pieces of the puzzle towards clinical application Melatonin Production In Zebrafish: pieces of the puzzle towards clinical application Imran bin Rafi

Melatonin Production In Zebrafish:pieces of the puzzle towards clinical pieces of the puzzle towards clinical

applicationapplication

Melatonin Production In Zebrafish:pieces of the puzzle towards clinical pieces of the puzzle towards clinical

applicationapplication

Imran bin Rafi Ahmed bin Abdullah Imran bin Rafi Ahmed bin Abdullah PunekarPunekar

Imran bin Rafi Ahmed bin Abdullah Imran bin Rafi Ahmed bin Abdullah PunekarPunekar

slee

psl

eep

slee

psl

eep

drea

drea

drea

drea

seratoniseratoninnseratoniseratoninn

pineal gla

pineal glapineal gla

pineal glarose

sro

ses

rose

sro

ses

diurnaldiurnaldiurnaldiurnal

IntroductionIntroductionThis PresentationThis Presentation


Goals:To present a brief understanding of the

function of melatonin and biorhythms in humans, their effects, potential and disorders related to malfunction;

To discuss recent studies conducted in Zebrafish relating to this topic;

To analyze the appropriateness of using Zebrafish as a model in vertebrate biorhythm research; and

To present some of the challenges and steps ahead before this research can be ported to the bedside.

Goals:To present a brief understanding of the

function of melatonin and biorhythms in humans, their effects, potential and disorders related to malfunction;

To discuss recent studies conducted in Zebrafish relating to this topic;

To analyze the appropriateness of using Zebrafish as a model in vertebrate biorhythm research; and

To present some of the challenges and steps ahead before this research can be ported to the bedside.



This suspicious article….This suspicious article….

IntroductionIntroductionMelatonin – What is it?Melatonin – What is it?


MelatoninAlso known, on the streets, as

N-acetyl-5 methoxytryptamine, 5-methoxy-N-acetyltryptamine

MelatoninAlso known, on the streets, as

N-acetyl-5 methoxytryptamine, 5-methoxy-N-acetyltryptamine

http://www.plant.uoguelph.ca/research/cellculture/images/melatonin.jpg, http://en.wikipedia.org/wiki/Image:Melatonin.png



Melatonin Hormone secreted by the pineal gland in the brain, in

diurnal species it is secreted during our rest phase, ie. habitual hours of sleep

Many functions including: Aiding in reproductive processes Affecting moods Initiating and maintaining sleep Countering the effects of jet-lag and insomnia Aiding in immune system processes, thought to be an

immunostimulant Plays some role in cell differentiation and proliferation during

embryo development Regulates Seasonal Affective Disorder May control onset of breast cancer in women Also found in some medicinal plants, although its role in plants is

unknown

Melatonin Hormone secreted by the pineal gland in the brain, in

diurnal species it is secreted during our rest phase, ie. habitual hours of sleep

Many functions including: Aiding in reproductive processes Affecting moods Initiating and maintaining sleep Countering the effects of jet-lag and insomnia Aiding in immune system processes, thought to be an

immunostimulant Plays some role in cell differentiation and proliferation during

embryo development Regulates Seasonal Affective Disorder May control onset of breast cancer in women Also found in some medicinal plants, although its role in plants is

unknown

IntroductionIntroductionMelatonin – What does it do?Melatonin – What does it do?


Key figures in Melatonin ResearchJulius Axelrod – Nobel Prize

winner; performed many of the first experiments which determined the role of melatonin and the pineal gland in Circadian biorhythms.

Key figures in Melatonin ResearchJulius Axelrod – Nobel Prize

winner; performed many of the first experiments which determined the role of melatonin and the pineal gland in Circadian biorhythms.Showed that melatonin has profound

influences on the CNS, established that the pineal gland acts as a biological clock, and proved that melatonin is converted to/from seratonin.

