1

Supplemental Materials

Fatty acid binding protein E-FABP restricts tumor growth by promoting IFNβ responses

in tumor-associated macrophages

Yuwen Zhang, Yanwen Sun, Enyu Rao, Fei Yan, Qiang Li, Ying Zhang, Kevin A. T. Silverstein,

Shujun Liu, Edward Sauter, Margot P. Cleary, Bing Li

Supplemental Figures and Tables

Supplementary Figure 1, related to Figure 1.

2

Supplementary Figure 1 The development of tumors in WT and E-FABP-/- mice

A, 0.5×106 (left panel) or 1×106 (right panel) E0771 cells were orthotopically injected into the

mammary fat pad of WT and E-FABP-/- mice (n=9/group). Tumor size was measured at 3 day

intervals. RMA lymphoma cells (0.2×106) (B) or MC38 colon tumor cells (0.2×106) (C) were

respectively injected into the left flank of the WT and E-FABP-/- mice (n=9/group). Tumor size

was measured at 3 day intervals. Lung metastasis nodules were measured after euthanization of

mice on day 24 post tumor implantation. Data are shown as mean ± SD (*, P < 0.05 as

determined by Student’s t test).

Supplementary Figure 2, related to Figure 2.

Supplementary Figure 2 Phenotype analysis of tumor-bearing WT and E-FABP-/- mice

3

Spleens (A) or inguinal lymph nodes (B) were collected from naïve mice or E0771-tumor

bearing mice on day 24 after E0771 tumor implantation. Total cell numbers were counted with a

hemocytometer after the lysis of red blood cells. C, E0771 tumors were collected from WT and

E-FABP-/- mice on day 24 after tumor implantation. The percentage of CD11+F4/80+ TAMs was

analyzed by flow cytometric staining. Data are shown as mean ± SD (*, p< 0.05; ** p<0.01 as

determined by Student’s t test).

Supplementary Figure 3, related to Figure 3.

Supplementary Figure 3 Dynamic changes of E-FABP-expressing TAMs in the tumor

stroma

A, tumors from WT and E-FABP-/- mice were collected at the indicated time points after E0771

cell implantation and the percentage of CD11b+F4/80+Ly6C+MHCII+CD11c+ (Q2 subset)

population in the TAMs was determined by flow cytometric staining. B, the Q2 subset of TAMs

was separated from tumors and spleens by a flow sorter at the indicated time points post E0771

cell implantation and the relative expression levels of E-FABP and A-FABP were measured by

real-time PCR. Analysis of fold changes of E-FABP and A-FABP in tumor Q2 cells compared to

respective FABP in spleen Q2 cells. Data are shown as mean ± SD.

4

Supplementary Figure 4, related to Figure 4.

Supplementary Figure 4 Analysis of GM-BMMs from WT and E-FABP-/- mice

A, flow cytometric analysis of the expression of CD11b, F4/80, CD11c, and MHCII on GM-

BMMs from WT and E-FABP-/- mice. E-FABP expression in GM-BMMs from WT and E-

FABP-/- mice was analyzed by real-time PCR (B), western blotting (C) and confocal microscopy

(D). E, analysis of enriched pathways of differentially expressed genes regulated by E-FABP in

tumor-stimulated GM-BMMs by IPA. F, confirmation of gene expression results obtained from

Affymetrix microarray by real-time PCR. Data are shown as mean ± SD (*p<0.05, ** p<0.01).

