Int. J . Cancer: 47, 491-495 (1991) Publication of the International Union Against Cancer Publication de I'Union Internationale Contre le Cancer 0 1991 Wiley-Liss, Inc.

SEQUENCE VARIATIONS IN LTR AND env REGIONS OF HTLV-I DO NOT DISCRIMINATE BETWEEN THE VIRUS FROM PATIENTS WITH HTLV-I-ASSOCIATED MYELOPATHY AND ADULT T-CELL LEUKEMIA Tomohiro KINOSHITA, Atsumi TSUJIMOTO and Kunitada SHIMOTOHNO Virology Division, National Cancer Center Research Institute, 5-1 -1, Tsukiji, Chuo-ku, Tokyo 104, Japan.

For detailed comparison of human T-cell leukemia virus type I (HTLV-I) in adult T-cell leukemia (ATL) and HTLV- I-associated myelopathy (HAM), the nucleotide sequences of parts of the long terminal repeat (LTR) and envregionr of the HTLV-I proviruses from 12 patients with HAM, 8 patients with ATL and one with both diseases were analyzed. About 340 bp of the LTR U3 region, about 450 bp of the 5' region and about 280 bp of the 3' region of env were sequenced directly in DNAs amplified by the polymerase chain reaction (PCR) with 2 or 3 sets of primers for each region. Nucleotide inser- tions, deletions or point mutations were observed at 50 posi- tions in these regions of about 1,000 nucleotides length. None of these changes was specific to either HAM or AXL, and some changes were observed in proviruses from both cases of HAM and ATL. Moreover, the sequences of proviruses iso- lated from pairs of cell lines established from cerebrospinal fluid (CSF) and peripheral blood mononuclear cells (PBMCs) of the 4 patients with HAM also had different sequences. These results indicate that the proviruses from HAM and ATL are indistinguishable in these sequenced regions, suggesting that these 2 diseases are caused by infection with genetically indistinguishable HTLV-I. Therefore, the reason why these two distinct diseases, HAM and ATL. develop in HTLV-I car- riers may be based on a host factor@) or some other factor@) rather than variation in the virus itself.

Human T-cell leukemia virus type I (HTLV-I) is the first human retrovirus shown to be closely related to a human T-cell malignancy, adult T-cell leukemia (ATL) (Uchiyama et al., 1977; Yoshida et al., 1982). Anti-HTLV-I antibody is detect- able in most ATL patients (Hinuma et al., 1981) and mono- clonal integration of the HTLV-I provirus is detectable in most fresh ATL cells (Yoshida et al., 1984). Thus HTLV-I is con- sidered to be the etiological agent of ATL. In addition to ATL, another disease entity named HTLV-I-associated myelopathy (HAM) was established (Osame et al., 1987). HAM is closely related to HTLV-I, but its clinical manifestation is distinct from that of ATL. HAM is a chronic progressive myelopathy and patients with HAM have antibodies that react with HTLV-I antigens. Southern blot analysis showed that the proviruses in peripheral blood mononuclear cells (PBMCs) or lymphocytes in cerebrospinal fluid (CSF) of patients with HAM was indis- tinguishable from the provirus in ATL cells (Yoshida et al., 1987; Imamura et at., 1988; Gessain et al., 1989). Moreover, nucleotide sequence analysis of a molecularly cloned provirus, H-5 (Tsujimoto et al., 1988), derived from a cell line estab- lished from the CSF of a patient with HAM (Hirose et al., 1986) showed that this provirus shares about 97% nucleotide sequence homology with the provirus, XATK-1, that was de- rived from a patient with ATL (Seiki et al., 1983; Inoue et al., 1986), and that the provirus could be considered to belong to the same HTLV-I species as that from a patient with ATL.