Showed that melatonin has profound influences on the CNS, established that the pineal gland acts as a biological clock, and proved that melatonin is converted to/from seratonin.U.S. National Library of Medicine. "Profiles in Science: The Julius Axelrod Papers.

http://en.wikipedia.org/wiki/Image:Axelrod01.jpg



Key figures in Melatonin ResearchGeorge C. Brainard

BA in Psychology, Wesleyan 1973; MA in Psychology, Goddard College, 1978

PhD in Anatomy, Univ. Texas Health Science Ctr., 1982

Currently at the brand new Farber Institute for Neurosciences at Jefferson Medical College.


BA in Psychology, Wesleyan 1973; MA in Psychology, Goddard College, 1978

PhD in Anatomy, Univ. Texas Health Science Ctr., 1982

Currently at the brand new Farber Institute for Neurosciences at Jefferson Medical College.

Director of Jeff’s Light Research program since 1984Currently working, using photobiology, radioimmunoassay and performance to elucidate action spectrum of melatonin regulation, investigate phase shifting in light, study influence of light in tumor progression, and test new treatments for SAD.



Key figures in Melatonin Research George C. Brainard

The lab is also one of 6 directly funded by NASA for chronobiology, sleep and lighting research.

Interestingly, Dr. Brainard currently serves, among other roles, as: NASA, Lighting design of space vehicle and space craft interiors: space shuttle, space station and space laboratory team, 1987-present.

NASA, National Space Biomedical Research Institute, Member Human Performance Factors, Sleep and Chronobiology Team, 2001-present.

NASA, National Space Biomedical Research Institute, Associate Team Leader Human Performance Factors, Sleep and Chronobiology Team, 2002-present.

United States National Committee, Chairman Photobiology Committee (Division 6), 1992-present.

Key figures in Melatonin Research George C. Brainard

The lab is also one of 6 directly funded by NASA for chronobiology, sleep and lighting research.

Interestingly, Dr. Brainard currently serves, among other roles, as: NASA, Lighting design of space vehicle and space craft interiors: space shuttle, space station and space laboratory team, 1987-present.

NASA, National Space Biomedical Research Institute, Member Human Performance Factors, Sleep and Chronobiology Team, 2001-present.

NASA, National Space Biomedical Research Institute, Associate Team Leader Human Performance Factors, Sleep and Chronobiology Team, 2002-present.

United States National Committee, Chairman Photobiology Committee (Division 6), 1992-present.


IntroductionIntroductionMelatonin – What does it do?Melatonin – What does it do?Key figures in Melatonin Research

George C. BrainardFindings:

Evidence for existence of novel circadian photoreceptor in the eye, establishing of its action spectrum

Disrupted circadian cycles have an adverse effect on tumor progression, ie. breast cancer

Photo-treatment is an effective therapeutic approach to dealing with mood disorders related to circadian rhythms and melatonin regulation


Findings:Evidence for existence of novel circadian

photoreceptor in the eye, establishing of its action spectrum

Disrupted circadian cycles have an adverse effect on tumor progression, ie. breast cancer

Photo-treatment is an effective therapeutic approach to dealing with mood disorders related to circadian rhythms and melatonin regulation

Dr. ZhdanovaDr. ZhdanovaDr. ZhdanovaDr. Zhdanova

Key figures in Melatonin ResearchIrina Zhdanova

MD, 1982: First Leningrad Medical Institute (Internal Medicine) MD specialization, 1984: Institute of Experimental Medicine (Clinical Physiology) Ph.D., 1988: Institute of Experimental Medicine, Leningrad (Physiology of Behavior)

