RealTime ready Universal ProbeLibrary Redefining …...RealTime ready Universal ProbeLibrary Redefine and revolutionize real-time qPCR assays Based on only 165 short hydrolysis probes

RealTime ready Universal ProbeLibrary

Redefining and revolutionizing real-time qPCR assays

Universal ProbeLibrary – Technology 4

Technology 4

Coverage Rate 4

Multiplex Assays 5

Universal ProbeLibrary – Assay Design 6

ProbeFinder Software 6

In silico PCR 6

Design Multiplex Assays 6

Assay Design Process 6

Input Formats for Target Specification 8

Other Organisms 8

Entering Multiple Sequences (Batch Design) 8

Universal ProbeLibrary – Performance Data 9

Comparison to SYBR Green I Assays 9

Quantification of Zea mays mRNAs 10

Comparison of hydrolysis probe assay to UPL on the LightCycler® 480 Instrument 11

Universal ProbeLibrary Assay List 12

Universal ProbeLibrary – Step by Step Assay Design Guide 13

Choose an Organism 14

Specify Your Target 14

Examine the Result 17

View Additional Assays 19

See All Assays 20

Entering Multiple Sequences 21

Make Your Choice 25

Additional Information 26

Glossary 26

Ordering Information 30

2

Design gene expression assays and quantify virtually any transcript in any

genome by using the unique combination of rapid, online assay design and

165 probes. Choose from transcriptome specific sets of 90 probes, the complete

library, or select individual probes for your specific design.

RealTime ready

RealTime readyUniversal ProbeLibrary

Redefine and revolutionize real-time qPCR assays

Based on only 165 short hydrolysis probes and an easy-to-use and fast assay

design software Universal ProbeLibrary (UPL) allows you to design real-time

qPCR assays in seconds and to analyze over five million transcripts of a large

variety of organisms.

3

� Significantly reduce assay design time –in just seconds, design specific, intron-spanning assays for multipleorganisms with the free, web-based ProbeFinder software, available at www.universalprobelibrary.com

� Rely on probe-based qPCR assays that work first time –there is no need to wait for an assay or custom probe or spend weeks on assay optimization.

� Reduce the costs of gene expression quantitation –by performing multiplex assays with UPL Reference Gene Assays.

� Utilize standard protocols on any real-time PCR instrument –no special hardware or reaction conditions required.

4

RealTime ready Universal ProbeLibrary – Technology

Perform millions of qPCR assays for any sequenced organismwith only 165 short hydrolysis probes

Technology

Technology

Universal ProbeLibrary is based on only 165 shorthydrolysis probes, labeled at the 5' end with fluorescein (FAM) and at the 3' end with a darkquencher dye.

The extensive transcript coverage of the UPL probesis due to their short length of just 8–9 nucleotidesand the selected sequences. In order to maintain thespecificity and melting temperature that hybridizingqPCR probes require, Locked Nucleic Acids (LNA)are incorporated into the sequence of each UPLprobe. LNA’s are DNA nucleotide analogues withincreased binding strengths compared to standardDNA nucleotides.

The sequences of the 165 UPL probes have beencarefully selected to detect 8- and 9-mer motifs thatare highly prevalent in the transcriptomes, ensuringoptimal coverage of all transcripts in a given tran-scriptome. Within the human transcriptome, eachprobe binds to approximately 7000 transcripts,while each transcript is detected by approximately16 different probes. Only one specific transcript is detected at a time in a given PCR assay, as definedby the set of chosen PCR primers. A specific real-time PCR assay is designed by a simple two-stepprocedure using the ProbeFinder Software, onlineavailable at the Assay Design Center. For each assay,the design software suggests an optimal set of PCR primers, a probe, and any possible alternativecombinations.

Coverage Rate

94 – 99 % of all transcripts of the organisms thatcan be selected on the Assay Design Center can bedetected with a UPL assay. A large number of thoseare intron-spanning (Table 1). For all other orga-nisms assays can be designed with a high successrate, when entering the specific sequence information.

� Table 1: Organism-Specific Coverage Rate of UPLProbes

Organism Species No of Coverage Assays Rate

Human Homo sapiens > 639 500 99%

Mouse Mus musculus > 509 500 99%

Rat Rattus norvegicus > 364 000 98%

Primates Pan troglodytes > 519 500 96%

Drosophila Drosophila > 253 500 99% melanogaster

Arabidopsis Arabidopsis > 199 000 98% thaliana

C. elegans Caenorhabditis > 134 000 95% elegans

Maize Zea mays > 61 500 94%

Rice Oryza sativa > 898 500 98%

Zebrafish Danio rerio > 630 000 98%

Yeast Saccharomyces > 42 000 95% cerevisiae

Total > 5 000 000

Organism Species No of Coverage Assays Rate

Product ConceptUPL assays are compatible with all real-time PCRinstruments capable of detecting fluorescein, FITC, FAM, and/or SYBR Green I. UPL probes maybe purchased either individually or as part of preconfigured sets with 90 probes each, for human,mouse and rat. The complete library is obtainedwhen ordering the Universal ProbeLibrary Set,

Human, containing probes # 1 – 90 and the UniversalProbeLibrary Extension Set, containing probes # 91 to 165.

Note: PCR primers are not included with the Universal ProbeLibrary Sets, but can be orderedfrom any oligonucleotide supplier.

Multiplex Assays with Universal ProbeLibrary Reference Gene Assays

Use the Universal ProbeLibrary Reference GeneAssays together with the UPL probes to easily quantifyexpression levels of a human, mouse, or rat gene of interest in relation to an endogenous reference genein a dual-color assay. Four reference gene assays are available for human (Human PBGD-, HPRT-,ACTB-, and PGK1 Gene), two for mouse and rat(ACTB-, and GAPD Gene each).