Although HTLV-I has been considered to be the etiological agent of both ATL and HAM, the reason why HTLV-I causes these 2 distinct diseases, ATL and HAM, is unknown. The pathogenicity or cell tropism of retrovirus is changed by minor base changes in the proviral genome, especially in the LTR or env (Lenz et al., 1984; Rassart e f al., 1986). Therefore, minor viral gene mutations may play some crucial roles in the devel-

opments of these 2 diseases. In fact, nucleotide sequence anal- ysis of a proviral clone derived from a patient with HAM revealed nucleotide sequence differences, especially clustered in the U3 region of LTR, and the 5' and 3' regions of env (Tsujimoto et al., 1988), between the proviruses of ATL and HAM. For detailed comparison of the proviruses in HAM and ATL, we analyzed the proviral sequences of these regions in 21 samples from patients with ATL and/or HAM by direct se- quencing of enzymatically amplified DNA. As reported here, no nucleotide sequence alteration specific for HAM or ATL was observed in these regions, indicating that the nucleotide sequences of HTLV-I in HAM and ATL are indistinguishable.

MATERIAL AND METHODS

Cells Proviruses from 12 patients with HAM, 8 patients with ATL

and 1 patient with both HAM and ATL were analyzed. Data on the samples examined are summarized in Table I . The cell lines CNS-2, CNS-3, CNS-4 were established from the CSF of pa- tients with HAM (Taguchi et al., 1987; Imamura et al., 1988). The HPB-3 and HPB-4 cell lines were established from the same patients from whom the CNS-3 and CNS-4 lines, respec- tively, were established (Imamura et al., 1988). Samples 1C and 1 P and 2C and 2P are 2 pairs of cell lines established from the CSF and peripheral blood (PB) of 2 patients with HAM, C and P indicating the origins of these cell lines from the CSF and PB respectively. MT-2 (Miyoshi et al., 1981), MT-4 (Miyoshi

Number

1c 1P 2 c 2P 3 c 3P 4c 4P 5 6 7 8

TABLE I -

Diagnosis

HAM HAM HAM HAM HAM HAM HAM HAM HAM HAM HAM HAM

CELLS ANALYZED'

Cell Origin

Cell line CSF Cell line PB Cell line CSF Cell line PB CFS-4 CSF HPB-4 PB CFS-3 CSF HPB-3 PB CNS-2 CSF PBMCs PB PBMCs PB PBMCs PB

9 ATL MT-4 PB 10 ATL MT-2 PB 11 ATL c 9 l/PL PB 12 ATL ATL- 1 K PB 13 ATL IKD PB 14 ATL NKD PB 15 ATL Tumor Skin tumor 16 ATL Tumor Skin tumor 17 HAM and ATL PBMCs PB

'Cell line, cultured cells or cell lines; Origin, origin of the cells analyzed; HAM HTLV-I-associated myelopathy; ATL, adult T-cell leukemia; CSF, cerebrospinal fluid; PB, peripheral blood; PBMCs, peripheral blood mononuclear cells.

Received: March 3, 1990 and in revised form September 25, 1990.

492 KINOSHITA ET AL

et al., 1982), C91/PL (Popovic et al., 1983) and ATL-1K (Hoshino et al., 1983) are cell lines established from ATL patients. IKD and NKD are cell lines established from 2 ATL patients, which show the same T-cell-receptor P-chain gene rearrangement patterns and the same HTLV-I integration pat- terns as those of fresh ATL cells from these respective patients by Southern blot analysis (Kagami et al., 1988). Skin tumors from 2 patients with ATL (Table I, numbers 15, 16), and PBMCs from 3 patients with HAM (Table I, 6, 7, 8) and from a patient with both HAM and ATL (Table I, 17) were also included in this study. PBMCs from patients with ATL or HAM were separated by Ficoll-Conray gradient centrifugation of heparinized peripheral blood.

DNA isolation High-molecular-weight DNA was extracted from various

cells by the conventional method using proteinase K and SDS followed by phenol chloroform extraction and ethanol precip- itation.