1989-1992: Research Scientist, Lab. of Physiology of Primate Behavior, Pavlov Institute of Physiology, St. Petersburg, Russia 1992-1994: Postdoctoral Fellow, Dept. of Brain and Cog. Sci., MIT, Cambridge, MA 1995-1997: Research Scientist, Dept. of Brain and Cog. Sci., MIT, Cambridge, MA 1997-2000: Principal Research Scientist, Dept. of Brain and Cog. Sci., MIT, 1999-2001: Adjunct Associate Professor, Dept. of Psychiatry, Northwestern Univ., 2000-2001: Research Associate Professor, Dept. of Molecular Pharm. and Biol. Chemistry, Northwestern Univ., Chicago, IL2002—: Research Associate Professor, Dept. Anatomy and Neurobiology, Boston University

Key figures in Melatonin ResearchIrina Zhdanova

MD, 1982: First Leningrad Medical Institute (Internal Medicine) MD specialization, 1984: Institute of Experimental Medicine (Clinical Physiology) Ph.D., 1988: Institute of Experimental Medicine, Leningrad (Physiology of Behavior)

1989-1992: Research Scientist, Lab. of Physiology of Primate Behavior, Pavlov Institute of Physiology, St. Petersburg, Russia 1992-1994: Postdoctoral Fellow, Dept. of Brain and Cog. Sci., MIT, Cambridge, MA 1995-1997: Research Scientist, Dept. of Brain and Cog. Sci., MIT, Cambridge, MA 1997-2000: Principal Research Scientist, Dept. of Brain and Cog. Sci., MIT, 1999-2001: Adjunct Associate Professor, Dept. of Psychiatry, Northwestern Univ., 2000-2001: Research Associate Professor, Dept. of Molecular Pharm. and Biol. Chemistry, Northwestern Univ., Chicago, IL2002—: Research Associate Professor, Dept. Anatomy and Neurobiology, Boston University

Dr. ZhdanovaDr. ZhdanovaDr. ZhdanovaDr. Zhdanova

Papers are numerous and cover various topics, including 4 book chapters on melatonin and pineal function, however, particularly interesting is her selected list of invited seminars:

2002: Sleep: from Humans to zebrafish. Dept. Brain and Cognitive Sciences, MIT, Boston, MA2002: Sleep and Sleep Disorders: from humans to zebrafish. Dept. Pathology, BUMC, Boston, MA 2001: Swimming to sleep: zebrafish and melatonin. Northeastern University, Boston, MA 2001: Melatonin and sleep: from zebrafish to humans. Stanford University Medical School, Palo Alto, 2000: Melatonin and sleep. Brown University, Providence, RI 2000: Effects of melatonin on sleep and mood. Brandeis University, MA 2000: Age-related insomnia and melatonin. Stanford University Medical School, Palo Alto, CA 2000: Melatonin, sleep and behavior. Boston University Medical School, Boston, MA 1999: Melatonin and insomnia of aging. Harvard University Medical School, Cambridge, MA 1999: Endogenous hypnotics. St. Elizabeth Medical Center, Tufts University Medical School, Boston 1999: Endogenous sleep factors. St. Vincent's Hospital and Medical Center, New York, NY 1999: Melatonin and its effects on sleep. Northwestern University, Chicago IL 1998: Effects of melatonin on sleep. Harvard University Medical School, Cambridge, MA 1998: Melatonin and sleep in humans. Baylor College of Medicine, Houston, TX 1998: Melatonin: sleep and circadian rhythms modulator. Stanford Univ Medical School, Palo Alto

Papers are numerous and cover various topics, including 4 book chapters on melatonin and pineal function, however, particularly interesting is her selected list of invited seminars:

