Sugar Potentiation of Fatty Acid and TriacylglycerolAccumulation1[OPEN]

Zhiyang Zhai, Hui Liu, Changcheng Xu, and John Shanklin2

Biology Department, Brookhaven National Laboratory, Upton, New York 11973

ORCID IDs: 0000-0003-3181-1773 (Z.Z.); 0000-0002-0179-9462 (C.X.); 0000-0002-6774-8043 (J.S.).

Photosynthetically derived sugar provides carbon skeletons for lipid biosynthesis. We used mutants of Arabidopsis (Arabidopsisthaliana) and the expression of oleogenic factors to investigate relationships among sugar availability, lipid synthesis, and theaccumulation of triacylglycerol (TAG) in leaf tissue. The adg1mutation disables the small subunit of ADP-glucose pyrophosphorylase,the first step in starch synthesis, and the suc2mutation disables a sucrose/proton symporter that facilitates sucrose loading from leavesinto phloem. The adg1suc2 double mutant increases glucose plus sucrose content in leaves 80-fold relative to the wild type, total fattyacid (FA) content 1.8-fold to 8.3% dry weight, and TAG more than 10-fold to 1.2% dry weight. The WRINKLED1 transcription factoralso accumulates to higher levels in these leaves, and the rate of FA synthesis increases by 58%. Adding tt4, which disables chalconesynthase, had little effect, but adding the tgd1 mutation, which disables an importer of lipids into plastids to create adg1suc2tt4tgd1,increased total leaf FA to 13.5% dry weight and TAG to 3.8% dry weight, demonstrating a synergistic effect upon combining thesemutations. Combining adg1suc2 with the sdp1 mutation, deficient in the predominant TAG lipase, had little effect on total FA contentbut increased the TAG accumulation by 66% to 2% dry weight. Expression of the WRINKLED1 transcription factor, along withDIACYLGLYCEROL ACYLTRANSFERASE1 and the OLEOSIN1 oil body-associated protein, in the adg1suc2 mutant doubled leaf FAcontent and increased TAG content to 2.3% dry weight, a level 4.6-fold higher than that resulting from expression of the same factorsin the wild type.

Sugars are the energy currency of the cell, fuelinggrowth and development. Therefore, it is critical for thecell to have the capacity to sense its sugar/energy statusand to respond to maintain an appropriate physiologicalstatus (Sheen, 2014). When sugar and energy are plentiful,anabolic metabolism predominates over catabolism, en-abling growth and development. Conversely, when sugarand energy are limiting, growth slows due to a shiftfrom anabolism to catabolism. Sugar signaling is ahighly complex process involving multiple partially re-dundant regulatory networks that are principally me-diated by three multifunctional sensor complexes:hexokinase, a Snf1-related protein kinase (SnRK1), and

target of rapamycin (Li and Sheen, 2016). SnRK1 is a keyprotein kinase that, under low-sugar conditions, phos-phorylates more than 1,000 target proteins, resulting in astimulation of catabolism and a simultaneous repressionof anabolism, thereby promoting sugar availability (Priceet al., 2004). Conversely, when sugar is abundant, SnRK1becomes inhibited, resulting in a shift from catabolism toanabolism, thereby mediating sugar homeostasis.

Fatty acid (FA) synthesis is highly dependent on thesupply of photosynthetically derived sugar as a sourceof carbon skeletons, ATP, and reductant. Many factorshave been reported to influence the accumulation of tri-acylglycerol (TAG) in vegetative tissues (Xu and Shanklin,2016). Factors that increase lipid synthesis and ac-cumulation have been categorized as push, pull, andprotect (Vanhercke et al., 2014). Examples of pushfactors include WRINKLED1 (WRI1), an APETALA2transcriptional factor that induces the expression ofmore than 20 genes involved in glycolysis and FAsynthesis (Cernac and Benning, 2004; Maeo et al., 2009),and TRIGALACTOSYLDIACYLGLYCEROL1 (TGD1),a permease-like protein involved in lipid reimport fromthe endoplasmic reticulumto theplastid that,whenmutated,stimulates FA synthesis and TAG accumulation (Xuet al., 2005). Pull factors include various acyltransfer-ases such asDIACYLGLYCEROLACYLTRANSFERASE1(DGAT1), which catalyzes the formation of TAG fromdiacylglycerol and acyl-CoA (Bouvier-Navé et al.,2000), and PHOSPHOLIPID:DIACYLGLYCEROLACYLTRANSFERASE (PDAT), which catalyzes the for-mation of TAG by an acyl transfer from the sn-2 position

1 This work was entirely supported by the U.S. Department ofEnergy, Office of Science, Office of Basic Energy Sciences under con-tract number DE-SC0012704, specifically through the Physical Bio-sciences program of the Chemical Sciences, Geosciences, andBiosciences Division. This research used resources of the Center forFunctional Nanomaterials, which is a U.S. DOE Office of Science Fa-cility, at Brookhaven National Laboratory under contract numberDE-SC0012704.

2 Address correspondence to shanklin@bnl.gov.The author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:John Shanklin (shanklin@bnl.gov).

J.S. and Z.Z. conceived the study; J.S. C.X., and Z.Z. analyzed andinterpreted the data and wrote the article; Z.Z. and H.L. developedmethods and performed experiments.

[OPEN] Articles can be viewed without a subscription.www.plantphysiol.org/cgi/doi/10.1104/pp.17.00828

696 Plant Physiology�, October 2017, Vol. 175, pp. 696–707, www.plantphysiol.org � 2017 American Society of Plant Biologists. All Rights Reserved. www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from

Copyright © 2017 American Society of Plant Biologists. All rights reserved.

of phospholipids to diacylglycerols (Dahlqvist et al., 2000).Protect factors includes OLEOSIN1 (OLE1), which is anamphipathic lipid body-associated protein that influencesoil body size (Miquel et al., 2014) and physically pro-tects TAG from hydrolysis by lipases such as SUGAR-DEPENDENT1 (SDP1), the predominant TAG lipasein Arabidopsis (Arabidopsis thaliana; Kelly et al., 2013).Despite the close dependence of FA and TAG syn-

thesis on sugar availability, until recently little wasknown about the interrelationship between the regu-lation and coordination of these processes. However,in recent years, several links between sugar signalingand the posttranslational regulation of lipid metabo-lism have emerged. For example, a putative SnRK1target site at Ser-197 was identified in nasturtium(Tropaeolum majus) DGAT1, mutation of which to Alaincreased DGAT activity, and overexpression of themutant in Arabidopsis seed resulted in increased oilaccumulation (Xu et al., 2008). Sugar has been reportedto potentiate the oleogenic effects of the WRI1 transcrip-tion factor in vegetative tissues (Cernac and Benning,2004; Sanjaya et al., 2011). We recently reported a mech-anistic explanation for the sugar potentiation of WRI1(i.e. that SnRK1, encoded by KIN10 and KIN11 inArabidopsis [Williams et al., 2014], phosphorylatestwo previously unidentified SnRK1 target sites withinWRI1 that marks it for proteasomal degradation [Zhaiet al., 2017]). According to the model, under low-sugarconditions, when SnRK1 is active, WRI1 is degradedand lipid synthesis is repressed. Conversely, whensugar is abundant, SnRK1 is repressed, WRI1 is sta-bilized, and lipid synthesis is stimulated.In photosynthesizing leaves, Suc is synthesized pri-