Each Universal ProbeLibrary Reference Gene Assayprovides a specifically designed 12-mer UPL refe-rence gene probe and the corresponding referencegene-specific primer pair in a separate tube. Theprobe is labeled with LightCycler® Yellow 555 at the5’-end and with a dark quencher dye near the 3’-end, to enable dual-color assays in combinationwith the standard UPL probes, which are labeledwith FAM. The UPL reference gene probes can bedetected using real-time PCR instruments withexcitation filters of 470 nm to 530 nm and emissionfilters of 550 nm to 610 nm.

The design of multiplex PCR assays for a targetgene and a UPL Reference Gene Assay is facilitatedby the free web-based ProbeFinder software at theAssay Design Center.

5

Assay Design

PerformanceData

Assay DesignGuide

AdditionalInformation

Technology

LNA Technology

Locked Nucleic Acids (LNA) is a class ofnucleic acids analogues, where the ribosering is “locked” with a methylene bridgeconnecting the 2’-O atom with the 4’-C atom(see structure). LNA nucleosides containingthe six common nucleobases (T, C, G, A, Uand mC) are able to form base-pairs withtheir complementary nucleosides accordingto the standard base pairing rules. Therefore,LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleo tide wheneverdesired. The locked ribose conformationenhances base stacking and backbone pre-organization, this gives rise to an increasedthermal stability and dis criminative power ofduplexes.

Pervect Match Singe Mismatch

3’-ACGACCAC-5’ 3’-ACGGCCAC-5 �Tm

LNA 8-mer

5’-TGCTGGTG-3’ 71 °C 45 °C 26 °C

DNA 8-mer

5’-TGCTGGTG-3’ 35 °C 25 °C 10 °C

Perfect Match Single Mismatch

� Figure 1: Typical dual-color qPCR results using theUniversal ProbeLibrary Reference Gene Assays. cDNA dilutions were amplified in mono- and dual-color assayson the LightCycler® 480 Instrument and detected either (a) inthe FAM channel or (b) in the LightCycler® Yellow 555 channel.

ProbeFinder Software

ProbeFinder is a web-based software tool, that is usedin combination with the UPL probes. Based on theuser-defined target information the software designsreal-time PCR assays by combining a suitable UPLprobe with a set of target specific PCR primer pairs.Together, the probe and PCR primers constitute aspecific real-time PCR assay for a given target. Probe -Finder assay design software is based on Primer3software using optimized settings as default, to givebest results with UPL probes without any furtheroptimization of assay conditions, as described in theproduct information. Experienced Primer3 users can modifiy these settings before they start assaydesign. (Details about used Primer3 settings can befound in the Glossary.)

In silico PCR

All primer pairs designed by ProbeFinder are checkedby an in-house developed in silico PCR algorithm.The algorithm searches the relevant genome andtranscriptome for possible mis-priming sites for eitherof the two PCR primers. If any of the identifiedmis-priming sites are positioned in the genome orthe transcriptome in a way that could potentially give rise to an un in tended amplicon, the assay is down-graded in the list of available assays and flagged as having failed the in silico PCR check.

Design of Multiplex Assays withHuman, Mouse or Rat Reference Genes

When the option “Design multiplex PCR with reference gene” is chosen, ProbeFinder will conductassay design for your gene of interest, while at thesame time subjecting each of these designs to an insilico test to evaluate its ability to be multiplexedwith the selected UPL reference gene assays. The insilico PCR for multiplex assays, takes the followingparamenter into consideration:

• Primer-primer interactions • Primer-probe interactions • Probe-probe interactions• Probe-amplicon interactions (to prevent the

probe from incorrectly generating signal on the amplicon)

• In silico PCR with all 4 primers (to prevent amplification of undesired cDNA fragments)

Assay Design Process

ProbeFinder performs a number of steps to selectthe optimal real-time PCR probe from the UniversalProbeLibrary in combination with a set of PCR primers. The following databases are available toProbeFinder: h_sap_gene, h_sap_exon, h_sap_refseq,h_sap_embl, h_sap_genome. Database updates are done regularly. (Details about data bases and sequence identifierscan be found in the Glossary.)The in silico PCR function minimizes:

� Risk of false assay signals from genomic DNA � Risk of false assay signals from unrelated

transcripts generated by splice variants or homo logous genes/gene family members

� Detection of pseudogenes � Targeting of genes with introns that are too

short for effective intron-spanning assays

Technology

6

RealTime ready Universal ProbeLibrary – Assay Design

Utilize the free, online ProbeFinder assay design softwareat www.universalprobelibrary.com to generate qPCRassays for virtually any transcript of any organism

PerformanceData

Assay DesignGuide


Assay Design

Technology

7

PerformanceData

Assay DesignGuide


� Locate exon-exon junctions

� Find appropriate UPL probe

� Design PCR primer for each target site

� Rank the availableassays to

� Display results

Introns are identified by one of following methods:• Look-up in Ensembl (if available)• Prediction by in house algorithm based on BLAST• User annotated in the input sequence

ProbeFinder uses the following criteria when predicting introns: • The identity must be at least 95% certain • The exon must be at least 40 nucleotides long • The intron must be at least 30 nucleotides long

• Search input sequence for UPL probes target sites avoiding known human SNP’s (only for Ensembl sequences).

• The human, mouse and rat design relies on the 90 probes of the respective organismspecific UPL sets where as the remaining are based on the complete 165 UPL probes

• Search the genome to ensure primer uniqueness • Search for gene family members and splice variants• Perform in silico PCR

• Favour a unique assay without cross hybridizations to other areas of the genome (in silico PCR)

• Favour intron spanning amplicons to remove false signals from contaminating genomic DNA

• Favour a small amplicon size for reproducible and robust assays• Best multiplex combination with selected reference gene

• ProbeFinder always displays the best assay according to the above described rankingcriteria. Assay details contain probe number, primer and amplicon sequence. In addition the “Multiplex PCR with Reference Gene” option is depicted. Results can be downloaded as pdf or text report. More assay details are shown in the“TranscriptOverview” or the “Detailed View”. When a sequence identifier from the GenBank/EMBL(e.g. ENST00000217133.1) is entered, SNPs of the whole transcript are displayed anddetails can be seen with the mouse over function.