2002: Sleep: from Humans to zebrafish. Dept. Brain and Cognitive Sciences, MIT, Boston, MA2002: Sleep and Sleep Disorders: from humans to zebrafish. Dept. Pathology, BUMC, Boston, MA 2001: Swimming to sleep: zebrafish and melatonin. Northeastern University, Boston, MA 2001: Melatonin and sleep: from zebrafish to humans. Stanford University Medical School, Palo Alto, 2000: Melatonin and sleep. Brown University, Providence, RI 2000: Effects of melatonin on sleep and mood. Brandeis University, MA 2000: Age-related insomnia and melatonin. Stanford University Medical School, Palo Alto, CA 2000: Melatonin, sleep and behavior. Boston University Medical School, Boston, MA 1999: Melatonin and insomnia of aging. Harvard University Medical School, Cambridge, MA 1999: Endogenous hypnotics. St. Elizabeth Medical Center, Tufts University Medical School, Boston 1999: Endogenous sleep factors. St. Vincent's Hospital and Medical Center, New York, NY 1999: Melatonin and its effects on sleep. Northwestern University, Chicago IL 1998: Effects of melatonin on sleep. Harvard University Medical School, Cambridge, MA 1998: Melatonin and sleep in humans. Baylor College of Medicine, Houston, TX 1998: Melatonin: sleep and circadian rhythms modulator. Stanford Univ Medical School, Palo Alto

Melatonin and Sleep:Melatonin and Sleep:From Humans to ZebrafishFrom Humans to Zebrafish


Melatonin, sleep, and circadian regulation have been studied extensively in Humans, non-Human primates, rats and mice, as well as birds.

Majority of the studies focused on structure of sleep and effects of clinical administration of hypnotics.

Led to advancement of the understanding of the effects of hypnotics such as melatonin and the patterns involved in circadian regulation and time-keeping, but left researchers wondering about the molecular mechanisms of melatonin, its genetic bases and pathway by which it is genetically controlled, maintained and altered.

Thus, there came to be a need, a seeking for a thoroughly well-mapped, genetically tractable, VERTEBRATE, DIURNAL model species.


Majority of the studies focused on structure of sleep and effects of clinical administration of hypnotics.

Led to advancement of the understanding of the effects of hypnotics such as melatonin and the patterns involved in circadian regulation and time-keeping, but left researchers wondering about the molecular mechanisms of melatonin, its genetic bases and pathway by which it is genetically controlled, maintained and altered.

Thus, there came to be a need, a seeking for a thoroughly well-mapped, genetically tractable, VERTEBRATE, DIURNAL model species.




None of these species are both genetically tractable and diurnal.

On the other Zebrafish, as we know, have been studied thoroughly with respect to their genetics and development, and thus presented themselves as an excellent candidate for circadian rhythm studies.


None of these species are both genetically tractable and diurnal.

On the other Zebrafish, as we know, have been studied thoroughly with respect to their genetics and development, and thus presented themselves as an excellent candidate for circadian rhythm studies.

The Zebrafish (The Zebrafish (Danio Danio reriorerio))

The Zebrafish (The Zebrafish (Danio Danio reriorerio))

Zebrafish (Danio rerio)

+ = ?

Zebrafish (Danio rerio)

+ = ?

http://7art-screensavers.com/screenshots/animals/zebra.jpga

http://backyardmissionary.typepad.com/backyardmissionary/nemo.jpeg

http://7art-screensavers.com/screenshots/animals/zebra.jpga

http://backyardmissionary.typepad.com/backyardmissionary/nemo.jpeg

The Zebrafish (The Zebrafish (Danio rerioDanio rerio))The Zebrafish (The Zebrafish (Danio rerioDanio rerio))

Zebrafish (Danio rerio)Zebrafish (Danio rerio)

http://www.disgalaxy.addr.com/Muppets/kermit100.jpg, http://www-2.cs.cmu.edu/People/dwinkler/sounds/kermit2.wav

The Zebrafish (The Zebrafish (Danio rerioDanio rerio))lit. damn rare fishlit. damn rare fish

The Zebrafish (The Zebrafish (Danio rerioDanio rerio))lit. damn rare fishlit. damn rare fish

Zebrafish (Danio rerio)Zebrafish (Danio rerio)

http://home.earthlink.net/~ryanstern/images/zebrafish.jpg



Qualifying round for circadian study: If you recall, Zhdanova concludes that Zebrafish

fulfill the role of a model species for circadian study because of several key factors, including:

the fact that sleep has certain common characteristics in zebrafish, mammals and other species,

zebrafish, like some mammals and birds have characteristic sleep postures,

lack of locomotory activity during the rest phase, heightened arousal threshold,

common effects of rest deprivation both during the rest phase and during the day.

