APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2002, p. 4559–4566 Vol. 68, No. 90099-2240/02/$04.00�0 DOI: 10.1128/AEM.68.9.4559–4566.2002Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Rickettsia monacensis sp. nov., a Spotted Fever Group Rickettsia, fromTicks (Ixodes ricinus) Collected in a European City Park

Jason A. Simser,1† Ann T. Palmer,1 Volker Fingerle,2 Bettina Wilske,2 Timothy J. Kurtti,1*and Ulrike G. Munderloh1

Department of Entomology, University of Minnesota, St. Paul, Minnesota 55108,1 and Max von Pettenkofer-Institut furHygiene und Medizinische Mikrobiologie, Ludwig-Maximilians-Universitat Munchen, Munich, Germany2

Received 8 February 2002/Accepted 14 June 2002

We describe the isolation and characterization of Rickettsia monacensis sp. nov. (type strain, IrR/MunichT)from an Ixodes ricinus tick collected in a city park, the English Garden in Munich, Germany. Rickettsiae werepropagated in vitro with Ixodes scapularis cell line ISE6. BLAST analysis of the 16S rRNA, the citrate synthase,and the partial 190-kDa rickettsial outer membrane protein A (rOmpA) gene sequences demonstrated that theisolate was a spotted fever group (SFG) rickettsia closely related to several yet-to-be-cultivated rickettsiaeassociated with I. ricinus. Phylogenetic analysis of partial rompA sequences demonstrated that the isolate wasgenotypically different from other validated species of SFG rickettsiae. R. monacensis also replicated in celllines derived from the ticks I. ricinus (IRE11) and Dermacentor andersoni (DAE100) and in the mammalian celllines L-929 and Vero, causing cell lysis. Transmission electron microscopy of infected ISE6 and Vero cellsshowed rickettsiae within the cytoplasm, pseudopodia, nuclei, and vacuoles. Hamsters inoculated with R.monacensis had immunoglobulin G antibody titers as high as 1:16,384, as determined by indirect immunoflu-orescence assay. Western blot analyses demonstrated that the hamster sera cross-reacted with peptides fromother phylogenetically distinct rickettsiae, including rOmpA. R. monacensis induced actin tails in both tick andmammalian cells similar to those reported for R. rickettsii. R. monacensis joins a growing list of SFG rickettsiaethat colonize ticks but whose infectivity and pathogenicity for vertebrates are unknown.

Rickettsiae are arthropod-associated gram-negative prokary-otes that reside within the cytoplasm and sometimes nuclei ofeukaryotic host cells (17). They are subdivided into the typhusor spotted fever group (SFG) on the basis of genotypic andphenotypic analyses (39). This is supported by sequence analy-ses of genes for 16S rRNA (42, 45, 49), the genus-common17-kDa antigen (3, 58), citrate synthase (gltA) (45), and rick-ettsial outer membrane proteins A (rOmpA) (15, 57) and B(rOmpB) (43). rompA sequences have been found to be mostuseful for species differentiation within the SFG (15, 40, 41).

Several yet-to-be-cultivated SFG rickettsiae have been de-tected by the hemolymph test or PCR in Ixodes ricinus ticksfrom Switzerland (5), Spain (25), and Slovakia (45). For ex-ample, the Cadiz agent was detected in I. ricinus adults col-lected in southwestern Spain (25) and IRS3 and IRS4 weresubsequently identified in I. ricinus ticks collected in two dif-ferent regions of Slovakia (45). Sequence comparisons of 16SrRNA gene, gltA, and rompA sequences suggested that theserickettsiae represented new genotypes within the SFG (25, 45).These rickettsiae were distinct from Rickettsia helvetica, whichwas recently implicated in chronic perimyocarditis in humans(32), and Rickettsia slovaca, both of which are commonly as-sociated with and isolated from I. ricinus (5, 8, 30, 31, 36, 46).

In this report, we describe the cultivation, actin-based mo-tility, and partial molecular and immunologic characterization

of an SFG rickettsia from a female I. ricinus tick collected in aEuropean city park, the English Garden in Munich, Germany.The type strain organism, designated IrR/MunichT, was iso-lated by inoculation of tick tissues onto an Ixodes scapularis cellline, ISE6. We determined this rickettsia to be distinct from allother currently recognized rickettsial species and closely re-lated to the yet-to-be-isolated Cadiz agent, IRS3, and IRS4.Thus, we propose that this novel rickettsia be formally namedRickettsia monacensis after its geographic origin.

MATERIALS AND METHODS

Tick collection. Adult I. ricinus ticks were collected in May 1998 in the EnglishGarden, a recreational park in Munich, Germany, by dragging a white flannelcloth along grassy areas in the northeastern section of the park. Ticks weremaintained in glass vials within desiccator jars humidified with a saturated solu-tion of Na2SO4 and in a photoperiod of 16 h of light (22°C) and 8 h of darkness(18°C).

Dissection and cultivation of I. ricinus tissues. Internal tissues were dissectedfrom 12 partially engorged females for the detection and isolation of micro-organisms. Individual females were surface disinfected (23), and their salivaryglands, Malpighian tubules, ovaries, and midgut tissues were aseptically re-moved. DNA was extracted from half of the salivary glands and midgut tissuesfor PCR and restriction fragment length polymorphism (RFLP) analyses (seebelow). The remaining organs were individually placed into wells of a 24-wellplate (Becton Dickinson & Company, Franklin Lakes, N.J.) containing cells ofthe I. scapularis line ISE6 (for I. scapularis embryos from tick 6) (28). Themedium was L15B300 with NaHCO3 (0.25%) and HEPES (25 mM) (27). Plateswere incubated in a humidified candle jar at 34°C (29) for 5 days. The candle jarscreated an atmosphere containing lower oxygen and higher carbon dioxide levels,conditions conducive to the isolation of ehrlichiae from ticks (27, 29). Culturesfrom the same tick that remained uncontaminated were then pooled in 5 ml offresh medium, transferred to 25-cm2 vented-cap flasks (Sarstedt, Newton, N.C.),and further incubated in a candle jar as described above. Culture medium wasreplaced weekly, and subsequent passages of infected cells and rickettsiae weremade directly into 25-cm2 sealed-cap flasks (Sarstedt), removing the need forcandle jars.

* Corresponding author. Mailing address: Department of Entomol-ogy, University of Minnesota, 1980 Folwell Ave., St. Paul, MN 55108.Phone: (612) 624-3688. Fax: (612) 625-5299. E-mail: kurtt001@tc.umn.edu.

† Present address: Department of Microbiology, University of Mary-land, Baltimore, MD 21201.

