R

EPRODUCTIONRESEARCH

ARX/Arx is expressed in germ cells during spermatogenesis inboth marsupial and mouse

Hongshi Yu1,2, Andrew J Pask1,2,3, Yanqiu Hu1,2, Geoff Shaw1,2 and Marilyn B Renfree1,2

1ARC Centre of Excellence for Kangaroo Genomics and 2Department of Zoology, The University of Melbourne,Melbourne, Victoria 3010, Australia and 3Department of Molecular and Cell Biology, The University of Connecticut,Storrs, Connecticut 06269, USA

Correspondence should be addressed to M B Renfree at Department of Zoology, The University of Melbourne;Email: m.renfree@unimelb.edu.au

Abstract

The X-linked aristaless gene,ARX, is essential for the development of the gonads, forebrain, olfactory bulb, pancreas, and skeletalmuscle in

mice and humans. Mutations cause neurological diseases, often accompanied by ambiguous genitalia. There are a disproportionately high

number of testis and brain genes on the human and mouse X chromosomes. It is still unknown whether the X chromosome accrued these

genes during its evolution or whether genes that find themselves on the X chromosome evolve such roles.ARXwas originally autosomal in

mammals and remains so in marsupials, whereas in eutherian mammals it translocated to the X chromosome. In this study, we examined

autosomal ARX in tammars and compared it with the X-linked Arx in mice. We detected ARXmRNA in the neural cells of the forebrain,

midbrain and hindbrain, and olfactory bulbs in developing tammars, consistent with the expression in mice. ARXwas detected by RT-PCR

and mRNA in situ hybridization in the developing tammar wallaby gonads of both sexes, suggestive of a role in sexual development as

in mice. We also detected ARX/Arx mRNA in the adult testis in both tammars and mice, suggesting a potential novel role for ARX/Arx

in spermiogenesis. ARX transcripts were predominantly observed in round spermatids. ArxmRNA localization distributions in the mouse

adult testis suggest that it escaped meiotic sex chromosome inactivation during spermatogenesis. Our findings suggest that ARX in the

therian mammal ancestor already played a role in male reproduction before it was recruited to the X chromosome in eutherians.

Reproduction (2014) 147 279–289

Introduction

The X-linked aristaless homeobox gene, ARX, belongsto the family of paired-type homeodomain transcriptionfactors that have essential roles in the development of theforebrain, olfactory bulb, pancreas, skeletal muscle, andgonads in mice and humans (Kitamura et al. 2002, Helleret al. 2005, Yoshihara et al. 2005, Biressi et al. 2008).ARX was initially identified as an important regulator offorebrain development in mice and zebrafish (Schneitzet al. 1993, Miura et al. 1997). Subsequently, ARXorthologs were detected in the forebrain of chickens(Cobos et al. 2005), Xenopus (El-Hodiri et al. 2003, Kellyet al. 2005, Seufert et al. 2005), and Caenorhabditiselegans (Melkman & Sengupta 2005). The ARXprotein contains a Q (50) paired-type homeodomain, aC-terminal aristaless domain, and an N-terminal octa-peptide and acts as a nuclear transcriptional regulator toactivate or inhibit gene expression (Seufert et al. 2005,McKenzie et al. 2007, Biressi et al. 2008, Fullenkamp &El-Hodiri 2008, Colasante et al. 2009). The ARX geneencodes a 562-amino acid protein (Ohira et al. 2002,Stromme et al. 2002) with four characteristic polyalanine(PolyA) tracts where most of the ARX mutations occur

q 2014 Society for Reproduction and Fertility

ISSN 1470–1626 (paper) 1741–7899 (online)

(Gecz et al. 2006). ARX mutations in humans lead tomultiple neurological disorders including X-linkedlissencephaly with or without ambiguous genitalia(XLAG syndrome), epilepsy, and mental retardation.

ARX plays crucial roles in the development andmaintenance of the CNS in embryogenesis and adulthood(Miura et al. 1997, Kitamura et al. 2002, El-Hodiri et al.2003, Colombo et al. 2004, Poirier et al. 2004, Melkman &Sengupta 2005, Yoshihara et al. 2005, Friocourt et al.2006).ARX is expressed in the forebrain, predominantly intelencephalic structures, of zebrafish, mice, and humansthroughout fetal development. The distribution of ARXmRNA in human fetal brain suggests that ARX is involvedin the differentiation and maintenance of specific neuronalcell types in the CNS (Ohira et al. 2002). Arx mutationslead to the development of a small brain with reducedolfactory bulbs, confirming that the Arx gene is necessaryfor normal brain development (Kitamura et al. 2002,Yoshihara et al. 2005).

Arx is expressed at all stages of pancreatic develop-ment in the proliferating epithelium, differentiatingpancreatic precursors, and islets of Langerhans in mice(Collombat et al. 2003). Deficiency of Arx results in a

DOI: 10.1530/REP-13-0361

Online version via www.reproduction-online.org

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

280 H Yu and others

loss of mature endocrine a-cells with a concomitantincrease in the numbers of b- and d-cells (Collombat et al.2003), suggesting that Arx is required for the specificationand differentiation of a-cells (Collombat et al. 2003,2005). Arx is strongly expressed in differentiatingembryonic muscle and is progressively decreased duringmyogenesis, acting as a positive regulator of thedifferentiation and specification of skeletal muscle fibers(Biressi et al. 2008).ARX is also important for mammalian gonadal

development. In mice, Arx is strongly expressed in thefetal testis, principally in the interstitial cells, includingperitubular myoid cells, tunica albuginea, endothelialcells, and interstitial fibroblast-like cells. However, Arxis barely detectable in developing Sertoli cells, Leydigcells, and germ cells (Kitamura et al. 2002). Arx-knockout neonatal male mice have smaller testes andseminiferous tubules of a larger diameter, but do notsurvive to adulthood (Kitamura et al. 2002). Arxfunctions through a paracrine signaling pathway topromote the differentiation of Leydig cells. Loss of Arxdecreases the number of Leydig cells that producetestosterone to maintain testis development, resulting inX-linked lissencephaly with abnormal genitalia (XLAG)syndrome (Ogata et al. 2000, Kitamura et al. 2002).Surprisingly, there have been no detailed studies of ARXexpression in the adult testes of any mammal. In additionto its role in testis development, weak expression of Arxis also observed in the developing mouse ovary at theboundary of the mesonephros at E14.5 (Kitamura et al.2002), but a specific role for Arx in ovary developmenthas not been investigated yet.

