostate cancer: A systematic review and meta-analysis of randomized clinical trials. Critical reviews in oncology/hematology 90, 253-261 (2014).

38. Scher, H.I., et al. Increased survival with enzalutamide in prostate cancer after chemotherapy. The New England journal of medicine 367, 1187-1197 (2012).

39. de Bono, J.S., et al. Abiraterone and increased survival in metastatic prostate cancer. The New England journal of medicine 364, 1995-2005 (2011).

40. Antonarakis, E.S., et al. AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. The New England journal of medicine 371, 1028-1038 (2014).

41. Antonarakis, E.S., et al. Androgen Receptor Splice Variant 7 and Efficacy of Taxane Chemotherapy in Patients With Metastatic Castration-Resistant Prostate Cancer. JAMA oncology (2015).

42. Onstenk, W., et al. Efficacy of Cabazitaxel in Castration-resistant Prostate Cancer Is Independent of the Presence of AR-V7 in Circulating Tumor Cells. European urology (2015).

43. Zhang, G., et al. Androgen receptor splice variants circumvent AR blockade by microtubule-targeting agents. Oncotarget (2015).

44. Taplin, M.E., et al. A phase II study of mifepristone (RU-486) in castration-resistant prostate cancer, with a correlative assessment of androgen-related hormones. BJU international 101, 1084-1089 (2008).

45. Kettel, L.M., et al. Treatment of endometriosis with the antiprogesterone mifepristone (RU486). Fertility and sterility 65, 23-28 (1996).



Supplementary Figure 1: Docetaxel resistance is independent on serum glucocorticoids PC3-DR and DU145-DR maintain docetaxel resistance in steroid-depleted culture medium (charcoal-stripped).

Supplementary Figure 2: PC3-DR cells with stable GR knockout lose docetaxel resistance. (A) Protein expression analysis of GR in PC3-DR wt and stable GR knockout PC3-DR cell lines. **p<0.01 vs. PC3-DR wt. (B) Growth rate of PC3-DR and GR knockout cell lines. *p<0.05 vs. PC3-DR wt; **p<0.01 vs. PC3-DR wt; ***p<0.001 vs. PC3-DR wt. (C) GR knockout in PC3-DR cells results in enhanced sensitivity to docetaxel treatment. *p<0.05 vs. PC3-DR wt; ***p<0.001 vs. PC3-DR wt.

Chapter 4

94

Supplementary Figure 3: Glucocorticoid receptor (GR) antagonism in docetaxel-resistant prostate cancer cells (A) RU-486 and CPA do not affect PC3-(DR) and DU145-(DR) cells after 72 h of treatment. (B) Simultaneous treatment with 3 µM RU-486 and docetaxel diminishes the clonogenic potential of docetaxel-resistant cells. *p<0.05 vs. without docetaxel; **p<0.01 vs. without docetaxel; ***p<0.001 vs. without docetaxel; $ p<0.05 vs. without GR antagonist; $$ p<0.01 vs. without GR antagonist; $$$ p<0.001 vs. without GR antagonist.

Chapter 5

Preclinical Evaluation of Docetaxel-Loaded Π-Π-Stacking Stabilized

Polymeric Micelles in Human Bone Metastatic Prostate Cancer in vivo

Jan Kroon1,2

Daniëlle M. Hemmer1

Mies J. van Steenbergen3

Maaike van der Mark1

Yang Shi3


Wim E. Hennink3

Gert Storm2,3


1 Department of Urology, Leiden University Medical Center, Leiden, the Netherlands

2 Department of Targeted Therapeutics, MIRA Institute for Biological Technology and Technical Medicine, University of Twente, Enschede, the Netherlands

3 Department of Pharmaceutics, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, the Netherlands

4 Department of Experimental Molecular Imaging, University Clinic and Helmholtz Institute for Biomedical Engineering, RWTH-Aachen University, Aachen, Germany

Manuscript in preparation

Chapter 5

96

Abstract

Bone metastasis represents a detrimental stage in advanced prostate cancer for which

no curative treatment options exist to date. Docetaxel is routinely used as treatment for

this disease stage but poor solubility, suboptimal pharmacokinetics and dose-limiting

toxicities largely undermine its applicability. To overcome these issues, polymeric

micelles may become suitable targeted carriers for docetaxel although their utility is

often thwarted by micellar instability and premature drug release in the blood

circulation. Hence, approaches to increase micellar stability and drug retention hold

much promise.

In this study, we evaluated the preclinical performance of docetaxel-loaded Π-Π

stacking-stabilized polymeric micelles in a clinically relevant model for bone metastatic

lesions from prostate cancer in vivo. In this model, we found a potent and long-lasting

antitumor efficacy of docetaxel-loaded micelles while being well-tolerated, in contrast

to free docetaxel which induced substantial toxicity. This study highlights the potential

of docetaxel-loaded Π-Π stacking polymeric micelles highlighting its potential as a

candidate for further (pre)clinical investigation, towards development as targeted

nanomedicine to treat bone metastatic prostate cancer patients.

Preclinical Evaluation of Docetaxel-Loaded Π-Π-Stacking Stabilized Polymeric Micelles in Human Bone Metastatic Prostate Cancer In Vivo

Introduction

Castration-resistant prostate cancer (CRPC) is an advanced, detrimental stage in

prostate carcinogenesis and is commonly associated with metastasis to the bone

microenvironment1,2. In the treatment of CRPC, taxane-based chemotherapeutics are

standard-of-care. Docetaxel (Taxotere) was approved as the first line treatment in 20043

and cabazitaxel (Jevtana) as second-line treatment in 20104. Taxanes are

chemotherapeutic agents that bind and stabilize microtubules thereby preventing their

disassembly during chromosome separation, and this subsequently leads to cell cycle

arrest and apoptosis5,6. The clinical approval of docetaxel has led to prolonged overall

survival in CRPC patients3, but the use of docetaxel in the clinic comes with several

important issues, namely poor drug solubility, suboptimal pharmacokinetic properties,

dose-limiting toxicities and acquired chemotherapy resistance7.

To address the difficulties, formulation into targeted polymeric micelles has been

proposed. These drug carriers can efficiently be loaded with hydrophobic drugs

including docetaxel, and can be designed to show prolonged circulation kinetics of

anticancer drugs after intravenous administration8. Long circulation characteristics allow

the polymeric micelles exploit the high permeability that often characterizes solid tumor

vasculature by extravasating through the tumor vasculature into the tumor intertitium,

a phenomenon referred to as the enhanced permeability and retention (EPR)-effect9.

Although micellar encapsulation has the potential to enhance the therapeutic index, the

success of polymeric micelles is oftentimes frustrated by premature micellar

destabilization and rapid drug release in the bloodstream upon intravenous

administration10-12. Hence, particular attention has been given to approaches to

enhance micellar stability and drug retention. With this purpose in mind, Π-Π stacking-

stabilized polymeric micelles were recently developed13,14 showing a strong non-

covalent interaction between aromatic rings, which are present in taxane-based

chemotherapeutic drugs as well as in tailored polymers. This results in a substantial

increase in micellar stability and enhanced drug retention15. These stabilized polymeric

micelles can also be designed to be long-circulating in the bloodstream, to exploit the

EPR-effect for tumor tissue accumulation. In this study, we evaluated the therapeutic

feasibility of docetaxel-loaded Π-Π stacking-stabilized polymeric micelles in a clinically

relevant model for prostate cancer bone metastases.

Chapter 5

98

Material and methods

Assembly of polymeric micelles

Block polymer methoxy poly(ethylene glycol)-b-(N-(2-

benzoyloxypropyl)methacrylamide)) (mPEG-b-p-(HPMAm-Bz)) was synthesized as

previously described14. To assemble micelles, 27 mg mPEG-b-p-(HPMAm-Bz) polymer

was dissolved in 1 mL tetrahydrofuran (THF), unloaded or loaded with 12 mg docetaxel

(Sigma-Aldrich) or with 2.7 mg of the fluorescent lipophilic dye nile red (for empty

micelles, docetaxel-loaded micelles and nile red-loaded micelles, respectively). This

mixture was added dropwise to 1 mL PBS while stirring and incubated at RT for 2 hours

before it was filtered through a 0.45 μM filter (Acrodisc). To allow evaporation of THF,

the micelles were incubated at room temperature (RT) for 48 hours. Micelles were

stored at 4ᵒC until use. Mean particle size and distribution were measured using

dynamic light scattering (Malvern 4700 system, Malvern Ltd., United Kingdom). Residual

THF was measured using nuclear magnetic resonance in which the integral of THF (3.60

ppm) was compared to sodium acetate (1.76 ppm). To determine the concentration of

docetaxel in the micelles, docetaxel-loaded micelles and docetaxel standards (0.2-100

μg/mL) were prepared in acetonitrile and quantified by ultra performance liquid

chromatography analysis as previously described for paclitaxel14.

Cell culture

Osteotropic human prostate cancer cell lines PC-3M-Pro4luc2 and C4-2B4 were used in

this study. PC-3M-Pro4luc2 were cultured in DMEM supplemented with 10% FCII,

penicillin/streptomycin (P/S) and 800 µg/mL G-418 (Invitrogen). C4-2B4 cells were

cultured in DMEM (Sigma-Aldrich) supplemented with 10% FCS, F-12K nutrient mixture

Kaighn’s modification (Life Technologies), P/S, insulin-transferin-selenium (Gibco),

biotin, adenine and T3.

Viability and cell death assessment

To compare the therapeutic feasibility of free- vs. micellar docetaxel in a prostate cancer

setting, the effect of both formulations on cell viability (MTS assay, mitochondrial

activity) and cell death (uptake of TO-PRO-3) was monitored. For the viability assay, cells

were seeded 1500 cells per well in a 96-wells plate and for the cell death assay cells


were seeded 50000 cells per well in a 24-wells plate. Subsequently, cells were treated

with free- or micellar docetaxel at the indicated concentrations and time points. EtOH

and empty micelles were used as negative controls. For the viability assay, MTS reagent

(Celltiter 96 Aqueous One Solution Cell Proliferation Assay; Promega) was added and

after 2 hours of incubation at 37ᵒC the absorbance at 490 nm was measured. For the cell

death assay, floating and adherent cells were harvested and 0.5 µM TO-PRO-3 (Life

Technologies) was added. TO-PRO-3 uptake was analysed using flow cytometry (FL-3

channel, FACS Calibur 2).

Micellar uptake studies

The uptake of micelles by prostate cancer cells was assessed using nile red-loaded

micelles. Cells were seeded 50000 cells per well in a 24-wells plate and incubated with

nile red-loaded micelles for different concentrations and time points. Cells were

washed, harvested and the uptake of nile red-loaded micelles was monitored using flow

cytometry (FL-2 channel, FACS Calibur 2).

Therapeutic studies in mice

Seven week old male Balb-c nu/nu mice were purchased from Charles River (L’Arbresle,

France) and all animal studies were approved by the local committee for animal health,

ethics and research at Leiden University (DEC14181). The tibia of mice were inoculated

bilaterally with single cell suspensions of 50000 luciferase-expressing PC-3M-Pro4luc2

cells in 10 μL PBS as described previously16,17. After 18-25 days, treatment was started

using 3 groups (N=5-6 tumor-bearing mice per group): 1) vehicle (EtOH/Tween-80/PBS

– v/v/v - 0.05/0.05/0.90, solvent for free docetaxel); 2) free docetaxel (7.5 mg/kg,

dissolved in EtOH/Tween-80/PBS – v/v/v - 0.05/0.05/0.90, comparable to the clinically-

used formulation of docetaxel7) and 3) micellar docetaxel (7.5 mg/kg, dissolved in PBS).

Treatment was administered by intravenous injection in the tail vein (100 μL) at day 0, 3,

6 and 10. Tumor growth was measured twice weekly by bioluminescent imaging (IVIS

Illumina). At the end of the experiment, mice were sacrificed by cervical dislocation and

tumor-bearing tibia and non-target organs were collected for histological examination.

Chapter 5

100

Statistical analysis

Statistical analysis was performed using GraphPad Prism 5.0 software (GraphPad

Software Inc., San Diego, CA, USA). Significant differences in cell viability, in vivo tumor

growth and body weight were calculated with a two-way ANOVA with Bonferoni

posttest. Significant differences in cell death were calculated with a two-tailed TTEST.

Data is presented as mean±SEM unless otherwise stated.

Results

Characteristics of docetaxel-loaded micelles

The mPEG-b-p-(HPMAm-Bz) polymer14 was used to assemble empty micelles, docetaxel-

loaded micelles and nile red-loaded micelles. For empty micelles, DLS analysis revealed a

mean particle size of 49±1nm with a PDI of 0.15 while docetaxel-loaded micelles

displayed a mean particle size of 137±2nm with a PDI of 0.15 (Table 1). The enhanced

mean particle size for docetaxel-loaded micelles is likely explained by the relatively high

docetaxel input (12 mg per batch, with 27 mg polymer), which is supported by the

observation of an enhanced micellar size upon increasing paclitaxel-loading14.

Micelle-formulation Mean particle size Polydispersity

index

Entrapment efficiency

(Docetaxel)

Empty-micelles 49±1nm 0.15±0.03nm N.A.

Docetaxel-loaded 137±2nm 0.15±0.01nm 27±3%

Nile red-loaded 126±4nm 0.09±0.00nm N.A.

Table 1: Characteristics of micelles


Cellular uptake of polymeric micelles

To monitor the cellular uptake of polymeric micelles by prostate cancer cells, we

assembled polymeric micelles with the fluorescent model drug nile red. In terms of size,

these micelles were comparable to docetaxel-loaded micelles (126±4 nm, Table 1). Flow

cytometry revealed a rapid uptake of micelles by both PC-3M-Pro4luc2 and C4-2B4 cells

(99.5±0.1 and 98.5±0.3 % nile red-positive cells after 0.5 h incubation for PC-3M-

Pro4luc2 and C4-2B4, respectively) (Fig. 1a). Prolonged incubation of prostate cancer

cells with micelles resulted in enhanced micellar uptake (i.e. increased mean fluorescent

intensity), which reached a plateau after 4 h of incubation (Fig. 1b).

Figure 1: The uptake of polymeric micelles by prostate cancer cells (A) The % uptake of nile red-positive cells after incubation with labeled micelles. (B) Mean fluorescent intensity of PC-3M-Pro4luc2 and C4-2B4 cells after incubation with nile red-labeled micelles.

Head-to-head comparison of free- and micellar-docetaxel on viability and cell death of

prostate cancer cells in vitro

The antitumor effects of free docetaxel and micellar docetaxel were compared head-to-

head by analysis of mitochondrial activity (MTS assay) and membrane integrity (TO-PRO-

3 uptake which indicates compromised cell membranes and hence cell death). The MTS

assay demonstrated a dose-dependent decrease in mitochondrial activity for free

docetaxel and treatment with free docetaxel significantly outperformed micellar

docetaxel in both PC-3M-Pro4luc2 and C4-2B4 prostate cancer cell lines (Fig. 2a). At

higher dose levels (30 nM), free- and micellar docetaxel displayed similar antitumor

efficacy after 48-72 hours (Fig. 2b). In line with these observations, cell death analysis

revealed superior antitumor efficacy of free- compared to micellar docetaxel at 10-30

nM (both cell lines, Fig. 3a) and at 48-72 hours (PC-3M-Pro4luc2, Fig. 3b).

Chapter 5

102

Figure 2: The effect of (micellar) docetaxel on viability of prostate cancer cell lines (A) Dose-dependent and (B) time-dependent effect of (micellar) docetaxel on PC-3M-Pro4luc2 and C4-2B4 prostate cancer cells. **p<0.01 vs. vehicle; ***p<0.001 vs. vehicle; $$$ p<0.001 vs. docetaxel.

Figure 3: The effect of (micellar) docetaxel on cell death of prostate cancer cell lines (A) Dose-dependent and (B) time-dependent effect of (micellar) docetaxel on cell death of PC-3M-Pro4luc2 and C4-2B4 cells. *p<0.05 vs. t=0; **p<0.01 vs. t=0; ***p<0.001 vs. t=0.


