Supplementary Information for:

Disruption of the P2RY5 Gene in Humans Underlies Autosomal Recessive Woolly Hair Yutaka Shimomura1, Muhammad Wajid1, Yoshiyuki Ishii1, Lawrence Shapiro3, Lynn Petukhova1, Derek Gordon4 and Angela M. Christiano1,2

1Departments of Dermatology and 2Genetics & Development, 3Departments of Biochemistry & Molecular Biophysics and Ophthalmology, Columbia University College of Physicians & Surgeons, New York, New York 10032, USA. 4Department of Genetics, Rutgers University, Piscataway, New Jersey 08854, USA.

Supplementary Note: 1. Clinical aspects of woolly hair Woolly hair (WH) is a group of disorders involving structural defects of the hair shaft, which are characterized by tightly curled hair1. In 1974, Hutchinson et al. reported several common features of WH2. The onset of WH is at birth or soon after birth, and the hair symptoms often improve with age. Second, the hair is brittle and tightly curled, and it is hard to brush or comb the hair. Third, the root of the hair is dystrophic and lacking in root sheath components.

Affected individuals with WH can show other symptoms in the skin, such as palmoplantar keratoderma3,4 and keratosis pilaris1. In addition, as mentioned in the main text, WH can also appear as a part of several systemic diseases1. Although some of the causative genes of syndromic WH have been gradually disclosed, the pathogenesis of WH without associated findings (non-syndromic WH) remains largely unknown. Non-syndromic WH can be inherited as either an autosomal dominant (ADWH; OMIM 194300)2 or autosomal recessive (ARWH; OMIM 278150)2,5 trait. Only two families with ARWH have been reported in the literature2,5. The first family was a large consanguineous family with 6 affected individuals who showed not only tightly curled hair, but also less dense and depigmented hair5. The second family had only one affected male whose parents were second cousins2. The hair of the affected individual was depigmented and sparse. Based on these reports, an associated feature of ARWH may be sparse hair, however, woolly hair is an invariant finding. Due to the limited information in the literatuure, however, the complete clinical spectrum of ARWH has not yet completely been established. 2. Clinical features of ARWH families analyzed in this study We identified 6 consanguineous families of Pakistani origin with a similar hair disorder. All affected individuals have various degrees of woolly hair since their birth (Fig. 1a,b and Supplementary Fig. 1a-h). Most affected individuals show fine, tightly curled hair which is difficult to be comb. Hair growth is generally slow and stops growing at a few inches. Some affected individuals have thin and light-colored hair that can be easily plucked. Hair density is variable among affected individuals, ranging from normal to less dense. It is noted that the hair phenotype of some affected individuals is relatively mild (Fig. 1a and Supplementary Fig. 1c,g), and such variation in phenotype is observed among affected individuals within a family. There is no obvious difference in severity between families. In most cases, the hair symptoms have improved with age. We observed plucked hairs of affected individuals under light microscopy. As compared with the plucked hair of a control individual (Supplementary Fig. 1i), the hairs of affected individuals shows dystrophic features without root sheath components (Fig. 1c and Supplementary Fig. 1j). The hair shaft is twisted

(Supplementary Fig. 1k) and the distal portion shows a tapered end (Supplementary Fig. 1l ).

Because some affected individuals show less dense hair, a variant of autosomal recessively inherited hypotrichosis could be considered as differential diagnosis. We have recently reported that mutations in the desmoglein 4 gene (DSG4) cause localized autosomal recessive hypotrichosis (OMIM 607903)6, which is characterized by sparse and fragile hair, as well as diffuse perifollicular papules on the scalp. In addition, moniliform hair, which is a hair shaft anomaly showing the node and internode formation, is observed in some cases7-9. In the ARWH families, neither perifollicular papules nor moniliform hair was detected, and we excluded the DSG4 gene from all 6 ARWH families using microsatellite markers close to DSG4. More recently, a common founder mutation in the Lipase H gene (LIPH) has been shown to cause an autosomal recessive form of hypotrichosis (OMIM 604379) in Russian populations10. Affected individuals with LIPH mutations show sparse and kinky hair10. Linkage analysis similarly excluded LIPH from all 6 ARWH families. The single invariable clinical feature among affected individuals in our families is woolly hair, while hair density varies from normal to sparse, and can be a present or absent finding. Based on the previous reports, as well as the clinical features in the 6 Pakistani families, we concluded that the appropriate diagnosis for these families is ARWH.

