Click here to load reader

Sequencing genomes & personal genomics. Some (not all) variation is hereditary

  • View
    214

  • Download
    0

Embed Size (px)

Text of Sequencing genomes & personal genomics. Some (not all) variation is hereditary

  • Slide 1
  • Sequencing genomes & personal genomics
  • Slide 2
  • Slide 3
  • Some (not all) variation is hereditary
  • Slide 4
  • DNA Watson & Crick 1953 Why is variation hereditary?
  • Slide 5
  • What is DNA? AGCTAGCT type of molecule every cell of every living thing polymer nbc, gwryieodr ltame h,hr s, nerof tahgnaiodr ptnenfnnntdphe leesunF tet ccna bed orda ahrieatrtospoooaataa ccietsonuuel iaotnshveo t eyrn tcr q ieuodore ivt stdneuio aL.e i, Four score and seven years ago our fathers brought forth, upon this continent, a new nation, conceived in Liberty, and dedicated to the proposition that all men are created equal.
  • Slide 6
  • ACCCTCTTCAGAGCTGCACTAGACATTCACAGGGAATTGAGGTTCCCTATGCAGAAAGGTTTTCAGACAGAGGACCCAGCCCAT TTTCTCTCTCCAAATCCTCCTCCCTCCCTCTTTTGTGGTTGCAGCTATAAAATAATGATTCAACAATCAAAGAGCCTCTCATGA GATGGGAGAAGGAAGGGAACGAAAGGGGAAGAGGTGCCCTGGGCTGAAAACCTGTAGATTTTTTCTAAGTGACAAAGGGCAAGG GTCCTTTTTTGAAATTAGGAGAGAGACAGCTGTTTCCTCAATCGAAACTTCGCACATTACAACCAGCCTTGGGAAAAGCCAACA CCACCAGGGAGGAAGTGCTATGGGGTTTTGAAGCCAGACACTGATTTCTGGCTGTAATACTTTCCAGCCGTGTCTCTAAGCCTC GGCTTCTGCCTCCATCTGTAGAGTGGGCTTAATAATTTTGACCATCTCACAGAGTTGATGTGAAAATTAAAATAACCCGAACAG AACAGGCGATATATACAGGAATTAATGAAAGATTCCTGACATAATGCTTATAAGTTCATGATGCTTAGGAAGATAAAATTCATT GTAGAGATGCCGAACGGGGGTCTAGAGCTTGCCTTTTCGGGGTCTCTCCCGTCCTTCTCCATCCTCCTTATCTCCTGGGCTGCC CCCTCTCCCCCCGCGCCCCGCTCTCCCTGGCTCGCCCGGGCCTAGGGCGCCGCCTGCAGTTGCGCGCGGCCGCCTCTAGATGGA ACTTTCTCACCAACGCAAGGCCCGGCCGGAGCAGCTACCCGGGAGCTGGGCGGCGAGGGGCTACTTTCTCTCATTCCGGCGGGT GCAGGATCGGGGGGCCTGGGCAGTAACTAGTGGGGAGGAGCGCTGGACTGTGCACGTCGAGCCCGGCAGGTTTCCGCATGCGGC ATGCGAAGGGAATCCCGAGGTTTCCCTGCAGAACCCGAGCACGGCTCCCCCGGAGTTTCCTGCCCCGCGTCTGCGGCTCCTTGA