Head-to-head comparison of free- and micellar-docetaxel in vivo

Next, we evaluated the antitumor efficacy of micellar docetaxel in a clinically relevant

model for prostate cancer bone metastases in vivo. Mice with tumor-bearing tibiae were

treated according to a therapeutic protocol in which treatment was initiated after

establishment of detectable bone lesions (Fig. 4a). Treatment with both free- and

micellar docetaxel resulted in a robust antitumor response (Fig. 4b) which was

significant on 20-24 days after the start of treatment (Fig. 4c). Micellar docetaxel was

well tolerated (i.e. no weight loss) (Fig. 4d) while still exhibiting potent antitumor

efficacy, in contrast to free docetaxel which was associated with severe weight loss (Fig.

4d). The absence of adverse effects upon administration of micellar-docetaxel permits

the use of higher dosages.

Chapter 5

104

Figure 4: Preclinical evaluation of (micellar) docetaxel in bone metastasis-bearing mice (A) Experimental outline. (B) Waterfall plot indicating the fold change in burden of individual tumors at day 24. (C) The effect of

(micellar) docetaxel on the intra-tibial growth of PC-3M-Pro4luc2 cells. (D) The effect of (micellar) docetaxel on body weight of

tumor-bearing mice. *p<0.05 vs. vehicle; **p<0.01 vs. vehicle; ***p<0.001 vs. vehicle; $$$ p<0.001 vs. micellar docetaxel.


Discussion

In this study, we show potent, long-lasting antitumor efficacy of Π-Π-stacking docetaxel-

loaded polymeric micelles in a clinically relevant model for prostate cancer bone

metastasis. In addition to this robust antitumor efficacy, docetaxel-loaded micelles are

well-tolerated in mice, which is likely explained by the stable micellar entrapment of

docetaxel while in systemic circulation. This superior tolerability of micellar docetaxel at

the evaluated dosage advocates treatment with higher dosage which will likely result in

further enhanced antitumor efficacy. As such, docetaxel-loaded micelles may improve

the therapeutic value via the same mechanism as abraxane, i.e. allowance of intensified

dosing18,19. Clearly, this is not permitted for free docetaxel administration as equal

dosages of free docetaxel (7.5 mg/kg, 4x in 10 days) resulted in considerable toxicity (i.e.

weight loss), which was also found in a breast cancer study that used equal cumulative

dosages of free docetaxel (i.e. 30 mg/kg)20.

Several groups studied other paclitaxel-loaded micelle formulations in prostate cancer

models in vivo21-23, while only one study investigated the feasibility of micellar delivery

of docetaxel, which is surprising as docetaxel is the current first-line treatment for CRPC.

Docetaxel-loaded PEG-2000-polycaprolactone micelles enhance the circulation time of

docetaxel compared to free docetaxel (Duopafei®), resulting in enhanced antitumor

efficacy in subcutaneous xenografts24. It is important to note that subcutaneous models,

although routinely used in studies assessing micellar drug delivery, may not properly

reflect tumor growth at the (bone) metastatic site. Many important parameters that

modulate adequate drug delivery and subsequent antitumor responses may differ

strongly between subcutaneous and metastatic tumors25, e.g. the permeability of the

tumor endothelium, tumor growth rate and the bi-directional interactions between

cancer and stromal cells. In addition, the bone microenvironment displays bone-specific

reactive stromal responses that contrast stromal responses at other tumor sites26,

asking for the use of more relevant bone metastatic models. To our knowledge, we are

the first to examine the utility of taxane-loaded micelles in a clinically relevant model for

metastatic bone lesions.

Besides toxicity to non-targeted organs, the usage of taxane-based chemotherapeutics

in (metastatic) CRPC is largely restrained by other factors including poor water solubility

Chapter 5

106

and rapid clearance from the circulation. Polymeric micelles eliminate the issue of poor

solubility of taxanes, an issue that is currently addressed by the application of

solubilizers, e.g. the use of ethanol and polysorbate in the clinical formulation of

docetaxel (Taxotere) and cabazitaxel (Jevtana) while paclitaxel (Taxol) is currently

dissolved in ethanol and cremophor. These formulations entail significant adverse

effects besides the toxicity of the incorporated taxanes, e.g. hypersensitivity11. Another

difficulty with the use of taxanes is their poor pharmacokinetic profile, i.e. rapid renal

clearance, which largely curtails its effectiveness in cancer patients. Micellar

encapsulation can improve the pharmacokinetics of taxanes by significantly decreasing

its clearance and enhancing its local tumor delivery but is still frustrated by micellar

instability and (premature) drug leakage. For example, the plasma levels of paclitaxel in

mice are rapidly lowered upon intravenous injection of paclitaxel-loaded pluronic

micelles27. Indeed, we previously showed that Π-Π-stacking stabilized micelles display

favourable pharmacokinetics with high serum levels of paclitaxel and an extension of

the circulation half-life to 8 hours after intravenous injection, suggesting excellent

micellar stability and drug retention of these micelles14.

In our studies, we observed that free docetaxel was already effective at lower doses,

while micellar-docetaxel only displayed cytotoxicity at the higher doses. This may be the

result of docetaxel leakage from the micelles in the culture medium rather than micelle-

cell interactions28. Alternatively, as a result of their enhanced stability the docetaxel may

remain entrapped in the micelles after cellular uptake, thereby strongly limiting its

bioavailability in vitro. This also illustrates a potential drawback of micellar

encapsulation since antitumor actions of micellar docetaxel could only be achieved if

micelles are efficiently taken up by prostate cancer cells and docetaxel is released

intracellularly from the micelles. Our uptake studies show rapid and efficient uptake of

polymeric micelles by prostate cancer cells, excluding the explanation that the reduced

cytotoxicity in vitro is due to suboptimal micellar uptake. It rather suggests that the

polymeric micelles may partly remain intact after cellular uptake, thereby limiting the

intracellular activity of docetaxel. Thus, micellar encapsulation may introduce additional

barriers that need to be bypassed to accomplish potent antitumor efficacy. Despite

these challenges, our docetaxel-loaded micelles still display potent antitumor efficacy in

vivo suggesting that the slow release of docetaxel from the micelles does not undermine


its antitumor efficacy in animals. Nevertheless, exploring ways to release micelle-bound

docetaxel may further improve this, and potential tools to serve this aid include pH-

sensitive micelles29 and thermo-sensitive micelles30.

The antitumor efficacy of micellar-docetaxel may, besides direct actions on prostate

cancer cells, also be partially mediated via effects on stromal cells, which has been

demonstrated for other docetaxel nanoparticles20,31. Indeed, cells in the tumor

microenvironment have been shown to efficiently take up nanoparticles32 and alteration

of their activity may indirectly influence tumor growth. Alternatively, stromal cells (e.g.

tumor-associated macrophages) efficiently take up nanoparticles due to their strong

phagocytic capacity, leading to subsequent release of docetaxel in the tumor

microenvironment where it exhibit its cytotoxic effect on tumor cells. To date, the

effects of nanoparticles on cells of the supportive tumor microenvironment are still

relatively underexplored, and more research to delineate its precise involvement in the

effectiveness of anticancer nanomedicine is warranted.

In conclusion, we demonstrate potent antitumor efficacy and good tolerability of

docetaxel-loaded Π-Π-stacking polymeric micelles in a preclinical model for bone

metastases. These findings warrant further preclinical investigations paving the way to

clinical development as novel treatment for bone metastatic CRPC patients.

Acknowledgements

JK was supported by a grant from NanoNextNL Drug Delivery programme 03D.01. MM

was supported by the Dutch Cancer Society (UL-2011-4030).

Chapter 5

108

References

1. Carles, J., et al. Castration-resistant metastatic prostate cancer: current status and treatment possibilities. Clin Transl Oncol

14, 169-176 (2012). 2. Coleman, R.E. Skeletal complications of malignancy. Cancer 80, 1588-1594 (1997). 3. Tannock, I.F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New

England journal of medicine 351, 1502-1512 (2004). 4. de Bono, J.S., et al. Prednisone plus cabazitaxel or mitoxantrone for metastatic castration-resistant prostate cancer

progressing after docetaxel treatment: a randomised open-label trial. Lancet 376, 1147-1154 (2010). 5. Jordan, M.A. & Wilson, L. Microtubules as a target for anticancer drugs. Nature reviews. Cancer 4, 253-265 (2004). 6. Fitzpatrick, J.M. & de Wit, R. Taxane mechanisms of action: potential implications for treatment sequencing in metastatic

castration-resistant prostate cancer. European urology 65, 1198-1204 (2014). 7. Yared, J.A. & Tkaczuk, K.H. Update on taxane development: new analogs and new formulations. Drug design, development

and therapy 6, 371-384 (2012). 8. Oerlemans, C., et al. Polymeric micelles in anticancer therapy: targeting, imaging and triggered release. Pharmaceutical

research 27, 2569-2589 (2010). 9. Lammers, T., Kiessling, F., Hennink, W.E. & Storm, G. Drug targeting to tumors: principles, pitfalls and (pre-) clinical progress.

Journal of controlled release : official journal of the Controlled Release Society 161, 175-187 (2012). 10. Letchford, K. & Burt, H.M. Copolymer micelles and nanospheres with different in vitro stability demonstrate similar paclitaxel

pharmacokinetics. Molecular pharmaceutics 9, 248-260 (2012). 11. Kim, S.C., et al. In vivo evaluation of polymeric micellar paclitaxel formulation: toxicity and efficacy. Journal of controlled

release : official journal of the Controlled Release Society 72, 191-202 (2001). 12. Miller, T., et al. Premature drug release of polymeric micelles and its effects on tumor targeting. International journal of

pharmaceutics 445, 117-124 (2013). 13. Kataoka, K., et al. Doxorubicin-loaded poly(ethylene glycol)-poly(beta-benzyl-L-aspartate) copolymer micelles: their

pharmaceutical characteristics and biological significance. Journal of controlled release : official journal of the Controlled Release Society 64, 143-153 (2000).

14. Shi, Y., et al. Complete Regression of Xenograft Tumors upon Targeted Delivery of Paclitaxel via Pi-Pi Stacking Stabilized Polymeric Micelles. ACS nano (2015).

15. Shi, Y., et al. Pi-pi stacking increases the stability and loading capacity of thermosensitive polymeric micelles for chemotherapeutic drugs. Biomacromolecules 14, 1826-1837 (2013).

16. Buijs, J.T., Que, I., Lowik, C.W., Papapoulos, S.E. & van der Pluijm, G. Inhibition of bone resorption and growth of breast cancer in the bone microenvironment. Bone 44, 380-386 (2009).

17. Kroon, J., et al. Liposomal delivery of dexamethasone attenuates prostate cancer bone metastatic tumor growth In Vivo. The Prostate (2015).

18. Miele, E., Spinelli, G.P., Miele, E., Tomao, F. & Tomao, S. Albumin-bound formulation of paclitaxel (Abraxane ABI-007) in the treatment of breast cancer. International journal of nanomedicine 4, 99-105 (2009).

19. Gradishar, W.J., et al. Phase III trial of nanoparticle albumin-bound paclitaxel compared with polyethylated castor oil-based paclitaxel in women with breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 23, 7794-7803 (2005).

20. Hu, Q., et al. Complete regression of breast tumour with a single dose of docetaxel-entrapped core-cross-linked polymeric micelles. Biomaterials 53, 370-378 (2015).

21. Zhang, X., et al. Poly(l-histidine) based triblock copolymers: pH induced reassembly of copolymer micelles and mechanism underlying endolysosomal escape for intracellular delivery. Biomacromolecules 15, 4032-4045 (2014).

22. Lu, J., et al. PEG-derivatized embelin as a nanomicellar carrier for delivery of paclitaxel to breast and prostate cancers. Biomaterials 34, 1591-1600 (2013).

23. Leung, S.Y., Jackson, J., Miyake, H., Burt, H. & Gleave, M.E. Polymeric micellar paclitaxel phosphorylates Bcl-2 and induces apoptotic regression of androgen-independent LNCaP prostate tumors. The Prostate 44, 156-163 (2000).

24. Jin, M.J., et al. Improved anti-tumor efficiency against prostate cancer by docetaxel-loaded PEG-PCL micelles. Journal of Huazhong University of Science and Technology. Medical sciences = Hua zhong ke ji da xue xue bao. Yi xue Ying De wen ban = Huazhong keji daxue xuebao. Yixue Yingdewen ban 34, 66-75 (2014).

25. Fleming, J.M., Miller, T.C., Meyer, M.J., Ginsburg, E. & Vonderhaar, B.K. Local regulation of human breast xenograft models. Journal of cellular physiology 224, 795-806 (2010).

26. Ozdemir, B.C., et al. The molecular signature of the stroma response in prostate cancer-induced osteoblastic bone metastasis highlights expansion of hematopoietic and prostate epithelial stem cell niches. PloS one 9, e114530 (2014).

27. Yoncheva, K., et al. Stabilized micelles as delivery vehicles for paclitaxel. International journal of pharmaceutics 436, 258-264 (2012).

28. Storm, G., Steerenberg, P.A., van Borssum Waalkes, M., Emmen, F. & Crommelin, D.J. Potential pitfalls in in vitro antitumor activity testing of free and liposome-entrapped doxorubicin. Journal of pharmaceutical sciences 77, 823-830 (1988).

29. Du, N., et al. Novel pH-sensitive nanoformulated docetaxel as a potential therapeutic strategy for the treatment of cholangiocarcinoma. Journal of nanobiotechnology 13, 17 (2015).

30. Liu, B., et al. The antitumor effect of novel docetaxel-loaded thermosensitive micelles. European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V 69, 527-534 (2008).


31. Murakami, M., et al. Docetaxel conjugate nanoparticles that target alpha-smooth muscle actin-expressing stromal cells suppress breast cancer metastasis. Cancer research 73, 4862-4871 (2013).


Chapter 5

110

Chapter 6

Glycogen Synthase Kinase-3β Inhibition Depletes the Population of

Prostate Cancer Stem/Progenitor-like Cells and Attenuates Metastatic

Growth

Jan Kroon1

Lars S. in ’t Veld1

Jeroen T. Buijs1

Henry Cheung1



1Department of Urology, Leiden University Medical Center, Leiden, the Netherlands

Oncotarget. 2014 Oct; 5(19):8986-8984

Chapter 6

112

Abstract

Cancer cells with stem or progenitor properties play a pivotal role in the initiation,

recurrence and metastatic potential of solid tumors, including those of the human

prostate. Cancer stem cells are generally more resistant to conventional therapies thus

demanding the characterization of key pathways involved in the formation and/or

maintenance of this malignant cellular subpopulation. To this end, we identified

Glycogen Synthase Kinase-3β (GSK-3β) as a crucial kinase for the maintenance of

prostate cancer stem/progenitor-like cells and pharmacologic inhibition of GSK-3β

dramatically decreased the size of this cellular subpopulation. This was paralleled by

impaired clonogenicity, decreased migratory potential and dramatic morphological

changes. In line with our in vitro observations, treatment with a GSK-3β inhibitor leads

to a complete loss of tumorigenicity and a decrease in metastatic potential in preclinical

in vivo models. These observed antitumor effects appear to be largely Wnt-independent

as simultaneous Wnt inhibition does not reverse the observed antitumor effects of GSK-

3β blockage. We found that GSK-3β activity is linked to cytoskeletal protein F-actin and

inhibition of GSK-3β leads to disturbance of F-actin polymerization. This may underlie

the dramatic effects of GSK-3β inhibition on prostate cancer migration. Furthermore,

GSK-3β inhibition led to strongly decreased expression of several integrin types

including the cancer stem cell-associated α2β1 integrin. Taken together, our mechanistic

observations highlight the importance of GSK-3β activity in prostate cancer stemness

and may facilitate the development of novel therapy for advanced prostate cancer.