Polymerase chain reaction and sequencing The polymerase chain reaction (PCR) (Saiki et al., 1988)

was carried out as described elsewhere (Kinoshita et al., 1989). The primers used for the PCR are shown in Table 11. Using these sets of primers, all sites of nucleotide differences between the U3 regions of the LTR and env regions of H-5 and ATK-1 could be sequenced. Samples of 1-4 kg of cellular DNA were subjected to PCR. The nucleotide sequence of the amplified DNA was analyzed by the method of Stoflet et al. (1988). The primers used for sequencing are shown in Table 11. The 3' portions of the env regions of some samples were se- quenced by the method of Maxam and Gilbert (1980) using the primers PCR3 and PCR4.

RESULTS

Nucleotide sequence analysis of the LTR U3 region The nucleotide sequence was determined by direct sequenc-

ing of the enzymatically amplified DNA without further clon- ing procedures, so misreading by the Thermus aquaticus DNA polymerase was judged to be insignificant. Thus the sequences are thought to be those of the main proviral clones in vivo in PBMCs from patients with ATL or HAM.

The sequences of the U3 regions of the LTR examined are summarized in Table 111. About 340bp of most of the LTR U3

region of the HTLV-Is could be sequenced with 3 sets of primers (Table 11). Sequence variations from that of AATK-1 or H-5 were observed at 18 of about 340 nucleotides sequenced in these samples. None of these variations was in a major functional region, such as a triplicated 21-bp enhancer, a poly- adenylylation signal, a TATA box or a cap site. Moreover, none of these variations was specific to HAM or ATL. There- fore, most of the basic functions of the LTR in these proviruses are considered to be conserved, indicating that the proviruses associated with HAM and ATL have functionally indistin- guishable LTRs. None of these variations in the proviruses was specific to PB or CSF, from which these cell lines were estab- lished. Three of 4 pairs of cell lines, derived from the periph- eral blood and CSF, respectively, of individual patients with HAM, showed some differences in these regions (Table 111, 1C and lP, 3C and 3P, 4C and 4P).

Nucleotide sequence analysis of env region The nucleotide sequences of about 730 bp of the 5' and 3'

regions of env were analyzed using 4 sets of primers (Table 11). In these regions, sequence variations were observed at 32 sites (Table IV). Of these 32 variations, 14 caused mutations of deduced amino acids. None of these variations in nucleotides or deduced amino acids was specific to either HAM or ATL. Thus the nucleotide sequences of the env regions of the pro- viruses in HAM or ATL were indistinguishable.

The proviruses of 3 of the 4 pairs of cell lines from 4 HAM patients described above differed from each other in nucleotide sequences in these regions (Table IV, 1C and IP, 2C and 2P, 4C and 4P), and 1 of them (Table IV, 4P) had a sequence identical to that of one ATL patient (Table IV, 15). Thus all 4 pairs of proviruses derived from the CSF and PB, respectively, of 4 patients with HAM differed in nucleotide sequence in the LTR andlor env region.

DISCUSSION

The reason why HTLV-I causes 2 distinct diseases, leuke- mia and myelopathy, is unknown. Two possible explanations may be considered. One is that the host or some factor(s) other than the virus is responsible for the development of these dif- ferent diseases. HLA haplotype-linked high immune respon- siveness against HTLV-I is associated with HAM patients but not with ATL patients (Usuku et al., 1988). This suggests a relation of some host factor(s) to the etiology of HAM and

TABLE I1 - NUCLEOTIDE SEQUENCES OF THE PRIMERS FOR PCR AND FOR SEQUENCING

Region 5' and 3' primers for PCR' Primers for sequencing analyzed LTR U3 *LTR3: CTTAGAGCCTCCCAGTGAAA (37-56) LTR10: TTGAGGTGAGGGGTTGT (278-262)

LTR6: AGCCATATGCGTGCCATGAA (305-286) LTR U3 LTR15: TGACAATGACCATGAGC (1-17)

LTR U3 *LTR11: ATCATAAGCTCAGACCTCCG (179-198)