5

Supplementary Table 1, related to Figure 4

ID Entrez Gene Name Log2 Fold* FDR#

Fabp5 fatty acid binding protein 5 (psoriasis-associated) -7.889 1.68E-11Ms4a4c membrane-spanning 4-domains, subfamily A, member 4B -3.247 4.16E-02Cxcl10 chemokine (C-X-C motif) ligand 10 -3.184 3.36E-02Gm14446 interferon-induced protein with tetratricopeptide repeats 1 -2.974 3.17E-02Ms4a4c membrane-spanning 4-domains, subfamily A, member 4B -2.826 3.00E-02Ifit3 interferon-induced protein with tetratricopeptide repeats 3 -2.783 4.57E-02Iigp1 interferon inducible GTPase 1 -2.742 2.01E-02Iigp1 interferon inducible GTPase 1 -2.721 2.35E-02Pydc4 pyrin domain containing 4 -2.71 3.14E-02Pydc4 pyrin domain containing 4 -2.595 3.86E-02Cmpk2 cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial -2.517 4.12E-02Rsad2 radical S-adenosyl methionine domain containing 2 -2.516 3.58E-02Ifit2 interferon-induced protein with tetratricopeptide repeats 2 -2.442 3.79E-02Cmpk2 cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial -2.389 2.45E-02Oasl1 2'-5'-oligoadenylate synthetase-like -2.36 2.45E-02Rsad2 radical S-adenosyl methionine domain containing 2 -2.341 3.55E-02Isg20 interferon stimulated exonuclease gene 20kDa -2.284 2.88E-02Ifi44 interferon-induced protein 44 -2.273 3.20E-02Ifit1 interferon-induced protein with tetratricopeptide repeats 1B -2.234 4.21E-02Cxcl11 chemokine (C-X-C motif) ligand 11 -2.219 2.01E-02Cd69 CD69 molecule -2.212 2.46E-02Slfn4 schlafen family member 12-like -2.188 4.71E-02Ms4a6b membrane-spanning 4-domains, subfamily A, member 6B -2.18 3.61E-02Mx1 myxovirus (influenza virus) resistance 1 -2.129 2.45E-02Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 -1.969 2.63E-02Ctgf connective tissue growth factor -1.823 1.97E-02Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 -1.795 2.09E-02Tlr3 toll-like receptor 3 -1.794 3.65E-02Mx2 myxovirus (influenza virus) resistance 1 -1.775 2.65E-02Rsad2 radical S-adenosyl methionine domain containing 2 -1.719 4.37E-02Ms4a6b membrane-spanning 4-domains, subfamily A, member 6B -1.702 4.05E-02Ddx60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 -1.697 1.60E-02Ms4a4b membrane-spanning 4-domains, subfamily A, member 4B -1.697 2.45E-02Fam26f family with sequence similarity 26, member F -1.696 2.97E-02Bambi-ps1 BMP and activin membrane-bound inhibitor, pseudogene (Xenopus laevis) -1.651 3.44E-02Gbp6 guanylate binding protein 6 -1.647 2.98E-02Tlr3 toll-like receptor 3 -1.643 2.95E-02Irf7 interferon regulatory factor 7 -1.623 3.61E-02Gm9706 predicted gene 9706 -1.6 3.97E-02Nt5c3 5'-nucleotidase, cytosolic IIIA -1.538 2.47E-02Ms4a6c membrane-spanning 4-domains, subfamily A, member 6C -1.517 4.39E-02Igtp interferon gamma induced GTPase -1.502 3.73E-02Ddx60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 -1.502 3.61E-02Serpina3g serine (or cysteine) peptidase inhibitor, clade A, member 3G -1.502 1.84E-02Gm11772 predicted gene 11772 -1.491 4.04E-02Herc6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 -1.471 3.92E-02Ifi47 interferon gamma inducible protein 47 -1.462 3.60E-02Gbp3 guanylate binding protein 4 -1.451 2.65E-02Ddx4 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 -1.45 2.18E-03Ifnb1 interferon, beta 1, fibroblast -1.432 1.26E-02Pyhin1 interferon activated gene 204 -1.421 3.79E-02Herc6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 -1.4 2.97E-02Ly6a lymphocyte antigen 6 complex, locus A -1.387 4.58E-02Herc6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 -1.381 3.13E-02Mxd1 MAX dimerization protein 1 -1.374 1.85E-02Rilpl1 Rab interacting lysosomal protein-like 1 -1.369 1.60E-02Hspa1b heat shock 70kDa protein 1A -1.358 1.66E-02Gbp7 guanylate binding protein 7 -1.352 1.97E-02Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) -1.334 3.86E-02Hspa1b heat shock 70kDa protein 1A -1.32 1.60E-02Chrna5 cholinergic receptor, nicotinic, alpha 5 (neuronal) -1.316 1.60E-02Gpsm2 G-protein signaling modulator 2 -1.303 3.30E-02Pyhin1 interferon activated gene 204 -1.289 4.42E-02Col1a2 collagen, type I, alpha 2 -1.287 2.62E-03Stat2 signal transducer and activator of transcription 2, 113kDa -1.275 1.66E-02Hspa1b heat shock 70kDa protein 1A -1.268 1.26E-02