ATCATCTCAATAAAATGACCGTCCCGGTAGCCACCCATGCCCCTTCCTGCGCAGTGCCCGCAGCGGACCGCGCTGTGTGGTACC TCGAGCCCTGGGGACTCTGTTGCACGCGTCCCTCAGACCCTCGGGGGCGGGGAGTGGGGAGACAATCGCCAGAGCCGCGGGGCG GGACAAATGGCGGAACCGCCGCGCGGCGCCAGGCAAACTTTGCAAGGGAACCGCGCGGCTTGCCGGCTCTACTTTAAGCATTCC CGAAAAGAAAGCATGTGGCGGGACACTTGTCATCTACCATGTGTTATTCTCGGTGACGCTTTCTGGAGCTGTGTTCACCGGGGA CCCGGGCTCGCGGGTGCTGCCCGCTGTGCTCGGGCGGGCGTCGCGCCTCCCCGCGCCGGTCCCGGGCTCGCCAGGCAGCCGGAG CCGCTGGGCTCCTCCACAACCATATTCCTTCTTCTACCGCTCCCGCTTCTTCCCACCCTCTCACTCTGTAGTTGGGTCCTCCCC TTTTTCTTGGGGGCGGGGAAGGGGGGATGATTTTTAAAAATCAGAACTATTGACATTTCTGGTCTCCTCGTCGCTTCAGGCTGA AGAGCGGAGGGGGATCCGCGGGCCGAGGGTCCCCCTCCCTGCCCGCGCCAGGGCCGCTGGGTGACACCGAAATCCAGAGGCTCC CGCCCCTCGGGGGTTCCTCCTCCCGCTTCCCGAGGTGACTGGTTGGCGCGAAGCGATTGGCGATCCCGGGCGCGATCCTGGCCG CGGCTCCCCGCGCCGCGCCGGGTGAATGGCCGCGGGCGGAGGATCGGGAGGGCCCGGGCGCAGACCAATCGCGGCCGCCGGTGG GAGTATTTGTTATTCACATGGAAGAGACTTGGCGCCTGCTAGGCCAGCTCAGCCCCCTCAGCCCAGAGATCAGCCACAAGTGCG GCCGCTGTGCTCGCCTCACGCGGCGGCGGCGGCGGCGGCGGCGGCGCTGACATGGAGCTGCGGGCCCCCGGCGGGCTTCCTCAC CGCGCCCTCTGCGGGGAGCAGGGTAAGACTCGCCGCCCGGCAGCAGAAAGCGGCTCCGAGGAAAGCAAGTGCCGAACCACGGGA CAAAAAGCCCCTGGCCCCCAAACTTCCCCAAAACGCCCTGCTTGTTGGAAAAGGAGAATCCCCCCGTTTTATTCCCCTTTCCGT TTTCTTCTCTAAAACCTTTCAGCGGACAGCCAGGTGCACCATTCCTTCTCATATCACTCTAGTGATTTGTTTTTCCTGAGCACA AGTAGATGGCCCTGCATGTCCGTAGTCTGTGAGAGAAATAGCGGGCGGAGGTGACGGGAATGGGGGGAGAAGGAGAGTGGGCAC CAGGGGGCGAGGGGCTGGCCGGGCATTGGAGCTTGATTGGGTGTCTGTTGATTTTACGTTGCAAAGAACAAGGCAGCCACCCCT CTTGTCTGCCCATGATTACATTACAGTAAAGAGGTTCAGAAAAGAGGGAGACTTTACCCGGAACTCCCAAGGCTTGGAGATGTG ATCCCCCAAAAGTTTAGTCGGCGAATGGGAGACTGAAGGGTGACGGGAAGGGGGCAGGCGCGCTCGGCGCTCTGACTGGGCGTG CGGCGGCAGGATTTTAAAGCGCTCTGCCTCGGATCGTCTGCCCTGGGTGACCTCCCGGACCTGCCCTGGTGGAATCCGGACTTG
  • Slide 7
  • What is a genome? DNA blueprint for an organism
  • Slide 8