Qualifying round for circadian study: If you recall, Zhdanova concludes that Zebrafish

fulfill the role of a model species for circadian study because of several key factors, including:

the fact that sleep has certain common characteristics in zebrafish, mammals and other species,

zebrafish, like some mammals and birds have characteristic sleep postures,

lack of locomotory activity during the rest phase, heightened arousal threshold,

common effects of rest deprivation both during the rest phase and during the day.

Melatonin and Sleep:Melatonin and Sleep:ZebrafishZebrafish


Figure 1. Zebrafish in characteristic rest postures, either Figure 1. Zebrafish in characteristic rest postures, either lying along the bottom of the cage, or floating suspended lying along the bottom of the cage, or floating suspended with head down. Highlighting similarities in characteristic with head down. Highlighting similarities in characteristic physiological and physical changes during the rest phase physiological and physical changes during the rest phase of the activity cycle. of the activity cycle. Taken from Zhdanova, 2001.Taken from Zhdanova, 2001.



Data showing that Data showing that melatonin acts via a melatonin acts via a melatonin-specific melatonin-specific pathway. This is crucial pathway. This is crucial information in the information in the understanding of sleep understanding of sleep regulation and the regulation and the chemical processes chemical processes involved in melatonin involved in melatonin secretion and secretion and regulation. The fact that regulation. The fact that this is found in zebrafish this is found in zebrafish again highlights the again highlights the suitability of suitability of Danio rerioDanio rerio as an adequate model of as an adequate model of circadian study in circadian study in vertebrates, including in vertebrates, including in humans. Figure taken humans. Figure taken from Zhdanova, 2001. from Zhdanova, 2001.



Therefore, Zhdanova concludes that melatonin acts via an independent and melatonin-specific cell membrane channel, that zebrafish are an ideal system for use a model for circadian rhythm study because of the fact that there are inherent and profound similarities in the ways in which diurnal species exhibit sleep, presenting a very exciting opportunity of using zebrafish as a methods of studying melatonin function, secretion and regulation in diurnal species.

Therefore, Zhdanova concludes that melatonin acts via an independent and melatonin-specific cell membrane channel, that zebrafish are an ideal system for use a model for circadian rhythm study because of the fact that there are inherent and profound similarities in the ways in which diurnal species exhibit sleep, presenting a very exciting opportunity of using zebrafish as a methods of studying melatonin function, secretion and regulation in diurnal species.



Follow-up papers

Isolation and Phenogenetics of a Novel Circadian Rhythm Mutant in Zebrafish Jason DeBruyne, Mark Hurd, Laura Gutiérrez, Maki Kaneko, Ying Tan, Dan Wells, Gregory Cahill University of Houston, Houston, TX

Journal of Neurogenetics, April-June 2004

Follow-up papers

Isolation and Phenogenetics of a Novel Circadian Rhythm Mutant in Zebrafish Jason DeBruyne, Mark Hurd, Laura Gutiérrez, Maki Kaneko, Ying Tan, Dan Wells, Gregory Cahill University of Houston, Houston, TX

Journal of Neurogenetics, April-June 2004



DeBruyne et al. 2004: Citing the vast expansion of Zebrafish in

developmental studies and the resultant advancements in technology allowing researchers to generate, map and clone mutant genes, this paper presents the way by which a circadian mutant was identified and isolated.

This clearly has enormous implications for the study of the basis and mechanisms of circadian regulation both in zebrafish as well as other species, especially considering what little is known about the precise pathway of melatonin regulation.

DeBruyne et al. 2004: Citing the vast expansion of Zebrafish in

developmental studies and the resultant advancements in technology allowing researchers to generate, map and clone mutant genes, this paper presents the way by which a circadian mutant was identified and isolated.