(Table continues)

Table 1. The selected differentially expressed genes in macrophages regulated by E-FABP

6

Table 1. (continued)ID Entrez Gene Name Log2 Fold* FDR#

Irgm2 immunity-related GTPase family M member 2 -1.268 3.79E-02Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) -1.262 2.65E-02Usp18 ubiquitin specific peptidase 18 -1.258 3.48E-02Pou3f1 POU class 3 homeobox 1 -1.256 1.56E-02Aldh1b1 aldehyde dehydrogenase 1 family, member B1 -1.247 3.61E-02Herc6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 -1.239 2.35E-02Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 -1.234 4.93E-02Stat1 signal transducer and activator of transcription 1, 91kDa -1.229 2.98E-02Ifi203 interferon activated gene 204 -1.225 4.27E-02Irgm1 immunity-related GTPase family, M -1.215 4.39E-02Hspa1a heat shock 70kDa protein 1A -1.21 1.60E-02Slfn5 schlafen family member 5 -1.206 3.79E-02Daxx death-domain associated protein -1.201 3.02E-02Ifih1 interferon induced with helicase C domain 1 -1.198 3.01E-02Nlrc5 NLR family, CARD domain containing 5 -1.193 3.61E-02Gbp2 guanylate binding protein 2 -1.158 2.91E-02Stat2 signal transducer and activator of transcription 2, 113kDa -1.155 2.45E-02Il15ra interleukin 15 receptor, alpha -1.137 2.09E-02Rilpl1 Rab interacting lysosomal protein-like 1 -1.129 1.33E-02Fcgr1 Fc fragment of IgG, high affinity Ia, receptor (CD64) -1.128 4.58E-02Samhd1 SAM domain and HD domain 1 -1.127 1.60E-02Gbp7 guanylate binding protein 7 -1.127 2.88E-02Oas3 2'-5'-oligoadenylate synthetase 3, 100kDa -1.127 3.67E-02Tpst1 tyrosylprotein sulfotransferase 1 -1.117 4.35E-02Parp14 poly (ADP-ribose) polymerase family, member 14 -1.114 2.14E-02Mxd1 MAX dimerization protein 1 -1.106 2.57E-02Dcn decorin -1.1 2.04E-02Xaf1 XIAP associated factor 1 -1.099 3.86E-02Fabp3 fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) -1.095 2.72E-02Stat1 signal transducer and activator of transcription 1, 91kDa -1.088 3.17E-02Mthfr methylenetetrahydrofolate reductase (NAD(P)H) -1.083 3.61E-02Il15 interleukin 15 -1.08 4.67E-02Asb13 ankyrin repeat and SOCS box containing 13 -1.079 3.50E-02Fabp4 fatty acid binding protein 4, adipocyte -1.078 4.38E-03BC013712 thymocyte selection associated family member 2 -1.071 3.09E-02Tor3a torsin family 3, member A -1.068 3.97E-02Tnfsf8 tumor necrosis factor (ligand) superfamily, member 8 -1.064 3.97E-02Ifi203 interferon activated gene 204 -1.063 1.83E-02Znfx1 zinc finger, NFX1-type containing 1 -1.055 4.09E-02Tor3a torsin family 3, member A -1.054 3.86E-02Stat1 signal transducer and activator of transcription 1, 91kDa -1.05 3.51E-02Col5a2 collagen, type V, alpha 2 -1.05 2.45E-02Parp14 poly (ADP-ribose) polymerase family, member 14 -1.046 3.65E-02Timeless timeless circadian clock -1.038 4.18E-02Slfn5 schlafen family member 5 -1.036 3.93E-02Stat1 signal transducer and activator of transcription 1, 91kDa -1.034 3.13E-02Mucl1 salivary protein 1 -1.029 3.93E-02Gbp2 guanylate binding protein 2 -1.019 3.42E-02Oas2 2'-5'-oligoadenylate synthetase 2, 69/71kDa -1.018 3.43E-02Tor3a torsin family 3, member A -1.015 3.82E-02Parp12 poly (ADP-ribose) polymerase family, member 12 -1.011 4.37E-02Casp4 caspase 4, apoptosis-related cysteine peptidase -1.007 2.14E-02Il15ra interleukin 15 receptor, alpha -1.004 3.00E-02Rnf213 ring finger protein 213 -1.002 4.00E-02Galnt12 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransfer 1.036 2.09E-02Dpp4 dipeptidyl-peptidase 4 1.075 4.39E-02Sox4 SRY (sex determining region Y)-box 4 1.142 3.58E-02Pisd-ps3 phosphatidylserine decarboxylase, pseudogene 3 1.211 2.60E-02Pisd-ps3 phosphatidylserine decarboxylase, pseudogene 3 1.243 2.88E-02Gm7120 chromosome 5 open reading frame 28 1.277 2.35E-021700112E06Rik chromosome 10 open reading frame 11 1.304 2.17E-021700112E06Rik chromosome 10 open reading frame 11 2.367 2.86E-021700112E06Rik chromosome 10 open reading frame 11 4.095 2.45E-02