Glycogen Synthase Kinase-3β Inhibition Depletes the Population of Prostate Cancer Stem/Progenitor-like Cells and Attenuates Metastatic Growth

Introduction

Prostate cancer is the most common diagnosed male malignancy with over 900000 new

cases and over 250000 deaths worldwide in 20081. At early stage, when the disease is

still organ-confined, treatment options include prostatectomy or radiation.

Unfortunately, 20-25% of patients will experience relapse within 5 years of treatment2.

Once prostate cancer has spread beyond the prostate it is incurable and, at this stage,

androgen deprivation therapy is the standard treatment. However, virtually all patients

relapse with castration-resistant prostate cancer (CRPC) within 1-3 years3-5. Despite the

introduction of new agents to treat metastatic CRPC, a major challenge remains to

improve survival of these patients. A principal limitation of docetaxel, the current first-

line therapy for metastatic CRPC, is initial or acquired resistance which largely reduces

its antitumor efficacy. Hence, the identification of specific pathways involved in therapy

resistance is pivotal for the development of novel treatment options for advanced

prostate cancer.

An increasing number of studies demonstrate that a small subpopulation of transformed

cells with stem- and progenitor properties, also referred to as cancer stem cells (CSCs), is

involved in prostate cancer initiation, metastasis and the resistance to current

therapies6. While ALDHHIGH, CD44+ and α2-integrinHIGH CSCs in primary prostate cancer

predominantly display a basal cell phenotype, the stem/progenitor cells that survive

androgen deprivation therapy and re-initiate tumor growth exhibit a luminal progenitor

phenotype7-10. The notion that CSCs play an essential role in resistance to conventional

therapies warrants the characterization of key pathways and proteins for the formation

and maintenance of tumor- and metastasis-initiating cells. Selective targeting of such

pathways, therefore, seems highly promising.

Glycogen synthase kinase-3β (GSK-3β) is known to play a role in several cellular

processes such as cell cycle control, proliferation, differentiation and apoptosis11. GSK-

3β can phosphorylate a range of substrates including glycogen synthase, cyclin D1/E and

c-MYC but is typically known for its role in the Wnt signaling pathway in which it acts as

a negative regulator of Wnt effector molecule β-catenin12. Here, GSK-3β-mediated

phosphorylation of β-catenin leads to ubiquitination and subsequent proteasomal

Chapter 6

114

degradation of the latter. Uncontrolled Wnt signaling was shown to be involved in the

development of several solid tumors13,14.

In this study, the importance of GSK-3β activity for the maintenance of prostate cancer

stem/progenitor-like subpopulation and its involvement in metastasis was evaluated.

We show that GSK-3β provides a potential therapeutic target that is functionally

involved in prostate cancer stem cell maintenance, tumorigenicity and metastasis in

vivo.

Materials & Methods

Cell lines and culture conditions

The human prostate cancer cell lines PC3 and PC-3M-Pro4 were cultured in Dulbecco’s

modified Eagle’s medium (DMEM, GibcoBRL) containing 4,5 g glucose/L supplemented

with 10% FCII (ThermoScientific), 100 u/mL penicillin and 50 µg/mL streptomycin

(Gibco). For the luciferase expressing PC-3M-Pro4luc2 cells, the previous medium was

supplemented with 800 µg/mL G-418 (Neomycin, Invitrogen). C4-2B4 cells were

cultured in DMEM (Sigma) supplemented with F-12K nutrient mixture Kaighn’s

modification (Life Technologies), 10% FCS, 100 u/mL penicillin and 50 µg/mL

streptomycin, insulin-transferin-selenium (Gibco), biotin, adenine and T3. DU145 cells

were cultured in DMEM supplemented with 10% FCS, 100 u/mL penicillin and 50 µg/mL

streptomycin. All cell lines were grown in a humidified incubator at 37ºC and 5% CO2.

Transient transfection and luciferase reporter assay

PC3 or PC-3M-Pro4 cells were seeded 10000 cells in 500 µL medium in a 24-wells plate.

Fugene HD transfection reagent (Promega) was used according manifacturer’s protocol.

For each well, 500 ng of BAT-luciferase and 25 ng CAGGS-renilla were transfected. After

24 hours, medium was replaced and cells were pretreated with 30-100 µM PNU-74654

(Sigma-Aldrich) for 1 hour before stimulation with 50-100 nM GIN for 24 hours. The

luciferase and renilla levels in the lysates were measured using Dual Luciferase Assay

(Promega).


Flow cytometry

PC3, PC-3M-Pro4luc2, C4-2B4 and DU145 cells were seeded 500000 cells in 5 mL

medium in a T25. After 16 hours, cells were incubated with 30-100 µM PNU-74654

and/or 100 nM GIN. After 48 hours of treatment, cells were washed and harvested and

ALDH activity was determined using the ALDEFLUOR assay kit (StemCell Technologies,

Durham, USA). Expression of integrins was measured using the following antibodies: α6-

APC, αv-PE and α2-FITC (Miltenyi). BD FACS caliburTM was used for analysis10.

Clonogenic assay

PC-3, PC-3M-Pro4luc2, C4-2B4 or DU145 cells were seeded 1 cell per well in a 96-well

plate. After 16 hours, cells were pretreated with 30-100 µM PNU-74654 for 1 hour and

then treated with 100 nM GIN. After 6-8 days, colonies were counted using light

microscopy (Zeiss Axiovert 200M)15.

Migration assay

Cells were starved with 0.3% serum overnight and seeded 60000 cells (PC3, PC-3M-

Pro4luc2 and C4-2B4) or 20000 cells (DU145) per Boyden Chamber (pore size 8.0 µm,

Costar). Cells were allowed to migrate for 16 hours under the presence of 30-100 µM

PNU-74654 and/or 100 nM GIN and were fixated using MeOH and stained with crystal

violet (Merck)10.

Real-time qPCR analysis

RNA was extracted using Trizol (Invitrogen) and cDNA was synthesized by reverse

transcription (Promega, Madison, USA) according to manufacturer’s instructions. For

real-time qPCR, Biorad IQ5 cycler was used. Gene expression was measured relative to

GAPDH expression16.

Animal studies

Male Balb-c nu/nu mice were housed in ventilated cages under sterile conditions

according to the local guidelines for laboratory animals (DEC12181). PC-3M-Pro4luc2

cells were seeded 400000 cells/8 mL medium in T75s and pretreated with 100 nM GIN

for 48 hours. Cells were harvested and the amount of viable cells was determined using

Chapter 6

116

trypan blue exclusion. Two vehicle or GIN-pretreated single cell suspensions were

inoculated subcutaneously (100 000 cells in 50 µl PBS) into 8-week-old Balb-c nu/nu

mice. Similarly, single cell suspensions of vehicle or GIN-pretreated cells were inoculated

in the left cardiac ventricle (100000 cells in 100 µl PBS) of 5-week-old male Balb-c nu/nu

mice. Tumor growth was monitored twice weekly by bioluminescent imaging (IVIS

Illumina)10.

Confocal microscopy

PC3 or PC-3M-Pro4luc2 cells were seeded at a density of 5000 cells per 200 µL medium

onto glass slides and treated with 100 µM PNU-74654 and/or 100 nM GIN. After 48h,

cells were fixed with acetone, stained with 0.25 µM Phalloidin (Life technologies) and

sealed with vectashield/DAPI (Vector Laboratories). Confocal microscopy (Leica SP5) was

used for analysis of Phalloidin and DAPI.

Statistical analysis

Statistical analysis was performed using GraphPad Prims 5.0 sofware (San Diego, CA)

using either t-test (for comparison between two groups) or ANOVA (for comparison

between more than two groups). Data is presented as mean±SEM. Significant

differences are indicated with asterisks (*p< 0.05, **p<0.01, ***p<0.001) or a dollar

signs ($ p<0.05, $$ p<0.01, $$$ p<0.001).

Results

GSK-3β inhibition affects cellular morphology

The cellular morphology upon treatment with selective GSK-3β inhibitor GIN17,18

revealed a change from a stellate mesenchyme-like shape to a more round shaped

morphology in PC-3M-Pro4 cells (Suppl. Fig. 1a, Day 1 & 3). This morphological effect

was completely reversible, as removal of GIN resulted in restored cell growth and

normalized cellular morphology (Suppl. Fig. 1a, Day 6 & 8, lower row). Continued GSK-3β

inhibition led to a long-lasting effect on cellular morphology (Suppl. Fig 1a, Day 6 & 8,

center row).


GSK-3β inhibition leads to an induction of Wnt signaling

GSK-3β is mostly known for its inhibitory role in the Wnt signaling pathway, in which it

phosphorylates β-catenin which targets the latter for proteasomal degradation and

thereby prevents Wnt signaling14. To confirm this in our cells, PC3 cells were transiently

transfected with a bioluminescent canonical Wnt-reporter construct, BAT-Firefly

luciferase19,20, and CAGGSpromotor-Renilla luciferase as a control for transfection

efficiency. As expected, GSK-3β inhibition led to a strong, 5-fold, induction of Firefly

luciferase/Renilla luciferase ratio, indicating enhanced Wnt signaling (Fig. 1, left). This

dose-dependent induction of Wnt signaling upon GSK-3β inhibition was reversed by

simultaneous incubation with the downstream inhibitor of Wnt signaling, PNU-74654, in

which the 100 µM dose led to a near complete reversal of the induced Wnt signaling in

PC3 cells (-72%, Fig. 1, left). In PC-3M-Pro4 cells, a 400-fold induction of Wnt signaling

was observed upon GSK-3β inhibition which was partially reversed by addition of 30 µM

PNU-74654 (-52%, Fig. 1, right).

Figure 1: The effect of GSK-3β inhibition on Wnt signaling in prostate cancer cell lines Wnt reporter activity in transiently transfected PC3 and PC-3M-Pro4 cells after pretreatment with 30-100 µM PNU-74654 and/or 50-100 nM GIN for 24 hours. The figure comprises two independent experiments. *p<0.05 vs. control; ***p<0.001 vs. control; $ p<0.05 vs. GIN-treated.

Chapter 6

118

GSK-3β inhibition and stem/progenitor-like cells

Based on these initial experiments, the dosage of 100 nM GIN was selected for the

following functional experiments. We evaluated the effect of GSK-3β inhibition on the

prostate cancer stem/progenitor-like subpopulation, and functional cellular

characteristics such as the clonogenic and migratory capacity. GSK-3β inhibition almost

completely eradicated the subpopulation of ALDEFLUOR+ or ALDHHIGH stem/progenitor-

like cells in PC3 and PC-3M-Pro4 cells10, while C4-2B4 and DU145 cells were not

significantly affected (Fig. 2a). In line with this, the mRNA expression of 5 out of 7 tested

ALDH isoforms was significantly downregulated in PC-3M-Pro4 cells upon GSK-3β

inhibition (Suppl. Fig. 2a). In addition, expression of genes known to be critically

involved in self-renewal8,10,21 and bone metastasis22 were investigated which revealed a

significant reduction of NANOG, Oct-4 and α-2 integrin, and showed similar trends for

Bmi-1 and CD44 (Suppl. Fig. 2b).

Next, GSK-3β inhibition strongly attenuated the clonogenic capacity of tested prostate

cancer cell lines PC3 (68% inhibition), PC-3M-Pro4 (-97%), C4-2B4 (-94%) and DU145 (-

44%) (Fig. 2b). In addition to a decrease in colony number, the colonies that were

observed upon GSK-3β inhibition were much smaller then under vehicle-treated

conditions (not shown). The strong effects observed in multiple prostate cancer cell lines

suggest cell-type independency of GSK-3β inhibition. Also, inhibition of GSK-3β activity

resulted in a strong decrease in cellular migration of all tested prostate cancer cell lines;

PC3 (92% decrease), PC-3M-Pro4luc2 (88%), C4-2B4 (87%) and DU145 (71%) (Fig. 2c).

Interestingly, while C4-2B4 cells lost their clonogenic and migratory potential upon GSK-

3β inhibition, the ALDHHIGH population remained unaffected. This shows that the

functional effects of GSK-3β inhibition are not necessarily accompanied by a change in

the activity of ALDH enzymes. To exclude that any of the effects described above could

be attributed to increased cell death upon GSK-3β inhibition, the percentage of trypan

blue-positive cells were counted (Suppl. Fig. 1b) which revealed no significant increase

in cell death.

To evaluate if the stimulation of Wnt signaling was causally involved in the observed

effects, canonical Wnt signaling was blocked using PNU-74654. This did not reverse the

diminishing effects on the stem/progenitor-like population, the anti-clonogenic and the


anti-migratory effects of GSK-3β inhibition, suggesting that GIN exerts its effects

independent of Wnt signaling. Notably, 100 µM PNU-74654 significantly reduced

migratory potential under basal and GSK-3β inhibitory conditions, suggesting that active

Wnt signaling may, in fact, be positively correlated with migration of prostate cancer

cells.

GSK-3β inhibition, tumorigenicity and metastasis in vivo

Based on the strong effects of GSK-3β inhibition on the stem/progenitor cell

subpopulation in vitro, we evaluated the effects of GIN pretreatment on prostate cancer

tumorigenicity and metastatic potential in vivo. To this end, PC-3M-Pro4luc2 cells were

pretreated with vehicle or GIN in vitro for 48 hours prior to subcutaneously inoculation

in Balb-c nu/nu mice (Fig. 3a). GIN pretreatment resulted in a complete loss of

tumorigenic potential, resulting in a significant decrease of subcutaneous tumor burden

as soon as 14 days after tumor inoculation (Fig. 3b, 3c).

Next, we assessed the potential anti-metastatic effects of GSK-3β inhibition in a

xenograft model of experimentally-induced bone metastasis. PC-3M-Pro4luc2 cells

were, again, pretreated with vehicle or GIN for 48 hours and inoculated into the left

cardiac ventricle of Balb-c nu/nu mice (Fig. 4a). As expected, vehicle-pretreated prostate

cancer cells readily formed bone metastases at multiple sites throughout the body (Fig.

4b, 4c)10. Strikingly, pretreatment with GIN led to a near-complete loss of metastatic

tumor burden in this model (Fig. 4c).

Chapter 6

120

Figure 2: The effect of GSK-3β inhibition on the stem/progenitor subpopulation, clonogenic and migratory potential The effect of treatment with 30-100 µM PNU-74654 and/or 50-100 nM GIN on (A) ALDHHIGH subpopulation after 48 hours (%ALDHHIGH subpopulation of untreated: PC3 4.5±1.0%; PC-3M-Pro4 25.8±7.1%; C4-2B4 19.6±2.9%; DU145 2.3±0.5%), (B) clonogenic potential after 7 days and (C) migratory capacity after 16 hours. All figures comprise two or three independent experiments. *p<0.5 vs. control; **p<0.01 vs. control; ***p<0.001 vs. control; $$ p<0.01 vs. GIN-treated.


Figure 3: The effect of GIN pretreatment in vitro on tumorigenic potential in vivo PC-3M-Pro4luc2 cells were pretreated with vehicle or 100 nM GIN for 48 hours prior to subcutaneous inoculation in nude mice (n=10 per group). (A) Experimental schedule. (B) Subcutaneous tumor burden. (C) Representative examples of bioluminescent images. *p<0.05 vs. control.

Chapter 6

122

Figure 4: The effect of GIN pretreatment in vitro on metastatic potential in vivo PC-3M-Pro4luc2 cells were pretreated with vehicle or 100 nM GIN for 48 hours prior to subcutaneous inoculation in the left cardiac ventricle of nude mice (n=9 per group). (A) Experimental schedule. (B) Quantification of the total number of metastasis and (C) total tumor burden. **p<0.01 vs. control.


GSK-3β inhibition disturbs F-actin polymerization and reduces integrin expression

The results described above highlight a strong attenuating effect of GSK-3β inhibition on

cancer stemness and migration in vitro and tumorigenic and metastatic potential in vivo.