This clearly has enormous implications for the study of the basis and mechanisms of circadian regulation both in zebrafish as well as other species, especially considering what little is known about the precise pathway of melatonin regulation.



DeBruyne et al. 2004: In order to identify the genes in question, DeBruyne et

al. did a behavioral screen of thousands of zebrafish to determine which, based on circadian periodicity of locomotor activity, were behaving as though their circadian systems may be malfunctioning.

From a screen of 6,500 genomes, 8 homozygous, viable, self-dominant mutants were found, one of which is the topic of this paper.

The mutant zebrafish, coined the lager and lime mutant (lagdg2), has a circadian rhythm which is shortened by 0.7 hrs in heterozygotes and by 1.3 hrs in homozygotes.

This results in a shortened period of melatonin secretion by the pineal gland.

Thus, the mutation is exhibited on the genetic, molecular and behavioral levels, making it an attractive test specimen.

DeBruyne et al. 2004: In order to identify the genes in question, DeBruyne et

al. did a behavioral screen of thousands of zebrafish to determine which, based on circadian periodicity of locomotor activity, were behaving as though their circadian systems may be malfunctioning.

From a screen of 6,500 genomes, 8 homozygous, viable, self-dominant mutants were found, one of which is the topic of this paper.

The mutant zebrafish, coined the lager and lime mutant (lagdg2), has a circadian rhythm which is shortened by 0.7 hrs in heterozygotes and by 1.3 hrs in homozygotes.

This results in a shortened period of melatonin secretion by the pineal gland.

Thus, the mutation is exhibited on the genetic, molecular and behavioral levels, making it an attractive test specimen.



DeBruyne et al., 2004: Also determined that the mutation alters the

sensitivity of the pineal circadian rhythm to temprature

Linkage mapping with microsatellite markers indicates that the lag mutation occurs on chromosome 7. The only known clock gene homolog near the locus of the lag gene is the zebrafish homolog of period1 (per1). However, the per1 homolog, was determined to be unaffected.

This suggests that the lag gene is a novel clock gene present in zebrafish

DeBruyne et al., 2004: Also determined that the mutation alters the

sensitivity of the pineal circadian rhythm to temprature

Linkage mapping with microsatellite markers indicates that the lag mutation occurs on chromosome 7. The only known clock gene homolog near the locus of the lag gene is the zebrafish homolog of period1 (per1). However, the per1 homolog, was determined to be unaffected.

This suggests that the lag gene is a novel clock gene present in zebrafish



Homeobox-clock protein interaction in zebrafish: A shared mechanism for pineal-specific and circadian gene expression

Lior Appelbaum, Ana Anzulovich, Ruben Baler, Yoav Gothil

Published in Journal of Biological Chemistry, March 25 2005.

Homeobox-clock protein interaction in zebrafish: A shared mechanism for pineal-specific and circadian gene expression

Lior Appelbaum, Ana Anzulovich, Ruben Baler, Yoav Gothil

Published in Journal of Biological Chemistry, March 25 2005.



Appelbaum et al., 2005: State that the circadian rhythm is regulated by

changes in the activity of arylalkylamine-Nacetyltransferase(AANAT), an important enzyme involved in melatonin production in the pineal gland.

Thus, AANAT (fish have 2, one in the pineal gland, and one preferentially expressed in the retina) is also periodic in its expression.

Zebrafish AANAT is known as zfaanat2, and regulates both pineal/retinal photoreceptivity, as well as the circadian rhythm.

Some other genes which play a role in zfaanat2 expression include PCE, PDRM and E-box regions. The study aimed at determining the relationship of each region to the production of melatonin.

Appelbaum et al., 2005: State that the circadian rhythm is regulated by

changes in the activity of arylalkylamine-Nacetyltransferase(AANAT), an important enzyme involved in melatonin production in the pineal gland.