* E-FABP-/- versus WT macrophages # FDR: false discovery rate

7

Supplementary Figure 5, related to Figure 5.

Supplementary Figure 5 Analysis of FABP expression and LD inhibition in GM-BMMs

A, analysis of E-FABP, A-FABP and H-FABP expression in GM-BMMs by real-time PCR. B,

the protein levels of E-FABP and A-FABP were determined by western blotting in 10µg of total

proteins extracted from GM-BMMs and mammary adipocytes. C, GM-BMMs were treated with

indicated concentrations of Triacsin C plus unsaturated FAs for 18h. LD formation was analyzed

by BODIPY staining with confocal microscopy (nucleic were stained with DAPI).

8

Supplementary Figure 6, related to Figure 6.

Supplementary Figure 6 IFNγ production in tumor infiltrated cells and NK depletion in

mice

A-C, tumors from WT and E-FABP-/- mice were collected one week after E0771 cell

implantation. Single cells were stimulated with or without PMA/ionomycin for 6h. IFNγ

production in CD4+ T cells (A), CD8+ T cells (B) and NK cells (C) was measured by

9

intracellular staining. The percentage of IFNγ+ cells was shown in the right panel. D, analysis of

NK cells in peripheral blood, spleen and draining lymph nodes in WT and E-FABP-/- mice with

or without NK cell depletion by flow cytometry staining.

Supplementary Figure 7, related to Figure 6.

Supplementary Figure 7 Analysis of tumor growth in the presence or absence of CD4+ T

cells in vivo. A, analysis of CD4+ T cells in spleen, draining lymph nodes and peripheral blood

10

in WT and E-FABP-/- mice with or without CD4+ T cell depletion by flow cytometry staining.

An average percentage of CD4+ T cells in each tissue is shown in panel B. C, measurement of

tumor size two weeks after E0771 cell implantation in WT and E-FABP-/- mice with or without

CD4+ T cell depletion (*, p<0.05 as compared to E-FABP-/- mice).