• When the “More Assays” option is selected, all possible assays for your gene of interest(with or without reference gene assays) are displayed in detail so that you select the bestassay for your particular experiment.

Assay Design

Technology

8

PerformanceData

Assay DesignGuide


Input Formats for Target Specification

The assay design process is startet by selecting theappropriate organism and entering target informationin the depicted input windows. Target information can be entered either by geneaccession number, gene name or keyword, or thetarget nucleotide sequence. Accept able entry formatsinclude RefSeq, enBank/EMBL and Ensemblsequence IDs (details about the different sequenceidentifiers can be found in the Glossary). Whengene names or keywords are entered, ProbeFinderprovides results from a number of databases, containing your keyword, to help you select the geneID or nucleotide sequence.

Other Organisms

When your organism of interest is not available inthe drop down menue on the Assay Design Center, you can still use the ProbeFinder software to designassays. The UPL probes can be used to analyze anyorganism, and assays can be designed for anysequence from any organism (or any sequence froma non-natural source) provided that the sequencecontains a probe binding site and correspondingacceptable primer sites. To design an assay for sucha sequence select the button “Other Organisms”and paste the sequence into the “sequence”-field.

Entering Multiple Sequences

The “Batch processing” feature of ProbeFinder allows you to:

� Enter up to 10 different target genes at the same time

� See all results displayed on a single page � Find assays that target splice variants or gene

families

Please note: this feature is currently extended toprocess up to 200 design requests at a time.

Assay Design

Assay Design

Technology

9

Assay DesignGuide


UPL assay performance is comparable to SYBR Green I assays, but no primer-dimers are detected.

Universal ProbeLibrary offers the flexibility of SYBR Green I, by being independent from designing andordering of fluorescence labeled probes. In addition, UPL assays provide a specificity which is comparableto commonly used probe formats, such as hydrolysis probes or HybProbe probes.

RealTime ready Universal ProbeLibrary – Performance Data

NTC

NTC

A

B

� Figure 2: Real-time RT-PCRassays for GAPDH with a dilution series of cDNA on aLightCycler® 2.0 Instrument.

A: Amplification curve of SYBRGreen I assay;

B: Amplification curve of UniversalProbeLibrary assay; NTC = No template control.

Data is kindly provided by AmyJassen, Ph.D., New England PrimateResearch Center, Harvard MedicalSchool. Performance

Data

Technology

Assay Design

Universal ProbeLibrary assays for 20 different maize(Zea mays) mRNA sequences as a representativesubset, indicating whether UPL is suitable for thedetection of maize transcripts. Assays could bedesigned with a high success rate and the majorityshowed excellent performance.In addition the performance of the Universal Probe -Library was tested on two different qPCR plat-forms, the LightCycler® System and a competitor

sequence detection system. Figure 3 shows a repre-sentative result with a primer-probe combinationspecific for phosphoenolpyruvate carboxykinase(PEPCK), a photosynthetic enzyme of intermediateabundance. Universal ProbeLibrary assays workedefficiently on both systems. The crossing pointswere usually slightly lower with the LightCycler®System and this occasionally resulted in a highersensitivity.

10

Quantification of Zea mays mRNAs by real-time PCR using the Universal ProbeLibrary

Assay DesignGuide


PerformanceData

� Figure 3: Comparison of the UPL assayfor PEPCK mRNA on two different platforms.

A: Amplification curves for PEPCK mRNA withthe LightCycler® System (Display modeF1/F3).

B: Amplification curves for PEPCK mRNA acompetitor real-time PCR sequence detectionsystem.

Data kindly provided by Christoph Peterhänsel,RWTH Aachen, Institute for Biology I, Aachen,Germany

A

B

Technology

Assay Design

11

Assay DesignGuide


Comparison of a commercially available hydrolysis probe assay to a Universal ProbeLibrary assay on the LightCycler® 480 Instrument.

GAPDH was amplified from dilutions of a qPCRhuman reference cDNA (BD Biosciences) perfor-ming a UPL assay with probe # 60 and appropriateprimers and a commercially available competitorhydrolysis probe assay for GAPDH.The UPL assay was performed with the same concentrations of primers and probe (900nM primersand 250nM probe) as used in the competitor assay.Both type of assays were run on a LightCycler® 480Instrument.

For both assays the LightCycler® 480 Probes Masterwas used.Both assays perform with optimal PCR efficiency ofapprox. E = 2.The Universal ProbeLibrary assay for GAPDH createsslightly earlier crossing points than the competitorassay.

PerformanceData

Figure 4: Real-time RT-PCR assays for GAPDH with a dilution series of commercially available cDNA on a LightCycler® 480 Instrument; A: Amplification curve of a commercially available hydrolysis probe assay; (primer conc. 900nM, probe conc. 250nM)B: Amplification curve of a Universal ProbeLibrary assay with elevated primer (900nM) and probe (250nM) concentrations.

Please visit the Universal ProbeLibrary site, www.universalprobelibrary.com for customer statements andmore data in numerous applications.

A B

Technology

Assay Design

12


Universal ProbeLibrary Assay List

A constantly growing compilation of successfully designed and used assays is provided on the UniversalProbeLibrary internet page www.universalprobelibrary.com, also accessible via the Roche Applied Sciencehome page. You may add your own Universal ProbeLibrary assays as well as recommendations or hints forother scientists.

Assay DesignGuide

PerformanceData

Technology

Assay Design

PerformanceData

13


Step by Step Guide through Universal ProbeLibrary Assay Design

To access the ProbeFinder Assay Design Center, point your browser to www.universalprobelibrary.comIn the left navigation bar, click on Assay Design Center.