4559

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Rickettsial strains and animal cell lines. R. monacensis IrR/MunichT multi-plied in both tick and mammalian cell lines maintained in L15B300 (27). Thetype strain of R. monacensis, IrR/MunichT, has been deposited at the Amer-ican Type Culture Collection (Manassas, Va.) and the WHO CollaboratingCenter for Tropical Diseases, Department of Pathology, University of TexasMedical Branch, Galveston. Cell lines from I. ricinus (IRE11; embryonic cellline) (U. G. Munderloh, unpublished data) and D. andersoni (DAE100;embryonic cell line) (48) ticks were also used. Line DAE100 was clearedof a chronic Rickettsia peacockii infection by incubation at 37°C for a month.We also used the mouse L-929 (ATCC CCL-1) and African green monkeykidney Vero (ATCC CCL-81) cell lines to grow R. monacensis. For transferof R. monacensis between different cell lines, a host cell-free, semipurifiedrickettsial suspension was prepared from a confluent 25-cm2 culture. Cellswere ruptured by repeated passage through a 27-gauge needle to release therickettsiae. Large debris was removed by low-speed centrifugation (275 � gfor 10 min), the supernatant was filtered through a 5.0-�m-pore-size syringefilter, and rickettsiae were inoculated into the heterologous target culture.R. helvetica C9P9 (6) was provided by Lorenza Beati (Department of Epide-miology and Public Health, Yale University School of Medicine) and main-tained in IRE11 cells. R. peacockii DaE100R (48) was maintained in D.andersoni embryonic cell line DAE100, from which it originated. Rickettsiarickettsii Hlp#2 (35) (provided by Robert Heinzen, Rocky Mountain Labo-ratories, National Institutes of Health) and Rickettsia strain MOAa (26) wereboth maintained in I. scapularis cell line IDE2, which had previously beenisolated from embryos of an “Ixodes dammini ” (� I. scapularis) female (28).

Microscopy. Cultures were observed weekly by phase-contrast microscopy toassess culture confluency, cytopathic effect, and the presence and relative abun-dance of rickettsiae. Cultures were periodically sampled, and cells were stainedwith Giemsa stain to determine percent infection.

R. monacensis bacteria passaged 4 and 16 times in ISE6 and Vero cells,respectively, were prepared for transmission electron microscopy (26) to assessthe ultrastructure and intracellular location of microorganisms.

DNA extraction and preparation. DNA was extracted from infected cell cul-tures and the salivary glands and guts of each tick with the Puregene DNAisolation kit (Gentra Systems, Minneapolis, Minn.). Following alcohol precipi-tation, DNA was dissolved in 50 �l of water and stored at �70°C. DNA wasextracted from IrR/MunichT at passages 1, 2, 8, and 36 in ISE6 cells and fromR. helvetica at passage 2 in IRE11 cells (21, 57).

PCR amplification. Rickettsia-specific primer sets (Table 1) were used foramplification and preliminary identification of rickettsial DNA in tick tissues andcell cultures. The PCR amplification conditions were as specified in the literature(Table 1), with a RoboCycler thermocycler (Stratagene, La Jolla, Calif.) and50-�l reaction mixtures with 5 �l of template DNA or water (negative control).Amplification products were visualized by electrophoresis through 1.5% agarosegels stained with ethidium bromide.

DNA sequencing. R. monacensis 16S rRNA, citrate synthase (gltA) andrompA gene PCR products, corresponding to the fD1-Rc16S.452n, RpCS.877p-RpCS.1258n, and Rr190.70p-Rr190.602n primer pairs, respectively, were se-quenced (48). Template DNA was prepared with passage 2 of IrR/MunichT inISE6 cells. Three clones of each partial gene PCR product were sequencedin both directions with an ABI 377 automated sequencer (Advanced GeneticAnalysis Center, University of Minnesota). Sequences were aligned with theCLUSTAL W multiple-sequence alignment program (52) to find the consensusnucleotide sequence, and similarity to other rickettsial organisms was deter-mined by running BLAST analyses (1).

RFLP. We used RFLP analyses to characterize the 16S rRNA and gltA geneamplification products (Table 1) obtained from cultured IrR/MunichT (passages1, 2, 8, and 36) to assess the homogeneity of the culture isolate. We comparedthese to products amplified from I. ricinus tick no. 5 (salivary glands and guttissues) and R. helvetica. RsaI (Life Technologies) and BstXI (Takara Biotech-nology, Shiga, Japan) were used to digest the 16S rRNA gene PCR products,while AluI and Sau3AI (Promega, Madison, Wis.) were used to digest the gltAPCR products. Diagnostic cutting sites for these enzymes were selected with theaid of the restriction mapping software Webcutter 2.0 (M. Heiman; http://www.firstmarket.com/firstmarket/cutter/cut2.html). PCR products (10-�l aliquots)were digested with 10 U of endonuclease for 4 h at 37°C for RsaI, AluI, andSau3AI and 45°C for BstXI. Digested DNA was resolved by electrophoresisthrough an 8% polyacrylamide gel, stained with ethidium bromide, and visual-ized by UV illumination.

Phylogenetic analysis. Partial rompA sequences of validated SFG rickettsialspecies (11; http://www.bacterio.cict.fr/) in the GenBank database were used tophylogenetically place R. monacensis (IrR/MunichT) among these species. Se-quences corresponding to R. rickettsii rompA positions 92 to 581 (40) weremanually aligned with conserved nucleotides as reference points. A dendrogramwas constructed by the neighbor-joining method (44); PAUP�, version 4.0b8(PPC) (50); and Kimura’s two-parameter option (22) to determine distances.Bootstrap analysis was used with 1,000 replicates to test the relative support forthe branches produced by the neighbor-joining analysis (12). Trees were rootedwith Rickettsia australis PHS on the basis of phylogenetic studies of the 16SrRNA (42, 45, 49), citrate synthase (45), rompB (43), and 23S rRNA genes, aswell as sequences of the fmt-to-rrl spacer region (4).

Production of R. monacensis antisera. Male Syrian hamsters (Mesocricetusauratus; 2 months old) were injected intraperitoneally with 106 IRE11 (threehamsters, passage 25) or Vero (three hamsters, passage 23) cells infected withR. monacensis. The cells were previously cultured at 34°C, and �95% wereinfected. Serum from an age-matched, uninfected hamster served as a control.Blood was collected 6 weeks later by cardiac puncture from hamsters killed byexposure to CO2. Animals were maintained and handled in accordance with allof the guidelines established by the National Institutes of Health and the Uni-versity of Minnesota Animal Care and Use Committee. Titers of immunoglob-ulin G to different SFG rickettsial species were determined by indirect im-munofluorescence assay (IFA) with 18-ring antigen slides (Erie Scientific,Portsmouth, N.H.). ISE6 cells infected with R. monacensis, R. helvetica, R. pea-cockii, R. rickettsii, or Rickettsia strain MOAa were suspended in culture medium,and aliquots were pipetted into individual rings. Slides were ambient air driedovernight, and cells were fixed and permeabilized in methanol for 4 min. Serialtwofold dilutions of test and control hamster sera were applied to duplicate wellsof IFA slides containing rickettsial antigen as described above and incubated for1 h at 37°C. Bound antibodies were labeled with fluorescein isothiocyanate(FITC)-conjugated anti-hamster IgG (heavy and light chains; Pierce, Rockford,Ill.) for 1 h at 37°C. Slides were counterstained for 4 min in 0.005% Evans blue,mounted in Vectashield antifade solution (Vector Laboratories, Burlingame,Calif.), and examined with a Nikon E400 Eclipse microscope fitted for epifluo-rescence illumination.