Supplementary Table 2, related to Figure 7

Supplementary Table 2 E-FABP expression in normal breast tissues and breast cancer

tissues by analysis of Oncomine databases

Supplementary Table 3, related to Figure 7

Supplementary Table 3 E-FABP expression in normal breast stroma and invasive breast

cancer stroma by analysis of GEO dataset GSE9014

11

Supplementary Figure 8, related to Figure 7.

Supplementary Figure 8 E-FABP expression in breast cancer patients

A, analysis of serum levels of E-FABP in patients with benign breast diseases and invasive

breast cancers by western blotting. The mean band density is shown in panel B. C, analysis of

wound-scratch migration assays with human MDA-MB-231 cells. Wounds were made to

confluent MDA-MB-231 cells and wound width was measured at 0 or 72 hours in the presence

of indicated concentrations of recombinant human E-FABP. D, MDA-MB-231 cells were

treated with recombinant human E-FABP for 6 hours and subjected to colony-forming assays.

Graphs represent the colony numbers from three biological replicates. Data are shown as

mean±SD.

12

Supplemental Materials and Methods

Flow cytometry and cell sorting

Immune cells from draining lymph nodes and spleens were subjected to surface staining or

cultured with PMA (50ng/ml; Sigma)/ionomycin (500ng/ml; Sigma) and Golgiplug (BD

Biosciences) for 6~8 hrs. Cells were harvested for surface and intracellular staining. Flow

cytometric data were collected with a BD FACS Calibur™. Single immune cell population from

spleens or distinct subset of TAMs from tumors was separated with a BD FACSAria II Cell

Sorter. Flow cytometric data were analyzed with Flowjo software (Tree Star). The following

antibodies were used for cell staining or depletion: anti-CD3 (clone 145-2C11 ), anti-CD4 (clone

RM4-5 ), anti-CD8 (clone 53-6.7), anti-CD49b (clone DX5), anti-CD36 (clone HM36), anti-

CD11b(clone M1/70), anti-CD11c (clone HL3), TCR γ/δ(clone GL3), NK1.1(clone PK136),

anti-F4/80 (clone BM8), anti-MHC class II (clone M5/114.15.2), anti-Ly6C (clone HK1.5 ), anti-

Gr-1 (clone RB6-8C5), anti-interferon-γ (IFN-γ, clone XMG1.2), anti-Dectin-1 (clone RH1),

anti-TLR2 (clone T2.5), anti-TLR4 (clone MTS510) and anti-NK1.1 (clone PK136). NK1.1

blocking mAb (clone PK136), TRAIL blocking mAb (clone N2B2), CD4 blocking mAb (clone

GK1.5), and CD8 blocking mAb (clone 53-6.7).

GM-CSF-induced bone marrow-derived macrophages (GM-BMMs)

Bone marrow cells from naïve mice were collected to differentiate into bone marrow derived

macrophages (BMMs) using recombinant mouse GM-CSF (R&D Systems). Briefly, bone

marrow cells were obtained from sterile mouse femurs and tibias. Red blood cells (RBCs) were

lysed with RBC lysis buffer. After washing with 2% FBS PBS twice, 8x106 bone marrow cells

13

were cultured in 12 ml RPMI1640 with 20ng/ml GM-CSF in a 100mm dish. On day 3, 8 ml fresh

medium with 20ng/ml GM-CSF was added. On day 5, 10ml of the medium was carefully taken

from the top without disturbing the cells, and 10 ml fresh medium with 20ng/ml GM-CSF was

added. On day 7, the GM-BMMs were collected for experiments.