LTR15: same as 3' primer for PCR

LTR14: same as 3' primer for PCR *LTRlO: same as shown above

LTR14: ACTCAACCGGCGTGGAT (417400) env 5' RPX3: ATCCCGTGGAGACTCCTCAA ( 5 0 9 6 5 115)

*PCR20: TGTAGGGCCTGATCTGCTGA (5371-5352) KBERl: GACCCGTCGGAGGCCCC (5 133-5 149)

env 5' *PCR21: CAGCTACCATGCCACCTA'M (5402-5421) ENV12: GAGAAGGGAAAACCGCA (5665-5649) PCR22: ATATCCTGGAGCGTCGACTA (569&5671)

PCR4: ATGCATGGTCCTGCAAGGAT (65684549)

PCR6: AGAGGTTAATTATTGGCAGG (6709-6690)

env 3' *PCR3: AAATTGCGCAGTATGCTGCC (6289-6308) ENV6: ACAAGAAGGAGTAGCGC (6547-653 1)

env 3' *PCRI: CAATACTACAAGAAAGACCC (6412-643 1) ENVS: AGGCGATGTGGTTGCAA (6680-4664)

'Numbers in parentheses indicate the corresponding locations of the nucleotides in the 5' or 3' portions of the primers to those in AATK-1, a proviral clone derived from a patient with ATL (Seiki et al . . 1983; Inoue et a[., 1986). Asterisks denote the primers that carry additional sequences of the promoter for the T7 RNA polymerase: GGTACCTAATACGACTCACTATAGGGAGA (Stoflet er at., 1988). For sequencing with some sets of primers, one of the primers for PCR that does not carry the additional sequence for T7 RNA polymerase was used as primer for dideoxy sequencing (LTR14 and LTRl5).

COMPARISON OF HTLV-I IN ATL AND HAM

TABLE ILI - NUCLEOTIDE VARIATIONS OBSERVED IN THE LTR u 3 REGION'

493

HAM ATL ATL H-5 AATK-1 & HAM Nucleotide

number 1C 1P 2C 2P 3C 3P 4C 4P 5 6 7 8 9 10 I1 12 13 14 15 16 17

46 49 67

128 (128)

~ 146' 209 210 219 230 245 247

'306' 316

(357) (357)

'Only nucleotides that differed from those in AATK-1 are shown in this Table. The nucleotides and their locations in clone AATK-I, an HTLV-I proviral clone derived from a patient with ATL, are shown for reference. Nucleotide insertions are indicated by parenthesis of the nucleotide number just before the location of the insertion. Nucleotide deletions are indicated as dashes and identical nucleotides to those in AATK-1 are shown as dots.

ATL. The other possibility is that some minor variation be- tween the viruses in ATL and HAM is responsible for the development of the 2 distinct diseases. Consistent with the idea of a relationship between nucleotide sequence variations of retroviruses and their pathogenicity, there are reports of change in the cell tropism of murine leukemia virus by minor changes

of nucleotides in the LTR (Lenz et af., 1984), and of change of the virus from a leukemic to a neuropathic form by alteration of the nucleotide sequence in the env region (Rassart et al., 1986). Moreover we have found differences in the nucleotide sequences of molecularly cloned proviruses derived from cases of HAM and ATL (Tsujimoto et al., 1988).

TABLE IV - NUCLEOTIDE VANATIONS OBSERVED IN THE ENV REGION'

HAM ATL ATL H-5 AATK-1 & HAM Nucleotide

number 1C 1P 2C 2P 3C 3P 4C 4P 5 6 7 8 9 10 11 12 13 14 15 16 17

5204 5232* 5235* 5300 5315 5334* 5344* 5446* 5450 5456 5498 5588 5591* 5610* 6381* 6388* 6389 6395 6398 6411* 6425 6437 6455 6472* 6509 6530 6536 6548 6580* 6584 6629* 6642*

~ ~ ~~

'Only variations of nucleotides observed in this study are indicated in this table. The nucleotides and their locations in the XATK- 1 clone are shown for reference. Nucleotides that were identical to those in AATK-I are indicated by dots. Nucleotide numbers with an asterisk show nucleotide variations causing a change in a deduced amino acid.