Demonstration of actin tails. Polymerized (F-)actin associated with R. mona-censis in tick and mammalian cells was visualized as previously described (20, 26).D. andersoni DAE100 and mouse L-929 cells were seeded onto glass coverslipsin 24-well plates at a concentration of 5 � 105 cells/well in 1 ml of medium.R. monacensis bacteria were liberated from a 25-cm2 culture, partially purified as

TABLE 1. PCR primer sets used in this study

Primer set Gene Nucleotide sequence (5�-3�) Size (bp) Reference(s)

fD1-Rc16S.452n 16SrRNA AGAGTTTGATCCTGGCTCAG 416 25, 56AACGTCATTATCTTCCTTGC

RpCS.877p-RpCS.1258n gltA GGGGGCCTGCTCACGGCGG 381 40ATTGCAAAAAGTACAGTGAACA

Rr17 17-kDa antigen GCTCTTGCAACTTCTATGTT 434 58CATTGTTCGTCAGGTTGGCG

Rr190.70p-Rr190.602n rompA ATGGCGAATATTTCTCCAAAA 532 40AGTGCAGCATTCGCTCCCCCT

4560 SIMSER ET AL. APPL. ENVIRON. MICROBIOL.

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

specified above, and diluted in medium, and 0.1-ml aliquots of 102-, 103-, and104-fold dilutions were added to wells.

We used dual fluorescence staining to visualize rickettsiae and their associatedF-actin structures. Rickettsiae were reacted with hamster anti-R. monacensisserum at a dilution of 1:4,096 in phosphate-buffered saline with 3% bovine serumalbumin and labeled with goat anti-hamster IgG (heavy and light chains) conju-gated with FITC (Pierce) for visualization of the labeled rickettsiae. Texas redphalloidin (Molecular Probes, Eugene, Oreg.) at a dilution of 1:20 in phosphate-buffered saline with 3% bovine serum albumin was added together with thesecondary antibody to stain F-actin. Coverslips were mounted onto microscopeslides with a drop of Vectashield and examined by fluorescence microscopy witha Nikon E800 microscope fitted with a CoolCam 2000 video camera (ImagingCenter, University of Minnesota). Digital images of sequential horizontal focalplanes of infected cells were captured and then merged with ImagePro Plussoftware (Media Cybernetics, Des Moines, Iowa).

Western blot analyses. We compared antigens of R. monacensis to those fromR. helvetica, Rickettsia strain MOAa, and R. rickettsii by using high-titer (1:16,382)anti-R. monacensis sera from two hamsters inoculated with R. monacensis grownin Vero cells at 34°C (see above). Semipurified rickettsiae were prepared fromIRE11 or IDE2 cultures as already described. Rickettsiae were further purifiedby centrifugation (20,000 � g for 40 min at 4°C) through 30% diatrizoate(Hypaque 76; Nycomed Inc., Princeton, N.J.), washed in Hanks’ balanced saltsolution, and resuspended in 0.5 M Tris-HCl, pH 6.8. Approximate proteinconcentrations were determined by UV spectrophotometry. Proteins were de-natured, diluted, separated (65 �g/well) by sodium dodecyl sulfate-polyacrylam-ide gel electrophoresis (24) through 8 to 16% gradient minigels (ISC BioExpress,Kaysville, Utah), and blotted onto polyvinylidene difluoride membrane (Immo-bilon-P; Millipore Corporation, Bedford, Mass.) (34). Duplicate gels stained withCoomassie blue and blots developed with polyclonal hamster anti-R. monacensissera (diluted 1:300) were compared with blots reacted with murine monoclonalantibody (MAb) 13-5 (2) (diluted 1:500; provided by T. Hackstadt, Rocky Moun-tain Laboratories, National Institutes of Health) to identify rOmpA. Peroxidase-labeled goat anti-mouse IgG (diluted 1:1000; Kirkegaard & Perry Laboratories)was used to detect the MAb, and peroxidase-labeled goat anti-hamster IgG(heavy and light chains; diluted 1:1,000; Kirkegaard & Perry Laboratories) tovisualize antigens on blots reacted with polyclonal sera. Blots were developedwith the 4CN Membrane Peroxidase Substrate System (Kirkegaard & PerryLaboratories).

Nucleotide sequence accession numbers. The nucleotide sequences of the 16SrRNA, citrate synthase, and rompA gene PCR products of IrR/MunichT havebeen deposited in the GenBank database and assigned accession numbersAY048818, AY048817, and AF201329, respectively.

RESULTS

Isolation and in vitro maintenance of IrR/MunichT. Themidgut and Malpighian tubules from 1 of the 12 partiallyengorged I. ricinus ticks (no. 2) yielded a rickettsial isolate inISE6 cultures that was subsequently designated IrR/MunichT.Electron microscopy and DNA sequence data (see below) con-firmed the rickettsial identity of the bacteria. Intra- and extra-cellular coccobacillary microorganisms were first observed byphase-contrast microscopy 26 days after initiation of culturesand were also observed in Giemsa-stained cell spreads. Wemaintained the isolate for the first three transfers simply bypassage of infected cultures (diluted 1:10). The rickettsiae be-came cytopathic for ISE6 cells after the third passage (5months), causing cell lysis. Subsequent transfers of IrR/Mu-nichT were accomplished by transferring 0.05 to 0.1 ml of aninfected cell suspension to an uninfected, confluent (approxi-mately 5 � 106 cells/ml), 25-cm2, 5-ml culture once every 7 to10 days. Numerous extracellular rickettsiae were observed atthe later stages (7 days and later) of infection, when more than80% of the cells were infected and necrotic foci were apparentin the cell layer. Once stable in ISE6 cells, R. monacensis couldbe successfully transferred to other tick and mammalian celllines.