Based on our observation that the cellular morphology of prostate cancer cells was

disturbed following GSK-3β inhibition and a previous study pointing out a link between

GSK-3β and F-actin23, we performed a DAPI/Phalloidin double staining to monitor F-actin

polymerization. This clearly revealed a strong reduction of F-actin polymerization upon

GSK-3β inhibition (Fig. 5a). In accordance with our data on the stem/progenitor

subpopulation, clonogenic ability and migration, co-incubation with Wnt inhibitor PNU-

74654 did not restore F-actin polymerization in PC-3 or PC-3M-Pro4 prostate cancer

cells (Fig. 5a). Previously, a causal link between F-actin and several integrin isoforms has

been described21,24,25. Based on this, we examined the expression of αv- (ITGAV), α2-

(ITGA2) and α6-integrin (ITGA6) in GIN-treated PC-3M-Pro4 cells and this revealed a

significant reduction in the expression of α2 (-57%), α6-integrin (-74%) and αv-integrin (-

26%) (Figure 5b).

Chapter 6

124

Figure 5: The effect of GSK-3β inhibition on F-actin polymerization and integrin expression (A) PC3 and PC-3M-Pro4 cells were treated with 100 µM PNU-74654 and/or 100 nM GIN for 48 hours. F-actin polymerization was visualized using Phalloidin (green) and the nucleus was visualized using DAPI (blue). (B) PC-3M-Pro4 cells were treated with 100 nM GIN for 48 hours and integrin expression was monitored using flow cytometry. ***p<0.001 vs. control.


Discussion

The importance of stem/progenitor cells in prostate carcinogenesis, cancer

repopulation, therapy response and metastatic potential is increasingly being

recognized7-10. Accumulating evidence suggests that CSCs are highly resistant to

conventional therapies for the treatment of (advanced) prostate cancer, which warrants

further characterization of pathways and target genes essential for these tumorigenic

and metastasis-initiating cells. Identification and selective targeting of such key

pathways or proteins may provide a highly promising approach to deplete this highly

malignant subpopulation of cells in prostate carcinoma. In this study, we established the

role of GSK-3β in the acquisition and maintenance of an invasive, tumorigenic and

metastatic phenotype in human prostate cancer cells using a selective, small molecule

inhibitor of GSK-3β.

Previously, we showed that ALDHHIGH stem/progenitor subpopulation of human prostate

cancer display increased clonogenic and migratory potential in vitro and enhanced

orthotopic and metastatic growth in vivo10. We now show that blockage of GSK-3β

activity leads to a massive reduction in the size of this highly tumorigenic cellular

subpopulation of ALDHHIGH prostate cancer cells with a concomitant reduction in

clonogenic and migratory potential of human prostate cancer cell lines. Similar findings

of GSK-3β inhibition were described for glioblastoma, in which a reduction of stem cell

markers was described upon GSK-3β inhibition subsequently leading to impaired

neurosphere formation and lessened clonogenicity26,27.

The striking antitumor effects of GSK-3β inhibition in vitro were paralleled by a

significant decrease in subcutaneous growth and bone metastasis in vivo of the

osteotropic prostate cancer cell line PC-3M-Pro4. Previous findings with other GSK-3β

inhibitors (e.g. LiCl, TDZD8) in subcutaneously xenografted cancer cells further support

this notion28,29. In addition, other studies show antitumor effects of GSK-3β inhibition on

prostate cancer cells in vitro, but these effects were predominantly attributed to

modulating effects on the androgen receptor-axis30,31, or changes in cell cycle proteins23.

Although the androgen receptor may be partially responsible for decreased growth

upon the suppression of GSK-3β activity in the tested androgen receptor-positive cell

lines, it cannot explain the robust effects in the androgen receptor-negative cell lines

Chapter 6

126

PC3 and PC-3M-Pro4. Moreover, we found that GSK-3β inhibition mainly acts on cancer

stem/progenitor-like cells which were shown to be largely androgen-independent9,32. It

appears, therefore, that the drastic antitumor effects of GSK-3β inhibition cannot be

solely explained by modulation of the androgen receptor-axis.

GSK-3β is typically known for its role in the Wnt signaling pathway, in which it

phosphorylates β-catenin in the absence of Wnt signaling. As expected, inhibition of

GSK-3β resulted in increased Wnt signaling in the tested prostate cancer cell lines. To

date, the exact role of Wnt signaling in prostate cancer progression has remained

controversial. The observations that various Wnt antagonists like members of the

Dickkopf (Dkk) family are highly expressed in osteotropic prostate cancer cells33,

upregulated in prostate cancer patients34 and that stable expression of Dkk-1 stimulates

prostate cancer growth35 all suggest that decreased Wnt signaling may also be beneficial

for metastatic outgrowth.

Our data indicate that increased Wnt signaling is not mechanistically involved in the

observed antitumor effects mediated by pharmacologic GSK-3β inhibition. Blocking Wnt

signaling by downstream inhibition of the β-catenin/TCF interaction after GSK-3β

inhibition does not restore the stem/progenitor-like subpopulation and their clonogenic

and migratory potential. Hence, it appears that GSK-3β activity is involved in prostate

cancer stemness and migration via a Wnt-independent mechanism. However, other

studies have shown that Wnt signaling is involved in prostate cancer growth as was

shown by increased sphere formation upon exogenous addition of Wnt3a36 and

antitumor effects upon Wnt inhibition37-39 (reviewed in40). Also, (embryonic or

hematopoietic) stem cells appear to be largely dependent on Wnt signaling41,42, pointing

out a positive correlation of Wnt signaling and stemness. It seems, therefore, that the

observed antitumor effects of GSK-3β attenuation overrule the previously described

pro-tumor effects of Wnt hyperactivation. Strikingly, in mixed-lineage leukemia,

activation of Wnt signaling was sufficient to (partially) revert antitumor effects of GSK-

3β inhibition, and combined blockage of GSK-3β and β-catenin was required to achieve

tumor regression43.

Next, we hypothesized that the effect of GSK-3β inhibition may be mediated via its

effect on cytoskeletal rearrangements, in particular the actin cytoskeleton. The


regulation of the actin cytoskeleton23 and focal adhesions44 were previously linked with

GSK-3β activity. In non-transformed cells, i.e. hematopoietic stem and progenitor cells,

GSK-3β can influence F-actin polymerization through Rac, Arf6 and Rho activation which

results in lamellipodia formation and this is an essential process in cellular migration.

Here, inhibition of GSK-3β resulted in reduced motility through interference with actin

polymerization45. In our studies, we observed a strong reduction of F-actin

polymerization upon GSK-3β inhibition, which appears to be the predominant

mechanism involved in the suppression of cellular migration in vitro and tumorigenicity

and metastasis in vivo. Furthermore, we found that GSK-3β inhibition led to a reduction

of integrin αv, α-2 and α6 expression, possibly mediated via the association of these

integrins with F-actin24,25. As integrin signaling was previously shown to be involved in

cancer stem/progenitor cell maintenance21,46,47 and bone metastasis22,48-50, we strongly

believe that the disturbance of F-actin via GSK-3β inhibition, thereby leading to reduced

integrin-mediated adhesion and signaling, is responsible for the decrease in prostate

cancer stemness and bone metastasis.

Taken together, our mechanistic observations highlight the importance of GSK-3β

activity in the maintenance of prostate cancer stem/progenitor-like cells and prostate

cancer progression in vivo. Current findings with pharmacologic GSK-3β inhibitors may,

thus, facilitate the development of novel therapy for incurable, advanced prostate

cancer.

Acknowledgements

This study was supported by a grant from the NanoNextNL Drug Delivery Programme (3-

D), project number 03D.01. HC, JB and GvdH are funded by Agentschap.nl; PRONET

(International Innovation grant), Netherlands Organization for Scientific Research (NWO,

VENI-Grant, 916.131.10) and the Dutch Cancer Society (UL-2011-4930), respectively.

Chapter 6

128

References

1. Jemal, A., Center, M.M., DeSantis, C. & Ward, E.M. Global patterns of cancer incidence and mortality rates and trends. Cancer Epidemiol Biomarkers Prev 19, 1893-1907 (2010).

2. Wirth, M.P., et al. Bicalutamide 150 mg in addition to standard care in patients with localized or locally advanced prostate cancer: results from the second analysis of the early prostate cancer program at median followup of 5.4 years. The Journal of urology 172, 1865-1870 (2004).

3. Petrylak, D.P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine 351, 1513-1520 (2004).

4. Tannock, I.F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine 351, 1502-1512 (2004).

5. Attard, G., et al. Phase I clinical trial of a selective inhibitor of CYP17, abiraterone acetate, confirms that castration-resistant prostate cancer commonly remains hormone driven. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 26, 4563-4571 (2008).

6. Dean, M., Fojo, T. & Bates, S. Tumour stem cells and drug resistance. Nature reviews. Cancer 5, 275-284 (2005). 7. Wang, X., et al. A luminal epithelial stem cell that is a cell of origin for prostate cancer. Nature 461, 495-500 (2009). 8. Germann, M., et al. Stem-like cells with luminal progenitor phenotype survive castration in human prostate cancer. Stem Cells

30, 1076-1086 (2012). 9. Collins, A.T., Berry, P.A., Hyde, C., Stower, M.J. & Maitland, N.J. Prospective identification of tumorigenic prostate cancer stem

cells. Cancer research 65, 10946-10951 (2005). 10. van den Hoogen, C., et al. High aldehyde dehydrogenase activity identifies tumor-initiating and metastasis-initiating cells in

human prostate cancer. Cancer research 70, 5163-5173 (2010). 11. Rayasam, G.V., Tulasi, V.K., Sodhi, R., Davis, J.A. & Ray, A. Glycogen synthase kinase 3: more than a namesake. Br J Pharmacol

156, 885-898 (2009). 12. Jope, R.S. & Johnson, G.V. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem Sci 29, 95-102 (2004). 13. Reya, T. & Clevers, H. Wnt signalling in stem cells and cancer. Nature 434, 843-850 (2005). 14. Clevers, H. Wnt/beta-catenin signaling in development and disease. Cell 127, 469-480 (2006). 15. Li, H., Chen, X., Calhoun-Davis, T., Claypool, K. & Tang, D.G. PC3 human prostate carcinoma cell holoclones contain self-

renewing tumor-initiating cells. Cancer research 68, 1820-1825 (2008). 16. van den Hoogen, C., et al. The aldehyde dehydrogenase enzyme 7A1 is functionally involved in prostate cancer bone

metastasis. Clin Exp Metastasis 28, 615-625 (2011). 17. Engler, T.A., et al. Substituted 3-imidazo[1,2-a]pyridin-3-yl- 4-(1,2,3,4-tetrahydro-[1,4]diazepino-[6,7,1-hi]indol-7-yl)pyrrole-

2,5-diones as highly selective and potent inhibitors of glycogen synthase kinase-3. J Med Chem 47, 3934-3937 (2004). 18. Miclea, R.L., et al. Inhibition of Gsk3beta in cartilage induces osteoarthritic features through activation of the canonical Wnt

signaling pathway. Osteoarthritis Cartilage 19, 1363-1372 (2011). 19. van Bezooijen, R.L., et al. Wnt but not BMP signaling is involved in the inhibitory action of sclerostin on BMP-stimulated bone

formation. J Bone Miner Res 22, 19-28 (2007). 20. Maretto, S., et al. Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proceedings of

the National Academy of Sciences of the United States of America 100, 3299-3304 (2003). 21. van den Hoogen, C., et al. Integrin alphav expression is required for the acquisition of a metastatic stem/progenitor cell

phenotype in human prostate cancer. The American journal of pathology 179, 2559-2568 (2011). 22. Sottnik, J.L., et al. Integrin alpha2beta 1 (alpha 2beta 1) promotes prostate cancer skeletal metastasis. Clin Exp Metastasis 30,

569-578 (2013). 23. Sun, A., et al. Lithium suppresses cell proliferation by interrupting E2F-DNA interaction and subsequently reducing S-phase

gene expression in prostate cancer. The Prostate 67, 976-988 (2007). 24. Case, L.B. & Waterman, C.M. Adhesive F-actin waves: a novel integrin-mediated adhesion complex coupled to ventral actin

polymerization. PloS one 6, e26631 (2011). 25. Yu, C.H., Law, J.B., Suryana, M., Low, H.Y. & Sheetz, M.P. Early integrin binding to Arg-Gly-Asp peptide activates actin

polymerization and contractile movement that stimulates outward translocation. Proceedings of the National Academy of Sciences of the United States of America 108, 20585-20590 (2011).

26. Korur, S., et al. GSK3beta regulates differentiation and growth arrest in glioblastoma. PloS one 4, e7443 (2009). 27. Fotovati, A., et al. YB-1 bridges neural stem cells and brain tumor-initiating cells via its roles in differentiation and cell growth.

Cancer research 71, 5569-5578 (2011). 28. Zhu, Q., et al. Suppression of glycogen synthase kinase 3 activity reduces tumor growth of prostate cancer in vivo. The

Prostate 71, 835-845 (2011). 29. Mai, W., et al. Deregulated GSK3{beta} sustains gastrointestinal cancer cells survival by modulating human telomerase reverse

transcriptase and telomerase. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 6810-6819 (2009).

30. Mazor, M., Kawano, Y., Zhu, H., Waxman, J. & Kypta, R.M. Inhibition of glycogen synthase kinase-3 represses androgen receptor activity and prostate cancer cell growth. Oncogene 23, 7882-7892 (2004).

31. Schutz, S.V., et al. Inhibition of glycogen synthase kinase-3beta counteracts ligand-independent activity of the androgen receptor in castration resistant prostate cancer. PloS one 6, e25341 (2011).

32. Maitland, N.J., Frame, F.M., Polson, E.S., Lewis, J.L. & Collins, A.T. Prostate cancer stem cells: do they have a basal or luminal phenotype? Hormones & cancer 2, 47-61 (2011).


33. Schwaninger, R., et al. Lack of noggin expression by cancer cells is a determinant of the osteoblast response in bone metastases. The American journal of pathology 170, 160-175 (2007).

34. Zenzmaier, C., et al. Elevated levels of Dickkopf-related protein 3 in seminal plasma of prostate cancer patients. J Transl Med 9, 193 (2011).

35. Thudi, N.K., et al. Dickkopf-1 (DKK-1) stimulated prostate cancer growth and metastasis and inhibited bone formation in osteoblastic bone metastases. The Prostate 71, 615-625 (2011).

36. Bisson, I. & Prowse, D.M. WNT signaling regulates self-renewal and differentiation of prostate cancer cells with stem cell characteristics. Cell Res 19, 683-697 (2009).

37. Yee, D.S., et al. The Wnt inhibitory factor 1 restoration in prostate cancer cells was associated with reduced tumor growth, decreased capacity of cell migration and invasion and a reversal of epithelial to mesenchymal transition. Molecular cancer 9, 162 (2010).

38. Lin, C., et al. Mesd is a general inhibitor of different Wnt ligands in Wnt/LRP signaling and inhibits PC-3 tumor growth in vivo. FEBS Lett 585, 3120-3125 (2011).

39. Thamilselvan, V., Menon, M. & Thamilselvan, S. Anticancer efficacy of deguelin in human prostate cancer cells targeting glycogen synthase kinase-3 beta/beta-catenin pathway. International journal of cancer. Journal international du cancer 129, 2916-2927 (2011).

40. Majid, S., Saini, S. & Dahiya, R. Wnt signaling pathways in urological cancers: past decades and still growing. Molecular cancer 11, 7 (2012).

41. Trowbridge, J.J., Xenocostas, A., Moon, R.T. & Bhatia, M. Glycogen synthase kinase-3 is an in vivo regulator of hematopoietic stem cell repopulation. Nat Med 12, 89-98 (2006).

42. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P. & Brivanlou, A.H. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med 10, 55-63 (2004).

43. Fung, T.K., Gandillet, A. & So, C.W. Selective treatment of mixed-lineage leukemia leukemic stem cells through targeting glycogen synthase kinase 3 and the canonical Wnt/beta-catenin pathway. Curr Opin Hematol 19, 280-286 (2012).

44. Kobayashi, T., et al. Glycogen synthase kinase 3 and h-prune regulate cell migration by modulating focal adhesions. Mol Cell Biol 26, 898-911 (2006).