The X and Y chromosomes have evolved fromautosomes in the common mammalian ancestor(Ohno 1967, Skaletsky et al. 2003, Ross et al. 2005,Graves 2006). The human X chromosome comprisesan X conserved region (XCR) present in all therianmammals and recently added regions (XAR) present onthe X chromosome in eutherians but located on anautosome in the common therian ancestor and in extantmarsupials (Alsop et al. 2005). Comparative mapping intammars, platypuses, chickens, and fish indicates thatthe XAR was translocated to the human X chromosomein a block of genes, after the divergence of marsupialsfrom eutherian mammals (Graves 2008, Veyrunes et al.2008, Delbridge et al. 2009). ARX maps to the XARin tammars and so is X-linked in eutherian mammalswhile being autosomal (on chromosome 5p) in marsu-pials (Delbridge et al. 2008) and other non-mammalianvertebrates. Since the X chromosome is hemizygous inmales, any genes that confer a reproductive advantagecan be directly selected for. As a result, the eutherianX chromosome is thought to have become enrichedwith genes that have functions related to reproduction(Saifi & Chandra 1999, Wang et al. 2001, Vallender &Lahn 2004, Ropers & Hamel 2005, Delbridge & Graves2007, Mueller et al. 2008).

Reproduction (2014) 147 279–289

As marsupials occupy an important position inX chromosome evolution in mammals, this study exa-mined the expression of autosomal ARX in the tammarwallaby and compared this with the expression of itsX-linked homologue Arx in the mouse. We demonstratethat autosomal ARX was already dynamically expressedduring testis development and spermatogenesis beforeit was recruited to the X chromosome in eutherianmammals.

Materials and methods

Animals

Tammar wallabies (Macropus eugenii) from Kangaroo Island(South Australia) were maintained in open grassy yardssupplemented with fresh vegetables and water ad libitum inour breeding colony in Melbourne, Australia. Pouch youngof various ages were removed from their mother’s pouchfor sampling. The age of pouch young was estimated usinghead length from published growth curves (Poole et al. 1991).Samples of mouse (Swiss white) tissue were collectedopportunistically from other ethically approved experiments.Mice were bred in the Department of Zoology. All samplingtechniques and tissue collection procedures conformed to theAustralian National Health and Medical Research Councilguidelines (2004) and were approved by the University ofMelbourne Animal Experimentation and Ethics Committees.

Tissues

Adult tissues from tammars including brain, pituitary, hypo-thalamus, olfactory bulb, thyroid, muscle, spleen, mammarygland, heart, lung, liver, kidney, and adrenal were collectedfrom three adult females (along with uterus and ovary) and twoadult males (along with testes). Fetal gonads 1 day before birth(day 25 of gestation, nZ3), pouch young gonads after birth(dppZdays post partum), d2pp (nZ3), d7pp (nZ3), d10pp(nZ2), d15pp (nZ2), and d24pp (nZ3), and mature gonads(nZ2), as well as adult testes from mice (nZ4) for molecularanalysis were snap–frozen in liquid nitrogen and stored atK80 8C until use. Olfactory bulbs were collected from bothsexes of pouch young aged between d14 and d89pp. All tissueswere collected under RNase-free conditions. Tissues for in situhybridization were fixed overnight in 4% paraformaldehyde,washed several times with 1! PBS, and stored in 70% ethanolbefore paraffin embedding and sectioning at 7 mm.

Cloning of tammar ARX gene and gene structuredetermination

Cross-species primers (ARXFw1 and ARXRv1) spanning theconserved regions of ARX were designed to partially clone ARXin tammars. Tammar ARX gene-specific primers (nestedprimers) were designed from the above PCR fragment for3 0 and 5 0 RACE to isolate the full gene transcript (the sequencesof all primers are listed in Table 1). cDNA template wasderived from reverse-transcribed total RNA from the head of afetal tammar, using the SMART cDNA Library Construction Kit

www.reproduction-online.org

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

Table 1 Primers designed for the analysis of ARX expression by PCR.

Primers Sequence (5 0–3 0) Application

ARXFw1 CAGTTTCAGCTGC(A/T)GGA(A/G)CTGG Cross-species cloning and RT-PCRARXRv1 TTCCC(A/C)GG(C/G)AGGAT(A/G)TTGA Cross-species cloning and RT-PCRARXFw2 ACTCACCCTCCAGGTTTGC 3 0 RACEARXRv2 CTGGGTGATGAGGAGGGA 5 0 RACESMART IV AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG 5 0 RACECDS III ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30NK1N

(nZA, G, C, or T; NK1ZA, G, or C)3 0 RACE

5 0 PCR primers AAGCAGTGGTATCAACGCAGAGT 5 0 RACEARXFw3 ACTCACCCTCCAGGTTTGC RT-PCRARXRv3 TGAGGAGGAAAGGACAGG RT-PCR18S F GATCCATTGGAGGGCAAGTCT RT-PCR18S R CCAAGATCCAACTACGAGCTTTTT RT-PCR

All the primers are listed in the 5 0 to 3 0 orientation; CDSIII, Smart IV, and 5 0 PCR primers were synthesized by SIGMA (Genosys) according to theSMART cDNA Library Construction Kit (Clontech).

ARX has a novel role in spermatogenesis 281

(Clontech). 5 0 RACE was first carried out with primer 5 0 PCRand ARXRv1 and then 5 0 PCR and nested primer ARXRv2 wereused to carry out 5 0 RACE. 3 0 RACE was carried out using theARXFw1 and CDS III primers. Nested PCR was carried outusing the ARXFw2 and CDS III primers. PCR cycling conditionswere as follows: 35 cycles of 30 s, 95 8C; 60 s, 50 8C; and 90 s,72 8C, in a 25 ml reaction mixture with GoTaq Green MasterMix (Promega) and 0.4 mM of each primer.

Comparative analysis was carried out to determine the genestructure of ARX in tammars using the gene structure ofhumans, mice, rats, South American grey short-tailed opossum(Monodelphis domestica), and the platypus (Ornithorhynchusanatinus) (http://www.ensembl.org/). Partial genomic sequenceof M. eugenii was obtained from the trace archives at NCBI(http://www.ncbi.nlm.nih.gov/) to confirm the number of exonsand their length and define the position of introns.

Sequence alignment analysis

The ARX protein sequences were retrieved from Ensembl(http://www.ensembl.org/) or NCBI (http://www.ncbi.nlm.nih.gov/protein/): human – AAK93901; macaque – ENSMMUP00000024253; mouse – NP_031518; rat – NP_001093644;dog – NP_001108138; opossum – ENSMODP00000009070;tammar – GU369938; Xenopus – NP_001079329; zebrafish –BAA21764; nematode – NP_509860; and fruit fly – AAF51505.Sequence identity was calculated by BLAST2 (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAMZblastp&BLAST_PROGR-AMSZblastp&PAGE_TYPEZBlastSearch&SHOW_DEFAUL-TSZon&BLAST_SPECZblast2seq&LINK_LOCZblasttab&LAST_PAGEZblastn&BLAST_INITZblast2seq). ARX proteinsequences were aligned with Clustal-X (http://www.molecular-evolution.org/software/alignment/clustal) and viewed andedited by GeneDoc (http://www.nrbsc.org/gfx/genedoc/).