Supplementary Methods: Clinical details and DNA extraction. Informed consent was obtained from all subjects and approval for this study was provided by the Institutional Review Board of Columbia University. The study was conducted in adherence to the Declaration of Helsinki Principles. Peripheral blood samples were collected from members of 6 Pakistani families as well as 100 unrelated healthy control individuals of Pakistani origin. Genomic DNA was isolated from these samples according to standard techniques11. Two-point / multipoint linkage and TDT analyses. Two-point and multipoint linkage analyses were performed for all markers genotyped in the region where we observed an excess of homozygosity among affected individuals and for which a mutation was subsequently found. We also performed TDT linkage analysis using the method implemented in the TDTAE program12,13. The purpose of the linkage and TDT analysis is to provide statistical evidence that this gene is the disease gene for all pedigrees in this study. These analyses were performed on a total of 4 pedigrees: ARWH2, ARWH5, ARWH15, and ARWH24. Two-point and multipoint linkage analyses were carried out using the MLINK program of the FASTLINK suite of programs14-16. Two-point LOD scores were computed for recombination fraction values of θ = 0.0, 0.01, 0.05, 0.10, 0.20, 0.30 and 0.40. The linkage parameters used were a disease frequency of 0.001, and a fully penetrant autosomal recessive mode of inheritance. Marker allele frequencies were estimated from the data obtained using observed and reconstructed genotypes of founders within the pedigrees. To avoid computational errors due to observed allele frequencies of 0.0, the alleles for all markers were re-coded using the RECODE program17. This re-coding program insured that alleles were numbered sequentially, and that every allelic frequency was non-zero. In addition, the re-coding had no effect on any of the analyses, in terms of power of the methods. Multipoint analyses were performed using the SIMWALK program version 2.618. Markers for the multipoint analysis were chosen so that the minimum distance between any two markers was 0.5 cM. We set this constraint to avoid inflation in LOD scores due to linkage disequilibrium among markers19,20. The order and distance between the markers used in the multipoint analysis were deduced from the Marshfield genetic map21. For TDT analyses, we constrained genotype relative risk parameters to follow a recessive mode of inheritance. While the TDTAE program was originally designed to perform TDT analyses when observed genotyping errors are present, the method has also be shown in simulations to be robust to missing parental genotype data22. Due to the size and complexity of the pedigrees, we first broke the pedigrees into nuclear families before performing TDT analyses. Finally, file format manipulation for all linkage and TDT analyses was performed using the methods implemented in the MEGA2 software program23. RT-PCR. Total RNA was isolated from 10 plucked human scalp hairs of a healthy control individual using the RNeasy® Minikit (Quiagen). 2 µg of total RNA was

reverse-transcribed with random primers and SuperScript™ III (Invitrogen). The cDNAs were then amplified by PCR using P2RY5-specific primers (forward 5’-CATCTACAAAGAACCAAGAATTGTGAG -3’, reverse 5’- TCCAAATGGCCAATTCCGTG-3’). The amplification conditions were 94°C for 2 min, followed by 40 cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 90 sec, with a final extension at 72°C for 7 min. GAPDH mRNA was amplified as a control. PCR products were run on 1.5% agarose gel. Indirect immunofluorescence (IIF), cell culture and western blots (WB). IIF on frozen sections of skin and individually dissected hair follicles as well as culture of normal human keratinocytes and WB were performed as described previously24. The primary antibodies used were rabbit polyclonal anti-P2Y5 (diluted 1:200 for IIF and 1:1,000 for WB; MBL international), guinea pig polyclonal anti-K6irs3 and anti-K6hf (1:2,000; generous gifts from Drs. Lutz Langbein and Jürgen Schweizer, Heidelberg, Germany), rabbit polyclonal anti-cytokeratin 1 (1:5,000; Covance), and rabbit polyclonal anti-β-actin (1:5,000; Sigma). Approval for the work with animals was obtained by the IACUC of Columbia University. References for Supplementary Note and Supplementary Methods: 1. Chien, A.J., Valentine, M.C. & Sybert, V.P. Hereditary woolly hair and