Isolate IrR/MunichT replicated in both tick (ISE6, IRE11,and DAE100) and mammalian (L-929 and Vero) cell lines.Growth in L-929 and Vero cells was much slower than in tickcells, even though the incubation temperature for all was 34°C.In mammalian cells, passages were therefore made with 0.5 to1 ml of an infected cell suspension. IrR/MunichT grew fastestin IRE11, and an inoculum of 0.5% caused complete host celllysis in 1 week. Growth and cytopathogenicity of IrR/MunichT

were retarded in cultures (DAE100 and Vero cells) main-tained at 37°C, which required monthly, or longer, transferintervals.

Ultrastructure of IrR/MunichT. We examined the ultra-structure of IrR/MunichT in ISE6 (Fig. 1A) and Vero (Fig. 1B)cells. In both, the bacteria had the ultrastructural features ofrickettsiae and were observed free in the cytoplasm (Fig. 1Aand B, arrows) and pseudopodia (Fig. 1D, arrow) and occa-sionally within nuclei (Fig. 1C, arrowheads) or vacuoles (Fig.1A, arrowhead). Extracellular rickettsiae were associated withcoated pits at the cell surface. The coccobacillary rickettsiaewere approximately 1.0 to 1.5 by 0.3 to 0.4 �m and weredelineated by an inner periplasmic membrane (Fig. 1E, arrow-head), a periplasmic space, and a trilaminar cell wall (Fig. 1E,arrow) of varying thickness and a faint microcapsular layer(Fig. 1E, insert, arrowheads). An electron-translucent zone orslime layer surrounded the cell wall and separated the bacte-rium from the cytoplasm of the host cell, a feature of SFGrickettsiae (18, 20). However, the IrR/MunichT slime layer wasthin (�30 nm) in comparison with that of R. rickettsii (30 to 60nm) (47, 53). There was no difference in the overall ultrastruc-ture of IrR/MunichT in tick or mammalian cells maintained at34°C.

Molecular analyses of IrR/MunichT (i) PCR and RFLPanalysis. Our results demonstrated that IrR/MunichT isan SFG rickettsia. Primer sets for the 16S rRNA (fD1-Rc16S.452n), citrate synthase (RpCS.877p-RpCS.1258n), and17-kDa Rickettsia-common antigen (Rr17) genes gave PCRproducts of approximately 440, 380, and 435 bp, respectively,as expected for rickettsiae, and indistinguishable from corre-sponding PCR products for R. helvetica. These primers alsoyielded PCR products of the same sizes from another tick (no.5) that was culture negative. Thus, 2 of the 12 I. ricinus ticksappeared to have been infected with an SFG rickettsia. TherompA primer set (Rr190.70p-Rr190.602n) gave PCR productsof the expected size (approximately 532 bp) for cultured IrR/MunichT and the second tick but failed to amplify productsfrom R. helvetica, as previously reported (6, 15, 36, 41).

RFLP analysis of 16S rRNA and citrate synthase (gltA) genePCR products demonstrated that the two ticks were infectedwith the same rickettsia, which had a genotype unlike that ofR. helvetica (Fig. 2). The restriction patterns of the 16S rRNAgene PCR products of IrR/MunichT and tick no. 5 digestedwith RsaI (132 and 304 bp) and BstXI (uncut) were identical.These profiles were as expected from sequence data (see be-low) and distinct from those obtained with R. helvetica (RsaIuncut, and BstXI cut, 132 and 304 bp). The RFLP patternsobtained from citrate synthase DNA of IrR/MunichT digestedwith AluI (43, 81, 87, and 165 bp; the predicted 6-bp fragmentwas not observed) and Sau3AI (107 and 275 bp) were also aspredicted and identical to those from tick no. 5. They differedfrom the R. helvetica patterns (AluI, 43, 43, 81, 87, and 122 bp

VOL. 68, 2002 RICKETTSIA MONACENSIS SP. NOV. FROM IXODES RICINUS 4561

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

[the predicted 6-bp fragment was not observed]; Sau3AI, 48,107, and 227 bp). In addition, the restriction profiles obtainedfrom IrR/MunichT subcultured 1, 2, 8, or 36 times did notdiffer, an indication of the purity of the isolate.

(ii) BLAST and phylogenetic analyses. To identify the SFGrickettsia infecting the I. ricinus females, we cloned and se-quenced PCR products generated from the 16S rRNA, citratesynthase, and rompA genes. BLAST analyses demonstrated ahigh level of sequence similarity of IrR/MunichT to three otherrickettsiae detected in I. ricinus ticks, the Cadiz agent, IRS3,and IRS4. The 16S rRNA gene sequences of IrR/MunichT, theCadiz agent, IRS3, and IRS4 were identical (GenBank acces-

sion numbers Y08783, AF141907, and AF141908, respective-ly). Partial gltA sequences from IrR/MunichT and IRS4 werethe same but differed from that of IRS3 by 1 nucleotide andfrom that of the Cadiz agent by 13 nucleotides (GenBankaccession numbers AF141906, AF140706, and Y08784, respec-tively). The partial rompA sequence was more similar to that ofIRS4, with 2 nucleotide differences, than to that of eitherIRS3 or the Cadiz agent, from which it had 6 and 10 nucle-otide differences, respectively (GenBank accession numbersAF141911, AF141909, and Y08785, respectively).

A neighbor-joining analysis based on partial rompA se-quences demonstrated the unique genotype of IrR/MunichT

FIG. 1. Transmission electron photomicrographs of R. monacensis IrR/MunichT within cultured tick and mammalian cells. (A) InfectedI. scapularis (ISE6) cell with rickettsiae in the cytoplasm (arrow), as well as being digested in vacuoles (arrowhead). Bar � 2 �m. N, host cellnucleus. (B) Vero cell filled with cytoplasmic rickettsiae (arrows). N, host cell nucleus. Bar � 2 �m. (C) R. monacensis within the nucleus (N,arrowheads) and cytoplasm (arrow) of an ISE6 cell. Bar � 0.5 �m. (D) Rickettsia (arrow) within a pseudopodial extension of an ISE6 cell. Bar �0.5 �m. (E) High magnification of R. monacensis showing the typical rickettsial morphology of the organism. Bar � 0.2 �m. Shown are the innerperiplasmic membrane (white arrowhead), the electron-lucent periplasmic space, and the cell wall (arrow). The insert shows an enlargement ofthe outer membrane. Bars delineate the trilaminar cell wall; small arrowheads indicate the faint microcapsular layer.

4562 SIMSER ET AL. APPL. ENVIRON. MICROBIOL.

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

among those of the validated species of the SFG (Fig. 3).Along with R. australis, IrR/MunichT was placed most basalwith respect to the other rickettsiae included in this analysis(98% bootstrap support).