Non-quantitative RT-PCR

Total RNA was isolated using RNAwiz (Ambion, Inc., Austin,TX, USA) according to the manufacturer’s instructions. Thequality and quantity of total RNA were verified by gelelectrophoresis and optical density reading with a Nanodrop

www.reproduction-online.org

(ND-1000 Spectrophotometer, Wilmington, DE, USA). TotalRNA of 2 mg was treated with DNaseI (Ambion, Inc.) for 30 minat 37 8C. Total RNA of 1 mg was reverse-transcribed using theSuperScript III kit (Invitrogen).

To check the expression pattern of ARX in developing tissuesand adult tissues, PCR was carried out in a 25 ml reactionmixture with GoTaq Green Master Mix and 0.4 mmol of eachprimer (ARXFw3 and ARXRv3). Amplification conditions wereas follows: 95 8C, 30 s; 53.5 8C, 60 s; and 72 8C, 120 s for 35cycles (ARX) or 25 cycles (18S). Samples were analyzed on a1.2 and 2% agarose gel for ARX and 18S respectively.

RNA isolation and northern blotting hybridization

Total RNA was isolated from snap-frozen adult tissues withRNAwiz (Ambion, Inc.). The concentration and quality of totalRNA were examined as described above. Equivalent amountsof RNA (about 12 mg) were subjected to electrophoresis in a 1%agarose gel containing formaldehyde (Sambrook & Russell2001). Northern blotting was carried out according to standardmethods. Hybridization was carried out at 42 8C in ULTRAhybsolution (Ambion, Inc.) with [a-32P]dCTP-labeled cDNA probefrom exon 2 to the end of 3 0 UTR.

ARX mRNA in situ hybridization

Antisense and sense RNA probes were prepared separately inthe exon 2 region and were about 680 bp in length. Probeswere synthesized and labeled with digoxigenin-UTP using SP6or T7 RNA polymerase. Tissues were fixed in 4% paraformal-dehyde overnight at 4 8C, rinsed several times with 1! PBS,embedded in paraffin, and sectioned onto polylysine slides(Menzel-Glaser, Braunschweig, Germany). After dewaxing, thesections were washed several times with 1! PBS, glycine,Triton X-100, and triethanolamine buffer and were thenimmediately hybridized with probes at 42 8C. Hybridizationsignals were detected using anti-Dig alkaline phosphatase-conjugated antibody and visualized with NBT/BCIP chromo-gen, according to the manufacturer’s instructions (RocheGmbH). The sections were counterstained with 0.1% FastRed (Aldrich Chemical Corp., Milwaukee, WI, USA).

Reproduction (2014) 147 279–289

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

282 H Yu and others

Results

Tammar ARX gene is highly conserved among mammals

The tammar ARX gene was cloned using degenerateprimers and RACE PCR (GenBank accession numberGU369938). ARX mRNA has 2747 bp, consisting of fiveexons (Fig. 1A). The sequence was confirmed from thetrace archives of the tammar (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and compared with the human ARX genestructure, in which the conserved homeobox regionspans exon 2 to exon 4.

(A)

(B)

(C)

Figure 1 Characterization of tammar ARX. (A) The tammar ARX gene has fi2719 bp. The white portion of boxes indicates the UTRs and black portionlabeled above the box. The broken line between exons represents introns of uhas a length of 2621 bp. (B) Cross-species ARX protein sequence comparisopossums and the lowest identity was observed between mammals and invhumans, mice, tammars, and Xenopus. The octapeptide (dashed box), nuclbox), fourth polyalanine (p(A)4 dashed box), and aristaless domain (dashedhighly conserved in humans, mice, and tammars. The amino acids shaded

Reproduction (2014) 147 279–289

The tammar ARX gene encodes a protein of 552 aminoacids, highly conserved with eutherian ARX (Fig. 1B). Wecompared the ARX proteins of humans, mice, tammars,and Xenopus to determine which regions were understrongest selection (Fig. 1C). ARX is especially conservedwithin the functional domains including the N-terminaloctapeptide, known to repress transcriptional activity andact as a nuclear localization signals recognized byimportin, the homeodomain with its characteristichelix-turn-helix DNA-interacting motif and theC-terminal aristaless transcription activation domain.

ve exons (black/white boxes) with a total open reading frame length ofs indicate protein-coding sequences (CDS). The length of each exon isnknown size, while intron 4 (the solid line between exon 4 and exon 5)

on. The highest identity (93%) was observed between tammars andertebrates as expected. (C) ARX protein sequence alignment betweenear localization signals (NLS, black underline), homeodomain (dashedbox) are highly conserved in all the species. The first and third p(A) areblack are identical across all the species.

www.reproduction-online.org

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

ARX has a novel role in spermatogenesis 283

There are three conserved nuclear localization signals(NLS) localized in the N-terminal region and both sides ofthe homeodomain in humans, mice, tammars, andXenopus. Interestingly, three of the four PolyA tractsimportant for brain development in humans and mice arefound only in therian mammals. However, the fourth tractis conserved in all the four species (Fig. 1C).

Figure 3 Northern blotting and RT-PCR in tammar adult tissues.Northern blot (top panel) identified a single transcript of 2.8 kb that waspredominant in the testis, but not detected in other tissues consistentwith the RT-PCR. RT-PCR (middle panel) revealed that ARX wasstrongly expressed in the adult testis and weakly expressed in theolfactory bulb, adrenal, ovary, and muscle. 18S (bottom panel) wasthe positive control for the RT-PCR.

Tammar ARX revealed highly conserved and novel sitesof expression

ARX plays critical roles in development of the forebrain,olfactory bulb, and gonads during embryogenesis inmice. To examine tammar ARX gene expression, wecarried out RT-PCR using various tissues.

Tammar ARX was widely expressed during embryo-genesis (data not shown) and was cloned from thedeveloping brain. We detected ARX expression through-out gonadal development (Fig. 2).ARXwas detected in thegonads before sexual differentiation (2 days before birth),during the time that testicular cords begin to form in males(around day 2pp) andwhen the cortex andmedulla form inthe ovary in females (around day 7–8pp), and later duringgerm cell proliferation in the ovary (on days 2–20pp) andwhen the ovarian germ cells begin to enter meiosis(around day 25pp) (Renfree et al. 1996). There was noobvious difference in ARX expression between male andfemale samples at any time point (Fig. 2), suggesting that itmay be important in sexual differentiation of both sexes.