  • ACCCTCTTCAGAGCTGCACTAGACATTCACAGGGAATTGAGGTTCCCTATGCAGAAAGGTTTTCAGACAGAGGACCCAGCCCAT TTTCTCTCTCCAAATCCTCCTCCCTCCCTCTTTTGTGGTTGCAGCTATAAAATAATGATTCAACAATCAAAGAGCCTCTCATGA GATGGGAGAAGGAAGGGAACGAAAGGGGAAGAGGTGCCCTGGGCTGAAAACCTGTAGATTTTTTCTAAGTGACAAAGGGCAAGG GTCCTTTTTTGAAATTAGGAGAGAGACAGCTGTTTCCTCAATCGAAACTTCGCACATTACAACCAGCCTTGGGAAAAGCCAACA CCACCAGGGAGGAAGTGCTATGGGGTTTTGAAGCCAGACACTGATTTCTGGCTGTAATACTTTCCAGCCGTGTCTCTAAGCCTC GGCTTCTGCCTCCATCTGTAGAGTGGGCTTAATAATTTTGACCATCTCACAGAGTTGATGTGAAAATTAAAATAACCCGAACAG AACAGGCGATATATACAGGAATTAATGAAAGATTCCTGACATAATGCTTATAAGTTCATGATGCTTAGGAAGATAAAATTCATT GTAGAGATGCCGAACGGGGGTCTAGAGCTTGCCTTTTCGGGGTCTCTCCCGTCCTTCTCCATCCTCCTTATCTCCTGGGCTGCC CCCTCTCCCCCCGCGCCCCGCTCTCCCTGGCTCGCCCGGGCCTAGGGCGCCGCCTGCAGTTGCGCGCGGCCGCCTCTAGATGGA ACTTTCTCACCAACGCAAGGCCCGGCCGGAGCAGCTACCCGGGAGCTGGGCGGCGAGGGGCTACTTTCTCTCATTCCGGCGGGT GCAGGATCGGGGGGCCTGGGCAGTAACTAGTGGGGAGGAGCGCTGGACTGTGCACGTCGAGCCCGGCAGGTTTCCGCATGCGGC ATGCGAAGGGAATCCCGAGGTTTCCCTGCAGAACCCGAGCACGGCTCCCCCGGAGTTTCCTGCCCCGCGTCTGCGGCTCCTTGA ATCATCTCAATAAAATGACCGTCCCGGTAGCCACCCATGCCCCTTCCTGCGCAGTGCCCGCAGCGGACCGCGCTGTGTGGTACC TCGAGCCCTGGGGACTCTGTTGCACGCGTCCCTCAGACCCTCGGGGGCGGGGAGTGGGGAGACAATCGCCAGAGCCGCGGGGCG GGACAAATGGCGGAACCGCCGCGCGGCGCCAGGCAAACTTTGCAAGGGAACCGCGCGGCTTGCCGGCTCTACTTTAAGCATTCC CGAAAAGAAAGCATGTGGCGGGACACTTGTCATCTACCATGTGTTATTCTCGGTGACGCTTTCTGGAGCTGTGTTCACCGGGGA CCCGGGCTCGCGGGTGCTGCCCGCTGTGCTCGGGCGGGCGTCGCGCCTCCCCGCGCCGGTCCCGGGCTCGCCAGGCAGCCGGAG CCGCTGGGCTCCTCCACAACCATATTCCTTCTTCTACCGCTCCCGCTTCTTCCCACCCTCTCACTCTGTAGTTGGGTCCTCCCC TTTTTCTTGGGGGCGGGGAAGGGGGGATGATTTTTAAAAATCAGAACTATTGACATTTCTGGTCTCCTCGTCGCTTCAGGCTGA AGAGCGGAGGGGGATCCGCGGGCCGAGGGTCCCCCTCCCTGCCCGCGCCAGGGCCGCTGGGTGACACCGAAATCCAGAGGCTCC CGCCCCTCGGGGGTTCCTCCTCCCGCTTCCCGAGGTGACTGGTTGGCGCGAAGCGATTGGCGATCCCGGGCGCGATCCTGGCCG CGGCTCCCCGCGCCGCGCCGGGTGAATGGCCGCGGGCGGAGGATCGGGAGGGCCCGGGCGCAGACCAATCGCGGCCGCCGGTGG GAGTATTTGTTATTCACATGGAAGAGACTTGGCGCCTGCTAGGCCAGCTCAGCCCCCTCAGCCCAGAGATCAGCCACAAGTGCG GCCGCTGTGCTCGCCTCACGCGGCGGCGGCGGCGGCGGCGGCGGCGCTGACATGGAGCTGCGGGCCCCCGGCGGGCTTCCTCAC CGCGCCCTCTGCGGGGAGCAGGGTAAGACTCGCCGCCCGGCAGCAGAAAGCGGCTCCGAGGAAAGCAAGTGCCGAACCACGGGA CAAAAAGCCCCTGGCCCCCAAACTTCCCCAAAACGCCCTGCTTGTTGGAAAAGGAGAATCCCCCCGTTTTATTCCCCTTTCCGT