keratosis pilaris. J. Am. Acad. Dermatol. 54, S35-39 (2006). 2. Hutchinson, P.E., Cairns, R.J. & Wells, R.S. Woolly hair. Clinical and general

aspects. Trans. St. Johns Hosp. Dermatol. Soc. 60,160-177 (1974). 3. Norgett, E.E. et al. Recessive mutation in desmoplakin disrupts desmoplakin-

intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma. Hum. Mol. Genet. 9, 2761-2766 (2000).

4. McKoy, G. et al. Identification of a deletion in plakoglobin in arrhythmogenic right ventricular cardiomyopathy with palmoplantar keratoderma and woolly hair (Naxos disease). Lancet 355, 2119-2124 (2000).

5. Salamon, T. Über eine familie mit recessiver Kraushaarigkeit, hypotrichose und anderen anomalien. Hautarzt 14, 540-544 (1963).

6. Kljuic, A. et al. Desmoglein 4 in hair follicle differentiation and epidermal adhesion: evidence from inherited hypotrichosis and acquired pemphigus vulgaris. Cell 113, 249-260 (2003).

7. Schaffer, J.V. et al. Mutations in the desmoglein 4 gene underlie localized autosomal recessive hypotrichosis with monilethrix hairs and congenital scalp erosions. J. Invest. Dermatol. 126, 1286-1291 (2006).

8. Shimomura, Y., Sakamoto, F., Kariya, N., Matsunaga, K. & Ito, M. Mutations in the desmoglein 4 gene are associated with monilethrix-like congenital hypotrichosis. J. Invest. Dermatol. 126, 1281-1285 (2006).

9. Zlotogorski, A. et al. An autosomal recessive form of monilethrix is caused by mutations in DSG4: clinical overlap with localized autosomal recessive hypotrichosis. J. Invest. Dermatol. 126, 1292-1296 (2006).

10. Kazantseva, A. et al. Human hair growth deficiency is linked to a genetic defect in the phospholipase gene LIPH. Science 314, 982-985 (2006).

11. Sambrook, J., Fritsch, E.F. & Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd edn New York, NY: Cold Spring Harbor Laboratory Press (1989).

12. Gordon, D. et al. A transmission disequilibrium test for general pedigrees that is robust to the presence of random genotyping errors and any number of untyped parents. Eur. J. Hum. Genet. 12, 752-761 (2004).

13. Gordon, D., Heath, S. C., Liu, X. & Ott, J. A transmission/disequilibrium test that allows for genotyping errors in the analysis of single-nucleotide polymorphism data. Am. J. Hum. Genet. 69, 371-380 (2001).

14. Lathrop, G. M., Lalouel, J. M., Julier, C. & Ott, J. Strategies for multilocus linkage analysis in humans. Proc. Natl. Acad. Sci. U.S.A. 81, 3443-3446 (1984).

15. Cottingham, R. W., Idury, R. M. & Schaffer, A. A. Faster sequential genetic linkage computations. Am. J. Hum. Genet. 53, 252-263 (1993).

16. Schaffer, A. A., Gupta, S. K., Shriram, K. & Cottingham, R. W., Jr. Avoiding recomputation in linkage analysis. Hum. Hered. 44, 225-237 (1994).

17. Weeks, D. E. RECODE - a program for recoding base-pair sized alleles into integer-numbered alleles. http://watson.hgen.pitt.edu/register/. (2000).