marily in mesophyll cells, from where it is transportedto phloem in a two-step process. SWEET proteins me-diate the passive release of Suc from photosyntheticcells to the apoplast (Chen et al., 2012). Suc is loadedsubsequently from the apoplast into the phloem bythe strongly expressed SUC-PROTON SYMPORTER2(SUC2; Gottwald et al., 2000). Several Arabidopsis lineswith mutations in SUC2 that result in impaired Sucloading into the phloem have been reported (Srivastavaet al., 2008). The decrease in Suc export from source leavesstarves nonphotosynthetic sink tissues and results in aseverely stunted growth phenotype. Relative to wild-typeArabidopsis, suc2-4 shows a dramatic, 20-fold increase inthe level of transient carbohydrate (i.e. the sumofGlc, Fru,Suc, and starch). Themajority of transient carbohydrate insuc2-4 leaves accumulates as starch (Srivastava et al.,2008), the synthesis of which competes with lipid syn-thesis for carbon skeletons. Elevated sugar in suc2-4 alsoresults in the induction of chalcone synthase (TT4), apolyketide synthase type III enzyme that mediates thefirst committed step in flavonoid synthesis that ulti-mately leads to anthocyanins (Ohto et al., 2001).The first committed step in starch synthesis is ATP:a-

Glc-1-P adenylyl transferase, also known as ADP-Glcpyrophosphorylase (ADGase; Preiss, 1996). ADGase cat-alyzes the formation of ADP-Glc from Glc-1-P and ATP.ADGase is composed of small and large subunits encoded

by ADG1 and ADG2, respectively. In adg1mutant plants,neither ADG1 nor ADG2 accumulates, and the plants aredevoid of ADGase activity (Wang et al., 1998).

In this work, we exploit the availability of variousArabidopsis mutant backgrounds to probe the conse-quences of elevated levels of sugar on TAG accumulationin leaves by analyzing the total FA and TAG levels invarious single and multiple mutants with an initial focuson adg1 and suc2, which we combined to create theadg1suc2 doublemutant.We show that increased levels ofsugar correlate with increased accumulation of total FAand TAG by increasing the rate of FA synthesis. Theadg1suc2 double mutant accumulated more than 80-foldhigher leaf sugar (Glc and Suc) and approximately 10-foldmore TAG thanwild-type leaves. The doublemutant alsoshowed a significant increase in the accumulation of theWRI1 transcription factor. The triplemutant adg1suc2sdp1resulted in a further increase in TAG, and the quadruplemutant adg1suc2sdp1tgd1 resulted in a doubling of TAGaccumulation relative to the triple mutant to 3.8% (dryweight). That the total FA in this line accumulated to13.5% (dry weight) points to a bottleneck in the assemblyof TAG from FA. Overexpression of WRI1, DGAT1, andOLE1 in the adg1suc2 background led to significantlyhigher levels of TAG than expression in wild-type plants.

RESULTS

Introducing adg1 into the suc2 Mutant BackgroundPartially Rescues Its Growth Retardation

The suc2-4 mutant (Salk_038124; henceforth referred assuc2) is a T-DNA insertion mutant line disrupted in thesecond intron of AtSUC2 that results in a severely stuntedgrowthphenotype relative to thewild type (Fig. 1A). Itwascrossed with the starchless mutant adg1-1, which showssimilar growth to that of thewild type, to generate the adg1-1suc2-4 double mutant (referred to herein as adg1suc2).Combining adg1 with suc2 partially reversed the severegrowth retardation phenotype of the suc2mutant such thatleaves of the double mutant expanded in a more normalmanner (Fig. 1A). During seed germination, adg1suc2 mu-tants also demonstrated more robust primary root elon-gation than suc2. Primary roots of adg1suc2 were 8.4-foldlonger than those of suc2 at 2 weeks after germination andgrowth on one-half-strengthMurashige and Skoog (1/2MS)medium without Suc (Fig. 1B). However, when cul-tured on 1/2MS medium supplemented with 1% Suc,there was little difference in primary root elongationbetween adg1suc2 and suc2 (Supplemental Fig. S1).

High Sugar Accumulation in the adg1suc2 Mutant

The primary phenotype of the adg1mutant is the lackof starch in leaves at the end of the light period, as vi-sualized by iodine staining (Fig. 2A). Similarly, theadg1suc2 double mutant failed to accumulate starch atthe end of the day (Fig. 2A). The combined content ofGlc and Suc in the suc2 plant is 21-fold that of the wild

Plant Physiol. Vol. 175, 2017 697

Sugar Potentiation of TAG Accumulation

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

type, whereas that of adg1suc2 is 3.8-fold higher thanthat of suc2 and 80-fold higher than that of the wildtype (Fig. 2B). Leaves of adg1suc2 plants display a visiblyreddish hue consistent with the accumulation of an-thocyanins. Analysis of these leaves revealed that theyaccumulated 218-fold more anthocyanin than wild-typeplants, corresponding to approximately 1.5% of dryweight. We next investigated the expression levels oftwo genes that had been demonstrated previously to beinduced upon incubation with Suc (i.e. TT4, a key en-zyme involved in the biosynthesis of flavonoids, and aclass II trehalose-6-phosphatase synthase [TPS5], which isnot catalytically active in producing TREHALOSE-6-PHOSPHATE; Schluepmann et al., 2004; Solfanelli et al.,2006). To test whether TT4 and TPS5 also are induced byendogenous Suc accumulation, qRT-PCR was used toquantify their expression in leaves of the wild type and theadg1suc2doublemutant. The expression ofTT4 in adg1suc2was approximately 6-fold higher than in suc2 and ap-proximately 1,000-fold higher than in the wild type (Fig.3B). The expression of TPS5 also was up-regulated signif-icantly in adg1suc2 and suc2 mutants, although to a lowerdegree than that of TT4 (Fig. 3C). Previous studies showedthat elevated sugar accumulation results in altered accu-mulation of TMT1/2 and SUC4, which influence the dis-tribution of Suc between the cytosol and the vacuole.However, our qRT-PCR data showed that the expressionof TMT1/2 and SUC4 in adg1suc2 does not differ signifi-cantly from that in the wild type (Fig. 3D), showing thattheir transcription is not regulated by Suc availability.

TAG Accumulation in Leaves of the adg1suc2Double Mutant

The accumulation of significant amounts of Glc andSuc in adg1suc2 leaves makes it an ideal background inwhich to study TAG biosynthesis in leaf tissues withelevated sugar content. Compared with the wild type,adg1suc2 shows an abundance of lipid droplets in leaveswhen visualized with the nonpolar lipid-selective flu-orescent dye BODIPY 493/503 (Invitrogen; Fig. 4A).TAG quantification of mature leaves of 5-week-oldplants showed that adg1suc2 accumulated 1.2% TAG(dry weight), which was approximately 12-fold higherthan that of the wild type (Fig. 4B). Correspondingly,leaf total FA content in adg1suc2 was 1.8-fold higherthan in thewild type and reached 8.3% (dryweight; Fig.4C). A short-duration (30 min) [1-14C]acetate labelingexperiment was used to test if high endogenous sugarincreases de novo FA synthesis in a similar manner tothat observed upon the coexpression of OLE1, WRI1,and DGAT in the wild type, a combination of genes

Figure 1. The severely stunted phenotype of suc2 is partially rescued inadg1suc2. A, Phenotypes of the shoots of the wild type (WT), adg1,suc2, and adg1suc2. Plants were grown on soil for 6 weeks. B, Rootgrowth of 2-week-old seedlings of the indicated genotypes grown on a1/2MS plate (top). The lengths of primary roots of plants from the top areshown at bottom. Values are means 6 SD for each genotype. Levels

indicated with different letters above histogram bars are significantlydifferent (Student’s t test for all pairs of genotypes, n = 10, P, 0.05). Theexperiment was repeated three times, and data from one representativeexperiment are presented.