Thus, AANAT (fish have 2, one in the pineal gland, and one preferentially expressed in the retina) is also periodic in its expression.

Zebrafish AANAT is known as zfaanat2, and regulates both pineal/retinal photoreceptivity, as well as the circadian rhythm.

Some other genes which play a role in zfaanat2 expression include PCE, PDRM and E-box regions. The study aimed at determining the relationship of each region to the production of melatonin.



Appelbaum et al., 2005:Methods, put simply:

Gene Knockouts of each of the 3 regions in question, PCE, PDRM, and E-Box,

As well as in vitro transfection anaylses of modified PDRM with different vector regions

Also, experiments were conducted to determine if the precise physical arrangement of the various genetic factors was critical to melatonin secretion

Appelbaum et al., 2005:Methods, put simply:

Gene Knockouts of each of the 3 regions in question, PCE, PDRM, and E-Box,

As well as in vitro transfection anaylses of modified PDRM with different vector regions

Also, experiments were conducted to determine if the precise physical arrangement of the various genetic factors was critical to melatonin secretion

Melatonin and Sleep:Melatonin and Sleep:Zebrafish – Oh the Suffering!Zebrafish – Oh the Suffering!

Melatonin and Sleep:Melatonin and Sleep:Zebrafish – Oh the Suffering!Zebrafish – Oh the Suffering!

…into NheI/KpnI -cut AA1M, yielding construct AA1M-PRDM. AA1M-PRDM-ME: PRDM with a mutated E-box (PRDM-ME, CACGTG to CTCGAG) was PCR amplified using AANAT2-EGFP-PRDM-ME (14) as a template and sub-cloned into AA1M, upstream to the AVP promoter, as described above, yielding the construct AA1M-PRDM-ME. AA1M-PRDM + PCE Mutation: The three PCEs within the PRDM were mutated. For each PCE two complementary primers containing the desired mutation [TAATC (PCE1) to AGATC, GATTA (PCE2) to GTATA and TAATC (PCE3) to ATATC] were utilized to introduce the mutations into AA1M-PRDM as described above. Consequently, novel restriction sites, Bgl II, EcoR V and BsTZ17 I, were introduced into the sequence in place of PCE1, PCE2 and PCE3, respectively. … These constructs were named AA1MPRDM- MP1, -MP2 and –MP3. Next, AA1MPRDM- MP1 was sequentially mutated at PCE2 and PCE3 to get a triple PCE mutation construct, AA1M-PRDM -MP1-3. AA1M-PRDM + insertion: Six and ten nucleotides were inserted in AA1M-PRDM between the E-box and PCE1 using a similar procedure and similar sequences as used for AANAT2-EGFP-PRDM insertions, yielding constructs AA1M-PRDM-M6 and AA1MPRDM- M10. Cytomegalovirus (CMV) promoter-driven mouse CLOCK (mCLOCK) and human BMAL1 (hBMAL1) expression vectors were generously provided by Drs. N. Gekakis and C. Weitz, BMAL1/3 MO, ATATCCATTCTTTGGTCTGCCATTA; BMAL2 MO, CAGATTTCATTTCCAGGTTGTCCAT; CLOCK1 MO, AGATACTGCTGTCATCCCGGTCTAT; CLOCK2 MO, TGTCCATGCTCACTCCTTCTCCCAT; CLOCK3 MO, ATGATAACTCGGTCTCATGGATCAG; EGFP MO, ACAGCTCCTCGCCCTTGCTCACCAT……………..