TTTCTTCTCTAAAACCTTTCAGCGGACAGCCAGGTGCACCATTCCTTCTCATATCACTCTAGTGATTTGTTTTTCCTGAGCACA AGTAGATGGCCCTGCATGTCCGTAGTCTGTGAGAGAAATAGCGGGCGGAGGTGACGGGAATGGGGGGAGAAGGAGAGTGGGCAC How big is a genome? Poliovirus7 thousand HIV virus10 thousand E. coli5 million M. tuberculosis4 million Rice400 million Mosquito300 million Chicken1 billion Mouse3 billion Human3 billion Opposum 4 billion Toad7 billion
  • Slide 9
  • How do we sequence genomes? (1) Break the DNA in to manageable chunks (2) Convert A, G, C & T 4 colors and sequence one chunks at a time (3) Assemble the chunks into a genome sequence
  • Slide 10
  • DNA sequencing technology 199619982001 100's1,000's1,000,000's nucleotides sequenced per day Year
  • Slide 11
  • H. influenzae (bacteria) 1995 S. cerevisiae (yeast) 1996 1998 C. elegans (worm) D. melanogaster (fruit fly) 2000 M. musculus (mouse) 2001 H. sapiens (human) 2002 P. troglodytes (chimp) 2005 questions?
  • Slide 12
  • The Human Genome June 26, 2000
  • Slide 13
  • What is the Human Genome? 3 billion As, Gs, Cs & Ts 23 chromosomes 2 copies each 20,000 genes
  • Slide 14
  • Slide 15
  • Whose genome is the human genome?
  • Slide 16
  • We are almost (but not exactly) the same 99.9%! 99.0%!
  • Slide 17
  • ACCCTCTTCAGAGCTGCACTAGACATTCACAGGGAATTGAGGTTCCCTATGCAGAAAGGTTTTCAGACAGAGGACCCAGCCCAT TTTCTCTCTCCAAATCCTCCTCCCTCCCTCTTTTGTGGTTGCAGCTATAAAATAATGATTCAACAATCAAAGAGCCTCTCATGA GATGGGAGAAGGAAGGGAACGAAAGGGGAAGAGGTGCCCTGGGCTGAAAACCTGTAGATTTTTTCTAAGTGACAAAGGGCAAGG GTCCTTTTTTGAAATTAGGAGAGAGACAGCTGTTTCCTCAATCGAAACTTCGCACATTACAACCAGCCTTGGGAAAAGCCAACA CCACCAGGGAGGAAGTGCTATGGGGTTTTGAAGCCAGACACTGATTTCTGGCTGTAATACTTTCCAGCCGTGTCTCTAAGCCTC GGCTTCTGCCTCCATCTGTAGAGTGGGCTTAATAATTTTGACCATCTCACAGAGTTGATGTGAAAATTAAAATAACCCGAACAG AACAGGCGATATATACAGGAATTAATGAAAGATTCCTGACATAATGCTTATAAGTTCATGATGCTTAGGAAGATAAAATTCATT GTAGAGATGCCGAACGGGGGTCTAGAGCTTGCCTTTTCGGGGTCTCTCCCGTCCTTCTCCATCCTCCTTATCTCCTGGGCTGCC