698 Plant Physiol. Vol. 175, 2017

Zhai et al.

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

previously shown to increase TAG accumulation thatwe use here as a positive control. The relative rate of FAsynthesis in leaves of adg1suc2was 58% higher than thatof the wild type but was not significantly different fromthat of suc2 (Fig. 4D).Previous studies showed that sugar potentiates the

accumulation of lipidswhenWRI1 is ectopically expressed(Cernac and Benning, 2004; Sanjaya et al., 2011; Kellyet al., 2013). In other work, it has been reported that thetranscription of WRI1 can be mildly up-regulated inthe presence of very high sugar levels (Masaki et al.,2005). To test whether high endogenous Suc also af-fects WRI1 in adg1suc2, the gene expression and pro-tein levels of WRI1 were quantified by qRT-PCR andimmunoblotting, respectively. The results show thatthe gene expression level was not significantly differ-ent between the wild type and adg1suc2 (Fig. 5A);however, while the WRI1 protein was barely detect-able in wild-type leaves, its levels were substantiallyhigher in leaves of adg1suc2 (Fig. 5B). For comparison,three oleogenic genes, Cys-OLE1, WRI1, and DGAT1,were assembled into a single construct we refer to asOWD. Equal loading was demonstrated by perform-ing duplicate western analysis using the constitutivehistone H3; however, we note that the presumptiveRubisco band appears somewhat stronger in the doublemutant and OWD. To visualize expression, cyan flu-orescent protein (CFP) was fused at the N terminus ofWRI1 while GFP was fused at the C terminus of Cys-OLE1, generating a Cys-OLE-GFP, CFP-WRI1, andDGAT1 (OWD) construct (Supplemental Fig. S2A). Forthis experiment, the ectopic expression ofWRI1 is usedas a positive control for the WRI1 western blot. Thepattern of expression of WRI1 polypeptide in adg1suc2is similar to that of OWD lacking fluorescent tags inthe wild type. Together, these data indicate that theWRI1 polypeptide is stabilized in adg1suc2 and that

the increased abundance of WRI1 is associated with in-creased FA synthesis and increased TAG accumulation.

Stacking Additional Gene Mutations with adg1suc2Further Increases the Accumulation of TAG and Total FA

As shown in Figure 3, adg1suc2 had dramaticallyup-regulated gene expression of TT4 and accumulated1.5% (dry weight) of anthocyanins. TT4 catalyzes theconversion of 4-coumaroyl-CoA and malonyl-CoA tonaringenin chalcone in the cytosol. Malonyl-CoA playsa key role in chain elongation in FA biosynthesis in chlo-roplasts. Although it remains unclear whether there isan exchange of malonyl-CoA pools between the cy-tosol and chloroplast, we tested whether blockinganthocyanin synthesis by combining a TT4mutant withadg1suc2would result in any increase in FA synthesis. Toachieve this, adg1suc2 was crossed with tt4 to generatethe adg1suc2tt4 triplemutant, which, as expected, lost thereddish hue associated with anthocyanin accumulation(Fig. 6A). Combining adg1suc2 with tt4 resulted in asignificant increased in its total FA to 10% dry weightfrom 8% dry weight in the adg1suc2 double mutant (Fig.6B), and a similar increase in TAG accumulation wasobserved (Fig. 6B).

Next, we tested whether suppressing TAG turnover byintroducing a mutation in the SDP1 TAG lipase wouldfurther enhance TAG accumulation in the leaves ofadg1suc2 (Fig. 6A). adg1suc2sdp1 increased TAG con-tent by 66% over that accumulated by adg1suc2, whiletotal FA content was not altered significantly (Fig. 6B).

In this study, leaves of the 5-week-old tgd1 mutantaccumulated TAG to approximately 0.4% of leaf dryweight. To determine whether the TGD1 mutation wouldprovide a synergistic effect in the context of the adg1suc2tt4triplemutant background,wegenerated the adg1suc2tt4tgd1

Figure 2. AccumulationGlc and Suc in adg1suc2 leaves. A, Iodine staining showed that no starch accumulates in adg1suc2 at theend of the light period. Leaves were developmentally matched vegetative rosette leaves harvested from equivalent positions from4-week-old plants at the end of the light cycle. B, Glc and Suc contents in the leaves of wild-type (WT), adg1, suc2, and adg1suc24-week-old soil-grown plants. FW, Fresh weight. Values are means6 SD for each genotype. Levels indicated with different lettersabove histogram bars are significantly different (Student’s t test for all pairs of genotypes, n = 5, P , 0.05). The experiment wasrepeated three times, and data from one representative experiment are presented.

Plant Physiol. Vol. 175, 2017 699

Sugar Potentiation of TAG Accumulation

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

quadruple mutant. The growth and development of theadg1suc2tt4tgd1 quadruple mutant mirrored that ofadg1suc2 and adg1suc2tt4 (Fig. 6A). The adg1suc2tt4tgd1quadruple mutant accumulated 3.8% TAG in 5-week-old leaves, which represents increases of 3.4- and 50-foldover that of adg1suc2tt4 triple mutant and wild-typeleaves, respectively. The levels of total FA in leaves ofadg1suc2tt4tgd1 reached 13.5% dry weight (Fig. 6B).That leaf TAG content in adg1suc2tt4tgd1 of 3.8% ismuch higher than that of the combined TAG of tgd1plus adg1suc2tt4 at 1.5% (i.e. 0.4% + 1.1%, respectively)indicates a positive synergistic effect on TAG synthesisfor this combination of mutations.

Ectopic Expression of WRI1, DGAT1, and OLE1 in theadg1suc2 Double Mutant Enhances TAG and TotalFA Accumulation

That elevated leaf sugar levels correlate with the in-creased accumulation of both FA and TAG prompted

us to explore the effects of overexpressing several genesthat have been shown to enhance lipid accumulationin tobacco (Nicotiana tabacum; Vanhercke et al., 2014).Specifically, this would address whether a high-sugarbackground would further enhance the lipogenic ef-fects of overexpressing OWD relative to their expres-sion in wild-type leaves. TheOWD construct (describedabove) was first tested in tobacco leaves.WRI and Cys-OLE showed strong expression after a 2-d infiltration,as visualized by fluorescent signals localized in thenucleus and oil drops, respectively (Supplemental Fig.S2B). After 4 d of infiltration, TAG accumulation inOWD-infiltrated leaves reached 3.3% dry weight, rep-resenting a 60-fold increase compared with leaves infil-trated with an empty vector control (Supplemental Fig.S2C). Having confirmed its functionality, OWD wastransformed into wild-type plants. The gene transfor-mation efficiency of the wild type of the OWD constructwas much lower than for other constructs. Only threeindependent transgenic lines were obtained from onetransformation experiment. We observed that ectopic