Antibody responses of hamsters inoculated with IrR/Mu-nichT. Five of six hamsters inoculated with IrR/MunichT sero-converted but appeared healthy throughout the course of thestudy. The IgG titer endpoints of four of the sera tested by IFAagainst other SFG rickettsiae are shown in Table 2. The high-est titer was obtained with IrR/MunichT as the antigen, andtiters ranging from 1:64 to 1:512 were obtained with the otherrickettsiae. Thus, IrR/MunichT induced IgG antibodies thatcross-reacted, albeit at lower titers, with phylogenetically dis-tinct SFG rickettsiae.

Western blot assays with polyclonal hamster sera or MAb13-5 to rOmpA of R. rickettsii identified further differencesbetween IrR/MunichT and other SFG rickettsiae. The pooledanti-IrR/MunichT sera from seroconverted hamsters infectedwith Vero cell-grown IrR/MunichT recognized a number ofpeptides from IrR/MunichT (Fig. 4A) and other SFG rickett-siae, apparently including rOmpA. The sera bound a 145-kDa

protein in both IrR/MunichT and R. helvetica and a 190-kDaantigen (arrow) in Rickettsia strain MOAa and R. rickettsii. Inall of the rickettsiae, the anti-IrR/MunichT antisera also rec-ognized bands of approximately 120 kDa (arrowhead) and aseries of low-molecular-mass (�30-kDa) bands. MAb 13-5 didnot react with any proteins of IrR/MunichT (Fig. 4B) but rec-ognized a series of bands in R. helvetica, Rickettsia strainMOAa, and R. rickettsii. The most prominent bands (arrow)were approximately 145 kDa for R. helvetica and 190 kDa forR. rickettsii and Rickettsia strain MOAa.

Actin tail formation of IrR/MunichT in vitro. Simultaneouslabeling of rickettsiae with FITC and of F-actin with Texas redshowed that IrR/MunichT induced actin tails in both tick(DAE100) (Fig. 5A, arrows) and mammalian (L-929) (Fig. 5B,arrows) cells. In both cell types, they were approximately 20�m long. Rickettsiae migrating centrifugally through thinpseudopodia appeared as if tethered to cells by actin tails, andrickettsial clusters found at the poles of host cells were some-times associated with actin bundles (Fig. 5B, arrowheads).

DISCUSSION

A wide geographic distribution throughout Europe (55) anda broad host range that encompasses mammals, birds, andreptiles expose I. ricinus to diverse blood-borne pathogens (37,38). Several different SFG rickettsiae have been detected inI. ricinus. R. helvetica and R. slovaca can be readily isolatedfrom I. ricinus and propagated in mammalian cell cultures (5,46). In addition, other yet-to-be-cultured rickettsiae have beendetected by the hemolymph test and PCR in I. ricinus ticksfrom Switzerland (5), Spain (25), and Slovakia (45). We haveisolated an SFG rickettsia from I. ricinus collected in Munich,Germany, by tick cell culture and partially characterized it withrespect to growth in tick and mammalian cells and antigenexpression and by PCR and nucleotide sequence analysis ofselected diagnostic genes. Our partial gltA and rompA se-quences and serological findings demonstrated this isolate tobe distinct from R. helvetica, R. slovaca, and other previouslyvalidated species of SFG rickettsiae. Accordingly, we proposeto name it R. monacensis sp. nov. and designate IrR/MunichT

the type strain in recognition of its geographic origin.Our analysis of three different genes confirmed the geno-

typic difference between R. monacensis and either R. helveticaor R. slovaca. Most informative was our analysis of R. mona-censis rompA with the primer set Rr190.70p-Rr190.602n. Thisprimer set does not detect the widely distributed species R.helvetica (6, 8, 30–32, 36), indicating that the gene is missing ormodified. R. helvetica is one of the few SFG species in whichthis rOmpA primer set does not mediate amplification ofa PCR product (6), underscoring the need to apply multiplemethods and primers for detection and isolation of pathogensfrom arthropods. Furthermore, the failure to detect any of thepredicted restriction products for R. helvetica and R. slovacaconfirmed their absence in our culture or in the ticks. Ourphylogenetic analysis of partial rompA sequences placed R.monacensis basal with respect to the validated SFG rickettsialspecies included in the analysis, with the exception of R. aus-tralis. BLAST analyses of the 16S rRNA, gltA, and rompA genesequences demonstrated a close relationship of R. monacensiswith the Cadiz agent, IRS3, and IRS4. The PCR-amplified 16S

FIG. 2. RFLP analyses of R. monacensis IrR/MunichT, I. ricinustick no. 5 salivary glands (sg.) and gut tissues, and R. helvetica C9P9PCR products. (A) 16S rRNA gene PCR products from the fD1-Rc16S.452n primer set uncut or digested with restriction endonucleaseRsaI or BstXI. (B) Citrate synthase gene (gltA) sequences correspond-ing to the RpCS.877p-RpCS.1258n primer set, uncut or digested withrestriction endonuclease AluI or Sau3AI. The molecular sizes indi-cated on the left correspond to X174 replicative-form DNA digestedwith HaeIII (Life Technologies).

VOL. 68, 2002 RICKETTSIA MONACENSIS SP. NOV. FROM IXODES RICINUS 4563

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

sequence of IrR/MunichT showed 100% similarity to those ofthe Cadiz agent, ISR3, and ISR4, and the PCR-amplified ci-trate synthase gene sequence of IrR/MunichT showed 100%similarity to that of IRS4 but less to those of IRS3 (99.77%)and the Cadiz agent (97.01%). The partial rompA gene se-quence also indicated that IrR/MunichT is closer to IRS4(99.62% similar) than to IRS3 (98.88% similar) and the Cadizagent (98.12% similar). Nevertheless, further studies and moresequence data are needed to resolve the phylogenetic relation-ship of R. monacensis to the Cadiz agent, IRS3, and IRS4 andto SFG rickettsiae detected in other species of Ixodes ticks (7,33). The isolation of these organisms in tick cell culture sys-tems could facilitate such studies.

Our serologic data provide further evidence that R. mona-censis is a novel SFG rickettsia. MAb 13-5 against rOmpA of R.rickettsii cross-reacts with most other species of SFG rickettsiae(2), and we have demonstrated its reactivity with R. helvetica,Rickettsia strain MOAa, and R. rickettsii. By contrast, R. mo-nacensis, similar to R. australis, failed to react with MAb 13-5,which is further evidence of a closer relationship between thesetwo species. Hamsters inoculated with IrR/MunichT serocon-verted with a specific IgG titer of 1:16,384, demonstrating itsability to elicit an adaptive immune response. The high anti-body titer suggested an established infection, as seen with theU strains of R. rickettsii (9). This is reflected in the numerousantigens detected in Western blots. Experimental tick trans-mission of R. monacensis to mammalian hosts will be impor-tant to the evaluation of its possible role as a tick-borne patho-gen. The availability of an in vitro culture system for thisorganism will allow further assessment of its epidemiologicpotential with serosurveys to identify populations at risk, as hasbeen done for R. helvetica and Anaplasma phagocytophila (10,

13, 14). Assessments of antibody titers in vertebrates residentin the English Garden would also be instructive.