Assay DesignGuide

Technology

Assay Design

PerformanceData

14


� Choose an Organism

On the Assay Design Center screen select your organism of interest from the dropdown menu to get to the target input screen. When your organism of interest is not available in the drop down menu, you can stilldesign an assay by selecting “Other Organism”. In this case, you are asked to providethe sequence of the transcript, for which you want to design an assay (please refer tothe option “Paste a Sequence”.)

� Specify your Target

��

Assay DesignGuide

Step by Step Guide, continued

Technology

Assay Design

PerformanceData

15


� Option I: Enter a Sequence ID This field accepts sequence identifiers from any of the following databases: Ensembl (e.g., ENST00000158302), RefSeq (e.g., NM_001101), and GenBank/EMBL(e.g., AB062273), gene names or keywords.

� Option II: Paste a SequenceThis field accepts input sequences in either the FASTA or plain text formats. The software accepts standard IUPAC nucleotide symbols (acgtuACGTU), but will ignorespaces, numbers and non-nucleotide characters. When you want to design intron-spanning assays, use opening and closing square brackets [ ] to indicate the positionof exon-exon boundaries. The square brackets may be “empty” or contain a numberto show intron size in the overview graphics, but must not contain characters (e.g.intron sequence information). Otherwise, please deselect the “Automatically select anintron spanning assay” option.

� Option III: Enter a Gene NameWhen you do not know the sequence ID of your target or the sequence itself, simplytype a gene name, e.g., tubulin into the By sequence ID field. When you then click the “Design” button, ProbeFinder will first display all sequence entries from the data-base that include this name in their description. Select one or up to 10 entries andclick “Design”.

Assay DesignGuide

Technology

Assay Design

PerformanceData

16


Option III continued

Before you click the “Design” button you can select:

� a) Reference Gene AssayWhen you want to design a multiplex assay with one of the UPL reference geneassays for human, mouse and rat, please check the respective box.Select “Any” when you want to leave it to ProbeFinder to find the most suitable reference gene assay for your gene of interest or select one of the provided assays inthe check box.

� b) Intron-spanning AssayThe intron-spanning Assay option is active by default. When you do not want todesign intron-spanning assays or did not depict introns in your input sequence bysquare bracket, you must deselect the intron-spanning option first.

When you click “Design” now, ProbeFinder will design the appropriate primers foryour assays and select the best matching UPL probe. In any case ProbeFinder willdisplay the best available multiplex assay.

Assay DesignGuide


Technology

Assay Design

PerformanceData

17


� Examine the Result

The best (highest ranked) real-time PCR assay is presented on the Result screen. TheResult screen has four parts: Assay details, Multiplex details, Transcript overview andDetailed view.

� Assay detailsAssay details (see screen below) lists the number and catalog number of the UPLprobe and provides sequence detailes for the forward and reverse primer and theamplicon.

You can download the detailed product instructions and save the assay details eitheras “Text report” or “PDF report”.

The “Order probes or sets” button takes you to the Roche Applied Science onlinecatalog and ordering. Paste the catalog or probe number of the probe into the e-ShopSearch field to find that probe in the online catalog.

� Multiplex detailsInformation about the multiplex assay that you have choosen or which is recommendedby ProbeFinder are shown. When you click on the small Information Icon � infor-mation about the respective reference gene assay is displayed.

� Transcript overview A graphical overview of the complete target transcript is displayed. The small shadedareas depict the location of the amplicon with the respective UPL probe. When asequence from Ensemble was chosen for target specifications, known SNPs areshown in red and detailes can be seen with the mouse over function.

��

Assay DesignGuide

� Detailed viewIs an enlarged graphical overview of the target transcript region.

Detailes on the different information are obtained when using the mouse over function.

Click the “Zoom In” button below the graphical overview to enlarge the graphic.Clicking other buttons will move the displayed sector (indicated by the rectangle)left or right.

� Figure legend? When you click this button, you get an explanation of the different elements of theresult screen.

Technology

Assay Design

PerformanceData

18



Assay DesignGuide

Technology

Assay Design

PerformanceData

19


� View Additional Assays

Typically, the ProbeFinder software is able to design several real-time PCR assays for a single transcript. The availability of many real-time PCR assays for each transcriptensures that each gene expression result can be cross-evaluated. Also, if the highestranked assay does not fit your needs, you can use one of the other suitable assays.To see a table of alternative real-time PCR assays, click the “More assays” button onthe Result screen.

UPL probes for additional assays are listed in a table and their position is shown in the“Transcript Overview”. Assays are ranked according to the degree of fulfillment ofscoring parameters and marked in decreasing shades of green, indicating whether allranking criteria were met or not. All multiplex options are shown for each assay.When you use “mouse over” the scoring column, additional information about thescoring is provided, which helps to select the optimal assay.

Assay DesignGuide

Technology

Assay Design

PerformanceData

20



� See All Assays

� Click the “see all assays” button to display all assays found by the software,including those that do not meet all design criteria as amplicon size, intron spanning assay in silico PCR and (for human Ensembl) absence of SNPs in primeror probe binding regions. These assays are marked with a brownish color.If you decide to use such an assay, check the “not met” criteria to assure, that theseare not critical for your experiment.

Assay DesignGuide

Technology

Assay Design

PerformanceData

21


� Entering Multiple Sequences

ProbeFinder can process up to 10 designs at a time*, so you can enter multiple targetson the Input screen. These sequences do not all need to be entered in the same format. However, each sequence in the list must be in one of the acceptable entry formats,which include: sequence IDs, gene names, plain text versions of the sequences, orsequences in FASTA format.

If you enter Ensembl Gene IDs (rather than transcript IDs), ProbeFinder will lookup the IDs in the Ensembl database and identify all available transcript variants ofthe input gene. The software will then display a Verification screen, which asks you toidentify which sequence(s) should be considered further.