18. Sobel, E. & Lange, K. Descent graphs in pedigree analysis: applications to haplotyping, location scores, and marker-sharing statistics. Am. J. Hum. Genet. 58, 1323-1337 (1996).

19. Boyles, A. L. et al. Linkage disequilibrium inflates type I error rates in multipoint linkage analysis when parental genotypes are missing. Hum. Hered. 59, 220-227 (2005).

20. Schaid, D. J., McDonnell, S. K., Wang, L., Cunningham, J. M. & Thibodeau, S. N. Caution on pedigree haplotype inference with software that assumes linkage equilibrium. Am. J. Hum. Genet. 71, 992-995 (2002).

21. Broman, K. W., Murray, J. C., Sheffield, V. C., White, R. L. & Weber, J. L. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Am. J. Hum. Genet. 63, 861-869 (1998).

22. Barral, S., Haynes, C., Levenstien, M. A. & Gordon, D. Precision and type I error rate in the presence of genotype errors and missing parental data: a comparison between original TDT and TDTae statistics. BMC Genet. 6, S150 (2005).

23. Mukhopadhyay, N., Almasy, L., Schroeder, M., Mulvihill, W. P. & Weeks, D. E. Mega2: data-handling for facilitating genetic linkage and association analyses. Bioinformatics 21, 2556-2557 (2005).

24. Bazzi, H. et al. Desmoglein 4 is expressed in highly differentiated keratinocytes and trichocytes in human epidermis and hair follicle. Differentiation 74, 129-140 (2006).

Supplementary Figure 1 Clinical appearance of ARWH. Affected individuals in ARWH24 (a-c), ARWH5 (d-f), ARWH15 (g, h). Plucked hairs of a control individual (i) and affected individuals (j-l). Scale bars: 100 µm.

Chromosome 13 Linkage Analysis

0

1

2

3

q12.11 q12.13 q12.3 q13.2 q14.11 q14.13 q14.3 q21.1 q21.31 q21.33 q22.1 q31.1 q31.1 q31.3 q31.3 q32.3 q33.2 q34

Mb

LOD

snp analysishaplotype analysisautozygosity mapping

a

b

0

2

4

6

8

10

12

14

16

18

40979 45979 50979 55979 60979

Map Position

LOD

Sco

re

LODTDTAEMultipointLOD

Supplementary Figure 2 Results of linkage analysis on chromosome 13. (a) Results of parametric linkage analysis. In addition to autozygosity mapping (in red), parametric linkage analysis is performed twice, once using snps (in green) and once using haplotypes that are inferred from the data (in blue). (b) Results of multipoint, TDTAE, and two-point linkage analysis for four ARWH pedigrees. The values for the multipoint LOD scores are either computed using the method in SIMWALK2 or are interpolated linearly based on the map distance among markers. The LOD scores refer to two-point LOD scores maximized over recombination fraction values between 0.0 and 0.50, in increments of 0.02. The TDTAE values are computed by dividing the results of the TDTAE score (which is has a central chi-square distribution with one degree of freedom under the null hypothesis) by 2 ln(10).

f

Supplementary Figure 3 Identification of five pathogenic mutations in the P2RY5 gene. (a) Haplotypes and homozygous mutation 69insCATG in ARWH2. (b) Haplotypes and homozygous mutation 172-175delAACT; 177delG in ARWH18. (c) Haplotypes and homozygous mutation 188A>T (D63V) in ARWH15. (d) Homozygous mutation 562A>T (I188F) in both ARWH24 and ARWH5. (e) Haplotypes and homozygous mutation 565G>A (E189K) in ARWH16. Results of restriction enzyme analyses are shown below the sequences (a-e). Affected individuals are colored in red. C, control individuals. (f) Multiple amino acid sequence alignment of P2RY5 between different species. The position of each mutation is indicated by an arrow. Residues, 63D, 188I, and 189E, are indicated in red. Residues that are conserved among at least 6 species are colored yellow. Transmembrane domains (TM1-7) are boxed. The accession numbers for the respective P2RY5 proteins are: human, NP_005758; chimpanzee, XP_001151666; monkey, XP_001100838; cattle, NP_001094754; rat, XP_001071585; mouse, NP_780325; chicken, NP_990530; zebrafish, NP_955900.