Figure 3. High sugar content in adg1suc2 activates anthocyanin synthesis and regulates gene expression. A, Quantification ofmonomeric anthocyanins in adg1suc2. Asterisks denote a statistically significant difference from thewild type (WT; Student’s test,n = 5, **, P, 0.01). The experiment was repeated three times, and data from one representative experiment are presented. DW,Dry weight. B and C, Gene expression of TT4 (B) and TPS5 (C) is increased significantly in adg1suc2mutants. D, Gene expressionof Glc (Suc) transporters on vacuolar membrane: SUC4 and TMT1/2 are not significantly different between the wild type andadg1suc2. The gene expression values represent means 6 SD of measurements obtained by qRT-PCR employing the primersshown in Table I. F-box gene expression was used as a control for normalization. Significance was determined by mean crossingpoint deviation analysis computed by the relative expression (REST) software algorithm. Levels indicated with different lettersabove histogram bars are significantly different (P , 0.05). The experiments were repeated three times, and data from a singlerepresentative experiment are presented.

700 Plant Physiol. Vol. 175, 2017

Zhai et al.

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

overexpression of OWD resulted in a negative growthimpact when expressed in the wild type. All threeOWD transgenic lines were small and exhibited re-duced fecundity compared with wild-type plants. Thehighest TAG accumulation observed in mature leavesof 5-week-old OWD transgenic plants was only 0.5%(Fig. 7A). It has been shown that an exogenous supplyof Suc can increase vegetative TAG content inWRI1- orFus3-transformed plants (Kelly et al., 2013; Zhang et al.,2016). To test the hypothesis thatOWD can increase TAGbiosynthesis in the presence of elevated sugar, we gen-erated OWD/adg1suc2 transgenic plants by crossingOWD/wild-type transgenics with adg1suc2. TAG and

total FA contents in OWD/adg1suc2 were further ele-vated to 2.3% and 11% dry weight, compared with 1%and 8.3% TAG and total FA contents in adg1suc2, re-spectively (Fig. 7B). These increases in TAG content inOWD/adg1suc2 are significantly larger than expectedby the addition of their individual contributions. The FAcomposition of mature leaves of the wild type, adg1suc2,adg1suc2sdp1, OWD/adg1suc2, and adg1suc2tt4tgd1shows that, as TAG content increases from 0.08% inthe wild type to 3.8% in adg1suc2tt4tgd1, the levels of18:3 declined as 18:2 became more abundant, sug-gesting that the desaturation capacity for 18:2 be-comes limiting as FA accumulation increases. This is

Figure 4. TAG accumulates in leaves of adg1-suc2. A, Lipid droplets are abundant in leavesof adg1suc2. Representative confocal fluores-cence micrographs showmesophyll tissue fromthe wild type (WT) and adg1suc2 after 6 weeksof growth on soil after staining with BODIPY493/503. DIC, Differential interference contrastimage. Bars = 50mm. B andC, TAG (B) and totalFA (C) were quantified from 6-week-old leavesof soil-grown plants as indicated. D, [1-14C]Acetate incorporation into fatty acyl productsby leaf strips after 30min of labeling. OWD, theline coexpressing WRI1, DGAT1, and OLE1,was used as a positive control for the labelingassay. DW,Dry weight; FW, fresh weight. Valuesare means 6 SD for each genotype. Levels indi-cated with different letters above histogram barsare significantly different (Student’s t test for allpairs of genotypes, n = 5, P , 0.05). Each ex-periment was repeated three times, and datafrom a single representative experiment arepresented.

Plant Physiol. Vol. 175, 2017 701

Sugar Potentiation of TAG Accumulation

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

consistent with previous reports that the capacity ofFAD3 desaturase is limiting to the level of 18:3 accu-mulation (Lemieux et al., 1990; Arondel et al., 1992). Thelevel of 18:0 increased significantly in the FA pool ofOWD/adg1suc2 compared with adg1suc2 (Fig. 7C).

DISCUSSION

Partial Rescue of suc2 by Introducing adg1

The severe dwarf phenotype of suc2 is attributed toits inability to export Suc to developing shoots androots, which severely restricts the carbon available forgrowth and development. Combining adg1 with suc2partially mitigates the dwarf phenotype with respect toboth shoot size and primary root elongation, suggest-ing that more Suc is available to shoots and roots in theadg1suc2 double mutant. This view is supported by theobservation that adg1suc2 and suc2 seeds that germinateon 1/2MS medium supplemented with Suc show equiv-alent primary root elongation. One possible explanationfor the partial rescue of suc2 by introducing adg1 is thatinactivation of the competing starch biosynthesis resultedin a higher intracellular Suc concentration. This wouldincrease the Suc gradient across the membranes ofphloem companion cells in adg1suc2 relative to that ofsuc2, thereby driving passive sugar efflux. However,at this time, we cannot discount the possibility thathigh levels of sugar could activate, or induce, the ac-cumulation of other phloem-loading Suc transportersto facilitate increased Suc transport to shoots androots.

Sugar Accumulation in adg1suc2 Leaves

Leaves do not normally accumulate high levels ofphotosynthetically fixed sugars because they are eitherconverted to starch, the predominant short-term stor-age carbohydrate in leaves (Komor, 2000), or loadeddirectly into phloem and transported to sink tissues.Environmental conditions such as high light or low

temperatures can favor Suc synthesis and accumula-tion. Low temperatures decrease carbon utilization andallow Suc concentrations to rise (Pollock, 1990). Highconcentrations of Suc are found naturally only in spe-cialized plant storage organs such as the stems of sugar-cane (Saccharum officinarum). These specialized organshave efficient sugar transporters and sugar-metabolizingenzymes, such as Suc synthases and invertases, thatfacilitate phloem unloading and sugar compartmen-talization into the vacuoles of storage parenchyma(Zhu et al., 2000; Carson and Botha, 2002; Carson et al.,2002; Casu et al., 2003). Here, we demonstrate an 80-foldincrease of sugars in mature Arabidopsis leaves by de-creasing Suc export and blocking starch synthesis si-multaneously in the adg1suc2 doublemutant. Unlike Sucstorage organs, which have efficient sugar transportersand sugar-metabolizing enzymes that compartmentalizeSuc into vacuoles, elevated levels of Suc accumulate inthe cytosol of adg1suc2. This is consistent with the ob-servation that adg1suc2 and the wild type have similarexpression levels of TMT1/2, which encodes the proton-coupled antiporter capable of high-capacity vacuolar Glcand Suc loading (Schulz et al., 2011), and similar levels ofSUC4, a proton-coupled symporter that exports Sucfrom the vacuole (Schneider et al., 2012).