45. Lapid, K., et al. GSK3beta regulates physiological migration of stem/progenitor cells via cytoskeletal rearrangement. The Journal of clinical investigation 123, 1705-1717 (2013).

46. Marthick, J.R. & Dickinson, J.L. Emerging putative biomarkers: the role of alpha 2 and 6 integrins in susceptibility, treatment, and prognosis. Prostate Cancer 2012, 298732 (2012).

47. Lipscomb, E.A. & Mercurio, A.M. Mobilization and activation of a signaling competent alpha6beta4integrin underlies its contribution to carcinoma progression. Cancer metastasis reviews 24, 413-423 (2005).

48. Colombel, M., et al. Increased expression of putative cancer stem cell markers in primary prostate cancer is associated with progression of bone metastases. The Prostate 72, 713-720 (2012).

49. van der Horst, G., et al. Targeting of alpha(v)-integrins in stem/progenitor cells and supportive microenvironment impairs bone metastasis in human prostate cancer. Neoplasia 13, 516-525 (2011).

50. Eaton, C.L., et al. Evaluation of the frequency of putative prostate cancer stem cells in primary and metastatic prostate cancer. The Prostate 70, 875-882 (2010).

Chapter 6

130


Supplementary Figure 1: The effect of GSK-3β inhibition on cellular morphology (A) Cells were treated with 100 nM GIN continuously or GIN was removed after 72 hours. (B) Cells were treated with 100 nM GIN for 6 days and the percentage of dead cells was determined using trypan blue exclusion.


Supplementary Figure 2: The effect of GSK-3β inhibition on mRNA expression of ALDH isoforms, self-renewal genes and putative stem cell markers (A) The effect of treatment of PC-3M-Pro4 cells with 100 nM GIN for 24 hours on (A) ALDH isoform mRNA expression and (B) mRNA expression of self-renewal genes and putative stem cell markers. *p<0.05 vs. control; **p<0.01 vs. control; ***p<0.001 vs. control.

Chapter 6

132

Chapter 7

Summary and Perspectives

Chapter 7

134

Summary

The landscape of treatment options for castration-resistant prostate cancer (CRPC) is

rapidly evolving. In 2004, the previous first-line treatment for CRPC, mitoxantrone plus

prednisone, was replaced with docetaxel plus prednisone as the latter displayed potent

clinical activity in a landmark phase 3 trial1. Although enhanced survival was

demonstrated (median overall survival 18.9 months with docetaxel administration every

3 weeks versus 16.5 months in the control arm), major obstacles still remain and these

include initial or acquired resistance and dose-limiting toxicities. In addition to

docetaxel, several other treatment options were recently approved by the FDA as they

were shown to prolong overall survival in CRPC, either in chemo-naïve or chemo-

pretreated patients. These treatments include the second-generation taxane

cabazitaxel2, immunotherapeutic sipuleucel-T 3, alpha emitter radium-223 4 and AR-

targeting agents abiraterone5 and enzalutamide6. Moreover, glucocorticoids (GC) are

frequently used in combination with the above mentioned therapeutics. Despite this

broad arsenal of therapeutic options, metastatic CRPC is still poorly managed, illustrated

by the fact that the majority of CRPC patients die within 3 years of diagnosis1.

For this reason, the aim of this PhD-thesis was to contribute to the improvement of

current therapeutics and to the development of novel therapeutics for patients with

metastatic CRPC. To this end, we explored four main strategies:

1) Exploit targeted nanomedicinal drug delivery

2) Dampen tumor-associated inflammation

3) Overcome chemotherapy resistance

4) Selective targeting of cancer stem/progenitor-like cells.


These therapeutic strategies were pursued in several studies and the outcome and

feasibility of these approaches are outlined in this PhD-thesis:

Chapter 1 provides an introduction on the clinical problem of prostate cancer and bone

metastasis and outlines the biological processes involved in prostate tumorigenesis.

Important players during prostate cancer metastasis and therapy resistance are

summarized and tumor characteristics that enable therapeutic targeting are presented.

Chapter 2 reviews the diverse strategies with liposomes that have been evaluated in

preclinical prostate cancer models to date. Furthermore, clinical trials assessing

liposomes in advanced prostate cancer patients are outlined.

Chapter 3 demonstrates the preclinical antitumor efficacy of liposomal dexamethasone

(DEX) in a model for prostate cancer bone metastasis. Liposomal encapsulation of DEX

strongly enhances systemic exposure, displays enhanced antitumor efficacy compared

to free DEX administration and is well tolerated in mice and rats. These findings suggest

further (pre)clinical exploration.

Chapter 4 investigates the role of the glucocorticoid receptor (GR) in prostate cancer

docetaxel resistance. Prostate tumors of docetaxel-pretreated patients exhibit

enhanced GR levels and functional involvement of GR in docetaxel resistance was

established. Therefore, GR provides a promising therapeutic target in docetaxel-

refractory disease.

Chapter 5 reports on the preclinical evaluation of micellar docetaxel. Micellar delivery of

docetaxel was shown to effectively prevent docetaxel-induced weight loss while

maintaining its antitumor efficacy. These findings warrant further (pre)clinical

examination.

Chapter 6 reveals the involvement of GSK-3β in the maintenance of prostate cancer

stem/progenitor-like cells. GSK-3β inhibition was shown to diminish the tumorigenic and

metastatic potential of prostate cancer cells. This provides a proof-of-principle for the

involvement of prostate cancer stem/progenitor-like cells in tumor-initiation and

metastasis.

Chapter 7

136

Perspectives

The potential role of nanomedicine in castration-resistant prostate cancer treatment

One of our aims was to improve currently available therapeutics for the clinical

management of CRPC by employing targeted drug delivery approaches in an attempt to

improve the therapeutic index, i.e. increased antitumor efficacy and/or decreased

adverse effects. To this end, we evaluated targeted micellar delivery of docetaxel and

liposomal delivery of DEX. In our studies, the main benefit of micellar delivery of

docetaxel was the prevention of side effects (i.e. weight loss), which is severe for free

docetaxel administration. The antitumor efficacy of docetaxel, however, did not

increase upon micellar encapsulation, although higher doses (i.e. at maximum tolerated

dose (MTD) ̴15-30 mg/kg)7 should be explored to determine the maximum therapeutic

benefit of micellar docetaxel. For DEX, the antitumor efficacy increased upon liposomal

encapsulation, most likely the result of enhanced circulation time and tumor-specific

localization, while liposomal encapsulation only minimally affected GC-associated side

effects8. Together, these studies highlight the potential of nanomedicine to enhance the

therapeutic index via two delivery modes, namely site-selective delivery and site-

avoidance delivery.

Numerous preclinical studies demonstrate efficient tumor localization of nanoparticles

in solid tumors9,10 including (bone) metastases8,11, and this is largely dependent on the

enhanced permeability and retention (EPR)-effect. However, the clinical relevance of the

EPR-effect has remained largely elusive. To our knowledge, only a limited number of

clinical studies provide evidence for the existence of the EPR-effect in cancer patients12-

14, but prostate cancer patients were not included. It is often not known if clinically

approved nanomedicinal formulations actually exploit the EPR-effect in cancer patients.

Doxil/Caelyx (liposomal doxorubicin), for instance, fails to enhance overall survival of

breast cancer patients15, but rather modulates its biodistribution thereby shifting the

toxicity profile of doxorubicin (e.g. reduced cardiotoxicity but increased skin

toxicity)16,17. Another clinically approved formulation, abraxane (albumin-bound

paclitaxel), does display enhanced efficacy compared to free paclitaxel (Taxol), but it is

unclear if this can be attributed to enhanced tumor localization or to the tolerability of

higher doses that then result in increased antitumor efficacy18,19. Hence, the importance


of the EPR-effect in cancer patients seems highly ambiguous. Several factors that may

undermine efficient tumor localization of nanomedicine in cancer patients include the

intratumoral and extratumoral heterogeneity in vascularization, high interstitial fluid

pressure and the lack of nanoparticle distribution into avascular tumor regions20.

These observations clearly stress the importance of using clinically relevant in vivo

models for cancer studies. In our efforts to address this for prostate cancer, we used a

model of intra-tibial injection of osteotropic prostate cancer cells, as patients with

metastatic bone disease represent a major population of prostate cancer patients for

which the investigated therapeutics are ultimately directed. It is still unclear, however, if

this model is comparable to actual bone metastases in terms of vasculature, EPR-effect,

interstitial fluid pressure and microenvironment. Therefore, future studies should be

directed at the development, improvement and clinical validation of in vivo models for

cancer.

Glucocorticoids in the treatment of castration-resistant prostate cancer

The rationale for GC usage in CRPC is plentiful. First, GCs diminish the secretion of

adrenocorticotropic hormone by the pituitary leading to decreased release of (pro-

tumorigenic) adrenal androgens. Second, GCs are commonly used as anti-emetics during

chemotherapy to prevent nausea and vomiting. Third, GCs have strong anti-

inflammatory activities that may help reduce pain from distant metastases. Fourth, GCs

silence tumor-promoting inflammation and angiogenesis21,22, and finally, GCs may be

directly cytotoxic to prostate cancer cells23. In a series of preclinical studies, we

evaluated the utility of targeted liposomal delivery of DEX in models for prostate cancer

bone metastases and showed enhanced antitumor efficacy of liposomal DEX compared

to conventional (non-encapsulated) DEX administration. Despite a drastic increase in

systemic exposure (100-fold increase in area under the curve upon liposomal

encapsulation), liposomal DEX does not present with any unexpected noteworthy

toxicities in tumor-bearing mice or healthy rats at dosages that display potent antitumor

efficacy (1.0 mg/kg/week). Hence, liposomal encapsulation increases the therapeutic

index of DEX in our preclinical prostate cancer studies pointing to further development

towards clinical investigation8.

Chapter 7

138

Based on the promising preclinical observations we have acquired funding for the

initiation of a Phase I/IIa clinical trial with liposomal DEX in advanced prostate cancer

patients (Leiden University Medical Center, Leiden, the Netherlands). In this study,

liposomal DEX will be administered in chemo-naïve CRPC patients upon onset of a rising

PSA, once every two weeks for a total of 3 injections. The major objective of this study is

to determine the maximum tolerated dose (MTD) of liposomal DEX in bone metastatic

CRPC patients while a secondary end point is a decline in serum PSA levels. From an

ethical point of view, it is important to realize that patients will be deprived of standard-

of-care docetaxel for the course of this study, which may result in accelerated tumor

growth. Alternatively, liposomal DEX may also be administered before a rise in serum

PSA occurs. With such a treatment approach, the time to PSA rise may be postponed,

thereby putting off docetaxel treatment.

It is of interest that a phase I trial with liposomal DEX will shortly be initiated in patients

with metastasized multiple myeloma, also aiming at assessing the MTD. This study may

be informative for the CRPC study, as the target population is similar in terms of age

range, and the dose-limiting toxicities (DLT) identified here could give clues about the

expected DLT in CRPC. Yet, the health condition of both patient populations could differ

significantly, thus highlighting the need for a dedicated Phase I trial in CRPC. It is

important to note that the proposed mechanism of action for antitumor efficacy of

liposomal DEX may differ between both disease indications. In CRPC, we believe that

silencing of tumor-associated inflammation plays a major role in the antitumor efficacy

of liposomal DEX, while in multiple myeloma we envision that liposomal DEX acts on

tumor cells directly as a cytotoxic agent. However, similarities in mechanism of action

may also be present between both cancers, e.g. inhibitory action on IL-6 activity24,25.

To further consider the clinical applicability of liposomal DEX, it is important to

acknowledge potential undesirable effects, i.e. the potential risks of (free) DEX,

liposomal DEX and liposomal carriers in general. Indeed, DEX is widely studied and its

pharmacokinetics and safety profile in a clinical setting are well-known, which allows

close monitoring and anticipation of the potential adverse effects in advanced prostate

cancer patients. It is important to note that liposomal DEX may have different

mechanisms of action compared to free DEX26, and this potentially yields additional

risks. In our studies, therapeutic doses of liposomal DEX (1.0 mg/kg) were not associated


with weight loss8, although studies in unrelated disease models do report this27,28. We

did observe a modest increase in liver toxicity, which is not surprising and can be

attributed to the altered distribution of DEX due to liposomal encapsulation, favouring

accumulation in the liver. To carefully address this, monitoring serum levels of liver-

toxicity markers, for example aspartate aminotransferase and alanine aminotransferase,

is paramount in our clinical studies.

Another disadvantage of using DEX (and GC in general) is the potential induction of

resistance to other currently used therapies for CRPC, i.e. AR-targeting therapy29,30 and

chemotherapy31-34. Though in this respect, it is reassuring that a recent meta-analysis

showed similar overall survival in CRPC patients treated with docetaxel and prednisone

compared to docetaxel without prednisone35. This indicates that the potential induction

of therapy resistance by GC does not result in shortened survival of CRPC patients.

Liposomal encapsulation may shift the balance of DEX’ actions towards antitumor

activity, as liposomes are quickly and efficiently taken up by tumor-associated

macrophages, targeting the actions of DEX mainly to macrophages (the proposed

mechanism of antitumor efficacy by DEX in CRPC) while shielding the tumor cells for DEX

exposure (thereby minimizing potential resistance-inducing activities). Taken all these

considerations into account, the usage of GC in CRPC seems justified, especially in

liposomal form. DEX seems to be the GC of choice, as a recent head-to-head comparison

between DEX and prednisolone revealed superiority of DEX with enhanced PSA-

response rate and prolonged time to PSA-progression in a Phase II trial36.

Risk analysis of liposomes

In addition to potential toxicities of DEX, the lipid carrier excipients that constitute the

liposomes, as well as the liposomes themselves may bring about health risks. The lipids

used to assemble our formulation of liposomal DEX - the phospholipids DPPC, DSPE-

PEG-2000 and cholesterol - are all biocompatible, (partly) endogenous, biodegradable

and essentially non-toxic37. Liposomes have been the focus of extensive preclinical and

clinical studies, and these generally favour their use. Despite this, it is important to

consider potential risks. As liposomes have a relative small size this may enable them to

circumvent many biological barriers, potentially giving rise to unexpected toxicities38.

Chapter 7

140

Liposomes are typically administered intravenously, upon which they circulate in the

systemic circulation where they may possess certain threats. First of all, liposomes can

cause blockage of capillaries and may thus induce pulmonary embolism39, although such

events have only been reported on rare occasions40. Second, the negative charge on the

PEG-moiety has been shown to cause complement activation, and as a result PEGylated

liposomes can give rise to hypersensitivity reactions, referred to as complement

activation-related pseudoallergy (CARPA)41. As CARPA represents a major barrier for

safe administration of PEGylated liposomes, efforts are made to modify PEG properties

in order to minimize the occurrence of CARPA42. In addition to these adverse effects,

tumor-promoting activities of (empty) liposomes have been reported, and intravenous

administration of liposomes was shown to enhance angiogenesis and decrease

antitumor immunity, together leading to accelerated tumor growth43. In contrast, the

majority of preclinical studies with empty liposomes report no effect on tumor growth44-

46. Further exploration of the potential toxic or tumor-promoting effects of (empty)

liposomes seems appropriate to aid further clinical use47,48.

Overcoming docetaxel resistance in castration-resistant prostate cancer

The antitumor activity of docetaxel is severely hampered by acquired resistance, and

this constitutes a major clinical problem in CRPC. Docetaxel resistance is caused by many

mechanisms including the overexpression of anti-apoptotic proteins49, overexpression

of ABC-transporters (e.g. P-glycoprotein; P-gp)50 and the modulation of β-tubulin51. We

characterized in vitro established docetaxel-resistant prostate cancer cells52 and

detected amplification of the GR, suggesting involvement of this nuclear receptor in

chemotherapy resistance. The clinical relevance of this finding was substantiated by the

observation that GR levels were enhanced in prostate tumors of docetaxel-pretreated

patients and the functional involvement of GR in docetaxel resistance was shown since

GR antagonism effectively potentiated docetaxel cytotoxicity in chemotherapy-resistant

cells. Similarly, GR overexpression and involvement in therapy-resistance was found for

AR blockage29,30,53. Therefore, GR antagonism especially seems a viable approach after

docetaxel or AR-targeting therapy, as this leads to GR amplification in prostate cancer

cells.