CCCTCTCCCCCCGCGCCCCGCTCTCCCTGGCTCGCCCGGGCCTAGGGCGCCGCCTGCAGTTGCGCGCGGCCGCCTCTAGATGGA ACTTTCTCACCAACGCAAGGCCCGGCCGGAGCAGCTACCCGGGAGCTGGGCGGCGAGGGGCTACTTTCTCTCATTCCGGCGGGT GCAGGATCGGGGGGCCTGGGCAGTAACTAGTGGGGAGGAGCGCTGGACTGTGCACGTCGAGCCCGGCAGGTTTCCGCATGCGGC ATGCGAAGGGAATCCCGAGGTTTCCCTGCAGAACCCGAGCACGGCTCCCCCGGAGTTTCCTGCCCCGCGTCTGCGGCTCCTTGA ATCATCTCAATAAAATGACCGTCCCGGTAGCCACCCATGCCCCTTCCTGCGCAGTGCCCGCAGCGGACCGCGCTGTGTGGTACC TCGAGCCCTGGGGACTCTGTTGCACGCGTCCCTCAGACCCTCGGGGGCGGGGAGTGGGGAGACAATCGCCAGAGCCGCGGGGCG GGACAAATGGCGGAACCGCCGCGCGGCGCCAGGCAAACTTTGCAAGGGAACCGCGCGGCTTGCCGGCTCTACTTTAAGCATTCC CGAAAAGAAAGCATGTGGCGGGACACTTGTCATCTACCATGTGTTATTCTCGGTGACGCTTTCTGGAGCTGTGTTCACCGGGGA CCCGGGCTCGCGGGTGCTGCCCGCTGTGCTCGGGCGGGCGTCGCGCCTCCCCGCGCCGGTCCCGGGCTCGCCAGGCAGCCGGAG CCGCTGGGCTCCTCCACAACCATATTCCTTCTTCTACCGCTCCCGCTTCTTCCCACCCTCTCACTCTGTAGTTGGGTCCTCCCC TTTTTCTTGGGGGCGGGGAAGGGGGGATGATTTTTAAAAATCAGAACTATTGACATTTCTGGTCTCCTCGTCGCTTCAGGCTGA AGAGCGGAGGGGGATCCGCGGGCCGAGGGTCCCCCTCCCTGCCCGCGCCAGGGCCGCTGGGTGACACCGAAATCCAGAGGCTCC CGCCCCTCGGGGGTTCCTCCTCCCGCTTCCCGAGGTGACTGGTTGGCGCGAAGCGATTGGCGATCCCGGGCGCGATCCTGGCCG CGGCTCCCCGCGCCGCGCCGGGTGAATGGCCGCGGGCGGAGGATCGGGAGGCGCCGGGCGCAGACCAATCGCGGCCGCCGGTGG GAGTATTTGTTATTCACATGGAAGAGACTTGGCGCCTGCTAGGCCAGCTCAGCCCCCTCAGCCCAGAGATCAGCCACAAGTGCG GCCGCTGTGCTCGCCTCACGCGGCGGCGGCGGCGGCGGCGGCGGCGCTGACATGGAGCTGCGGGCCCCCGGCGGGCTTCCTCAC CGCGCCCTCTGCGGGGAGCAGGGTAAGACTCGCCGCCCGGCAGCAGAAAGCGGCTCCGAGGAAAGCAAGTGCCGAACCACGGGA CAAAAAGCCCCTGGCCCCCAAACTTCCCCAAAACGCCCTGCTTGTTGGAAAAGGAGAATCCCCCCGTTTTATTCCCCTTTCCGT TTTCTTCTCTAAAACCTTTCAGCGGACAGCCAGGTGCACCATTCCTTCTCATATCACTCTAGTGATTTGTTTTTCCTGAGCACA AGTAGATGGCCCTGCATGTCCGTAGTCTGTGAGAGAAATAGCGGGCGGAGGTGACGGGAATGGGGGGAGAAGGAGAGTGGGCAC CAGGGGGCGAGGGGCTGGCCGGGCATTGGAGCTTGATTGGGTGTCTGTTGATTTTACGTTGCAAAGAACAAGGCAGCCACCCCT CTTGTCTGCCCATGATTACATTACAGTAAAGAGGTTCAGAAAAGAGGGAGACTTTACCCGGAACTCCCAAGGCTTGGAGATGTG ATCCCCCAAAAGTTTAGTCGGCGAATGGGAGACTGAAGGGTGACGGGAAGGGGGCAGGCGCGCTCGGCGCTCTGACTGGGCGTG CGG

Search related