Suc Favors TAG Biosynthesis

It has beendemonstrated that Suc has effects on variousaspects of plant metabolism. For example, Suc inducesfructan (i.e. polymers of Fru) synthesis in grasses (Nagarajet al., 2001; Noël et al., 2001). Suc also acts as a signalingmolecule that initiates/activates starch synthesis by in-ducing the gene expression of AGPase large subunits,starch synthase (GBSS1) and b-amylase (Nakamuraet al., 1991; Harn et al., 2000; Wang et al., 2001; Nagataet al., 2012), and by posttranslationally activating theAGPase enzyme by redox modification (Tiessen et al.,2002). The down-regulation of photosynthetic CO2 fixa-tion by Suc is a widely observed phenomenon (VanOosten and Besford, 1994), as is the induction of genes

Figure 5. WRI1 accumulates to higher levels inadg1suc2 than in wild-type (WT) leaves. A,Gene expression of WRI1 in adg1suc2 is notsignificantly different from that in the wild typeas determined by mean crossing point devia-tion analysis computed by the relative expres-sion (REST) software algorithm. The experimentwas repeated three times, and data from a sin-gle representative experiment are presented. B,WRI1 protein accumulates to higher levelsin adg1suc2 than in the wild type. OWD, atransgenic line coexpressing WRI1, DGAT1,and OLE1, was used as a positive control forWRI1 polypeptide expression. Histone H3 wasused as a control for protein load. M indicatesprotein markers.

702 Plant Physiol. Vol. 175, 2017

Zhai et al.

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

related to anthocyanin and flavonoid biosynthesis uponSuc feeding (Solfanelli et al., 2006). Consistent with ex-ogenous Suc feeding, the strongly elevated levels of in-tracellular Suc in suc2adg1 resulted in dramatic increases

in chalcone synthase mRNA and significant accumula-tion of anthocyanin.

The TAG content of 4-week-old Arabidopsis roots cul-tured on agar supplementedwith 3%Sucwas significantly

Figure 6. Introduction of additional mutations, tt4, sdp1, and tgd1, further increases TAG and/or total FA content when combinedwith adg1suc2. A, Phenotypes of the shoots of 4-week-old plants of the indicated genotypes. Bars = 20mm. B, TAGwas quantifiedin leaves of the wild type (WT), double mutant adg1suc2, triple mutants adg1suc2tt4 and adg1suc2sdp1, and quadruple mutantadg1suc2tt4tgd1 (left). Total FA also was quantified in corresponding leaves of the indicated genotypes (right). DW, Dry weight.Values are means 6 SD for each genotype. Levels indicated with different letters above histogram bars are significantly different(Student’s t test for all pairs of genotypes, n = 5, P, 0.05). Each experiment was repeated three times, and representative data froma single experiment are presented.

Plant Physiol. Vol. 175, 2017 703

Sugar Potentiation of TAG Accumulation

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

higher than that of roots grown on agar without sup-plementation, because sugar provides carbon skele-ton, ATP, and reductant for TAG synthesis (Kellyet al., 2013). In this study, we show that the adg1suc2

mutant, which accumulates significantly more Suc, accu-mulates 10-fold more TAG than wild-type plants. It alsohas been reported that Glc supplementation is necessaryfor TAG accumulation in seedlings overexpressing

Figure 7. Coexpression of WRI1, DGAT1, andOLE1 (OWD) in adg1suc2 increases the accumu-lation of TAG and total FA in adg1suc2. A, TAGquantification in leaves of the 5-week-oldwild type(WT), double mutant adg1suc2, and the same linesexpressingOWD. B, Total FA alsowas quantified inleaves from the plants described in A. DW, Dryweight. C, Compositions of the FA pools of the wildtype and the indicated genotypes from this research.Values are means 6 SD for each genotype. Levelsindicated with different letters above histogram barsare significantly different (Student’s t test for all pairsof genotypes, n = 5, P, 0.05). Each experiment wasrepeated three times, and representative data from asingle experiment are presented.

Table I. Primers used

Gene Primer Pair Sequences (59–39) Purpose

SUC2 GTTTTTCGGAGAAATCTTCGG and CAAATGCTGGAATGTTTCCAC Genotyping for suc2SDP1 AAGCATTGAATCTGGTGGTTG and TTGGTGTGGTTAGGACTTTGG GenotypingTGD1 ATGATGCAGACTTGTTGTATCCA and CACAGTTCTTCAAAGAATCTCC GenotypingWRI1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAAGAAGCGCTTAACCACTTC and

GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTCAGAACCAACGAACAAGCCGene cloning

DGAT1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGATTTTGGATTCTGCTG andGGGGACCACTTTGTACAAGAAAGCTGGGTCTGACATCGATCCTTTTCGGTTCATC

Gene cloning

OLE1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGGATACAGCTAGAGG andGGGGACCACTTTGTACAAGAAAGCTGGGTCAGTAGTGTGCTGGCCACCA

Gene cloning

TT4 GGAAGTCAGCTAAGGATGGTG and GTCCGAAACCAAACAAGACAC qRT-PCRTPS5 AAGAGCTTATGGAACACCTCG and AGACCTTTGTTCACACCCTG qRT-PCRWRI1 TCGGAAGAGTGTTTGGGAAC and CAATCGCAGCCATGTCATATG qRT-PCRDGAT1 CCGACGCAATCTTCAAACAG and CCGACGCAATCTTCAAACAG qRT-PCRPDAT1 TGTTGCAGGGCTTTTCTCTG and TGTTGAGTCCCATGTGCG qRT-PCRTMT1 ATGACGCAGAGATGGAACTTAG and GGTGTCGGCATTCAAATACTG qRT-PCRTMT2 AGAACTCCGTTGATGCCTG and ACAATTGGTCCTGCTATGGTAC qRT-PCRSUC4 CGTCCCATATGCGTTGATTTC and TCCCACCTCCAAACAGTTG qRT-PCRBCCP2 AACAGCAAAACCAACATCCG and CCCTTCTGTACCTTATCTCCAAC qRT-PCRKAS1 CACAATTAACAGCACCTCCAAG and TGGGATAAAGCAAGAGATGGG qRT-PCRPKP b1 CTCCATACCTAACTTGCACTCC and CTCTGCACCAAGATCACCTC qRT-PCR

704 Plant Physiol. Vol. 175, 2017

Zhai et al.

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

WRI1 (Cernac and Benning, 2004).WRI1 overexpressionstudies show that FA synthesis is potentiated by exog-enous Suc treatment (Masaki et al., 2005) or by increasingintracellular Suc resulting from the down-regulation ofstarch synthesis byAPGRNA interference (Sanjaya et al.,2011). These studies suggested that Suc plays a role as asignaling molecule in regulating the expression ofWRI1target genes. In this study, we observed a substantialincrease in the level of WRI1 polypeptide in adg1suc2relative to the wild type, which most likely results fromthe suppression of posttranscriptional KIN10-dependentphosphorylation that predisposes WRI1 to degradation.That WRI1 expression did not differ significantly be-tween adg1suc2 and the wild type supports this view.The data presented here, that elevated sugar correlateswith increased accumulation of WRI1, is consistent withthe previously proposed model of WRI1 stabilizationupon Suc-mediated inhibition of KIN10 (Zhai et al.,2017). This also supports our model for a dual role forsugar in providing carbon skeletons for FA synthesis andthrough inhibiting KIN10 activity and, thereby, stabi-lizing WRI1.In the storage tissues of some varieties of sugarcane,

sugar levels can approach 650 mM (Welbaum andMeinzer, 1990) without stimulating TAG accumulationin stems (Zale et al., 2016). One possible explanation isthat the majority of Suc is compartmentalized in vacu-oles, resulting in relatively low levels of Suc in the cy-toplasm that are available as carbon skeletons for FAsynthesis. It is also possible that oleogenic transcriptionfactors such as WRI1, or some of the enzymes of TAGsynthesis, are poorly expressed when sugarcane pa-renchyma cells are accumulating high levels of sugar.