The location of R. monacensis within nuclei and pseudopo-dia is characteristic of rickettsiae that induce actin polymeriza-tion for mobility (20, 26). The actin tails of R. monacensis weresimilar in length and shape to those formed by other SFGrickettsiae (e.g., R. rickettsii and R. conorii) (16, 54). Moreover,R. monacensis tended to cluster at the poles of host cells, wherethey were associated with bundles of actin, as observed withR. rickettsii (19). The ability to polymerize eukaryotic host cellactin is thought to facilitate intracellular, as well as intercellu-lar, movement of rickettsiae (20, 51). The long actin tails in-duced by R. monacensis are characteristic of SFG rickettsiae,such as R. rickettsii, that spread rapidly within hosts.

FIG. 3. Neighbor-joining phylogram based on partial rompA sequences showing the phylogenetic placement of R. monacensis sp. nov. IrR/MunichT among the validated SFG rickettsial species. Bootstrap support (�50%) for phylogenetic groupings and the scale of percent differencebetween taxa are indicated. R. australis PHS was used as the outgroup (see Materials and Methods).

TABLE 2. Comparative titers of IgG to selected SFG rickettsiaein sera of hamsters inoculated with R. monacensis

IrR/MunichT-infected host cellsa

Antigen Tick cells(IRE11)b

Mammaliancells (Vero)c

Controlserumd

Rickettsia monacensisIrR/MunichT

1:16,384/1:16,384 1:16,384/1:16,384 1:4

Rickettsia peacockiiDaE100R

1:256/1:512 1:256/1:512 1:1

Rickettsia strain MOAa 1:256/1:512 1:128/1:512 1:1Rickettsia rickettsii Hlp#2 1:128/1:256 1:128/1:256 1:4Rickettsia helvetica C9P9 1:128/1:128 1:64/1:512 1:1

a Intraperitoneal inoculation of 1 � 106 infected cells per hamster.b Sera from two hamsters, 67 days postinoculation.c Sera from two hamsters, 50 days postinoculation.d Negative control hamster serum.

4564 SIMSER ET AL. APPL. ENVIRON. MICROBIOL.

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Description of Rickettsia monacensis sp. nov. R. monacensis(mo.na.cen�sis. M.L. n. Monacum, Munich, a German city;M. L. adj. monacensis, from/of Munich) sp. nov., for a novelSFG rickettsial species isolated from a female I. ricinus tickcollected in the English Garden in Munich, Germany. The typestrain (IrR/MunichT) maintained in tick and mammalian cellcultures was characterized. The type strain was used to gener-ate partial 16S rRNA gene, rompA, and citrate synthase gene(gltA) sequences. The PCR and RFLP profiles obtained werethe same as those obtained from another tick collected at thesame time in the same area.

A prokaryote found in the castor bean tick (I. ricinus) thatgrows intracellularly in cultures of mammalian (mouse L-929and African green monkey Vero) and tick (I. ricinus IRE11,I. scapularis ISE6, and D. andersoni DAE100) cells. The or-ganism has an ultrastructure that conforms to that of rickett-siae, with a size range of 1 to 1.5 by 0.3 to 0.4 �m. Organismsare found free in the cytoplasm and occasionally within thenuclei of host cells. Not enclosed in host-provided membranesexcept when within digestive vacuoles of tick cells. The peri-plasmic membrane delineates an evenly mottled body, sepa-rated from the cell wall by a thin (20-nm) periplasmic space.The inner and outer leaflets of the trilaminar cell wall areequal in thickness, and the outer leaflet is lined with a faintmicrocapsular layer. The slime layer surrounding the microbesis thin (�30 nm). The rickettsiae are capable of inducing po-lymerization of host actin in both tick and mammalian cells,with tails averaging 20 �m in length. Polyclonal antibodiesfrom laboratory hamsters cross-react significantly in IFAs with

other SFG rickettsiae, but the titers of polyclonal antibodiesagainst the homologous antigen are the highest and thoseagainst R. helvetica are the lowest. The most prominent anti-gens recognized on Western blots are approximately 120 to 145kDa in size. IrR/MunichT does not react with MAb 13-5against rOmpA of R. rickettsii. DNA primers complementaryto regions of rickettsial genes for citrate synthase, the 17-kDaantigen, and rompA mediate amplification of specific products.Restriction of the 16S rRNA gene PCR product with RsaIyields two fragments, of 132 and 304 bp, but its restriction withBstXI yielded none. Restriction of the citrate synthase genePCR product with AluI yielded fragments of 6, 43, 87, and 165bp, and its restriction with Sau3AI yielded fragments of 107and 275 bp.

ACKNOWLEDGMENTS

This research was supported by a University of Minnesota GraduateSchool Doctoral Dissertation Fellowship award to Jason A. Simser.Research was also supported by state funds from the Minnesota Ag-riculture Experiment Station and Public Health Service grants(AR37909 and AI49424) from the National Institutes of Health.

REFERENCES

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.Basic local alignment search tool. J. Mol. Biol. 215:403–410.

2. Anacker, R. L., R. E. Mann, and C. Gonzales. 1987. Reactivity of monoclonalantibodies to Rickettsia rickettsii with spotted fever and typhus group rick-ettsiae. J. Clin. Microbiol. 25:167–171.

3. Anderson, B. E., and T. Tzianabos. 1989. Comparative sequence analysis ofa genus-common rickettsial antigen gene. J. Bacteriol. 171:5199–5201.

4. Andersson, S. G. E., D. R. Stothard, P. Fuerst, and C. G. Kurland. 1999.Molecular phylogeny and rearrangement of rRNA genes in Rickettsia spe-cies. Mol. Biol. Evol. 16:987–995.

5. Beati, L., P.-F. Humair, A. Aeschlimann, and D. Raoult. 1994. Identificationof spotted fever group rickettsiae isolated from Dermacentor marginatus andIxodes ricinus ticks collected in Switzerland. Am. J. Trop. Med. Hyg. 51:138–148.

6. Beati, L., O. Peter, W. Burgdorfer, A. Aeschlimann, and D. Raoult. 1993.Confirmation that Rickettsia helvetica sp. nov. is a distinct species of thespotted fever group rickettsiae. Int. J. Syst. Bacteriol. 43:521–526.

7. Billings, A. N., G. J. Teltow, S. C. Weaver, and D. H. Walker. 1998. Molec-

FIG. 4. Western blot analyses of R. monacensis IrR/MunichT,R. helvetica C9P9, Rickettsia strain MOAa, and R. rickettsii Hlp#2sodium dodecyl sulfate-polyacrylamide gel electrophoresis-separatedantigens reacted with pooled polyclonal sera from two hamsters inoc-ulated with IrR/MunichT (A) and MAb 13-5 to rOmpA (B). Arrowsindicate the approximate positions of rOmpA, as determined by MAb13-5. The arrowhead indicates the approximate position of rOmpB.