Using RT-PCR and northern blotting, we examinedARX expression in various adult tissues and confirmedthe broad expression pattern in the brain observed ina previous report on the tammar (Delbridge et al. 2008).A northern blot confirmed that there was only onetranscript of w2.8 kb in adult testis (Fig. 3), in contrast tothe three isoforms detected in human skeletal muscle(Stromme et al. 2002).

Interestingly, ARX was most strongly expressed inthe adult testis, but, by comparison, it was only weaklyexpressed in the olfactory bulb, ovary, and skeletalmuscle (Fig. 3). This finding suggests a previouslyunreported potential role for ARX in the adult testis.Therefore, we compared ARX mRNA localization andprotein distribution in the adult testes of a marsupial anda eutherian mammal.

Figure 2 Tammar ARX gene expression in developing gonads. Thetammar ARX gene was expressed in the developing ovary and testis atall stages examined from before birth (fetus: at 25 days gestation) to day45 post partum throughout the period of gonadal sex determination anddifferentiation. 18S rRNA was the positive control, and the last lane isthe negative control where template DNA was omitted from the PCR.

www.reproduction-online.org

Tammar ARX maintains a conserved localization inthe developing brain and gonads

ARX plays an important role in brain developmentin humans, mice, and zebrafish. To examine ARXexpression and localization within the developingbrain in marsupials, we examined the head on the dayof birth, a stage that is equivalent to early intra-uterinedevelopment period of most eutherian mammals(Fig. 4A and B).

ARX mRNA was detected in the epidermis (Fig. 4C)surrounding the head, and strong expression wasdetected in the tongue and palate epithelium (Fig. 4Dand E), as well as in the nasal epithelium. ARX mRNAstaining was also detected in the olfactory bulb (Fig. 4F)and the vomeronasal organ (VNO) (Fig. 4G) and, usingRT-PCR, strongly in the developing olfactory bulb (datanot shown). Tammar ARX was expressed in the neuronalcells at the site of the trigeminal ganglion (Fig. 4H),telencephalon (Fig. 4I), mesencephalon, metencephalon(Fig. 4J), and myelencephalon (Fig. 4K) in a patternsimilar to that observed in mice and zebrafish.

We examined ARX mRNA distribution in the devel-oping gonads of tammar wallabies from before birthto 26 days after birth with mRNA in situ hybridization(Fig. 5). Germ cells in the tammar wallaby testis are stillactively mitotically proliferating in the postnatal testis,peaking in number on day 25pp. At this stage, the germcells are developing gonocytes and are not yetspermatogonia (Tyndale-Biscoe & Renfree 1987). Beforesex determination, tammar ARX was localized in thecytoplasm of germ cells (Fig. 5A and B). Two days afterbirth, during the formation of testicular cords, ARX wasdetected in the cytoplasm of somatic cells and germ cells

Reproduction (2014) 147 279–289

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

Figure 4 ARX has a conserved mRNA localization in the developing brain. In situ hybridization of the tammar head with antisense ARX. mRNAdistribution is indicated by dark blue staining (A). The sense probe hybridization control is shown in the inset box. The tissue is also shown withhematoxylin and eosin staining (B). mRNA was localized in the spinosum and granulosa cells of epidermis (C) surrounding the head and in thetongue epithelium (D) and palate epithelium (E). ARX staining was also found in the olfactory bulb (F) and vomeronasal organ (G), both regionsimportant for smell and signal detection in mammals. ARX transcripts were found in the conserved regions of the developing brain in the neural cellsof trigeminal ganglion (H), telencephalon (I), metencephalon (J), and myelencephalon (K).

284 H Yu and others

(Fig. 5C and D). With testicular cord formation, ARX wasexpressed in the cytoplasm of some developing Sertolicells and in germ cells (Fig. 5E). During ovariandifferentiation (Fig. 5F), it was also cytoplasmic in thegerm cells and some somatic cells. Around 25 days afterbirth, when male germ cells began to enter mitotic arrest,ARX was similarly detected in the cytoplasm of someSertoli cells and germ cells (Fig. 5G). When female germcells began to enter meiosis about day 25 after birth, ARXwas observed predominantly in the cytoplasm of germcells as well as somatic cells (Fig. 5H).

Reproduction (2014) 147 279–289

Dynamic regulation of tammar ARX duringspermatogenesis in the adult testis

ARX mRNA was abundant in spermatogenic cells atspecific stages and in some somatic cells (Fig. 6).Interestingly, unlike in the developing gonocytes, therewas no expression in the mitotic spermatogonia andexpression was only observed in these cells after theinitiation of meiosis (Fig. 6A, B, C, D, and E). ARX mRNAwas especially abundant in spermatocytes (Fig. 6A).As meiosis proceeded, it became restricted to the newly

www.reproduction-online.org

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

Figure 5 mRNA in situ showing ARX localization in tammar developinggonads. ARX mRNA localization in the developing gonads of tammars.mRNA distribution is indicated by dark blue staining and tissue iscounterstained with 0.1% Nuclear Fast Red. On day 25 of gestation,ARX was detected in the cytoplasm of germ cells (A and B). On day 2after birth during the formation of testicular cords, ARX mRNA wasdetected in the cytoplasm of some Sertoli cells and germ cells (C), andno difference in ARX mRNA was found in the equivalently staged ovary(D). On day 8 after birth, there was strong staining in the cytoplasm ofgerm cells and some Sertoli cells in the testis (E), and during ovariandifferentiation, the same pattern of ARX staining was observed in thecytoplasm of germ cells and some somatic cells in the ovary (F). Whenmale germ cells began to enter mitotic arrest on day 25 after birth, ARXtranscripts were strongly expressed in the cytoplasm of germ cells andsome Sertoli cells (G). When female germ cells began to enter meiosison day 16 after birth, ARX staining was observed in the cytoplasm ofboth germ cells and somatic cells (H). A, C, E, and G show developingtestes, while B, D, F, and H show developing ovaries. Black dotted boxrepresents gonads; blue dotted box represents seminiferous tubules;and blue dotted line in H separates the cortex and medulla in the ovary.Scale barZ100 mm.

ARX has a novel role in spermatogenesis 285

formed round spermatids, but there was no staining inthe spermatocytes (Fig. 6B). As round spermatidsdeveloped, ARX staining became weaker in the cyto-plasm, but it was still strong in the round spermatids(Fig. 6C). No mRNA staining was detected in theelongated spermatids and spermatozoa (Fig. 6D and E),but there was still strong expression in the cytoplasm ofround spermatids at these stages (Fig. 6D and E). ARXmRNA was also observed in some Leydig cells (Fig. 6A)and peritubular myoid cells at early stages of thespermatogenic cycle (Fig. 6A, B, C, D, and E) beforeround spermatids were transformed into elongated

www.reproduction-online.org

spermatids. No mRNA expression was detected in Sertolicells at any stage (Fig. 6B).