CONCLUSION

A series of Arabidopsis lines with increased leafsugar accumulation were created and analyzed for theamount of total FA and TAG. Increased levels of sugarcorrelated with increased accumulation of total FA andTAG along with increased rates of FA synthesis. Thislikely results from a combination of two mechanisms:(1) through increasing the supply of carbon skeletons,ATP, and reductant (Sanjaya et al., 2011); and (2) viainhibiting the KIN10-dependent degradation of WRI1(Zhai et al., 2017). Relative to thewild type, the adg1suc2double mutant accumulated more than 80-fold higherleaf sugar, 10-fold more TAG, and substantially higherlevels of WRI1. The adg1suc2sdp1 triple mutant, defectivein starch synthesis, showed a further increase in TAG ac-cumulation, and the quadruple mutant adg1suc2sdp1tgd1,deficient in plastidial lipid reimport, resulted in a furtherand synergistic doubling of TAG accumulation relative toadg1suc2sdp1. That the total FA in adg1suc2tt4tgd1 accu-mulated to 14% of dry weight while the TAG levels wereonly approximately 4% implies a bottleneck in TAG as-sembly. Overexpression of WRI1, DGAT1, and OLE1 inthe adg1suc2 background synergistically increased levelsof TAG compared with the sum of their individual

contributions. These data provide valuable insights intothe relationship between sugar, FA, and TAG accumu-lation in vegetative tissues that will help inform bio-technological efforts to optimize TAG accumulation invegetative tissues of economically important plants.

MATERIALS AND METHODS

Plant Materials and Growth Conditions

Seeds of Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 (the wildtype) and tt4-3 (Zhang et al., 2010) were obtained from the Arabidopsis Bi-ological Resource Center. The suc2-4 mutant was provided by Brian Ayre(University of North Texas). In addition, the following mutant lines wereused in this study: suc2-4 (Srivastava et al., 2008), adg1-1 (Lin et al., 1988),sdp1-5 (Kelly et al., 2013), and tgd1 (Xu et al., 2005). Homozygous double,triple, or quadruple mutants were generated by crossing the correspondingmutant lines. The genotyping primers used to identify homozygous mutantsare listed in Table I. For overexpression of OLE1, DGAT1, and WRI1 in adg1-1suc2-4, adg1-1suc2-4 was crossed with an OWD/wild type (OLE1, DGAT1and WRI1 overexpression line in the wild-type background). All plants weregrown with a light/dark cycle of 16 h/8 h, day/night temperatures of 23°C/19°C, a photosynthetic photon flux density of 250 mmol m22 s21, and 75%relative humidity.

RNA Isolation and qRT-PCR

To quantify the gene expression of TT4, TPS5, SUC4, TMT1/2, WRI1,DGAT1, and PDAT1, total RNAs were isolated from the wild type andadg1suc2 and treated with DNaseI. cDNA was prepared using SuperScriptIII First-Strand Synthesis SuperMix (Invitrogen). qRT-PCR was performedwith the CFX96 qPCR Detection System (Bio-Rad) and gene-specific primersfor TT4, TPS5, WRI1, DGAT1, PDAT1, F-box (AT5G1571), and Expressed1(AT4G33380), among which F-box and Expressed1 were used as referencegenes (Table I). Statistical analysis of qRT-PCR data was carried out withREST2009 (Pfaffl et al., 2002).

Leaf Iodine Staining

For leaf starch iodine staining, fresh leaves sampled from thewild type, suc2-4, and adg1-1suc2-4were decolored by incubating with absolute ethanol at 70°Cfor 5 min before staining with diluted Lugol’s solution (Tsai et al., 2009).

Leaf Total Anthocyanin, Suc, and Glc Quantification

Total leaf anthocyanin levels were quantified by the methods described byFuleki and Francis (1968). For the quantification of Suc and Glc of leaves, assayswere performed according to the manufacturer’s instructions for the SucroseAssay Kit and the Glucose (GO) Assay Kit (Sigma).

TAG and Total FA Quantification

Total lipids (TAG and polar lipids) were isolated from 100 mg of fresh leaftissue with 700 mL of methanol:chloroform:formic acid (2:1:0.1, v/v/v) andmixed by vigorous vortexing for 30 min. After the addition of 1 M KCl and 0.2 M

H3PO4, samples were vortexed and clarified by centrifugation at 2,000g for10 min; total lipids were collected as the lower phase. For TAG quantification,60 mL of total lipids was fractionated by thin-layer chromatography usinghexane:diethyl ether:acetic acid (70:30:1, v/v/v) as the mobile phase on SilicaGel 60 plates (Merck) and visualized after spraying with 0.05% primuline (in80% acetone). TAG fractions identified under UV light were isolated from theplate and transmethylated to FAmethyl esters by incubation by the addition of1 mL of boron trichloride-methanol and incubation at 80°C to 85°C for 40 min.For total FA quantification, 10 mL of total lipids was directly transmethylatedwith boron trichloride-methanol. For both assays, 5 mg of C17:0 was added asan internal standard prior to transmethylation. FAmethyl esters were extractedinto hexane and dried under a stream of dry nitrogen before dissolving in100 mL of hexane, followed by analysis using the Agilent Technologies 7890A

Plant Physiol. Vol. 175, 2017 705

Sugar Potentiation of TAG Accumulation

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

GC System equipped with a 5975C mass selective detector and a 60-m 30.25-mm i.d. DB23 column (Supelco).

Antibody and Immunoblotting

Anti-WRI1 and anti-histoneH3 antibodies were used in this study. Anti-WRI1polyclonal antibodies were raised in rabbits immunized with a synthetic peptide(DFMFDDGKHECLNLENLDC) corresponding to residues 299 to317 of theWRI1amino acid sequence (Pierce, Thermo Fisher). Histone H3 polyclonal antibodieswere purchased from Agrisera. A total of 50 mg of mature leaves of 4-week-oldwild-type and adg1suc2 plants was ground under liquid nitrogen and thenmixedwith 200mLof preheat protein extraction buffer (8M urea, 2%SDS, 0.1 MDTT, 20%glycerol, 0.1 M Tris-HCl [pH 6.8], and 0.004% Bromophenol Blue). Afterclarification by centrifugation at 16,000g, 30 mL of supernatant was loadedinto each and resolved by SDS-PAGE before transfer to PVDF membranes forimmunoblot analysis. Immunoblots of target proteins were visualized usingalkaline phosphatase-conjugated secondary antibodies and the substrates5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (Bio-Rad).

In Vivo [1-14C]Acetate Labeling

[1-14C]Acetate labeling was performed according to the method of Koo et al.(2004). In brief, half leaves were incubated in 25 mM MES (pH 5.7) buffer con-taining 0.01% (w/v) Tween 20 aswetting agent under a photon flux of 180mmolphotos m22 s21 at 25°C. Labeling was initiated by the addition of 10 mCi ofsodium [1-14C]acetate solution (58 mCi mmol21; American RadiolabeledChemicals). Labeling was terminated by removal of the medium, after whichthe leaf material waswashed three times withwater. Total lipids were extractedand separated as described above. Radioactivity associated with total lipidswas determined by liquid scintillation counting.