The Batch Assay feature offers three options for assay design: Batch Assay (defaultoption), Differentiating Assay or Common Assay.

When the results are displayed, you can select one of the following options:

� Batch AssayIn Batch Assay mode, ProbeFinder processes multiple input sequences and displaysassays for each exactly as if each sequence had been input individually. While proces-sing the sequences, the software does not consider any interrelationships between theinput sequences or their available assays. This option provides a convenient way todesign new real-time PCR assays for a large number of sequences.

• On the Sequence Input Screen, enter up to 10 sequence IDs, gene names, or plaintext sequences in any combination. Separate sequence IDs or gene names by comma.

• If you enter several plain text sequences into the ‘By sequence’ field, start eachsequence with the “>” sign and separate them by pressing “Enter”. Avoid the use ofany of the boolean operators AND, OR, NOT.

��

* This feature is currently extended to process up to 200 design requests at a time.

Assay DesignGuide

Technology

Assay Design

PerformanceData

22



Batch Assay continued

The next screen will list all identified sequences. Select those sequences for whichyou want to design an assay by clicking the corresponding check boxes (�) or bychoosing “Select All” (�).

On the Result screen, ProbeFinder will display the best assay for each of the inputsequences. Note that these assays are designed independently of each other.

Note: It is important to realize that the software works on an “all or nothing” principle.If ProbeFinder cannot recognize one of the input sequences, it will not generate aresult for any of the input sequences.

At the bottom of the Result screen, there are buttons for two more options: “Differentiating Assay” and “Common Assay”.

Assay DesignGuide

Technology

Assay Design

PerformanceData

23


� Differentiating AssayIn Differentiating Assay mode, ProbeFinder tries to design assays that uniquely identify(differentiate) each of the input sequences by targeting areas of those sequences thatare distinctly different. The “Differentiating Assay” option is particularly useful whenyou wish to target splice variants of your gene. When you select this option, Probe-Finder applies strict criteria to identify those assays that are specific to each of thesubmitted gene family members or splice variants. If it cannot find a unique design,ProbeFinder will not generate a solution.

To identify assays that are Differentiating Assays, the software performs a new searchthat is similar to the in silico PCR routine performed on each assay during the normal assay design process. The new search is performed only on the input sequencesand does not include any additional database searches. By reducing the scope of the search, the software can apply much tighter parameters without requiring additionalcomputing time.The narrow search also effectively minimizes cross-hybridizationbetween the input sequences.

Differentiating Assay result will be displayed in a different color than the one usedfor a Batch Assay result.

��

Assay DesignGuide


Technology

Assay Design

PerformanceData

24

Assay DesignGuide

� Common AssayIn Common Assay mode, ProbeFinder scans all the available assays and tries to identifyone assay that targets an area found in all the input sequences. The “Common Assay”option is particularly useful when you wish to target all members of a gene family, e.g.;all splice variants, rather than particular splice variants. When you select this mode,ProbeFinder does its utmost to design an assay that will target all the submitted genetranscripts with a single Universal ProbeLibrary probe and primer pair.

Common Assay result will be displayed in a different color than those used for a BatchAssay or a Differentiating Assay result.



Technology

Assay Design

PerformanceData

25

Assay DesignGuide

Make Your Choice

Finally, choose your preferred assay. Then ask any oligonucleotide supplier to synthesizethe PCR primers and deliver them overnight. When the primers arrive, take theappropriate Universal ProbeLibrary probe from your freezer and set up the real-timePCR assay. For best results we recommend the use of the following master in your assay:

For PCR product carry-over prevention (optional):• LightCycler® Uracil-DNA Glycosylase* in combination with LightCycler®

TaqMan® Master or FastStart TaqMan® Probe Master and • Uracil-DNA Glycosylase, heat-labile* in combination with FastStart Universal

Probe Master (Rox) and other real-time PCR reagents.

* products are available from Roche Applied Science. Please refer to Ordering Information.

Real-Time PCR Recommended Reference RemarksInstrument Master Mix Dye

LightCycler® 480 LightCycler® 480 -Instrument * Probes Master *

LightCycler® 2.0 LightCycler® -Instrument * TaqMan® Master *

LightCycler® 1.5 LightCycler® - Please note: Instrument * and TaqMan® Master * the UPL Reference Assays, lower versions labeled with the

LightCycler® Yellow 555 are not recommended for use on this instrument

Real-Time PCR FastStart Universal Included in the Instruments requiring Probe Master (Rox)* master mixreference dye

Real-Time PCR FastStart TaqMan® Rox Reference Dye* can Instruments Probe Master * be added to the reaction, not requiring if requiredreference dye

Real-Time PCR Recommended Reference RemarksInstrument Master Mix Dye

26

Glossary

Technology

Assay Design

PerformanceData

Assay DesignGuide

EMBL Sequence Identifier

The EMBL Nucleotide Sequence Database (also known as EMBL-GeneBank;http://www.ebi.ac.uk/embl/) is the European com -ponent of the International Nucleotide SequenceDatabase Collaboration (INSD) and is maintainedat the EBI. All records in the database are syn-chronized with the NCBI GenBank (North America)and the DNA Data-base of Japan (DDBJ). Each ofthe three groups collects a portion of the total se quence data reported worldwide, and all new andupdated entries are exchanged between the databases.

Main sources for DNA and RNA sequences in theEMBL-Bank are direct submissions from individualresearchers, genome sequencing projects and pa tentapplications. As such, EMBL-Bank is a repositorydata base that contains highly redundant data.

To reduce search times, ProbeFinder uses a subset of the EMBL database, which includes only entriesthat are from the relevant species, are annotated asmRNA, and are between100 nt and 20,000 nt long.