A recently identified mechanism of action of taxanes, next to microtubule stabilization,

is direct inhibition of AR transcriptional activity54,55. This similarity in mechanism of

action between taxanes and AR-targeting drugs may explain the presence of cross-

resistance towards docetaxel in enzalutamide- or abiraterone-resistant tumors56,57.

Cabazitaxel, enzalutamide and abiraterone are generally given in a post-docetaxel

setting58, and docetaxel pre-treatment may considerably undermine their antitumor

activity as second line treatments. Indeed, the clinical activity of cabazitaxel,

enzalutamide and abiraterone seems higher in chemo-naïve patients compared to

docetaxel-pretreated patients59. Cabazitaxel was shown, though, to remain active in

enzalutamide-resistant prostate cancer cells in vivo57 and in enzalutamide- and

abiratrone-pretreated CRPC patients60,61. Based on these preclinical and clinical

indications for cross-resistance, treatment sequencing in CRPC should be carefully

considered62. GR inhibition may also provide a beneficial approach to overcome cross-

resistance in CRPC, but more research is desired to delineate this potential application.

An alternative strategy to overcome chemotherapy resistance may be the use of

nanomedicinal drug carriers63-65. In contrast to free drugs, in which the ratio of influx

and efflux pump activity determines the intracellular drug concentration, the uptake of

drug carriers takes place via endocytosis which bypasses these transport events66,67.

After endocytosis, endosomes typically fuse with lysosomes which delivers the drug

carrier cargo deep into the cytoplasm, out of reach for the actions of drug efflux pumps

thereby preventing its efflux and enhancing its antitumor efficacy in chemotherapy-

resistant cells. Indeed, nanoparticles were shown to overcome chemotherapy resistance

to doxorubicin68,69 and paclitaxel70 in P-gp overexpressing cells. The clinical relevance of

P-gp in prostate cancer, however, is still disputed as studies show contrasting results, i.e.

no P-gp expression in clinical prostate cancer specimens71 in contrast to studies showing

enhanced P-gp expression upon disease progression72 and elevated exosomal P-gp in

docetaxel-resistant prostate cancer patients compared to chemo-naïve patients73. The

utility of nanomedicine to overcome mechanisms of chemotherapy resistance other

than P-gp has not yet been explored.

Chapter 7

142

Targeting CSC in castration-resistant prostate cancer

Over the last decade, the role of cancer stem/progenitor-like cells (CSC) in prostate

cancer progression is increasingly being recognized, and this includes their involvement

in chemotherapy resistance74-78. Docetaxel-resistant cells display enhanced prostate CSC

markers in vitro and the presence of such a docetaxel-resistant phenotype was shown in

primary and metastatic prostate cancer tissues75, outlining the clinical relevance of CSC

in (advanced) prostate cancer. Hence, CSC-targeted therapy may benefit prostate cancer

patients, specifically those with docetaxel-refractory tumors. In our studies, we show

the involvement of GSK-3β in the maintenance of prostate CSC, and that selective

inhibition of GSK-3β completely diminishes the CSC population (ALDHHIGH) in prostate

cancer cells, thereby restraining its tumorigenic and metastatic potential79. Although

this highlights the importance of prostate CSC in tumor initiation and dissemination, it is

still unclear if therapeutic blockage of GSK-3β could also lead to regression of

established prostate tumors and metastases. Hence, further preclinical evaluation

should address the utility of GSK-3β inhibitors according to a therapeutic protocol. In

such studies, preclinical models should resemble clinically relevant events in CRPC in

which CSC are likely involved, i.e. bone metastasis and docetaxel resistance. Of note,

systemic inhibition of GSK-3β may have undesired effects as this may lead to

uncontrolled Wnt signalling in other tissues. As enhanced Wnt signalling has been

associated with the development of many solid tumors80, most notably colorectal

cancer81, the use of GSK-3β inhibitors generates a serious risk of treatment-induced

tumors and therefore should be used with extreme caution. Nevertheless, our study on

GSK-3β provides a proof-of-principle on the utility of targeting CSC in advanced prostate

cancer, and encourages further exploration in this field.

Clinical perspective of experimental therapeutics

In this thesis, we have discussed several novel treatment approaches to battle advanced

prostate cancer. To further consider the applicability of such innovative therapeutic

strategies (or combinations thereof), selection of the appropriate patient population is

key. Novel therapeutics for CRPC could either compete with docetaxel as first-line

treatment, be used in combination with standard-of-care docetaxel, or should


specifically and efficiently target docetaxel-resistant disease to supplement the current

second-line treatments for CRPC. The clinical perspective of the novel treatment

approaches discussed in this thesis is schematically depicted in Figure 1.

Micellar docetaxel is a candidate drug that may compete with docetaxel as first-line

treatment in CRPC. In order to achieve this, additional preclinical studies should be

performed with higher doses of micellar docetaxel, in which it should display enhanced

antitumor efficacy or comparable antitumor efficacy with less adverse effects.

Alternatively, micellar docetaxel may be of value in docetaxel-refractory disease, but the

use of nanomedicine in overcoming chemotherapy resistance is not yet adequately

explored.

Liposomal DEX may be used as a monotherapy for prostate cancer patients after

hormone-resistance. Here, liposomal DEX may be efficient in prolonging the period of

time up to a rise in serum PSA. Alternatively, liposomal DEX may replace prednisone and

be administered in combination with docetaxel, although our outlined Phase I study will

thus far only involve chemo-naïve CRPC patients. Our preclinical studies only focused on

liposomal DEX as a mono treatment and further preclinical efforts should be focused on

combination treatment of liposomal DEX with docetaxel. Special attention should be

focused on whether liposomal DEX affects the antitumor efficacy of docetaxel, i.e. the

induction of docetaxel resistance by liposomal DEX.

GR antagonism may specifically be of value in docetaxel-refractory disease since GR

expression is elevated in docetaxel-resistant prostate tumors and was shown to be

functionally involved in chemotherapy resistance. This therapeutic strategy is, however,

still in an early stage of development and more preclinical studies are needed to

characterize the pharmacokinetics, dosing, tolerability and efficacy of GR antagonists in

docetaxel-resistant prostate xenografts. As the exact role of the GR is still controversial,

it is key to further investigate potential pro- and antitumor activities of both GR agonists

and GR antagonists, and in such studies direct effects on tumor cells and effects on the

supportive tumor microenvironment should be dissected.

Chapter 7

144

CSC-targeting agents may be used in the treatment of different stages of prostate

cancer as CSC appear to play a key role in several aspects of tumorigenesis. The CSC

population is elevated in docetaxel-resistant prostate tumors, pointing out a therapeutic

rationale for the treatment of docetaxel-refractory prostate cancer patients. So far, we

have provided proof-of-principle for the involvement of CSC in prostate cancer growth

and metastasis. In future studies, it is vital to examine the therapeutic feasibility of CSC-

targeting agents in preclinical prostate cancer studies.

Figure 1: Positioning of potential novel therapeutics in CRPC treatment. Currently used therapeutics for chemo-naïve and docetaxel-refractory prostate cancer are shown (orange boxes). The proposed positioning of novel therapeutic strategies discussed in this PhD-thesis are shown (blue boxes).


References 1. Tannock, I.F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New

England journal of medicine 351, 1502-1512 (2004). 2. de Bono, J.S., et al. Prednisone plus cabazitaxel or mitoxantrone for metastatic castration-resistant prostate cancer

progressing after docetaxel treatment: a randomised open-label trial. Lancet 376, 1147-1154 (2010). 3. Kantoff, P.W., et al. Sipuleucel-T immunotherapy for castration-resistant prostate cancer. The New England journal of

medicine 363, 411-422 (2010). 4. Parker, C., et al. Alpha emitter radium-223 and survival in metastatic prostate cancer. The New England journal of medicine

369, 213-223 (2013). 5. de Bono, J.S., et al. Abiraterone and increased survival in metastatic prostate cancer. The New England journal of medicine

364, 1995-2005 (2011). 6. Scher, H.I., et al. Increased survival with enzalutamide in prostate cancer after chemotherapy. The New England journal of

medicine 367, 1187-1197 (2012). 7. Dykes, D.J., Bissery, M.C., Harrison, S.D., Jr. & Waud, W.R. Response of human tumor xenografts in athymic nude mice to

docetaxel (RP 56976, Taxotere). Investigational new drugs 13, 1-11 (1995). 8. Kroon, J., et al. Liposomal delivery of dexamethasone attenuates prostate cancer bone metastatic tumor growth In Vivo. The

Prostate (2015). 9. Banciu, M., Fens, M.H., Storm, G. & Schiffelers, R.M. Antitumor activity and tumor localization of liposomal glucocorticoids in

B16 melanoma-bearing mice. Journal of controlled release : official journal of the Controlled Release Society 127, 131-136 (2008).

10. Schiffelers, R.M., et al. Liposome-encapsulated prednisolone phosphate inhibits growth of established tumors in mice. Neoplasia 7, 118-127 (2005).

11. Wang, F., Chen, L., Zhang, R., Chen, Z. & Zhu, L. RGD peptide conjugated liposomal drug delivery system for enhance therapeutic efficacy in treating bone metastasis from prostate cancer. Journal of controlled release : official journal of the Controlled Release Society 196, 222-233 (2014).

12. Koukourakis, M.I., et al. High intratumoural accumulation of stealth liposomal doxorubicin (Caelyx) in glioblastomas and in metastatic brain tumours. British journal of cancer 83, 1281-1286 (2000).

13. Koukourakis, M.I., et al. High intratumoral accumulation of stealth liposomal doxorubicin in sarcomas--rationale for combination with radiotherapy. Acta oncologica 39, 207-211 (2000).

14. Harrington, K.J., et al. Effective targeting of solid tumors in patients with locally advanced cancers by radiolabeled pegylated liposomes. Clinical cancer research : an official journal of the American Association for Cancer Research 7, 243-254 (2001).

15. O'Brien, M.E., et al. Reduced cardiotoxicity and comparable efficacy in a phase III trial of pegylated liposomal doxorubicin HCl (CAELYX/Doxil) versus conventional doxorubicin for first-line treatment of metastatic breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO 15, 440-449 (2004).

16. Gabizon, A., Shmeeda, H. & Barenholz, Y. Pharmacokinetics of pegylated liposomal Doxorubicin: review of animal and human studies. Clinical pharmacokinetics 42, 419-436 (2003).

17. Alberts, D.S., et al. Efficacy and safety of liposomal anthracyclines in phase I/II clinical trials. Seminars in oncology 31, 53-90 (2004).

18. Gradishar, W.J., et al. Phase III trial of nanoparticle albumin-bound paclitaxel compared with polyethylated castor oil-based paclitaxel in women with breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 23, 7794-7803 (2005).

19. Miele, E., Spinelli, G.P., Miele, E., Tomao, F. & Tomao, S. Albumin-bound formulation of paclitaxel (Abraxane ABI-007) in the treatment of breast cancer. International journal of nanomedicine 4, 99-105 (2009).

20. Nichols, J.W. & Bae, Y.H. EPR: Evidence and fallacy. Journal of controlled release : official journal of the Controlled Release Society 190, 451-464 (2014).

21. Banciu, M., Metselaar, J.M., Schiffelers, R.M. & Storm, G. Liposomal glucocorticoids as tumor-targeted anti-angiogenic nanomedicine in B16 melanoma-bearing mice. The Journal of steroid biochemistry and molecular biology 111, 101-110 (2008).

22. Banciu, M., Schiffelers, R.M., Fens, M.H., Metselaar, J.M. & Storm, G. Anti-angiogenic effects of liposomal prednisolone phosphate on B16 melanoma in mice. Journal of controlled release : official journal of the Controlled Release Society 113, 1-8 (2006).

23. Ndibe, C., Wang, C.G. & Sonpavde, G. Corticosteroids in the management of prostate cancer: a critical review. Current treatment options in oncology 16, 320 (2015).

24. Nishimura, K., et al. Potential mechanism for the effects of dexamethasone on growth of androgen-independent prostate cancer. Journal of the National Cancer Institute 93, 1739-1746 (2001).

25. Greenstein, S., Ghias, K., Krett, N.L. & Rosen, S.T. Mechanisms of glucocorticoid-mediated apoptosis in hematological malignancies. Clinical cancer research : an official journal of the American Association for Cancer Research 8, 1681-1694 (2002).


27. van den Hoven, J.M., et al. Optimizing the therapeutic index of liposomal glucocorticoids in experimental arthritis. International journal of pharmaceutics 416, 471-477 (2011).

28. Anderson, R., et al. Liposomal encapsulation enhances and prolongs the anti-inflammatory effects of water-soluble dexamethasone phosphate in experimental adjuvant arthritis. Arthritis research & therapy 12, R147 (2010).

Chapter 7

146

29. Isikbay, M., et al. Glucocorticoid receptor activity contributes to resistance to androgen-targeted therapy in prostate cancer. Hormones & cancer 5, 72-89 (2014).


31. Zhang, C., et al. Clinical and mechanistic aspects of glucocorticoid-induced chemotherapy resistance in the majority of solid tumors. Cancer biology & therapy 6, 278-287 (2007).

32. Zhang, C., et al. Corticosteroid-induced chemotherapy resistance in urological cancers. Cancer biology & therapy 5, 59-64 (2006).

33. Herr, I. & Pfitzenmaier, J. Glucocorticoid use in prostate cancer and other solid tumours: implications for effectiveness of cytotoxic treatment and metastases. The Lancet. Oncology 7, 425-430 (2006).

34. Herr, I., et al. Glucocorticoid cotreatment induces apoptosis resistance toward cancer therapy in carcinomas. Cancer research 63, 3112-3120 (2003).

35. Morgan, C.J., Oh, W.K., Naik, G., Galsky, M.D. & Sonpavde, G. Impact of prednisone on toxicities and survival in metastatic castration-resistant prostate cancer: A systematic review and meta-analysis of randomized clinical trials. Critical reviews in oncology/hematology 90, 253-261 (2014).

36. Venkitaraman, R., et al. A Randomised Phase 2 Trial of Dexamethasone Versus Prednisolone in Castration-resistant Prostate Cancer. European urology (2014).

37. Filion, M.C. & Phillips, N.C. Toxicity and immunomodulatory activity of liposomal vectors formulated with cationic lipids toward immune effector cells. Biochimica et biophysica acta 1329, 345-356 (1997).

38. Nystrom, A.M. & Fadeel, B. Safety assessment of nanomaterials: implications for nanomedicine. Journal of controlled release : official journal of the Controlled Release Society 161, 403-408 (2012).

39. Sugarman, S.M. & Perez-Soler, R. Liposomes in the treatment of malignancy: a clinical perspective. Critical reviews in oncology/hematology 12, 231-242 (1992).

40. Vorobiof, D.A., et al. First line therapy with paclitaxel (Taxol) and pegylated liposomal doxorubicin (Caelyx) in patients with metastatic breast cancer: a multicentre phase II study. Breast 13, 219-226 (2004).

41. Szebeni, J., et al. Hemodynamic changes induced by liposomes and liposome-encapsulated hemoglobin in pigs: a model for pseudoallergic cardiopulmonary reactions to liposomes. Role of complement and inhibition by soluble CR1 and anti-C5a antibody. Circulation 99, 2302-2309 (1999).

42. van den Hoven, J.M., et al. Complement activation by PEGylated liposomes containing prednisolone. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences 49, 265-271 (2013).

43. Sabnani, M.K., et al. Liposome promotion of tumor growth is associated with angiogenesis and inhibition of antitumor immune responses. Nanomedicine : nanotechnology, biology, and medicine 11, 259-262 (2015).

44. Banciu, M., Metselaar, J.M., Schiffelers, R.M. & Storm, G. Antitumor activity of liposomal prednisolone phosphate depends on the presence of functional tumor-associated macrophages in tumor tissue. Neoplasia 10, 108-117 (2008).