Dynamic regulation of Arx during spermatogenesis inthe adult mouse testis

This study, to our knowledge, is the first report of ARXexpression in any adult mammalian testis. To determinewhether our findings in the tammar represent a con-served role of ARX in the adult testis, we examined Arxexpression at the mRNA level in the adult mouse testis.

The Arx mRNA expression pattern in the mouse testiswas similar to that in the tammar testis, especially inspermatogenic cells. There was no detectable stainingin the spermatogonia and somatic cells (Fig. 7A, B, C,and D), but strong expression was detected in the primaryand secondary spermatocytes as well as round spermatids(Fig. 7A, B, C, and D). At later stages of the spermatogeniccycle, there was very weak staining in the cytoplasm ofelongated spermatids (Fig. 7A), but no mRNA stainingwas detected in the mature spermatozoa (Fig. 7B).

Discussion

Comparative analysis of ARX/Arx in tammars and micesuggests that it has a highly conserved expression patternduring spermatogenesis, despite its different chromo-somal location in these two species (X-linked in micevs autosomal in marsupials). This study is the first todemonstrate that ARX may have a highly conserved rolein spermatogenesis in addition to its established rolesin neurogenesis.

Evolution and conservation of ARX

ARX has a conserved five-exon gene structure acrosseutherian and marsupial mammals and fruit flies. ARX ishighly conserved at the protein level, with up to 93%identity between tammars and opossums, 85% withprimates, and 56% with zebrafish (Fig. 1B). Conservationis even higher across the functional domains, such asthe octapeptide domain, nuclear localization domain,homeodomain, and aristaless domain from the amphi-bian Xenopus to eutherian mammals. As in the mouse,the tammar ARX has three nuclear localization signals(NLS) that are identical to those of other species,consistent with their conserved role in directing andimporting ARX into the nucleus, possibly mediated byimportin (Lin et al. 2009, Shoubridge et al. 2010). Thus,ARX has been highly conserved despite its physicalrelocation in the genome from an autosome to the XARof the eutherian X chromosome (Delbridge et al. 2008).

ARX has conserved roles in early development. Thestrong mRNA staining of neural cells in the forebrain,midbrain, and hindbrain suggests that ARX plays apivotal role in CNS development in tammars as it does in

Reproduction (2014) 147 279–289

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

Figure 6 mRNA in situ showing ARX localization in tammar adult testis. In situ hybridization of adult tammar testes with antisense ARX. mRNAdistribution is indicated by dark blue staining and tissue is counterstained with 0.1% Nuclear Fast Red. Tammar ARX was strongly expressed in theround spermatids (RS) throughout all stages (A, B, C, D, E, F, and G) and there was no expression in the spermatogonia (SG), but there was stage-specific expression in other spermatogenic cells from the spermatocytes (SP) to the elongating spermatids (ES). At early stage I (A), ARX was expressedin the SP and some of the Leydig cells (LC) and peritubular myoid cells (PC) in the seminiferous cord. Slightly later in spermatogenesis at stage I (B),ARX was expressed in the RS and some of the LC, but in no other spermatogenic cells and Sertoli cells (SC). At stage IV (C), ARX was still stronglyexpressed in the RS, but weakly in the cytoplasm of ES. By stage V/VI (D), ARX was restricted to the RS. With the continuation of spermatogenesis(stage VIII, E), ARX was observed in the SP again besides the RS. At the early stage of spermatogenesis (F) and later stages (G), there was a dynamicexpression of ARX in the LC but no expression in the SG in all the stages. The stages of spermatogenesis are described in Tyndale-Biscoe & Renfree(1987). SG, spermatogonia; SP, spermatocytes; RS, round spermatids; ES, elongating/elongated spermatids; SZ, spermatozoa; LC, Leydig cells;PC, peritubular myoid cells; SC, Sertoli cells. Scale barZ100 mm.

286 H Yu and others

mice (Kitamura et al. 2002, Seufert et al. 2005). Thesimilarity in tammar and murine ARX/Arx localization inthe developing olfactory bulbs suggests that ARX isimportant for the normal development of this organ(Yoshihara et al. 2005). The mRNA distribution both inthe olfactory epithelium and in the VNO suggests thatARX could be important for developing the sense ofsmell that is so essential for directing newborn wallabiesinto the pouch to locate the teats (Schneider et al. 2009).Taken together, the conserved expression pattern in thedeveloping brain of marsupials and mice suggests thatARX is a critical gene for brain development throughouttherian mammalian evolution. Strong mRNA stainingwas also observed in the epithelium of the tongue andpalate and in the underlying muscle. Early tonguedevelopment is especially important in the head of thenewborn marsupial, which must be able to attach to thenipple and suck at the very early stages of development(Hughes & Hall 1988).

No obvious differences based on the RT-PCR weredetected between the developing testis and ovary intammar wallabies, similar to mice (Kitamura et al. 2002).The mRNA cellular location (Fig. 5) is similar to thepattern shown using whole-mount in situ hybridizationof the mouse E11.5 testes (Colombo et al. 2004) and

Reproduction (2014) 147 279–289

E14.5 gonads (Kitamura et al. 2002). Tammar ARXmRNA had a restricted pattern of expression in adulttissues with the highest expression in the adult testis andextremely weak expression in the olfactory bulb,adrenal, ovary, and muscle. By contrast, ARX is highlyexpressed in skeletal muscle in humans (Ohira et al.2002, Stromme et al. 2002).

ARX escapes meiotic sex chromosome inactivationduring spermatogenesis

This is the first report of the mRNA expression of ARX inthe adult testis of any mammal during spermatogenesis.The spermatogenic cycle of the germ cells in the testis iscoordinated and maintained by the somatic cellsincluding the Sertoli cells, peritubular myoid cells, andLeydig cells that participate in spermatogenesis via theirresponse to gonadotrophic signals (LH and FSH) from thehypothalamic–pituitary–testicular axis (Roser 2008, Yanet al. 2008, He et al. 2009, Li et al. 2009, Walker 2009,Cheng et al. 2010). However, most of the genes on thesex chromosomes are silenced during the meiotic phaseof spermatogenesis by a process known as meiotic sexchromosome inactivation (MSCI), but are active in themitotic stage and early meiosis (Hornecker et al. 2007,

www.reproduction-online.org

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

Figure 7 Arx localization in the adult mouse testis. mRNA in situhybridization of adult mouse testes with antisense mouse Arx. mRNAlocalization is indicated by dark blue staining and tissue is counter-stained with 0.1% Nuclear Fast Red. At stage II (A), Arx mRNA wasmainly localized to the cytoplasm of SP and RS and there was noexpression in SG, PC, and LC; at stage VII (B), Arx was also expressed inthe cytoplasm of SP and RS, but no expression was detected in SG andSZ; at stage X (C), Arx was stained in SP and weakly in ES, but nostaining was found in SG and LC; at stage XI (D), Arx was only detectedin RS, but not in SG, ES, and SC. The stages of spermatogenesis aredescribed in Hess & de Franca (2008). The abbreviations are the sameas those in Fig. 6. Scale barZ100 mm.