Supplementary Figure 4 P2RY5 is expressed in the suprabasal layers of human epidermis. (a) The junction between epidermis and dermis is indicated by dashes. Scale bar: 100 µm. (b) Western blot analysis of cell lysates obtained from normal human keratinocytes (NHK) grown on feeder layers in serum containing media. P2RY5 expression increases in a differentiation dependent manner. Cytokeratin 1 (K1), which is a differentiation marker of epidermal keratinocytes, shows a similar expression pattern. Note that the anti-P2RY5 antibody (MBL international) recognized the 55 KDa fragment (b), which was also detected with another anti-P2RY5 antibody (F-13; Santa Cruz Biotechnology) (data not shown).

Supplementary Figure 5 Expression of mouse and rat P2ry5 in the hair follicles and skin. (a) Mouse whisker follicle (C57BL/6; postnatal day 30). (b) Mouse back skin (C57BL/6; postnatal day 7). (c) Mouse foot pad skin (C57BL/6; post-natal day 30). Note that the signal in the cornified layer is non-specific, since it is also detected in a control section incubated with normal rabbit serum. (d) Rat whisker follicle. Scale bars: (a, c, d), 100 µm, (b), 20 µm.

Supplementary Table 1 Primers and restriction enzymes used in the analysis

primer name position (bp) forward primer (5’ to 3’) reverse primer (5’ to 3’) product

size (bp)

LRCH1-MS HTR2A-MS FNDC3A-MS

46,039,578-46,039,702 46,356,893-46,357,028 48,484,903-48,485,058

GTTCCCTTGGAGGTGAAAATGA CATCTTGATAAGTGTGAAGTCTTTTG TTTATTCCTGGGCACTTGGGTT

TAACTTGGATTTATCCAGGCTTTC GTGTGAGCTCATTCTGGTAAACT AGAGTATAGCAAGGTTGCTGGA

125 136 156

P2RY5 ex1 P2RY5 ex 2 P2RY5 ex3-1 P2RY5 ex3-2 P2RY5 ex3-3 P2RY5 ex3-4 P2RY5 ex3-5 NUDT15 ex1 NUDT15 ex2 NUDT15 ex3 MED4 ex1 MED4 ex2 MED4 ex3 MED4 ex4 MED4 ex5 MED4 ex6 MED4 ex7 RCBTB2 ex1 RCBTB2 ex2 RCBTB2 ex3 RCBTB2 ex4 RCBTB2 ex5 RCBTB2 ex6 RCBTB2 ex7 RCBTB2 ex8 RCBTB2 ex9 RCBTB2 ex10 RCBTB2 ex11 RCBTB2 ex12 RCBTB2 ex13 RCBTB2 ex14 RCBTB2 ex15 CYSLTR2 ex1 LOC647131 ex1 LOC647131 ex2 LOC647131 ex3 FNDC3A ex1 FNDC3A ex2

CTTTGGTTCCTTAATTAGAGGCCAA GTCAGGAGTTCAAGACCAGC CCTAGGTATATTCCCAGCAGAC GACAAGTGGTTTCATTCTGGTC TCCCAAAGGAGACTGCAGCT CACGGAATTGGCCATTTGGA CCAGAAGCCACATGGAAAAC TAGTGAGCGCGTCACTTCCT AGCCACATGCCCAGCTGATT GGTTAGCTTACCCAAATAAACACC ACCTGCGTCAGCTCGCTCT AGTTCACAGTCAATAGCGGACT ATAGCCTAGCCAATTCAGTTACG ATAGTCTGGGTGTCTTCTGCAT AAGGAAGGCAGGTGACTGAG GAACCAGCGAAAATGAGTATGTC GCATAAAGGGAAAAGTAAGAACTAG GCGAGAACATAACCCTGGAG CAAGACAGTATATTCTTTTCCTTCTG GTAGGTGATGTGGGCATGGT CTGCCTGGTTCCATCGAACA CAGAACTGAAGGGGCAGAGAA GGAAGATGATTCCTGTTTGGATG TCATTTGTGGAAGCTGTGCTACA GTCAGTGTCCAGTTGAGACAG CCACATCAGTCTCATGCCAG CCTACTTTGTGGAAGCAGTGAAA ACTTGTTTCTGCCCCGGTCA AGTACCAGTAGAGTAGTGCCATA TCACAGAGGCCATCTGTCCT AGTGGCTGAGTGAGCAACTG ATGCCATCATTTCCTCCACTTG CCTAGAGAGATGTAATCAGTAAGC CACACACTAGGCCAGTTTTAG AGTCCCTCTTCTGCTCGCAA CTGTTGGGGTTGTTTCCTGG TTGATCCTGCGTGGCTGCTT CCTTTGACAAGAATATCTCTTTAGGTT