Ensembl Sequence Identifier

Ensembl (http://www.ensembl.org/) is a joint projectbetween EMBL-EBI and the Sanger Center. This is a system that automatically tracks all the sequencedpieces of the human genome, attempts to assemblethem into large single stretches and then analyzesthe assembled DNA to find genes and other featuresthat will interest biologists and medical researchers.

Unlike most other databases (e.g., RefSeq andEMBL), Ensembl transcript entries contain informa -tion about exon-exon splice sites, as predicted byEnsembl. Ensembl intron/exon predictions arebased on a set of heuristic rules and are substantiatedby supporting experimental evidence from Uni-Prot/Swiss-Prot, UniProt/TrEMBL, NCBI RefSeq, aswell as cDNA entries from EMBL.

Since the Ensembl database contains intron infor-mation, an Ensembl ID is the input format preferredby ProbeFinder. When Ensembl IDs are submitted,ProbeFinder will use the information on intron/exonlocations available in the Ensembl data base to design intron-spanning assays.

FASTA

FASTA is a common sequence file format that isused by many sequence alignment and homologysearch programs. A sequence in FASTA formatbegins with a single-line description, followed bylines of sequence data. The description line isdistinguished from sequence data by a “>” symbol.Sequences must contain only the standardIUB/IUPAC nucleic acid symbols. However, lower-case versions of these symbols are accepted (butwill be transformed into upper-case by the databasesoftware).

>AB000263 |acc=AB000263|descr=Homo sapiens mRNA forprepro cortistatin like peptide, complete cds.|len=368ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAA

In silico PCR

(In silico: in or by means of a computer simulati-on.) All primer pairs designed by ProbeFinder(using Primer3) are checked with an in silico PCRalgorithm. The algorithm searches the relevantgenome and transcriptome for possible misprimingsites (“genome hits” or “transcriptome hits”) foreither or both PCR primers.


27

Technology

Assay Design

PerformanceData

Assay DesignGuide

If any of the identified mispriming sites couldpotentially lead to an unintended amplicon, the assay that uses those primers is ranked lower on the list of available assays and flagged as having failed the in silico PCR check. Assays that span asmall intron (<0.5 kb) are ranked lower as well.

The in silico PCR check is not an absolute guaranteethat the assay will be target-specific, but it is anadditional filter designed to discard assays that arelikely to cause problems.

� Genome hits are typically caused by pseudogenes,which are untranslated areas of the genome thatshare homology with the processed mRNA sequenceof real genes. Other hits can be caused by very short or incorrectly predicted introns. The higherthe number of genome hits the lower the level ofprotection against contaminating genomic DNA.However, when you use only properly purifiedRNA as target, an intron-spanning assay can tolerateseveral genome hits and still produce acceptableresults.

� Transcriptome hits are typically caused by thepresence of related genes or splice variants of the parent gene in the input sequence. Most splice variants are specific to the tissue or to a certaindevelopmental stage of the organism. Therefore afew transcriptome hits within the parent gene are not necessarily a reason for discarding the assay.

Intron-Spanning Assays

When designing real-time PCR assays that willamplify cDNA, making the amplicon span anintron will eliminate false positive signals fromcontamina ting genomic DNA. If the assay targetsan intron-spanning site, any PCR amplicon genera-ted from genomic DNA will be longer than the cor-responding amplicon generated from cDNA, there-by reducing the amplification efficiency of thegenomic DNA.

� Figure 5: Intron-spanning assay principle

In summary, the in silico PCR feature:

� Minimizes the risk of false assay signals fromgenomic DNA in the RNA sample.

� Minimizes the risk of false assay signals fromunrelated transcripts generated by splice variants and homologous genes/gene familymembers.

� Avoids assays that detect pseudogenes.

� Avoids intron-spanning assays targetingintrons that are too short to be effective targets.


28

Glossary, continued

Technology

Assay Design

PerformanceData

Assay DesignGuide

By default, ProbeFinder assumes the input sequenceis mRNA and attempts to design an intron-spanning assay. The software can obtain informationabout the locations of introns in the input sequence in three different ways:

• If an Ensembl ID is entered, ProbeFinder will use the information about intron/exon locations that is available in the Ensembl database.

• If another sequence ID (RefSeq and EMBL) is entered or the sequence is pasted into ProbeFinderas plain text, the introns will be predicted by an algorithm developed in-house:

The intron prediction algorithm assumes the inputsequence is mRNA and performs a BLAST search ofthe sequence against the relevant genome. An areaof the input sequence is considered to be an exon ifthe sequence is nearly (greater than 95%) identicalto a sequence found in the genome, and is at least 40 nucleotides long. An area in the genome is con-sidered to be an intron if it has two flanking exonsand is at least 30 nucleotides long. If only one flanking exon can be found in the genome, the areawill be accepted only if the intron is at least 200nucleotides long and the corresponding exon is atleast 100 nucleotides long and 100% identical topart of the input sequence. Finally, the software alsocorrects for intron sites that have the consensus 5´ and 3´ splice sites (GT and AG).

If the exact locations of the exon-exon junctions areknown, the user can indicate their locations in the input sequence by a set of square brackets [ ] asillustrated below:

CACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGT[ ]GCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCC

IUPAC

International Union of Pure and Applied Chemistry(Seehttp://www.chem.qmul.ac.uk/iupac/misc/naabb.htmlfor a description of the one-letter symbols.)

RefSeq Sequence Identifier

The Reference Sequence (RefSeq;http://www.ncbi.nlm.nih.gov/RefSeq/) collection is a data set provided by NCBI; it is derived from Gen-Bank and is maintained, at least in part, manually.Whereas GenBank is an archival repository of allsequences, the RefSeq database is a non-redundantset of reference standards that includes chromo-somes, complete genomic molecules (organellegenomes, viruses, plasmids), intermediate assembledgenomic contigs, curated genomic regions, mRNAs,RNAs, and proteins. ProbeFinder uses a subset of theRefSeq database, which includes only entries thatare from the relevant species and are annotated asmRNA. You may enter gene names (e.g., ACTB) intoProbeFinder as they occur in RefSeq. If the enteredname is ambiguous, the software will display a list ofmatching database entries.