ARX has a novel role in spermatogenesis 287

Cloutier & Turner 2010). Tammar ARX is autosomal, butmouse Arx is X-linked. We examined the change in theexpression of ARX/Arx between marsupials and miceduring spermatogenesis to gain insight into how sex andreproduction-related (SRR) genes evolved. While tam-mar ARX can be expressed at any stage of spermatogen-esis due to its autosomal localization, mouse Arx wouldnot be expressed in the meiotic phase of spermatogen-esis if it is silenced by MSCI. Tammar ARX mRNA waspredominantly transcribed in the cytoplasm of sperma-tocytes and round spermatids within the seminiferoustubules, which is similar to that of NANOG expression inthe adult testis (Kuijk et al. 2010). This requiresexpression during meiosis when genes on the sexchromosomes are normally silenced. If mouse Arx issubject to MSCI, it would not be expressed at equivalentstages in the germ cells of the adult testis. To determinewhether this is the case, we carried out mRNA in situhybridization in mouse testes and, surprisingly, found anexpression pattern in the germ line that was almostidentical to that observed in tammar testes. Thus, ARXappears to escape MSCI to maintain its role inpostmeiotic stages of spermatogenesis.

Relationship of autosomal ARX in a marsupial withX-linked Arx in mouse

An important aim of this study was to understand thefundamental question of why a disproportionately high

www.reproduction-online.org

number of testis and brain genes have accumulatedon the human and mouse X chromosomes. It is stillunknown whether the X chromosome has accruedtestis and brain genes during its evolution or whethergenes that find themselves on the X chromosomeevolve these roles. We examined how gene expressionchanged for the ARX gene when it became relocatedfrom an autosome in the therian mammalian ancestorto the X chromosome in eutherians. ARX was originallyautosomal in mammals and remains so in marsupials,making it an excellent comparison to the mouse X-linkedArx. Our findings suggest that ARX/Arx alreadyplayed a role in male reproduction long before it wasrecruited to the X chromosome in eutherians, addingto the pool of data suggesting that the eutherianX chromosome actively recruits testis genes (Saifi &Chandra 1999, Wang et al. 2001, Vallender & Lahn 2004,Mueller et al. 2008).

Our investigations also uncovered the previouslyunreported dynamic expression of ARX/Arx duringspermatogenesis. However, as yet, there is no directevidence to confirm a functional role for ARX/Arx inspermatogenesis. In mice, mutations in Arx cause earlypostnatal death (Kitamura et al. 2002), making itimpossible to examine the function of Arx in spermato-genesis in adults. A conditional knockout approachis needed to clarify this question. In non-traditionalmodel species such as marsupials, functional analysesare extremely difficult and it is not possible at presentto generate a transgenic or conditional transgenictammar. However, X-linked ARX/Arx mRNA is expressedin spermatocytes and round spermatids in bothtammars and mice maintaining this profile of expressionfor over 160 million years of divergent evolution (Fig. 7).In addition, if mouse Arx is subject to MSCI, it wouldnot be expressed at these stages in the germ cells ofthe adult testis. Our study provides strong evidence thatArx must escape MSCI. Thus, we postulate that thedynamic expression of Arx/ARX during spermatogenesisin both mice and tammars is highly suggestive of apotential role in spermatogenesis.

Conclusions

A similar but subtly different expression pattern duringspermatogenesis between tammars and mice highlightsthe similarities in the basic processes of gametogenesisin marsupial and eutherian mammals. Although ARXis located on an autosome in tammars and not onthe X chromosome as in eutherians, its expression doesnot appear to have been altered. This lends supportto the theory that the mammalian X chromosomemay selectively acquire SRR genes, rather than suchgenes evolving SRR functions after relocation to theX chromosome. Mouse Arx escapes MSCI duringspermatogenesis, suggesting that it has a potentiallyimportant function in mammalian spermatogenesis that

Reproduction (2014) 147 279–289

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

288 H Yu and others

has remained highly conserved for over 160 millionyears.

Declaration of interest

The authors declare that there is no conflict of interest thatcould be perceived as prejudicing the impartiality of theresearch reported.

Funding

This study was supported by the Australian Research CouncilCentre of Excellence in Kangaroo Genomics, a FederationFellowship to M B Renfree, and a National Health and MedicalResearch Council R D Wright Fellowship to A J Pask, and anNHMRC project grant to M B Renfree, G Shaw, and A J Pask.

Acknowledgements

The authors thank all the members of the tammar research team.

References

Alsop AE, Miethke P, Rofe R, Koina E, Sankovic N, Deakin JE, Haines H,Rapkins RW & Marshall Graves JA 2005 Characterizing the chromo-somes of the Australian model marsupial Macropus eugenii (tammarwallaby). Chromosome Research 13 627–636. (doi:10.1007/s10577-005-0989-2)

Biressi S, Messina G, Collombat P, Tagliafico E, Monteverde S, Benedetti L,Cusella De Angelis MG, Mansouri A, Ferrari S, Tajbakhsh S et al. 2008The homeobox gene Arx is a novel positive regulator of embryonicmyogenesis. Cell Death and Differentiation 15 94–104. (doi:10.1038/sj.cdd.4402230)

Cheng CY, Wong EW, Yan HH & Mruk DD 2010 Regulation ofspermatogenesis in the microenvironment of the seminiferousepithelium: new insights and advances. Molecular and CellularEndocrinology 315 49–56. (doi:10.1016/j.mce.2009.08.004)

Cloutier JM & Turner JM 2010 Meiotic sex chromosome inactivation.Current Biology 20 R962–R963. (doi:10.1016/j.cub.2010.09.041)

Cobos I, Broccoli V & Rubenstein JL 2005 The vertebrate ortholog ofAristaless is regulated by Dlx genes in the developing forebrain.Journal of Comparative Neurology 483 292–303. (doi:10.1002/cne.20405)

Colasante G, Sessa A, Crispi S, Calogero R, Mansouri A, Collombat P &Broccoli V 2009 Arx acts as a regional key selector gene in the ventraltelencephalon mainly through its transcriptional repression activity.Developmental Biology 334 59–71. (doi:10.1016/j.ydbio.2009.07.014)

Collombat P, Mansouri A, Hecksher-Sorensen J, Serup P, Krull J,Gradwohl G & Gruss P 2003 Opposing actions of Arx and Pax4 inendocrine pancreas development. Genes and Development 172591–2603. (doi:10.1101/gad.269003)

Collombat P, Hecksher-Sorensen J, Broccoli V, Krull J, Ponte I, Mundiger T,Smith J, Gruss P, Serup P & Mansouri A 2005 The simultaneous lossof Arx and Pax4 genes promotes a somatostatin-producing cellfate specification at the expense of the alpha- and beta-cell lineagesin the mouse endocrine pancreas. Development 132 2969–2980.(doi:10.1242/dev.01870)

Colombo E, Galli R, Cossu G, Gecz J & Broccoli V 2004 Mouseorthologue of ARX, a gene mutated in several X-linked forms of mentalretardation and epilepsy, is a marker of adult neural stem cells andforebrain GABAergic neurons. Developmental Dynamics 231 631–639.(doi:10.1002/dvdy.20164)

Delbridge ML & Graves JA 2007 Origin and evolution of spermatogenesisgenes on the human sex chromosomes. Society of Reproduction andFertility Supplement 65 1–17.