Lipid Staining

Mature leaves from 6-week-old soil-grown wild-type and adg1-1suc2-4plants were cut into approximately 8- 3 2-mm pieces. For BODIPY staining,fresh tissue was incubated with a solution containing 100 mg mL21 BODIPY493/503 (excitation/emission wavelengths; Invitrogen) in 0.1% Triton X-100(by dilution from a 10mgmL21 DMSO stock solution). Vacuumwas applied for10 min, before washing twice with phosphate-buffered saline to remove excessstain. The BODIPY-stained lipid droplets were imaged using a Leica SP5 con-focal laser scanning microscope with its excitation wavelength set at 488 nm.Lipid droplets were visualized at 633 magnification, with z gain of 824 and1,200 for BODIPY stain and chlorophyll, respectively.

Accession Numbers

Sequence data from this article can be found in The Arabidopsis Infor-mation Resource or GenBank database under the following accession num-bers: SUC2 (AT1G22710), ADG1 (AT5G48300), SDP1 (AT5G04040), TGD1(AT1G19800), DGAT1 (AT2G19450), TT4 (AT5G13930), TPS5 (AT4G17770),PDAT1 (AT5G13640), TMT1 (AT1G20840), TMT2 (AT4G35300), SUC4 (AT1G09960),BCCP2 (AT5G15530), KAS1 (AT5G46290), PKPb1 (AT5G52920), OLE1(AT4G25140), and WRI1 (AT3G54320).

Supplemental Data

The following supplemental materials are available.

Supplemental Figure S1. Phenotyping the root growth of 2-week-old seed-lings of the indicated genotypes grown on vertically oriented 1/2MSplates supplemented with 1% Suc.

Supplemental Figure S2. Transient expression of OWD in tobacco leaves.

ACKNOWLEDGMENTS

We thank Brian Ayre (University of North Texas) for the gift of suc2-4 andDr. F.W. Studier (Brookhaven National Laboratory) for critically reading thearticle.

Received June 19, 2017; accepted August 22, 2017; published August 25, 2017.

LITERATURE CITED

Arondel V, Lemieux B, Hwang I, Gibson S, Goodman HM, SomervilleCR (1992) Map-based cloning of a gene controlling omega-3 fatty aciddesaturation in Arabidopsis. Science 258: 1353–1355

Bouvier-Navé P, Benveniste P, Oelkers P, Sturley SL, Schaller H (2000)Expression in yeast and tobacco of plant cDNAs encoding acyl CoA:diacylglycerol acyltransferase. Eur J Biochem 267: 85–96

Carson D, Botha F (2002) Genes expressed in sugarcane maturing inter-nodal tissue. Plant Cell Rep 20: 1075–1081

Carson DL, Huckett BI, Botha FC (2002) Sugarcane ESTs differentially ex-pressed in immature and maturing internodal tissue. Plant Sci 162: 289–300

Casu RE, Grof CP, Rae AL, McIntyre CL, Dimmock CM, Manners JM(2003) Identification of a novel sugar transporter homologue stronglyexpressed in maturing stem vascular tissues of sugarcane by expressedsequence tag and microarray analysis. Plant Mol Biol 52: 371–386

Cernac A, Benning C (2004) WRINKLED1 encodes an AP2/EREB domainprotein involved in the control of storage compound biosynthesis inArabidopsis. Plant J 40: 575–585

Chen LQ, Qu XQ, Hou BH, Sosso D, Osorio S, Fernie AR, Frommer WB(2012) Sucrose efflux mediated by SWEET proteins as a key step forphloem transport. Science 335: 207–211

Dahlqvist A, Stahl U, Lenman M, Banas A, Lee M, Sandager L, Ronne H,Stymne S (2000) Phospholipid:diacylglycerol acyltransferase: an enzymethat catalyzes the acyl-CoA-independent formation of triacylglycerol inyeast and plants. Proc Natl Acad Sci USA 97: 6487–6492

Fuleki T, Francis F (1968) Quantitative methods for anthocyanins. J FoodSci 33: 266–274

Gottwald JR, Krysan PJ, Young JC, Evert RF, Sussman MR (2000) Geneticevidence for the in planta role of phloem-specific plasma membranesucrose transporters. Proc Natl Acad Sci USA 97: 13979–13984

Harn CH, Bae JM, Lee SS, Min SR, Liu JR (2000) Presence of multiplecDNAs encoding an isoform of ADP-glucose pyrophosphorylase largesubunit from sweet potato and characterization of expression levels.Plant Cell Physiol 41: 1235–1242

Kelly AA, van Erp H, Quettier AL, Shaw E, Menard G, Kurup S, Eastmond PJ(2013) The sugar-dependent1 lipase limits triacylglycerol accumulation invegetative tissues of Arabidopsis. Plant Physiol 162: 1282–1289

Komor E (2000) The physiology of sucrose storage in sugarcane. Dev CropSci 26: 35–53

Koo AJ, Ohlrogge JB, Pollard M (2004) On the export of fatty acids fromthe chloroplast. J Biol Chem 279: 16101–16110

Lemieux B, Miquel M, Somerville C, Browse J (1990) Mutants of Arabi-dopsis with alterations in seed lipid fatty acid composition. Theor ApplGenet 80: 234–240

Li L, Sheen J (2016) Dynamic and diverse sugar signaling. Curr Opin PlantBiol 33: 116–125

Lin TP, Caspar T, Somerville C, Preiss J (1988) Isolation and characteri-zation of a starchless mutant of Arabidopsis thaliana (L.) Heynh lackingADPglucose pyrophosphorylase activity. Plant Physiol 86: 1131–1135

Maeo K, Tokuda T, Ayame A, Mitsui N, Kawai T, Tsukagoshi H, IshiguroS, Nakamura K (2009) An AP2-type transcription factor, WRINKLED1,of Arabidopsis thaliana binds to the AW-box sequence conserved amongproximal upstream regions of genes involved in fatty acid synthesis.Plant J 60: 476–487

Masaki T, Mitsui N, Tsukagoshi H, Nishii T, Morikami A, Nakamura K (2005)ACTIVATOR of Spomin:LUC1/WRINKLED1 of Arabidopsis thaliana trans-activates sugar-inducible promoters. Plant Cell Physiol 46: 547–556

Miquel M, Trigui G, d’Andréa S, Kelemen Z, Baud S, Berger A, DeruyffelaereC, Trubuil A, Lepiniec L, Dubreucq B (2014) Specialization of oleosins in oilbody dynamics during seed development in Arabidopsis seeds. Plant Physiol164: 1866–1878

Nagaraj VJ, Riedl R, Boller T, Wiemken A, Meyer AD (2001) Light andsugar regulation of the barley sucrose:fructan 6-fructosyltransferasepromoter. J Plant Physiol 158: 1601–1607

Nagata T, Hara H, Saitou K, Kobashi A, Kojima K, Yuasa T, Ueno O (2012)Activation of ADP-glucose pyrophosphorylase gene promoters by a WRKYtranscription factor, AtWRKY20, in Arabidopsis thaliana L. and sweet potato(Ipomoea batatas Lam.). Plant Prod Sci 15: 10–18

Nakamura K, Ohto MA, Yoshida N, Nakamura K (1991) Sucrose-inducedaccumulation of b-amylase occurs concomitant with the accumulationof starch and sporamin in leaf-petiole cuttings of sweet potato. PlantPhysiol 96: 902–909

706 Plant Physiol. Vol. 175, 2017

Zhai et al.