45. Cosco, D., et al. In vivo activity of gemcitabine-loaded PEGylated small unilamellar liposomes against pancreatic cancer. Cancer chemotherapy and pharmacology 64, 1009-1020 (2009).

46. Bornmann, C., et al. A new liposomal formulation of Gemcitabine is active in an orthotopic mouse model of pancreatic cancer accessible to bioluminescence imaging. Cancer chemotherapy and pharmacology 61, 395-405 (2008).

47. Rizzo, L.Y., et al. In Vivo Nanotoxicity Testing using the Zebrafish Embryo Assay. Journal of materials chemistry. B, Materials for biology and medicine 1(2013).

48. Nel, A., Xia, T., Madler, L. & Li, N. Toxic potential of materials at the nanolevel. Science 311, 622-627 (2006). 49. Yoshino, T., et al. Bcl-2 expression as a predictive marker of hormone-refractory prostate cancer treated with taxane-based

chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research 12, 6116-6124 (2006).

50. Sanchez, C., et al. Expression of multidrug resistance proteins in prostate cancer is related with cell sensitivity to chemotherapeutic drugs. The Prostate 69, 1448-1459 (2009).

51. Galletti, E., Magnani, M., Renzulli, M.L. & Botta, M. Paclitaxel and docetaxel resistance: molecular mechanisms and development of new generation taxanes. ChemMedChem 2, 920-942 (2007).

52. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology 181, 2188-2201 (2012).

53. Xie, N., et al. The expression of glucocorticoid receptor is negatively regulated by active androgen receptor signaling in prostate tumors. International journal of cancer. Journal international du cancer 136, E27-38 (2015).

54. Zhu, M.L., et al. Tubulin-targeting chemotherapy impairs androgen receptor activity in prostate cancer. Cancer research 70, 7992-8002 (2010).

55. Gan, L., et al. Inhibition of the androgen receptor as a novel mechanism of taxol chemotherapy in prostate cancer. Cancer research 69, 8386-8394 (2009).

56. van Soest, R.J., et al. Cross-resistance between taxanes and new hormonal agents abiraterone and enzalutamide may affect drug sequence choices in metastatic castration-resistant prostate cancer. European journal of cancer 49, 3821-3830 (2013).

57. van Soest, R.J., et al. Targeting the Androgen Receptor Confers In Vivo Cross-resistance Between Enzalutamide and Docetaxel, But Not Cabazitaxel, in Castration-resistant Prostate Cancer. European urology (2014).

58. Sartor, O., Michels, R.M., Massard, C. & de Bono, J.S. Novel therapeutic strategies for metastatic prostate cancer in the post-docetaxel setting. The oncologist 16, 1487-1497 (2011).

59. Nadal, R., et al. Clinical activity of enzalutamide in Docetaxel-naive and Docetaxel-pretreated patients with metastatic castration-resistant prostate cancer. The Prostate 74, 1560-1568 (2014).

60. Al Nakouzi, N., et al. Cabazitaxel Remains Active in Patients Progressing After Docetaxel Followed by Novel Androgen Receptor Pathway Targeted Therapies. European urology (2014).


61. Pezaro, C.J., et al. Activity of cabazitaxel in castration-resistant prostate cancer progressing after docetaxel and next-generation endocrine agents. European urology 66, 459-465 (2014).

62. Fitzpatrick, J.M. & de Wit, R. Taxane mechanisms of action: potential implications for treatment sequencing in metastatic castration-resistant prostate cancer. European urology 65, 1198-1204 (2014).

63. Liang, X.J., et al. Metallofullerene nanoparticles circumvent tumor resistance to cisplatin by reactivating endocytosis. Proceedings of the National Academy of Sciences of the United States of America 107, 7449-7454 (2010).

64. Ganju, A., et al. Nanoways to overcome docetaxel resistance in prostate cancer. Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy 17, 13-23 (2014).

65. Ganoth, A., Merimi, K.C. & Peer, D. Overcoming multidrug resistance with nanomedicines. Expert opinion on drug delivery 12, 223-238 (2015).

66. Kunjachan, S., et al. Overcoming cellular multidrug resistance using classical nanomedicine formulations. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences 45, 421-428 (2012).

67. Kunjachan, S., Rychlik, B., Storm, G., Kiessling, F. & Lammers, T. Multidrug resistance: Physiological principles and nanomedical solutions. Advanced drug delivery reviews 65, 1852-1865 (2013).

68. Cohen, K., Emmanuel, R., Kisin-Finfer, E., Shabat, D. & Peer, D. Modulation of drug resistance in ovarian adenocarcinoma using chemotherapy entrapped in hyaluronan-grafted nanoparticle clusters. ACS nano 8, 2183-2195 (2014).

69. Lei, T., et al. Comparing cellular uptake and cytotoxicity of targeted drug carriers in cancer cell lines with different drug resistance mechanisms. Nanomedicine : nanotechnology, biology, and medicine 7, 324-332 (2011).

70. Xiao, L., et al. Role of cellular uptake in the reversal of multidrug resistance by PEG-b-PLA polymeric micelles. Biomaterials 32, 5148-5157 (2011).

71. Van Brussel, J.P., et al. Expression of multidrug resistance related proteins and proliferative activity is increased in advanced clinical prostate cancer. The Journal of urology 165, 130-135 (2001).

72. Bhangal, G., et al. Expression of the multidrug resistance gene in human prostate cancer. Urologic oncology 5, 118-121 (2000). 73. Kato, T., et al. Serum exosomal P-glycoprotein is a potential marker to diagnose docetaxel resistance and select a taxoid for

patients with prostate cancer. Urologic oncology (2015). 74. Ni, J., et al. Cancer stem cells in prostate cancer chemoresistance. Current cancer drug targets 14, 225-240 (2014). 75. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch-

and hedgehog-dependent tumor-initiating cells. Cancer cell 22, 373-388 (2012). 76. Zhang, L., et al. Tumorspheres derived from prostate cancer cells possess chemoresistant and cancer stem cell properties.

Journal of cancer research and clinical oncology 138, 675-686 (2012). 77. Wang, L., et al. Enrichment of prostate cancer stem-like cells from human prostate cancer cell lines by culture in serum-free

medium and chemoradiotherapy. International journal of biological sciences 9, 472-479 (2013). 78. Liu, C., et al. NOTCH1 signaling promotes chemoresistance via regulating ABCC1 expression in prostate cancer stem cells.

Molecular and cellular biochemistry 393, 265-270 (2014). 79. Kroon, J., et al. Glycogen synthase kinase-3beta inhibition depletes the population of prostate cancer stem/progenitor-like

cells and attenuates metastatic growth. Oncotarget 5, 8986-8994 (2014). 80. Polakis, P. Wnt signaling in cancer. Cold Spring Harbor perspectives in biology 4(2012). 81. de Sousa, E.M., Vermeulen, L., Richel, D. & Medema, J.P. Targeting Wnt signaling in colon cancer stem cells. Clinical cancer

research : an official journal of the American Association for Cancer Research 17, 647-653 (2011).

Chapter 7

148

Appendices

Nederlandse Samenvatting

Curriculum Vitae

List of Publications

Acknowledgements

Appendices

150

Nederlandse Samenvatting

Jaarlijks worden ongeveer 11.000 mannen in Nederland gediagnosticeerd met

prostaatkanker. Bij een deel van deze patiënten leidt prostaatkanker tot uitzaaiingen

(metastasen), die bovendien ongevoelig zijn geworden voor de huidige hormonale

therapieën. Dit vergevorderde stadium van de ziekte wordt castratie-resistent

prostaatcarcinoom (CRPC) genoemd en is zeer dodelijk. Hoewel er meerdere

geneesmiddelen beschikbaar zijn om patiënten met deze vergevorderde vorm van

prostaatkanker te behandelen blijft de overlevingskans laag: vrijwel alle patiënten in dit

stadium zullen binnen 5 jaar overlijden.

De geneesmiddelen die momenteel voorhanden zijn, zijn onder andere

chemotherapeutica (taxanen, zoals docetaxel) en remmers van de androgeenreceptor,

een belangrijke receptor betrokken bij de groei van prostaatkanker. Ook worden vaak

glucocorticoïden (zoals dexamethason en prednison) aan deze patiënten

voorgeschreven, meestal in combinatie met andere therapeutica. Helaas geldt voor de

meeste geneesmiddelen dat deze ook tot bijwerkingen leiden in gezonde weefsels.

Daarnaast vermindert de effectiviteit van deze anti-tumor middelen. Dit afnemen van de

anti-tumorwerking wordt ook wel resistentie genoemd (therapie-ongevoeligheid).

In dit proefschrift tonen we strategieën die we hebben onderzocht om deze problemen

te omzeilen, 1) door “targeted tumor delivery”, met als doel het effectiever maken van

anti-tumormedicijnen en/of het verminderen van bijwerkingen door doelgerichte

aflevering in tumorweefsels en het vermijden van ophoping elders in het lichaam, en 2)

door het omzeilen van therapie-resistentie.

Eén van de strategieën voor het verbeteren van huidige therapieën is het doelgericht

afleveren van medicijnen in de omgeving van de tumor. Dit wordt ook wel “targeted

nanomedicine” of “drug targeting” genoemd. Bij deze methode worden medicijnen

verpakt in drug delivery-deeltjes (e.g. liposomen en micellen) met een grootte van rond

de 100 nanometer. Hierdoor neemt de circulatietijd in het bloed aanzienlijk toe

waardoor tumoren langer blootgesteld worden aan de geneesmiddelen. Bovendien

kunnen deze deeltjes preferentieel ophopen rondom de tumor, omdat de bloedvaten

van tumoren gekenmerkt worden door een betere permeabiliteit (‘lekkage van de

bloedvaten’). Ter plekke kunnen deze drug delivery deeltjes het ingesloten anti-

tumormiddel vrijgeven en/of door tumor- of omgevingscellen opgenomen worden,

hetgeen weer kan leiden tot anti-tumor activiteit.

In hoofdstuk 2 wordt een overzicht gegeven van alle prostaatkanker studies waarin

liposomen gebruikt worden om preferentieel medicijnen af te leveren in tumoren. Uit

deze studies komt naar voren dat vooral liposomale chemotherapeutica onderzocht zijn,

en dat dit heeft geleid tot klinische fase I-II studies bij prostaatkankerpatiënten. De

bevindingen die uit deze onderzoeken naar voren komen, duiden op een anti-tumor

werking na toediening van liposomaal doxorubicine (een vorm van chemotherapie), en

een sterke vermindering van hartschade, een veelvoorkomende bijwerking van

conventionele toediening van doxorubicine.

In hoofdstuk 3 wordt beschreven dat het doelgericht afleveren van dexamethason, door

het verpakken in liposomen, leidt tot een sterke anti-tumorwerking in ziektemodellen

voor menselijke prostaatkanker. Dit komt doordat de activiteit van tumor-

ondersteunende ontstekingscellen geremd wordt. Ons onderzoek heeft aangetoond dat

liposomen zich op een efficiënte manier lokaliseren in botuitzaaiingen. Deze

doelgerichte aflevering van dexamethason leidt ertoe dat de anti-tumor werking

toeneemt ten opzichte van de vrije (niet-liposomale) toedieningsvorm van

dexamethason. Bovendien blijken therapeutisch actieve doseringen van liposomaal

dexamethason, ondanks een flink verhoogde circulatietijd (en dus blootstelling), niet of

nauwelijks bijwerkingen te geven. Concluderend kan gesteld worden dat liposomaal

dexamethason een veelbelovende nieuwe therapeutische optie is voor vergevorderde

prostaatkanker (inclusief botmetastasen), en lijkt de stap naar klinische evaluatie in

patiënten met gemetastaseerd prostaatkanker gerechtvaardigd. Naar verwachting

zullen klinische fase I-II studies in 2016 van start gaan.

In hoofdstuk 4 is het belang van de glucocorticoïd receptor (GR) bij de ontwikkeling van

resistentie voor docetaxel (eerstelijns therapie voor CRPC patiënten) aangetoond. Een

verhoogde expressie van de GR werd waargenomen bij tumorcellen van

prostaatkankerpatiënten die eerder behandeld zijn met docetaxel. Dezelfde bevindingen

werden gedaan met docetaxel-resistente prostaatkankercellijnen. De functionele

betrokkenheid van de GR in docetaxel-resistentie wordt nader onderbouwd doordat het

Appendices

152

selectief verwijderen van de GR de gevoeligheid voor docetaxel behandeling weer laat

toenemen. Het blokkeren van de GR blijkt een effectieve aanpak te zijn om docetaxel-

resistente kankercellen opnieuw gevoelig te maken voor behandeling met

chemotherapie. Een van de mogelijk onderliggende mechanismen is dat remming van

de GR leidt tot een verminderde expressie van zogenaamde anti-apoptose eiwitten, te

weten Bcl-2 en Bcl-xL. Door de verminderde expressie van deze eiwitten kan docetaxel

opnieuw kankercellen doden via het mechanisme van ‘geprogrammeerde celdood’

(apoptose). Op basis van onze resultaten lijkt de gecombineerde behandeling met

docetaxel en GR-remmers veelbelovend en wenselijk voor patiënten met docetaxel-

resistente prostaatkanker.

In hoofdstuk 5 is onderzocht of de werking van docetaxel verbeterd kan worden door

gebruik te maken van micellen, dit zijn een specifiek soort drug delivery-deeltjes om

medicijnen doelgericht af te leveren. De door ons gebruikte micellen worden

gekenmerkt door het unieke П-П-stacking-principe. Dit principe is gebaseerd op de non-

covalente interacties tussen aromatische ringen die aanwezig zijn in zowel docetaxel als

in de polymeren die gebruikt worden om micellen te fabriceren. Deze П-П interacties

zorgen voor zeer stabiele micellen (door de polymeer-polymeer interacties) en voor een

hoge drugretentie (door de polymeer-docetaxel interacties). Behandeling met deze

docetaxel-micellen in klinisch-relevante modellen leidt tot een sterke remming van

botuitzaaiingen, die vergelijkbaar is met de remming door conventioneel, ‘vrij’,

docetaxel. In tegenstelling tot vrij docetaxel, waarbij aanzienlijke bijwerkingen

waargenomen worden, leidt toediening van docetaxel-micellen niet tot deze

bijwerkingen. Op basis van bovenstaande positieve bevindingen is het nu – in principe -

mogelijk om te behandelen met een relatief hogere dosis docetaxel-micellen (in

vergelijking met vrij docetaxel), hetgeen kan leiden tot een versterkt anti-tumor effect.

Nader onderzoek zal dit moeten uitwijzen.

In hoofdstuk 6 wordt selectieve remming van een specifieke subpopulatie van

kankercellen, de zogenaamde kankerstamcellen, bestudeerd. Kankerstamcellen zijn de

cellen die verantwoordelijk worden geacht voor het uitzaaien van tumoren. Bovendien

zijn kankerstamcellen niet of nauwelijks gevoelig voor conventionele kankertherapieën.

Onze studie laat het belang van het eiwit GSK-3β zien bij de handhaving van het

kankerstamcel-fenotype. Remming van GSK-3β vermindert het percentage

kankerstamcellen in prostaatkanker. Dit gaat gepaard met een sterk verminderde

capaciteit om tumoren te vormen en een sterke afname in metastasepotentieel. Verder

onderzoek zal de therapeutische waarde van selectieve remming van kankerstamcellen

moeten aantonen.

Hoofdstuk 7 beschrijft de mogelijke klinische toepassing en de vervolgstappen van de

verschillende therapeutische strategieën die in dit proefschrift beschreven zijn. Een

belangrijke strategie is het toepassen van “targeted drug delivery”. Door gebruik te

maken van liposomen en micellen zijn we in staat gebleken om respectievelijk de anti-

tumorwerking van dexamethason te verhogen en de bijwerkingen van docetaxel te

verminderen. Op basis van onze pre-klinische onderzoeksresultaten met liposomaal

dexamethason hebben wij financiering verworven om fase I-II klinische studies met

prostaatkankerpatiënten te initiëren. Het voornaamste doel is om de maximaal

tolereerbare dosis van liposomaal dexamethason te bepalen en om de

serumconcentratie van prostaat-specifiek antigen (PSA), een belangrijke indicator voor

prostaatkankergroei, te vervolgen. Op basis van de PSA kan een eventuele anti-tumor

werking in prostaatkankerpatiënten worden vastgesteld.