Sequence ID

Sequence identifiers (ENST00000158302,NM_001101 or AB062273) which are used to retrievethe input sequence from the Ensembl, RefSeq andEMBL databases. (For more information, see the description of these databases in this glossary).


Primer3 Settings

29

Technology

Assay Design

PerformanceData

Assay DesignGuide


Description

Minimum, Optimum, and Maximum lengths (in bases) of a primer oligo. Primer3 will not pick primers shorter than Min or longer than Max, and under default conditions, willattempt to pick primers close to Opt length. Min cannot be smaller than 1. Max cannot belarger than 36. (This limit indicates the maximum size oligo for which melting temperaturecalculations are valid.) Min cannot be greater than Max.

Minimum, Optimum, and Maximum melting temperatures (Celsius) for a primer oligo. Primer3 will not pick oligos with temperatures lower than Min or higher than Max, andunder default conditions, will try to pick primers with melting temperatures close to Opt.Primer3 uses the oligo melting temperature formula given in Rychlik, Spencer and Rhoads,Nucleic Acids Research, 18: 6409-6412; and Breslauer, Frank, Bloeker and Marky, Proc.Natl. Acad. Sci. USA, 83: 3746-3750. Please consult the former paper for a discussion of thetheoretical background behind the formula.

The maximum allowable local alignment score when testing a single primer for (local) self-complementarity; also, the maximum allowable local alignment score when testing forcomplementarity between left and right primers. Local self-complementarity is designed topredict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system assigns the following values: 1.00 for complemen-tary bases, -0.25 for a match between any base (= N) and another N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. Scores cannot be negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.

The maximum allowable 3´-anchored global alignment score when testing a single primer for self-complementarity; also, the maximum allowable 3´-anchored global alignment scorewhen testing for complementarity between left and right primers. The 3´-anchored globalalignment score is designed to predict the likelihood of PCR-priming primer-dimers, forexample

Requires the result to have the specified number of consecutive Gs and Cs at the 3´ end of both the left and right primers.

Description

PRIMER_MIN_SIZE 18

PRIMER_MAX_SIZE 27

PRIMER_OPT_SIZE 20

PRIMER_MIN_TM 59

PRIMER_MAX_TM 61

PRIMER_OPT_TM 60

PRIMER_SELF_ANY 8.00

PRIMER_SELF_END 3.00

PRIMER_GC_CLAM 0

Argument Name Default DescriptionValue

Product Cat. No. Pack Size

Universal ProbeLibrary Sets

Universal ProbeLibrary Set, Human 04 683 633 001 Library of 90 detection probes

Universal ProbeLibrary Set, Mouse 04 683 641 001 Library of 90 detection probes

Universal ProbeLibrary Set, Rat 04 683 650 001 Library of 90 detection probes

Universal ProbeLibrary Extension Set, 04 869 877 001 Set of 75 probes for quantification Probes #91 - #165 of gene expression levels by realtime PCR

Universal ProbeLibrary Reference Gene Assays

Universal ProbeLibrary Set, 05 046 114 001 1 set (100 reactions of 50 µl or 250 reactions Human Reference Gene Assays of 20 µl for each reference gene)

Human ACTB Gene Assay 05 046 165 001 200 � 50 µl assays

Human B�M Gene Assay 05 189 390 001 200 � 50 µl assays

Human G6PD Gene Assay 05 046 246 001 200 � 50 µl assays

Human GAPD Gene Assay 05 190 541 001 200 � 50 µl assays

Human GUSB Gene Assay 05 190 525 001 200 � 50 µl assays

Human HPRT Gene Assay 05 046 157 001 200 � 50 µl assays

Human PBGD Gene Assay 05 046 149 001 200 � 50 µl assays

Human PGK1 Gene Assay 05 046 173 001 200 � 50 µl assays

Human PPIA Gene Assay 05 189 268 001 200 � 50 µl assays

Human TBP Gene Assay 05 189 284 001 200 � 50 µl assays

Mouse ACTB Gene Assay 05 046 190 001 200 � 50 µl assays

Mouse GAPD Gene Assay 05 046 211 001 200 � 50 µl assays

Rat ACTB Gene Assay 05 046 203 001 200 � 50 µl assays

Rat GAPD Gene Assay 05 046 220 001 200 � 50 µl assays

RealTime ready Focus Panels

RealTime ready Human Reference Gene Panel, 96 05 339 545 001 2 plates (each containing 96 assays)

RealTime ready Human Reference Gene Panel, 384 05 467 675 001 2 plates (each containing 384 assays)

RealTime ready Human Apoptosis Panel, 96 05 392 063 001 2 plates (each containing 96 assays)

RealTime ready Human Apoptosis Panel, 384 05 339 316 001 2 plates (each containing 384 assays)

RealTime ready Human ABC Transporter Panel, 96 05 339 324 001 2 plates (each containing 96 assays)

RealTime ready Human ABC Transporter Panel, 384 05 467 713 001 2 plates (each containing 384 assays)

RealTime ready Human Cell Cycle 05 339 359 001 2 plates (each containing 96 assays)Regulation Panel, 96

RealTime ready Human Cell Cycle 05 467 683 001 2 plates (each containing 384 assays)Regulation Panel, 384

30

Technology

Assay Design

PerformanceData

Assay DesignGuide


Universal ProbeLibrary Reference Gene Assays

Universal ProbeLibrary Sets


Ordering Information

RealTime ready Focus Panels

RealTime ready Human GPCR Panel, 96 05 353 068 001 2 plates (each containing 96 assays)