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

Noël GM, Tognetti JA, Pontis HG (2001) Protein kinase and phosphataseactivities are involved in fructan synthesis initiation mediated by sugars.Planta 213: 640–646

Ohto M, Onai K, Furukawa Y, Aoki E, Araki T, Nakamura K (2001) Effectsof sugar on vegetative development and floral transition in Arabidopsis.Plant Physiol 127: 252–261

Pfaffl MW, Horgan GW, Dempfle L (2002) Relative Expression SoftwareTool (REST) for group-wise comparison and statistical analysis of rela-tive expression results in real-time PCR. Nucleic Acids Res 30: e36

Pollock C (1990) The response of plants to temperature change. J Agric Sci115: 1–5

Preiss J (1996) ADPglucose pyrophosphorylase: basic science and appli-cations in biotechnology. Biotechnol Annu Rev 2: 259–279

Price J, Laxmi A, St Martin SK, Jang JC (2004) Global transcription profilingreveals multiple sugar signal transduction mechanisms in Arabidopsis.Plant Cell 16: 2128–2150

Sanjaya, Durrett TP, Weise SE, Benning C (2011) Increasing the energydensity of vegetative tissues by diverting carbon from starch to oil bi-osynthesis in transgenic Arabidopsis. Plant Biotechnol J 9: 874–883

Schluepmann H, van Dijken A, Aghdasi M, Wobbes B, Paul M, Smeekens S(2004) Trehalose mediated growth inhibition of Arabidopsis seedlings is dueto trehalose-6-phosphate accumulation. Plant Physiol 135: 879–890

Schneider S, Hulpke S, Schulz A, Yaron I, Höll J, Imlau A, Schmitt B, Batz S,Wolf S, Hedrich R, et al (2012) Vacuoles release sucrose via tonoplast-localisedSUC4-type transporters. Plant Biol (Stuttg) 14: 325–336

Schulz A, Beyhl D, Marten I, Wormit A, Neuhaus E, Poschet G, BüttnerM, Schneider S, Sauer N, Hedrich R (2011) Proton-driven sucrosesymport and antiport are provided by the vacuolar transporters SUC4and TMT1/2. Plant J 68: 129–136

Sheen J (2014) Master regulators in plant glucose signaling networks. JPlant Biol 57: 67–79

Solfanelli C, Poggi A, Loreti E, Alpi A, Perata P (2006) Sucrose-specificinduction of the anthocyanin biosynthetic pathway in Arabidopsis.Plant Physiol 140: 637–646

Srivastava AC, Ganesan S, Ismail IO, Ayre BG (2008) Functional charac-terization of the Arabidopsis AtSUC2 sucrose/H+ symporter by tissue-specific complementation reveals an essential role in phloem loading butnot in long-distance transport. Plant Physiol 148: 200–211

Tiessen A, Hendriks JH, Stitt M, Branscheid A, Gibon Y, Farré EM,Geigenberger P (2002) Starch synthesis in potato tubers is regulated bypost-translational redox modification of ADP-glucose pyrophosphor-ylase: a novel regulatory mechanism linking starch synthesis to the su-crose supply. Plant Cell 14: 2191–2213

Tsai HL, Lue WL, Lu KJ, Hsieh MH, Wang SM, Chen J (2009) Starchsynthesis in Arabidopsis is achieved by spatial cotranscription of corestarch metabolism genes. Plant Physiol 151: 1582–1595

Vanhercke T, El Tahchy A, Liu Q, Zhou XR, Shrestha P, Divi UK, Ral JP,Mansour MP, Nichols PD, James CN, et al (2014) Metabolic engineer-ing of biomass for high energy density: oilseed-like triacylglycerol yieldsfrom plant leaves. Plant Biotechnol J 12: 231–239

Van Oosten JJ, Besford RT (1994) Sugar feeding mimics effect of acclimation tohigh CO2-rapid down regulation of RuBisCO small subunit transcripts butnot of the large subunit transcripts. J Plant Physiol 143: 306–312

Wang SJ, Yeh KW, Tsai CY (2001) Regulation of starch granule-boundstarch synthase I gene expression by circadian clock and sucrose inthe source tissue of sweet potato. Plant Sci 161: 635–644

Wang SM, Lue WL, Yu TS, Long JH, Wang CN, Eimert K, Chen J (1998)Characterization of ADG1, an Arabidopsis locus encoding for ADPGpyrophosphorylase small subunit, demonstrates that the presence of thesmall subunit is required for large subunit stability. Plant J 13: 63–70

Welbaum GE, Meinzer FC (1990) Compartmentation of solutes and waterin developing sugarcane stalk tissue. Plant Physiol 93: 1147–1153

Williams SP, Rangarajan P, Donahue JL, Hess JE, Gillaspy GE (2014)Regulation of Sucrose non-Fermenting Related Kinase 1 genes in Ara-bidopsis thaliana. Front Plant Sci 5: 324

Xu C, Fan J, Froehlich JE, Awai K, Benning C (2005) Mutation of the TGD1chloroplast envelope protein affects phosphatidate metabolism in Ara-bidopsis. Plant Cell 17: 3094–3110

Xu C, Shanklin J (2016) Triacylglycerol metabolism, function, and accu-mulation in plant vegetative tissues. Annu Rev Plant Biol 67: 179–206

Xu J, Francis T, Mietkiewska E, Giblin EM, Barton DL, Zhang Y, ZhangM, Taylor DC (2008) Cloning and characterization of an acyl-CoA-dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Tro-paeolum majus, and a study of the functional motifs of the DGAT proteinusing site-directed mutagenesis to modify enzyme activity and oilcontent. Plant Biotechnol J 6: 799–818

Zale J, Jung JH, Kim JY, Pathak B, Karan R, Liu H, Chen X, Wu H,Candreva J, Zhai Z, et al (2016) Metabolic engineering of sugarcane toaccumulate energy-dense triacylglycerols in vegetative biomass. PlantBiotechnol J 14: 661–669

Zhai Z, Liu H, Shanklin J (2017) Phosphorylation of WRINKLED1 byKIN10 results in its proteasomal degradation, providing a link betweenenergy homeostasis and lipid biosynthesis. Plant Cell 29: 871–889

Zhang F, Maeder ML, Unger-Wallace E, Hoshaw JP, Reyon D, ChristianM, Li X, Pierick CJ, Dobbs D, Peterson T, et al (2010) High frequencytargeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases.Proc Natl Acad Sci USA 107: 12028–12033

Zhang M, Cao X, Jia Q, Ohlrogge J (2016) FUSCA3 activates triacylglycerol ac-cumulation in Arabidopsis seedlings and tobacco BY2 cells. Plant J 88: 95–107

Zhu YJ, Albert HH, Moore PH (2000) Differential expression of solubleacid invertase genes in the shoots of high-sucrose and low-sucrosespecies of Saccharum and their hybrids. Funct Plant Biol 27: 193–199

Plant Physiol. Vol. 175, 2017 707

Sugar Potentiation of TAG Accumulation

www.plantphysiol.orgon February 19, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.