Reproduction (2014) 147 279–289

Delbridge ML, McMillan DA, Doherty RJ, Deakin JE & Graves JA 2008Origin and evolution of candidate mental retardation genes on thehuman X chromosome (MRX). BMC Genomics 9 65. (doi:10.1186/1471-2164-9-65)

Delbridge ML, Patel HR, Waters PD, McMillan DA & Marshall Graves JA2009 Does the human X contain a third evolutionary block? Origin ofgenes on human Xp11 and Xq28 Genome Research 19 1350–1360.(doi:10.1101/gr.088625.108)

El-Hodiri HM, Qi XL & Seufert DW 2003 The Xenopus arx gene isexpressed in the developing rostral forebrain. Development Genes andEvolution 212 608–612. (doi:10.1007/s00427-002-0282-8)

Friocourt G, Poirier K, Rakic S, Parnavelas JG & Chelly J 2006 The role ofARX in cortical development. European Journal of Neuroscience 23869–876. (doi:10.1111/j.1460-9568.2006.04629.x)

Fullenkamp AN & El-Hodiri HM 2008 The function of the Aristaless-relatedhomeobox (Arx) gene product as a transcriptional repressor is diminishedby mutations associated with X-linked mental retardation (XLMR).Biochemical and Biophysical Research Communications 377 73–78.(doi:10.1016/j.bbrc.2008.09.116)

Gecz J, Cloosterman D & Partington M 2006 ARX: a gene for all seasons.Current Opinion in Genetics & Development 16 308–316. (doi:10.1016/j.gde.2006.04.003)

Graves JA 2006 Sex chromosome specialization and degeneration inmammals. Cell 124 901–914. (doi:10.1016/j.cell.2006.02.024)

Graves JA 2008 Weird animal genomes and the evolution of vertebratesex and sex chromosomes. Annual Review of Genetics 42 565–586.(doi:10.1146/annurev.genet.42.110807.091714)

He Z, Kokkinaki M & Dym M 2009 Signaling molecules and pathwaysregulating the fate of spermatogonial stem cells. Microscopic Researchand Technique 72 586–595. (doi:10.1002/jemt.20698)

Heller RS, Jenny M, Collombat P, Mansouri A, Tomasetto C, Madsen OD,Mellitzer G, Gradwohl G & Serup P 2005 Genetic determinants ofpancreatic epsilon-cell development. Developmental Biology 286217–224. (doi:10.1016/j.ydbio.2005.06.041)

Hess RA & de Franca LR 2008 Spermatogenesis and Cycle of theSeminiferous Epithelium. In molecular mechanisms in spermatogenesis(Advances in Experimental Medicine and Biology, vol 636), pp. 1–15.Ed Yan Cheng C. Texas: Landes Bioscience/Springer ScienceCBusinessMedia.

Hornecker JL, Samollow PB, Robinson ES, Vandeberg JL & McCarrey JR2007 Meiotic sex chromosome inactivation in the marsupial Mono-delphis domestica. Genesis 45 696–708. (doi:10.1002/dvg.20345)

Hughes RL &Hall LS 1988 Structural adaptations of the newborn marsupial.In The Developing Marsupial, pp. 8–27. Eds Tyndale-Biscoe CH andJanssens PA. Berlin: Springer-Verlag.

Kelly LE, Davy BE, Berbari NF, Robinson ML & El-Hodiri HM 2005Recombineered Xenopus tropicalis BAC expresses a GFP reporter underthe control of Arx transcriptional regulatory elements in transgenicXenopus laevis embryos. Genesis 41 185–191. (doi:10.1002/gene.20113)

Kitamura K, Yanazawa M, Sugiyama N, Miura H, Iizuka-Kogo A, Kusaka M,Omichi K, Suzuki R, Kato-Fukui Y, Kamiirisa K et al. 2002 Mutationof ARX causes abnormal development of forebrain and testes in miceand X-linked lissencephaly with abnormal genitalia in humans. NatureGenetics 32 359–369. (doi:10.1038/ng1009)

Kuijk EW, de Gier J, Lopes SM, Chambers I, van Pelt AM, Colenbrander B &Roelen BA 2010 A distinct expression pattern in mammalian testesindicates a conserved role for NANOG in spermatogenesis. PLoS ONE 5e10987. (doi:10.1371/journal.pone.0010987)

Li MW, Mruk DD, Lee WM & Cheng CY 2009 Cytokines and junctionrestructuring events during spermatogenesis in the testis: an emergingconcept of regulation. Cytokine & Growth Factor Reviews 20 329–338.(doi:10.1016/j.cytogfr.2009.07.007)

Lin W, Ye W, Cai L, Meng X, Ke G, Huang C, Peng Z, Yu Y, Golden JA,Tartakoff AM et al. 2009 The roles of multiple importins for nuclearimport of murine aristaless-related homeobox protein. Journal ofBiological Chemistry 284 20428–20439. (doi:10.1074/jbc.M109.004242)

McKenzie O, Ponte I, Mangelsdorf M, Finnis M, Colasante G,Shoubridge C, Stifani S, Gecz J & Broccoli V 2007 Aristaless-relatedhomeobox gene, the gene responsible for West syndrome and related

www.reproduction-online.org

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access

ARX has a novel role in spermatogenesis 289

disorders, is a Groucho/transducin-like enhancer of split dependenttranscriptional repressor. Neuroscience 146 236–247. (doi:10.1016/j.neuroscience.2007.01.038)

Melkman T & Sengupta P 2005 Regulation of chemosensory andGABAergic motor neuron development by the C. elegans Aristaless/Arx homolog alr-1. Development 132 1935–1949. (doi:10.1242/dev.01788)