CCAAGTGCTGGGATTCCATG GTTGTATATGCTGATCTCATCCTAC CAACGAGTCCAACCCATAGGATT TCCAAATGGCCAATTCCGTG GTTTTCCATGTGGCTTCTGG CAGCAATACAGAGAGTGATTGG GACACTTTTCACAGTTGAAGGAACT AAGCAAGCACGGCGTGAGTT CAGACCACTTGCTCTCCTGA TTCCCTAACCAGACCTTATTCTTG CGAGAACGAGCACAAACGCA CATTCCTGTTCCCACACAAAGTA CTGGCAATGGTGAGTGACAAG CCAGAACCTTAACTTTTCAGGTC TATGTGGCAGAGGTTTCTAAGG ATTCCAACCTTGTCATCTCTGG CCTGTAGTTTACATTTCCCTGCT CCAGTGGTACCTGACAGCAT TACTGACTGGCTGGGAGCAT CATTTCAGAGTTGACTTCCTGTG CCTATCGGTGACCAATAGGTG CCCCAAGATCTTCAATTTGGCAA TTCTCAAGGGCAGCTGCGAA CCAGGACTACTATAGAAGTCTAC GTGGGACATACCATACTGGC TGATATCTTTGCCAGCGAAGACT ATCACAATCACCAAAGACCAGTG CCCTGAGCTCTTTCCCAGAT CCGCTCCACTGTATGCTTGT TAGAAACCACCTTGTCAGTTCCT GCAGACACCTGGGTTCCATT CTCTGGCTTTTGCAGGGGAA GACTATGAGTGAATGAAGATGGAC CAGCAACTACTTTTGTTGAGCCA CCGAACTTGAACGCTTTTCTGAA GTTCGCGTGCTTTCGGAAAG AGTCCCTCTTCTGCTCGCAA CACGAATTAACAGGAACTCACTATTG

357 408 537 621 598 606 581

275 460 271

264 273 407 411 340 285 329

435 207 305 206 296 287 323 301 264 261 302 353 264 262 325

1185

400 295 523

219 346

size of the digested fragments (bp)

mutation

forward primer (5’ to 3’)

reverse primer (5’ to 3’)

product size (bp)

enzyme

wild type allele

mutant allele

69insCATG 172-175delAACT; 177delG 188A>T (D63V) 562A>T (I188F) 565G>A (E189K)

TCCCAAAGGAGACTGCAGCT CTGCGTCCTCAAAGTCCGAA CAACTTACATGATTAACTTGGCAATGTGAG (C>G change is introduced.) CACGGAATTGGCCATTTGGA CACGGAATTGGCCATTTGGA

TCCAAATGGCCAATTCCGTG GGTAGACAATTGCCAGAAATCGA GGTAGACAATTGCCAGAAATCGA CAGCAATACAGAGAGTGATTGG CAGCAATACAGAGAGTGATTGG

317

233

204

606

606

NsiI

MseI

MlyI

BstBI

TaqI

317 151, 42, 40 204 606 276, 226, 104

184, 133 193, 40 167, 37 330, 276 502, 104