RealTime ready Human GPCR Panel, 384 05 467 705 001 2 plates (each containing 384 assays)

RealTime ready Human Nuclear Receptor Panel, 96 05 339 332 001 2 plates (each containing 96 assays)

RealTime ready Human Nuclear Receptor Panel, 384 05 467 691 001 2 plates (each containing 384 assays)

RealTime ready Custom Assays and Panels For detailed information, please visit www.realtimeready.roche.com

31

Technology

Assay Design

PerformanceData

Assay DesignGuide



Instrument and Accessories

LightCycler® 1536 Instrument 05 334 276 001 1 instrument

LightCycler® 480 Instrument II 05 015 278 001 1 instrument (96 well)05 015 243 001 1 instrument (384 well)

LightCycler® 2.0 Instrument 03 351 414 001 1 instrument plus accessories

Associated Kits and Reagents

LightCycler® TaqMan® Master 04 535 286 001 1 kit (96 reactions)

LightCycler® 480 Probes Master 04 707 494 001 approx. 500 reactions of 20 µl final reaction volume

RealTime ready DNA Probes Master 05 502 381 001 5 x 1ml

FastStart Universal Probe Master (Rox) 04 913 949 001 2.5 ml04 913 957 001 12.5 ml04 914 058 001 50 ml04 914 066 001 50 ml

FastStart TaqMan® Probe Master 04 673 409 001 100 reactions (2 � 1.25 ml)04 673 417 001 500 reactions (10 � 1.25 ml)04 673 433 001 2000 reactions (10 � 5 ml)

FastStart TaqMan® Probe Master (Rox) 04 673 450 001 100 reactions (2 � 1.25 ml)04 673 468 001 500 reactions (10 � 1.25 ml)04 673 476 001 2000 reactions (10 � 5 ml)

LightCycler® Uracil-DNA Glycosylase 03 539 806 001 100 U (50 µl)

Uracil-DNA Glycosylase, heat-labile 11 775 367 001 100 U

Rox Reference Dye 04 673 549 001 50 µl

Instrument and Accessories

RealTime ready Custom Assays and Panels For detailed information, please visit www.realtimeready.roche.com

Associated Kits and Reagents


TrademarksLIGHTCYCLER, LC, FASTSTART, TAQMAN, MAGNA PURE, HIGH PURE, REALTIME READY and HYBPROBE are trademarks of Roche. PROBELIBRARY, PROBEFINDER and LNA are registered trademarks of Exiqon A/S, Vedbaek, Denmark.FAM, TAMRA, and ROX are trademarks of Applera Corporation, Norwalk, CT, USA. SYBR is a registered trademark of Molecular Probes, Inc.Other brand or product names are trademarks of their respective holders.

Published by:

Roche Diagnostics GmbHRoche Applied ScienceWerk Penzberg82372 PenzbergGermany

© 2009 Roche Diagnostics GmbHAll rights reserved.05

1410

7900

1�

0809

Roche Applied Science offers a large selection ofreagents and systems for life science research. For acomplete overview of related products and manuals,please visit and bookmark our home page,www.roche-applied-science.com, and our SpecialInterest Sites including:

� The Universal ProbeLibrary: http://www.universalprobelibrary.com

� RealTime ready Custom Assays and Panelshttp://www.realtimeready.roche.com

� The LightCycler® System family for real-time, online PCR: http://www.lightcycler-online.com

� The MagNA Pure System family for automated nucleic acid isolation: http://www.magnapure.com

� Amplification – Innovative tools for PCR: http://www.roche-applied-science.com/pcr

� DNA & RNA preparation – Versatile Tools for Nucleic Acid Purification: http://www.roche-applied-science.com/napure

Disclaimer of LicenseA license to perform the patented 5' Nuclease Process forresearch is obtained by the purchase of (i) both LicensedProbe and Authorized 5' Nuclease Core Kit, (ii) a Licensed 5'Nuclease Kit, or (iii) license rights from Applied Biosystems.

This product contains Licensed Probe. Its purchase priceincludes a limited, non-transferable immunity from suit underU.S. Patents Nos. 6,214,979 and 5,804,375 (claims 1-12 only)and corresponding patent claims outside the United States.The purchase of this product includes a limited, non-trans-ferable immunity from suit under the foregoing patent claimsfor using only this amount of product for the purchaser's own internal research. The right to use this product in the 5'Nuclease Process under the applicable claims of US PatentsNos. 5,210,015 and 5,487,972, and corresponding patentclaims outside the United States, can be obtained throughpurchase of an Authorized 5' Nuclease Core Kit. Except underseparate license rights available from Applied Biosystems, noright under any other patent claim, or to perform commercialservices of any kind, including without limitation reportingthe results of purchaser's activities for a fee or other com-mercial consideration, or to sublicense, repackage with otherproducts, or resell in any form, is conveyed expressly, by impli-cation, or by estoppel. This product is for research use only.Diagnostic uses under Roche patents require a separatelicense from Roche. Further information on purchasing licen-ses may be obtained from the Director of Licensing, AppliedBiosystems, 850 Lincoln Centre Drive, Foster City, California94404, USA.

The technology used for the LightCycler® System is licensedfrom Idaho Technology Inc., Salt Lake City, UT, USA.

ProbeLibrary is covered by US and other patent applicationsowned by Exiqon A/S. Locked Nucleic Acids (LNA) are cover-ed by U.S. Patents No US 6,794,499, US 6,670,461, US6,268,490 & US 6,770,748 and other patents and patent appli-cations owned by Exiqon A/S and Prof. Takeshi Imanishi. The quencher usedin the probes is covered by patent applications owned byExiqon A/S.

Documents

RealTime ready Universal ProbeLibrary Redefining …...RealTime ready Universal ProbeLibrary Redefine and revolutionize real-time qPCR assays Based on only 165 short hydrolysis probes