Miura H, Yanazawa M, Kato K & Kitamura K 1997 Expression of a novelaristaless related homeobox gene ‘Arx’ in the vertebrate telencephalon,diencephalon and floor plate. Mechanisms of Development 65 99–109.(doi:10.1016/S0925-4773(97)00062-2)

Mueller JL, Mahadevaiah SK, Park PJ, Warburton PE, Page DC & Turner JM2008 The mouse X chromosome is enriched for multicopy testis genesshowing postmeiotic expression. Nature Genetics 40 794–799. (doi:10.1038/ng.126)

Ogata T, Matsuo N, Hiraoka N & Hata JI 2000 X-linked lissencephaly withambiguous genitalia: delineation of further case. American Journal ofMedical Genetics 94 174–176. (doi:10.1002/1096-8628(20000911)94:2!174::AID-AJMG11O3.0.CO;2-O)

Ohira R, Zhang YH, Guo W, Dipple K, Shih SL, Doerr J, Huang BL, Fu LJ,Abu-Khalil A, Geschwind D et al. 2002 Human ARX gene: genomiccharacterization and expression. Molecular Genetics and Metabolism 77179–188. (doi:10.1016/S1096-7192(02)00126-9)

Ohno S 1967 Sex Chromosomes and Sex Linked Genes. Springer-Verlag,Berlin, Heidelberg, New York. 192 pp.

Poirier K, Van Esch H, Friocourt G, Saillour Y, Bahi N, Backer S, Souil E,Castelnau-Ptakhine L, Beldjord C, Francis F et al. 2004 Neuroanatomicaldistribution of ARX in brain and its localisation in GABAergic neurons.Brain Research. Molecular Brain Research 122 35–46. (doi:10.1016/j.molbrainres.2003.11.021)

Poole WE, Simms NG, Wood JT & Lubulwa M 1991 Tables for agedetermination of the Kangaroo Island wallaby (tammar), Macropuseugenii, from body measurements. In Technical memorandum No. 32.Division of Wildlife and Ecology, CSIRO, Canberra, Australia.

Renfree MB, O WS, Short RV & Shaw G 1996 Sexual differentiation of theurogenital system of the fetal and neonatal tammar wallaby, Macropuseugenii. Anatomica Embryology 194 111–134.

Ropers HH&Hamel BC 2005 X-linked mental retardation. Nature Reviews.Genetics 6 46–57. (doi:10.1038/nrg1501)

Roser JF 2008 Regulation of testicular function in the stallion: an intricatenetwork of endocrine, paracrine and autocrine systems. AnimalReproduction Science 107 179–196. (doi:10.1016/j.anireprosci.2008.05.004)

Ross MT, Grafham DV, Coffey AJ, Scherer S, McLay K, Muzny D, Platzer M,Howell GR, Burrows C, Bird CP et al. 2005 The DNA sequence ofthe human X chromosome. Nature 434 325–337. (doi:10.1038/nature03440)

Saifi GM & Chandra HS 1999 An apparent excess of sex- and reproduction-related genes on the human X chromosome. Proceedings. BiologicalSciences 266 203–209. (doi:10.1098/rspb.1999.0623)

Sambrook J & Russell DW 2001 Molecular cloning: a laboratory manual.Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.999 pp.

www.reproduction-online.org

Schneider NY, Fletcher TP, Shaw G & Renfree MB 2009 The olfactorysystem of the tammar wallaby is developed at birth and directs theneonate to its mother’s pouch odours. Reproduction 138 849–857.(doi:10.1530/REP-09-0145)

Schneitz K, Spielmann P & Noll M 1993 Molecular genetics of aristaless,a prd-type homeo box gene involved in the morphogenesis of proximaland distal pattern elements in a subset of appendages in Drosophila.Genes and Development 7 114–129. (doi:10.1101/gad.7.1.114)

Seufert DW, Prescott NL & El-Hodiri HM 2005 Xenopus aristaless-relatedhomeobox (xARX) gene product functions as both a transcriptionalactivator and repressor in forebrain development. DevelopmentalDynamics 232 313–324. (doi:10.1002/dvdy.20234)

Shoubridge C, Tan MH, Fullston T, Cloosterman D, Coman D,McGillivray G, Mancini GM, Kleefstra T & Gecz J 2010 Mutations inthe nuclear localization sequence of the Aristaless related homeobox;sequestration of mutant ARX with IPO13 disrupts normal subcellulardistribution of the transcription factor and retards cell division.PathoGenetics 3 1. (doi:10.1186/1755-8417-3-1)

Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L,Brown LG, Repping S, Pyntikova T, Ali J, Bieri T et al. 2003 The male-specific region of the human Y chromosome is a mosaic of discretesequence classes. Nature 423 825–837. (doi:10.1038/nature01722)

Stromme P, Mangelsdorf ME, Shaw MA, Lower KM, Lewis SM, Bruyere H,Lutcherath V, Gedeon AK, Wallace RH, Scheffer IE et al. 2002 Mutationsin the human ortholog of Aristaless cause X-linked mental retardationand epilepsy. Nature Genetics 30 441–445. (doi:10.1038/ng862)

Tyndale-Biscoe CH & Renfree MB 1987 Reproductive Physiology ofMarsupials. Cambridge: Cambridge University Press, 476 pp.

Vallender EJ & Lahn BT 2004 How mammalian sex chromosomes acquiredtheir peculiar gene content. Bioessays 26 159–169. (doi:10.1002/bies.10393)

Veyrunes F, Waters PD, Miethke P, Rens W, McMillan D, Alsop AE,Grutzner F, Deakin JE, Whittington CM, Schatzkamer K et al. 2008Bird-like sex chromosomes of platypus imply recent origin of mammal sexchromosomes. Genome Research 18 965–973. (doi:10.1101/gr.7101908)

WalkerWH2009 Molecular mechanisms of testosterone action in spermato-genesis. Steroids 74 602–607. (doi:10.1016/j.steroids.2008.11.017)

Wang PJ, McCarrey JR, Yang F & Page DC 2001 An abundance of X-linkedgenes expressed in spermatogonia. Nature Genetics 27 422–426.(doi:10.1038/86927)

Yan HH, Mruk DD & Cheng CY 2008 Junction restructuring andspermatogenesis: the biology, regulation, and implication in malecontraceptive development. Current Topics in Developmental Biology80 57–92. (doi:10.1016/S0070-2153(07)80002-0)

Yoshihara S, Omichi K, Yanazawa M, Kitamura K & Yoshihara Y 2005 Arxhomeobox gene is essential for development of mouse olfactory system.Development 132 751–762. (doi:10.1242/dev.01619)

Received 7 August 2013

First decision 9 September 2013

Revised manuscript received 2 December 2013

Accepted 4 December 2013

Reproduction (2014) 147 279–289

Downloaded from Bioscientifica.com at 08/20/2020 07:52:29AMvia free access