494 KINOSHITA ET AL.

REFERENCES

Note added in proof:

To clarify the significance of these sequence differences, we examined the nucleotide sequences of a number of proviruses derived from patients with HAM or ATL. In the regions se- quenced, that is, parts of the LTR and env regions, 50 nucle- otide variations were observed within about 1,000 base pairs sequenced in this study. None of 21 HTLV-I proviruses ana- lyzed in this study had exactly the same sequence. These re- sults indicate minor variations in HTLV-I in these patients. Moreover, none of these variations was found to be specifically correlated with HAM or ATL, indicating that in the regions sequenced the proviruses in cases of HAM and ATL are indis- tinguishable.

Previous studies showed only 1 nucleotide difference be- tween clone H5 and XATK-I in the pX region that caused alterations in the deduced amino acids in both ~ 4 0 ' ~ and p 2 F x . This alteration was located at nucleotide number 7259 in XATK- 1, the nucleotide being C in H-5 and G in XATK- 1, and the deduced amino acids in p40fa and respectively, being arginine and phenylalanine for H-5, and glycine and leucine for XATK-1. Nucleotide sequence analysis of the re- gion surrounding this mutated nucleotide in other samples showed that the mutated nucleotide was C in only 3 samples from patients with HAM (Table I , lC, 2C and 2P), A and G in MT-2 cells, and G in other samples from patients with HAM and in those with ATL (data not shown). Thus this nucleotide mutation observed in H-5 is not commonly observed in provi- ruses from patients with HAM, suggesting that it is not etio- logically related with either of the 2 diseases.

Since the nucleotide sequence differences between H5 and XATK-1 were clustered in the regions sequenced in this study, and since these regions are known to be essential for regulation of viral gene expression and determination of host cell speci- ficity of viral infection, our results suggest that the viruses in HAM and ATL are indistinguishable in function. Thus our results imply that some factor(s) other than the virus is respon- sible for determining whether HAM or ATL develops in asymptomatic HTLV-I carriers.

The nucleotide sequences of the proviruses in 4 pairs of cell

lines established from the PB and CNS, respectively, of 4 patients with HAM were all different. Mutation during in vitro cultivation cannot be ruled out, but this finding suggests that some patients with HAM have multiple clones of provirus and that even the proviruses in the PB and CSF of a single patient may differ in nucleotide sequence.

Although our results suggest that some other factor(s) be- sides the virus is involved in determining the development of HAM or ATL, they do not exclude the possibility that some minor viral clones present in these patients play some crucial roles in determining which of these diseases develops by such a way of changing cell tropism. For clarification of the mech- anisms of development of ATL and HAM in asymptomatic HTLV-I carriers, further investigations should be directed to these points. For example, studies should be made on minor viral clones in vivo and on possible host and environmental factors related to these diseases.

ACKNOWLEDGEMENTS

We thank Dr. T. Sugimura, the National Cancer Center, for continuous encouragement, Dr. T. Okamoto, the National Cancer Center, for helpful discussion, Drs. I. Miyoshi, S. Hirose and J. Imamura, Kochi Medical School, Dr. Y. Ka- gami, Nagoya University School of Medicine, Dr. N. Yoshi- hara, National Institute of Health, Dr. Y . Ohta, University of Tokyo, Dr. K. Kinoshita, National Nagasaki Central Hospital and Dr. K. Tobinai, the National Cancer Center, for gifts of various materials. This work was supported in part by a Grant- in-Aid for Cancer Research for a Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan.

After submission of this report, Daenke et al. ( J . Virol., 64, 1278-1282, 1990) also reported that the sequence variants of HTLV-I from patients with tropical spastic paraparesis and adult T-cell leukemia did not distinguish neurological from leukemic isolates.