Om de haalbaarheid van een klinische toepassing te bepalen is het van essentieel belang

om de mogelijke nadelige effecten te onderkennen. De (verhoogde) anti-tumor werking

van liposomen en micellen is sterk afhankelijk van de verhoogde doorlaatbaarheid

(permeabiliteit) van de tumorbloedvaten, waardoor deze drug delivery-deeltjes zich

efficiënt in de tumoromgeving kunnen ophopen. Het is op dit moment nog onduidelijk

of deze verhoogde permeabiliteit van de tumorbloedvaten bij de mens een grote rol

speelt voor het doelgericht afleveren van medicijnen aan de tumor. Verder klinisch

onderzoek is dan ook noodzakelijk om dit in (prostaat)-kankerpatiënten te

karakteriseren. Voorts is het van belang, in het geval van liposomaal dexamethason, de

mogelijke risico’s van liposomen goed in kaart te brengen. Doordat het gebruik van

liposomen de weefseldistributie van een medicijn beïnvloed, kan het bijvoorbeeld zo zijn

dat dit mogelijk (nieuwe) bijwerkingen met zich mee brengt. Het is geruststellend dat de

toediening van therapeutische doseringen van liposomaal dexamethason in onze pre-

klinische studies niet geassocieerd was met (onverwachte) bijwerkingen.

Appendices

154

Een ander risico bij het gebruik van glucocorticoïden (zoals dexamethason) is het

ontwikkelen van ongevoeligheid voor chemotherapie. In studies naar

prostaatkankercellen is gebleken dat de gevoeligheid voor docetaxelbehandeling

verminderd wordt door toediening van glucocorticoïden. Tegenstellend is de bevinding

in een recente meta-analyse die uitwijst dat de overlevingskans van patiënten met en

zonder glucocorticoïd behandeling vergelijkbaar is. Dit duidt erop dat het ontwikkelen

van chemotherapie-ongevoeligheid door glucocorticoïden niet opweegt tegen de

gunstige (anti-tumor) effecten. Alles bij elkaar genomen lijkt de klinische toediening van

liposomaal dexamethason in patiënten met prostaatkanker gerechtvaardigd.

Een andere strategie om de huidige therapieën te verbeteren is het opheffen van

chemotherapie-resistentie. Eerder is de betrokkenheid van de GR bij resistentie tegen

hormonale therapie (remmers van de androgeenreceptor signaleringsroute) al

beschreven en wij tonen nu aan dat de GR ook betrokken is bij resistentie voor het

chemotherapeuticum docetaxel. Remming van de GR lijkt een veelbelovende aanpak,

aangezien de GR functioneel betrokken is bij docetaxel-resistentie en tot verhoogde

expressie wordt gebracht bij prostaatkankerpatiënten die behandeld worden met

docetaxel. Verdere preklinische studies zijn vereist om de combinatietherapie met

docetaxel en GR-remmers te optimaliseren, ter voorbereiding voor verder klinisch

gebruik.

Ten slotte is het van cruciaal belang om de juiste patiëntenpopulatie voor de beoogde

verbeterde therapieën te selecteren. Nieuwe medicinale therapieën moeten of 1) de

huidige “standard-of-care” docetaxel kunnen verbeteren, of 2) gebruikt kunnen worden

in combinatie met docetaxel of 3) specifiek effectief zijn bij de behandeling van

docetaxel-resistente prostaatkanker. Docetaxel-micellen zullen de conventionele

docetaxel behandeling als eerstelijns behandeling van CRPC moeten kunnen verbeteren.

Liposomaal dexamethason lijkt juist als monotherapie veelbelovend, terwijl

combinatiebehandeling met docetaxel de effectiviteit van de chemotherapie mogelijk

niet ten goede komt. GR-blokkade kan specifiek in docetaxel-resistente prostaatkanker

een rol spelen om de gevoeligheid voor de docetaxel behandeling te herstellen.

Stamcel-gerichte therapieën kunnen potentieel in meerdere stadia van het ziektebeloop

van prostaatkanker ingezet worden, omdat kankerstamcellen in zowel de docetaxel-

gevoelige als docetaxel-resistente ziektefase een belangrijke rol spelen.

Curriculum Vitae

Jan Kroon was born on the 29th of June, 1988 in Nijmegen, the Netherlands. After

finishing secondary school at the ‘Dalton-college’ in Voorburg in 2005, he started the

study Biomedical Sciences at Leiden University for which he obtained his Bachelor of

Science degree in 2009. After this, Jan started the Masters Programme in Oncology at

the VU University, Amsterdam, the Netherlands. This comprised a half year internship at

the department of Experimental Medicine at Imperial College London, London, United

Kingdom. He graduated for his Master’s degree in 2011 and after half a year of overseas

travel he started his PhD-research in January 2012, under the supervision of Prof. Dr.

Gert Storm, Dr. Gabri van der Pluijm and Dr. Bart Metselaar. This 4-year PhD-project

focused on the development of novel therapeutics for prostate cancer and the results of

this work are presented in the PhD-thesis entitled: “The preclinical development of

novel treatment options for advanced prostate cancer”, for which the defence took

place on the 20th of January 2016. Throughout his PhD-period, Jan won a young

investigator award at the ESUR meeting in Urological research in Dresden, Germany

(2013), and a poster pitch award at the NanoNextNL Nanomedicine meeting in

Amsterdam, the Netherlands (2015).

Appendices

156

List of Publications

2016 Kroon J, Puhr M, Buijs JT, van der Horst G, Hemmer DM, Marijt KA, Hwang MS, Masood M, Grimm S, Storm G, Metselaar JM, Meijer OC, Culig Z, van der Pluijm G. Glucocorticoid receptor antagonism reverts docetaxel resistance in human prostate cancer. Endocrine-Related Cancer. 2016 Jan; 23(1):35-45.

2015 Kroon J, Buijs JT, van der Horst G, Cheung H, van der Mark M, van Bloois L, Rizzo LY, Lammers T, Pelger RC, Storm G, van der Pluijm G, Metselaar JM. Liposomal delivery of dexamethasone attenuates prostate cancer bone metastatic growth in vivo. The Prostate. 2015 Jun; 75(8):815-24.

2014 Pazarentzos E, Mahul-Mellier AL, Datler C, Chaisaklert W, Hwang MS, Kroon J, Qize D, Osborne F, Al-Rubaish A, Al-Ali A, Mazarakis ND, Aboagye EO, Grimm S. IκBα inhibits apoptosis at the outer mitochondrial membrane independently of NF-κB retention. EMBO J. 2014 Dec 1; 33(23):2814-28.

2014 Kroon J, In ‘t Veld LS, Buijs JT, Cheung H, van der Horst G, van der Pluijm G. Glycogen synthase kinase-3β inhibition depletes the population of prostate cancer stem/progenitor-like cells and attenuates metastatic growth. Oncotarget. 2014 Oct 15; 5(19):8986-94.

2014 Kroon J, Metselaar JM, Storm G, van der Pluijm G. Liposomal nanomedicines in the treatment of prostate cancer. Cancer Treat Rev. 2014 May; 40(4):578-84.

2013 de Wilt LH, Kroon J, Jansen G, de Jong S, Peters GJ, Kruyt FA. Bortezomib and TRAIL: a perfect match for apoptotic elimination of tumour cells? Crit. Rev. Oncol. Hematol. 2013 Mar; 85(3):363-72.

2012 Oosterhoff D, Lougheed S, van der Ven R, Lindenberg J, van Cruijsen H, Hiddingh L, Kroon J, van den Eertwegh AJ, Hangalapura B, Scheper RJ, de Gruijl TD. Tumor-mediated inhibition of human dendritic cell differentiation and function is consistently counteracted by combined p38 MAPK and STAT3 inhibition. Oncoimmunology. 2012 Aug 1;1(5):649-658.

2012 Buijs JT, van der Horst G, van den Hoogen C, Cheung H, de Rooij B, Kroon J, Petersen M, van Overveld PG, Pelger RC, van der Pluijm G. The BMP2/7 heterodimer inhibits the human breast cancer stem cell subpopulation and bone metastases formation. Oncogene. 2012 Apr 26;31(17):2164-74.

Acknowledgements

Het uitvoeren (en succesvol afronden) van een promotietraject is zonder twijfel een

uitdagende periode geweest, en ik wil dan ook alle betrokken personen bedanken voor

hun intellectuele, experimentele, mentale of morele steun. Allereerst, mijn promotor

Prof. Storm. Gert, ik heb jouw betrokkenheid bij mijn promotietraject altijd erg op prijs

gesteld en vooral jouw gefocuste en efficiënte begeleiding waren erg belangrijk voor het

succesvol afronden hiervan. Ik bewonder jouw ambitie om preklinische bevindingen

naar de kliniek te krijgen en ben ervan overtuigd dat dit gaat lukken.

Mijn co-promotoren: Dr. van der Pluijm en Dr. Metselaar. Gabri, ik waardeer het dat je

me 4 jaar geleden de kans gaf om me als promovendus bij jouw onderzoeksgroep te

voegen. De vrijheid die me gegeven is om zelfstandig wetenschappelijk onderzoek te

doen, alsmede de mogelijkheden om (buitenlandse) congressen te bezoeken heb ik

altijd erg op prijs gesteld. Dit heeft zeker mijn creativiteit, motivatie en moraal om

onderzoek te doen gestimuleerd. Bedankt! Bart, vanaf het begin van mijn project heb ik

jouw eerlijke, directe en constructieve commentaar erg gewaardeerd. Ik heb een hoop

geleerd van jouw pragmatische en klinisch-georiënteerde denkwijze, je stelde vaak de

juiste vraag op het juiste moment en stimuleerde mij na te denken over de context van

mijn bevindingen. Bedankt voor dit alles.

Dan wil ik mijn directe collega’s van de urologie afdeling bedanken. Jeroen, mijn

wetenschappelijke carrière – een stage tijdens de bachelor fase - begon onder jouw

supervisie, bedankt dat je me wegwijs hebt gemaakt in de wetenschap en het was een

genoegen je later weer tegen te komen als collega. Geertje, bedankt voor jouw hulp

met allerlei zaken in en rondom het lab, dit heeft me in het begin van mijn promotie

goed op weg geholpen. Eugenio, we started our PhD-projects at the same time (well, to

be exact: one day difference) and I always appreciated your help, I wish you all the best

with finishing your PhD, and with your future career. Marjan, ik heb je maar kort als

collega meegemaakt, maar ik ben ervan overtuigd dat je tijdens je promotie mooie

dingen gaat doen. Henry, Kasia, Marianna, Federico, Sofia, it was great working with all

of you and I wish you all the best for your future careers, wherever these may be.

Maaike, ook wij begonnen ongeveer tegelijkertijd bij de afdeling urologie. Ik waardeer

het echt enorm dat je op deze belangrijke dag naast me staat als paranimf.

Appendices

158

Verder wil ik ook alle studenten bedanken die ik begeleidt heb, Anne, Eline, Danielle,

bedankt voor jullie inzet, jullie hebben allemaal een grote bijdrage geleverd. Lars, je was

de eerste student die ik begeleidde en dit heeft in een snel tempo geleidt tot mijn eerste

research-paper, waar jij dan ook zeer terecht als tweede auteur op staat. Daarnaast sta

je deze dag naast mij als paranimf, bedankt.

Ik heb het genoegen gehad om tijdens mijn promotie met veel inspirerende en

talentvolle mensen samen te kunnen werken, en dit heeft zeker een uiterst belangrijke

rol gespeeld tijdens mijn promotietraject. Twan Lammers, bedankt voor je belangrijke

bijdrage voor het liposomaal DEX project. Wim Hennink en Mies van Steenbergen,

bedankt voor jullie hulp en input met betrekking tot het micellair-docetaxel project.

Zoran Culig and Martin Puhr, a special thanks to you for our fruitful collaboration on the

GR project. Your ideas, initiative and efforts were invaluable, and I hope this will yield

more interesting shared projects in the future. Koen Marijt, ik heb altijd genoten van

onze wetenschappelijke gesprekken. Bedankt voor je hulp met de CRISPR constructen,

dit was een belangrijk aspect van de GR-studie. Onno Meijer, ik waardeer onze

discussies omtrent de GR-studie, jouw ideeën hebben het stuk zeker naar een hoger

niveau getild. Ik verheug me erop om in de toekomst samen te werken.

De sfeer in het lab was altijd goed, en ik wil hiervoor dan ook mijn ENDO collega’s

bedanken. Ik heb genoten van de vele koffiepauzes, borrels en lab-uitjes. Ik ben er zeker

van ben dat ik een hoop van jullie vergeet, maar ik doe m’n best: Mieke, Martine,

Janine, Mariette, Edwin, Andrea, Rosa, Geerte, Eline, Kimberley, Huub, Lisanne,

Patrick, Louis, Mattijs, Lianne, Isabel, Jose, Lisa, Lisa, Jimmy, Monique, Maaike,

Nienke. Sander, jij was een paar maanden geleden al aan de beurt en ik vond het een

eer om naast je te mogen staan. Ik heb genoten van onze (wetenschappelijke en niet-

wetenschappelijke) weddenschappen, het organiseren van de (spontane) borrels en ik

wens je veel succes in Oxford. Verder een speciale vermelding voor Chris, Hetty, Trea,

jullie zijn zonder twijfel het fundament van het D4-lab, en hebben mij de laatste 4 jaar

dan ook met van alles en nog wat geholpen, en daarnaast hebben jullie veel gezelligheid

gebracht. Heel erg bedankt voor alles.

Mijn interesse voor de medische sector werd eigenlijk al op jonge leeftijd aangewakkerd

en het was dan ook geen verrassing dat mijn studierichting hierop aan sloot. Peer en

Marleen, bedankt voor jullie interesse en steun over de jaren heen.

Eef, wij kwamen elkaar tegen in het lab en zijn nu al een tijdje samen. Je bent in de

laatste fase van mijn promotie een enorme steun geweest en ik verheug me erg op onze

toekomst samen, met als eerste stop: onze wereldreis!

Appendices

160

Stellingen behorende bij het proefschrift

THE PRECLINICAL DEVELOPMENT OF NOVEL TREATMENT OPTIONS FOR ADVANCED PROSTATE CANCER

1. Het inflammatoire micromilieu is een aantrekkelijk therapeutisch doelwit in

prostaatkanker (dit proefschrift).

2. De glucocorticoïdreceptor is oorzakelijk betrokken bij het optreden van

chemotherapie resistentie van prostaatkanker (dit proefschrift).

3. Het selectief remmen van kanker stam/voorlopercellen vermindert de

metastaseringscapaciteit bij prostaatkanker (dit proefschrift).

4. De grootte van nanomedicinale geneesmiddeldragers is de meest cruciale

eigenschap voor het efficiënt doelgericht afleveren van medicijnen.

5. Nader klinisch onderzoek is wenselijk om het daadwerkelijke belang van het

“enhanced permeability and retention effect” bij kankerpatiënten te kunnen

beoordelen.

6. De omgekeerd evenredige correlatie tussen de androgeenreceptor en de

glucocorticoïdreceptor faciliteert kruisresistentie tussen remmers van de

androgeenreceptor en chemotherapeutica.

7. De timing van een behandeling is doorslaggevend voor de therapeutische

effectiviteit.

8. Niet alles wat glimt is goud.

Jan Kroon

Enschede, 20 januari 2016

Documents

THE PRECLINICAL DEVELOPMENT OF NOVEL TREATMENT OPTIONS FOR ADVANCED PROSTATE CANCER · Figure 2: Clinical progression of prostate cancer and current treatment options. At initial