FIG. 5. Immunofluorescence photomicrographs of R. monacensisIrR/MunichT-infected eukaryotic cells as visualized by simultaneousexcitation of the appropriate wavelengths for the Texas red and FITCfluorochromes. Rickettsiae were labeled with a hamster anti-IrR/Mu-nichT polyclonal serum reacted with a secondary anti-hamster IgGantibody conjugated to FITC, and host cell actin was labeled withTexas red phalloidin. The arrows indicate actin tail structures associ-ated with rickettsiae. The arrowheads indicate clustering of rickettsiaeat the poles of cells. Panels: A, tick (D. andersoni) DAE100 cells; B,mouse (Mus musculus) L-929 cells. Bars � 10 �m.

VOL. 68, 2002 RICKETTSIA MONACENSIS SP. NOV. FROM IXODES RICINUS 4565

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ular characterization of a novel Rickettsia species from Ixodes scapularis inTexas. Emerg. Infect. Dis. 4:305–309.

8. Burgdorfer, W., A. Aeschlimann, O. Peter, S. F. Hayes, and R. N. Philip.1979. Ixodes ricinus: vector of a hitherto undescribed spotted fever groupagent in Switzerland. Acta Trop. 36:357–367.

9. Dasch, G. A., and E. Weiss. 1992. The genera Rickettsia, Rochalimaea, Ehr-lichia, Cowdria, and Neorickettsia, p. 2407–2470. In A. Balows, H. G. Truper,M. Dworkin, W. Harder, and K.-H. Schleifer (ed.), The prokaryotes, vol. 3.Springer Verlag, New York, N.Y.

10. Dumler, J. S., A. F. Barbet, C. P. Bekker, G. A. Dasch, G. H. Palmer, S. C.Ray, Y. Rikihisa, and F. R. Rurangirwa. 2001. Reorganization of genera inthe families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales:unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehr-lichia and Ehrlichia with Neorickettsia, descriptions of six new species com-binations and designations of Ehrlichia equi and �HGE agent’ as subjectivesynonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145–2165.

11. Euzeby, J. P. 1997. List of bacterial names with standing in nomenclature: afolder available on the internet. Int. J. Syst. Bacteriol. 47:590–592.

12. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach usingbootstrap. Evolution 39:783–791.

13. Fingerle, V., J. L. Goodman, R. C. Johnson, T. J. Kurtti, U. G. Munderloh,and B. Wilske. 1999. Epidemiological aspects of human granulocytic ehrli-chiosis in southern Germany. Wien. Klin. Wochenschr. 111:1000–1004.

14. Fournier, P.-E., F. Grunnenberger, B. Jaulhac, G. Gastinger, and D. Raoult.2000. Evidence of Rickettsia helvetica infection in humans, eastern France.Emerg. Infect. Dis. 6:389–392.

15. Fournier, P.-E., V. Roux, and D. Raoult. 1998. Phylogenetic analysis ofspotted fever group rickettsiae by study of the outer surface protein rOmpA.Int. J. Syst. Bacteriol. 48:839–849.

16. Gouin, E., H. Gantelet, I. L. Egile, H. Ohayon, V. Villiers, P. Gounon, andP. J. Sansonetti. 1999. A comparative study of the actin-based motilities ofthe pathogenic bacteria Listeria monocytogenes, Shigella flexneri and Rickett-sia conorii. J. Cell Sci. 112:1697–1708.

17. Hackstadt, T. 1996. The biology of rickettsiae. Infect. Agents Dis. 5:127–143.18. Hayes, S. F., and W. Burgdorfer. 1982. Reactivation of Rickettsia rickettsii in

Dermacentor andersoni ticks: an ultrastructural analysis. Infect. Immun. 37:779–785.

19. Heinzen, R. A., S. S. Grieshaber, L. S. Van Kirk, and C. J. Devin. 1999.Dynamics of actin-based movement by Rickettsia rickettsii in Vero cells.Infect. Immun. 67:4201–4207.

20. Heinzen, R. A., S. F. Hayes, M. G. Peacock, and T. Hackstadt. 1993. Direc-tional actin polymerization associated with spotted fever group rickettsiainfection of Vero cells. Infect. Immun. 61:1926–1935.

21. Higuchi, R. 1989. Simple and rapid preparation of samples for PCR, p.31–43. In H. A. Ehrlich (ed.), PCR technology, principles and applicationsfor DNA amplification. Stockton Press, New York, N.Y.

22. Kimura, M. 1980. A simple method for estimating evolutionary rate of basesubstitution through comparative studies of nucleotide sequences. J. Mol.Evol. 16:111–120.

23. Kurtti, T. J., U. G. Munderloh, C. A. N. Hughes, S. M. Engstrom, and R. C.Johnson. 1996. Resistance to tick-borne spirochete challenge induced byBorrelia burgdorferi strains that differ in expression of outer surface proteins.Infect. Immun. 64:4148–4153.

24. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

25. Marquez, F. J., M. A. Muniain, R. C. Soriguer, G. Izquierdo, J. Rodriguez-Bano, and M. V. Borobio. 1998. Genotypic identification of an undescribedspotted fever group Rickettsia in Ixodes ricinus from southwestern Spain.Am. J. Trop. Med. Hyg. 58:570–577.

26. Munderloh, U. G., S. F. Hayes, J. Cummings, and T. J. Kurtti. 1998. Mi-croscopy of spotted fever rickettsia movement through tick cells. Microsc.Microanal. 4:115–121.

27. Munderloh, U. G., S. D. Jauron, V. Fingerle, L. Leitritz, S. F. Hayes, J. M.Hautman, C. M. Nelson, B. W. Huberty, T. J. Kurtti, G. G. Ahlstrand, B.Greig, M. A. Mellencamp, and J. L. Goodman. 1999. Invasion and intracel-lular development of the human granulocytic ehrlichiosis agent in tick cellculture. J. Clin. Microbiol. 37:2518–2524.

28. Munderloh, U. G., Y. Liu, M. Wang, C. Chen, and T. J. Kurtti. 1994.Establishment, maintenance and description of cell lines from the tick Ixodesscapularis. J. Parasitol. 80:533–543.

29. Munderloh, U. G., J. E. Madigan, J. S. Dumler, J. L. Goodman, S. F. Hayes,J. E. Barlough, C. M. Nelson, and T. J. Kurtti. 1996. Isolation of the equinegranulocytic ehrlichiosis agent, Ehrlichia equi, in tick cell culture. J. Clin.Microbiol. 34:664–670.