GESSAIN, A, , SAAL, F., MOROZOV, V. , LASNERET, J. , VILETTE, D., GOUT, O., EMANOIL-RAVIER, R. , SIGAUX, F. , DE T H ~ , G. and PERIES, J. , Characterization of HTLV-I isolates and T lymphoid cell lines derived from French West Indian patients with tropical spastic paraparesis. Int. J. Cancer, 43, 327-333 (1989). HINUMA, Y., NAGATA, K., MISOKA, M. , NAKAI, M., MATSUMOTO, T., KINOSHITA, K., SHIRAKAWA, S. and MIYOSHI, I., Adult T-cell leukemia: antigen in an ATL cell line and detection of antibodies to the antigen in human sera, Proc. nut. Acad. Sci. (Wash.), 78, 6476-6480 (1981).

HIROSE, S., UEMURA, Y., FUJISHITA, M., KITAGAWA, T. , YAMASHITA, M., IMAMURA, J. , OHTSUKI, Y., TAGUCHI, H. and MIYOSHI, I., Isolation of HTLV-I from cerebrospinal fluid of a patient with myelopathy. Lancet,

HOSHINO, H., ESUMI, H., MIWA, M., SHIMOYAMA, M., MINATO, K., TOBINAI, K., HIROSE, M., WATANABE, S. , INADA, N., KINOSHITA, K., KAMIHIRA, S., ICHIMARU, M. and SUGIMURA, T. , Establishment and char- acterization of 10 cell lines derived from patients with adult T-cell leuke- mia. Proc. nat. Acad. Sci. (Wash.), 80, 6061-6065 (1983). IMAMURA, J., TSUJIMOTO, A., OHTA, Y., HIROSE, S., SHIMOTOHNO, K., MIWA, M. and MIYOSHI, I., DNA blotting analysis of human retrovirus in cerebrospinal fluid of spastic paraparesis patients: the viruses are identical to human T-cell leukemia virus type I (HTLV-I). Int. J . Cancer, 42,

INOUE, J., WATANABE, T., SATO, M., ODA, A , , TOYOSHIMA, K., YOSHIDA, M. and SEIKI, M., Nucleotide sequence of the protease-coding region in an infectious DNA of simian retrovirus (STLV) of the HTLV-I family. Virology, 150, 187-195 (1986).

KAGAMI, Y., KINOSHITA, T., SHIMOYAMA, M. and MIWA, M., Soluble

11, 397-398 (1986).

221-224 (1988).

factor(s) secreted by a human skin-cancer cell line suppoerts clonal growth of adult T-cell leukemia cells. Jpn. J. Cancer Res., 79, 424427 (1988). KINOSHITA, T., SHIMOYAMA, M., TOBINAI, K., ITO, M., ITO, S., IKEDA, S., TAJIMA, K. , SHIMOTOHNO, K. and SUGIMURA, T., Detection of mRNA for the tax,/rex, gene of human T-cell leukemia virus type I in fresh peripheral blood mononuclear cells of adult T-cell leukemia patients and viral carriers by using the polymerase chain reaction. Proc. nat. Acad. Sci. (Wash.), 86, 562S5624 (1989). LENZ, J., CELANDER, D., CROWTHER, R.L., PATARCA, R., PERKINS, D.W. and HASELTINE, W.A., Determination of the leukaemogenicity of a murine retrovirus by sequences within the long terminal repeat. Nature (Lond.), 308, 467-470 (1984). MAXAM, A.M. and GILBERT, W., Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol., 65,49%560 (1980). MIYOSHI, I., KUBONISHI, I., YOSHIMOTO, S., AKAGI, T . , OHTSUKI, Y., SHIRAISHI, Y., NAGATA, K. and HINUMA, Y., Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukaemic T cells. Nature (Lond.), 294, 77C771 (1981). MIYOSHI, I., TAGUCHI, H., KUBONISHI, I., YOSHIMOTO, S., OHTSUKI, Y., SHIRAISHI, Y. and AKAGI, T., Type-C-virus-producing cell lines derived from adult T-cell leukemia. Gann Monogr., 28, 219-228 (1982). OSAME, M., MATSUMOTO, M., USUKU, K., IZUMO, S., IJICHI, N., AMI- TANI, H., TARA, M. and IGARA, A., Chronic progressive myelopathy associated with elevated antibodies to human T-lymphotropic virus type I and adult T-cell leukemialike cells. Ann. Neurol., 21, 117-122 (1987). POFQVIC, M., SARIN, P.S., KALYANARAMAN, V.S., MANN, D., MINOW- ADA, J. and GALLO, R.C., Isolation and transmission of human retrovirus (human T-cell leukemia virus). Science, 219, 856-859 (1983).