Real-time PCR Primers

Sequence Forward Reverse A-FABP TTTCCTTCAAACTGGGCGTG CATTCCACCACCAGCTTGTC

E-FABP AACCGAGAGCACAGTGAAG ACACTCCACGATCATCTTCC

H-FABP AGAGTTCGACGAGGTGACAG TGCCATGAGTGAGAGTCAGG

β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT

CD69 TGGTGAACTGGAACATTGGA CTCACAGTCCACAGCGGTAA

CXCL10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA

CXCL11 AGTAACGGCTGCGACAAAGT GTCAGACGTTCCCAGGATGT

Ifit1 GTCAAGGCAGGTTTCTGAGG AGGAACTGGACCTGCTCTGA

IFNβ1 CAGCTCCAAGAAAGGACGAAC GGCAGTGTAACTCTTCTGCAT

IFNα1 ACTGGCCAACCTGCTCTCTA GATGGCTTGAGCCTTCTTGA

IFN-γ GCTTTGCAGCTCTTCCTCAT GTCACCATCCTTTTGCCAGT

IL15RA CTGACATCCGGGTCAAGAAT TGAGGTCACCTTTGGTGTCA

IRF-7 CCAGTTGATCCGCATAAGGT GAGCCCAGCATTTTCTCTTG

Ms4a4c GTCAATTGCAGCAGGAGTGA TCCAAACCCTTGGTGATTGT

Viperin GCTTGTGAGATTCTGCAAGGA GGCCAATCAGAGCATTAACCTG

STAT1 AGACAGCCCAAGGATGTCAC GAGAAAAGCGGCTGTACTGG

STAT2 TGTTGCAGAACCTTGACAGC GCTGTAGTGGTCCCACTGGT

IFNAR1 AGCCACGGAGAGTCAATGG GCTCTGACACGAAACTGTGTTTT

TLR3 GAGGTTGACGCACCTGTTCT CCAGATTATGGGTGCAATCC

TNFSF10 CCTGCTTGCAGGTTAAGAGG GGCCTAAGGTCTTTCCATCC

Immunohistochemistry (IHC) and H&E staining

Tumors collected from mice were fixed in 10% neutral buffered formalin or snap-frozen in cryo-

embedding media OCT (Sakura Finetechnical Co., Ltd). The paraffin-embedded samples were

cut to 5μm sections and stained with hematoxylin and eosin (H&E). For IHC staining, frozen

issue blocks were cut and fixed with cold acetone. To detect tumor-infiltrating macrophages, the

14

sections were blocked with 3% bovine serum albumin (BSA) buffer and then stained with anti-

F4/80-biotin for 1 hour at room temperature. After three washes with blocking buffer, the

sections were stained with streptavidin-horseradish peroxidase (Southern Biotechnology

Associates) for 1 hour at room temperature. After additional washes, horseradish peroxidase

substrate (Vector Laboratories) was added for 30 min at room temperature. The sections were

counterstained with hematoxylin.

Fatty Acid Preparation

Saturated stearic acids (5mM) and unsaturated oleic/linoleic acids (5mM) were prepared with

2mM BSA in PBS, sonicated for 20~30 min, and filtered through 0.2µM sterile filters.

Wound-healing migration assays

Human breast cancer MDA-MB-231 cells were grown to confluence in a 6-well plate. The linear

wound of cellular monolayer was created by scratching confluent cell monolayer using a plastic

pipette tip (200μL or 1mL). The scratched cell monolayer was washed with PBS to remove

debris. After incubation at 37°C for 72 hours with different concentrations of recombinant

human E-FABP, the migration of the cells towards the wound was photographed under light

microscopy. Image J was used to determine the migration distance.

Colony formation assays

Methylcellulose colony formation assays of MDA-MB-231 cells were performed in MethoCult®

mixture (Stem Cell Technologies, Canada) following manufacturers’ instruction. Briefly, 6 hours

after exposure to different concentrations of recombinant human E-FABP, the cells were

15

harvested and diluted with 2% FBS IMDM to 5000-10000 cells/ml (10×). 0.3ml of diluted cells

was mixed with 3ml of MethoCult and 1.1mL of the MethoCult® mixture and dispensed into a

35mm dish. Colony formation was measured on day 7 in the culture dish.