30. Nilsson, K., T. G. T. Jaenson, I. Uhnoo, O. Lindquist, B. Pettersson, M.Uhlen, G. Friman, and C. Pahlson. 1997. Characterization of a spotted fevergroup rickettsia from Ixodes ricinus ticks in Sweden. J. Clin. Microbiol.35:243–247.

31. Nilsson, K., O. Lindquist, A. J. Liu, T. G. T. Jaenson, G. Friman, and C.Pahlson. 1999. Rickettsia helvetica in Ixodes ricinus ticks in Sweden. J. Clin.Microbiol. 37:400–403.

32. Nilsson, K., O. Lindquist, and C. Pahlson. 1999. Association of Rickettsiahelvetica with chronic perimyocarditis in sudden cardiac death. Lancet 354:1169–1173.

33. Noda, H., U. G. Munderloh, and T. J. Kurtti. 1997. Endosymbionts of ticksand their relationship to Wolbachia spp. and tick-borne pathogens of humansand animals. Appl. Environ. Microbiol. 63:3926–3932.

34. Obonyo, M., U. G. Munderloh, V. Fingerle, B. Wilske, and T. J. Kurtti. 1999.Borrelia burgdorferi in tick cell culture modulates expression of outer surfaceproteins A and C in response to temperature. J. Clin. Microbiol. 37:2137–2141.

35. Parker, R. R., E. G. Pickens, D. B. Lackman, E. J. Bell, and F. B. Thraikill.1951. Isolation and characterization of Rocky Mountain spotted fever rick-ettsiae from the rabbit tick Heamaphysalis leporis-palustris Packard. PublicHealth Rep. 66:455–463.

36. Parola, P., L. Beati, M. Cambon, and D. Raoult. 1998. First isolation ofRickettsia helvetica from Ixodes ricinus ticks in France. Eur. J. Clin. Microbiol.Infect. Dis. 17:95–100.

37. Parola, P., and D. Raoult. 2001. Tick-borne bacterial diseases emerging inEurope. Clin. Microbiol. Infect. 7:80–83.

38. Randolph, S. E. 2001. The shifting landscape of tick-borne zoonoses: tick-borne encephalitis and Lyme borreliosis in Europe. Philos. Trans. R. Soc.Lond. Ser. B Biol. Sci. 356:1045–1056.

39. Raoult, D., and V. Roux. 1997. Rickettsioses as paradigms of new or emerg-ing infectious diseases. Clin. Microbiol. Rev. 10:694–719.

40. Regnery, R. L., C. L. Spruill, and B. D. Plikaytis. 1991. Genotypic identifi-cation of rickettsiae and estimation of intraspecies sequence divergence forportions of two rickettsial genes. J. Bacteriol. 173:1576–1589.

41. Roux, V., P.-E. Fournier, and D. Raoult. 1996. Differentiation of spottedfever group rickettsiae by sequencing and analysis of restriction fragmentlength polymorphism of PCR-amplified DNA of the gene encoding theprotein rOmpA. J. Clin. Microbiol. 34:2058–2065.

42. Roux, V., and D. Raoult. 1995. Phylogenetic analysis of the genus Rickettsiaby 16S rDNA sequencing. Res. Microbiol. 146:385–396.

43. Roux, V., and D. Raoult. 2000. Phylogenetic analysis of the members of thegenus Rickettsia using the gene encoding the outer-membrane proteinrOmpB (ompB). Int. J. Syst. Evol. Microbiol. 50:1449–1455.

44. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new methodfor reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425.

45. Sekeyova, Z., P.-E. Fournier, J. Rehacek, and D. Raoult. 2000. Character-ization of a new spotted fever group rickettsia detected in Ixodes ricinus(Acari:Ixodidae) collected in Slovakia. J. Med. Entomol. 37:707–713.

46. Sekeyova, Z., V. Roux, W. Xu, J. Rehacek, and D. Raoult. 1998. Rickettsiaslovaca sp. nov., a member of the spotted fever group rickettsiae. Int. J. Syst.Bacteriol. 48:1455–1462.

47. Silverman, D. J., and C. L. Wisseman. 1979. In vitro studies of rickettsia-hostcell interactions: ultrastructural changes induced by Rickettsia rickettsii in-fection of chicken embryo fibroblasts. Infect. Immun. 26:714–727.

48. Simser, J. A., A. T. Palmer, U. G. Munderloh, and T. J. Kurtti. 2001.Isolation of a spotted fever group rickettsia, Rickettsia peacockii, in a RockyMountain wood tick, Dermacentor andersoni, cell line. Appl. Environ. Mi-crobiol. 67:546–552.

49. Stothard, D. R., and P. A. Fuerst. 1995. Evolutionary analysis of the spottedfever and typhus groups of Rickettsia using 16S rRNA gene sequences. Syst.Appl. Microbiol. 18:52–61.

50. Swofford, D. L. 2001. PAUP�: phylogenetic analysis using parsimony (�andother methods), 4.0b8 (PPC) ed. Sinauer Associates, Sunderland, Mass.

51. Teysseire, N., C. Chiche-Portiche, and D. Raoult. 1992. Intracellular move-ments of Rickettsia conorii and R. typhi based on actin polymerization. Res.Microbiol. 143:821–829.

52. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment throughsequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 22:4673–4680.

53. Todd, W. J., W. Burgdorfer, and G. P. Wray. 1983. Detection of fibrilsassociated with Rickettsia rickettsii. Infect. Immun. 41:1252–1260.

54. Van Kirk, L. S., S. F. Hayes, and R. A. Heinzen. 2000. Ultrastructure ofRickettsia rickettsii actin tails and localization of cytoskeletal proteins. Infect.Immun. 68:4706–4713.

55. Varma, M. G. R. 1989. Tick-borne diseases, p. 55–70. Geographical distri-bution of arthropod-borne diseases and their principal vectors. WorldHealth Organization, Geneva, Switzerland.

56. Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16Sribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697–703.

57. Weller, S. J., G. D. Baldridge, U. G. Munderloh, H. Noda, J. Simser, andT. J. Kurtti. 1998. Phylogenetic placement of rickettsiae from the ticksAmblyomma americanum and Ixodes scapularis. J. Clin. Microbiol. 36:1305–1317.

58. Williams, S. G., J. B. Sacci, M. E. Schriefer, E. M. Anderson, K. K. Fujioka,F. J. Sorvillo, A. R. Barr, and A. F. Azad. 1992. Typhus and typhuslikerickettsiae associated with opossums and their fleas in Los Angeles county,California. J. Clin. Microbiol. 30:1758–1762.

4566 SIMSER ET AL. APPL. ENVIRON. MICROBIOL.

on October 31, 2020 by guest

http://aem.asm

.org/D

ownloaded from