COMPARISON OF HTLV-I IN ATL AND HAM 495

RASSART, E., NELBACH, L. and JOLICOEUR, P., Cas-Br-E murine leukemia virus: sequencing of the paralytogenic region of its genome and derivation of specific probes to study its origin and the structure of its recombinant genomes in leukemic tissues. J. Virol., 60, 91C919 (1986). SAIKI, R.K., GELFAND, D.H., STOFFEL, S., SCHARF, S.J., HIGUCHI, R., HORN, G.T., MULLIS, K.B. and ERLICH, H.A., Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487-491 (1988). SEIKI, M., HATTORI, S., HIRAYAMA, Y. and YOSHIDA, M., Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus ge- nome integrated in leukemia cell DNA. Proc. nat. Acad. Sci. (Wash.), 80, 361&3622 (1983). STOFLET, E.S., KOEBERL, D.D., SARKAR, G . and SOMMER, S.S., Geno- mic amplification with transcript sequencing. Science, 239, 491-494 (1988). TAGUCHI, H., HIROSE, S., IMAMURA, J., FUJISHITA, M., MIYOSHI, I. and OHTSUKI, Y. , Isolation of HTLV-I from 2 patients with HTLV- I-associated myelopathy (HAM). Acta Haematol. Jap., 50, 316 (1987).

YOSHI, I. and MIWA, M., Nucleotide sequence analysis of a provirus TSUJIMOTO, A,, TERUUCHI, T., IMAMURA, J., SHIMOTOHNO, K., MI-

derived from HTLV-I-associated myelopathy (HAM). Mol. Biol. Med., 5 , 29-428 (1988). UCHIYAMA, T., YOWI, J., SAGAWA, K., TAKATSUKI, K. and UCHINO, H., Adult T-cell leukemia: clinical and hematological features of 16 cases. Blood, 50, 4814921 (1977). USUKU, K., SONODA, S., OSAME, M., YASHIKI, S., TAKAHASHI, K., MATSUMOTO, M., SAWADA, T., TSUJI, K., TARA, M. and IGATA, A., HLA haplotype-linked high immune responsiveness against HTLV-I in HTLV-I-associated myelopathy: comparison with adult T-cell leukemia/ lymphoma. Ann. Neurol., 23 (Suppl.), 143-150 (1988). YOSHIDA, M., MIYOSHI, I. and HINUMA, U.Y., Isolation and character- ization of retrovirus from cell lines of human ATL and its implication in the disease. Proc. nar. Acad. Sci. (Wash.), 79, 2031-2035 (1982). YOSHIDA, M., OSAME, M., USUKU, K., MATSUMOTO, M. and ICATA, A., Viruses detected in HTLV-I-associated myelopathy and adult T-cell leu- kemia are identical on DNA blotting. Lancet, I, 1085-1086 (1987). YOSHIDA, M., SEIKI, M., YAMACUCHI, K. and TAKATSUKI, K., Mono- clonal integration of human T-cell leukemia provirus in all primary tumors of adult T-cell leukemia suggests causative role of human T-cell leukemia virus in the disease. Proc. nat. Acad. Sci. (Wash.), 81,2534-2537 (1984).