…into NheI/KpnI -cut AA1M, yielding construct AA1M-PRDM. AA1M-PRDM-ME: PRDM with a mutated E-box (PRDM-ME, CACGTG to CTCGAG) was PCR amplified using AANAT2-EGFP-PRDM-ME (14) as a template and sub-cloned into AA1M, upstream to the AVP promoter, as described above, yielding the construct AA1M-PRDM-ME. AA1M-PRDM + PCE Mutation: The three PCEs within the PRDM were mutated. For each PCE two complementary primers containing the desired mutation [TAATC (PCE1) to AGATC, GATTA (PCE2) to GTATA and TAATC (PCE3) to ATATC] were utilized to introduce the mutations into AA1M-PRDM as described above. Consequently, novel restriction sites, Bgl II, EcoR V and BsTZ17 I, were introduced into the sequence in place of PCE1, PCE2 and PCE3, respectively. … These constructs were named AA1MPRDM- MP1, -MP2 and –MP3. Next, AA1MPRDM- MP1 was sequentially mutated at PCE2 and PCE3 to get a triple PCE mutation construct, AA1M-PRDM -MP1-3. AA1M-PRDM + insertion: Six and ten nucleotides were inserted in AA1M-PRDM between the E-box and PCE1 using a similar procedure and similar sequences as used for AANAT2-EGFP-PRDM insertions, yielding constructs AA1M-PRDM-M6 and AA1MPRDM- M10. Cytomegalovirus (CMV) promoter-driven mouse CLOCK (mCLOCK) and human BMAL1 (hBMAL1) expression vectors were generously provided by Drs. N. Gekakis and C. Weitz, BMAL1/3 MO, ATATCCATTCTTTGGTCTGCCATTA; BMAL2 MO, CAGATTTCATTTCCAGGTTGTCCAT; CLOCK1 MO, AGATACTGCTGTCATCCCGGTCTAT; CLOCK2 MO, TGTCCATGCTCACTCCTTCTCCCAT; CLOCK3 MO, ATGATAACTCGGTCTCATGGATCAG; EGFP MO, ACAGCTCCTCGCCCTTGCTCACCAT……………..



Appelbaum et al., 2005: Results: The researchers in this paper found that all three of the

components mentioned earlier are significantly involved in the regulation of melatonin secretion, and represent a very fine-tuned and exquisite control of the zfaanaat2 gene expression. The zfaanat2 PRDM controls both temporal and spatial regulatory factors and is therefore, what they call a four-dimensional coincidence transcriptional detector. transcriptional detector.

Furthermore, the authors suggest that there is a level of synergistic action between the translation factors which involves considerable physical interaction, controlling the gene’s expression both temporally and spatially.

They suggest that additional proteins involved in the regulation of aanat genes, in zebrafish as well as humans, need to be further studied in order to determine the precise mechanism of control

Appelbaum et al., 2005: Results: The researchers in this paper found that all three of the

components mentioned earlier are significantly involved in the regulation of melatonin secretion, and represent a very fine-tuned and exquisite control of the zfaanaat2 gene expression. The zfaanat2 PRDM controls both temporal and spatial regulatory factors and is therefore, what they call a four-dimensional coincidence transcriptional detector. transcriptional detector.

Furthermore, the authors suggest that there is a level of synergistic action between the translation factors which involves considerable physical interaction, controlling the gene’s expression both temporally and spatially.

They suggest that additional proteins involved in the regulation of aanat genes, in zebrafish as well as humans, need to be further studied in order to determine the precise mechanism of control

Melatonin and Sleep:Melatonin and Sleep:From Zebrafish to HumansFrom Zebrafish to Humans


Irina ZhdanovaKeeping in mind Zhdanova’s initial intentions

for exploring Zebrafish, we now return to the reverse translation, and the boon of all this labor:

Using the results of these experiments and others to aid our understanding of the human circadian system, and, ultimately, the development of medical therapies for the treatment of everything from attention disorders, the effects of intergalactic space travel, insomnia and other sleep disorders, and cancer research.

Irina ZhdanovaKeeping in mind Zhdanova’s initial intentions

for exploring Zebrafish, we now return to the reverse translation, and the boon of all this labor:

Using the results of these experiments and others to aid our understanding of the human circadian system, and, ultimately, the development of medical therapies for the treatment of everything from attention disorders, the effects of intergalactic space travel, insomnia and other sleep disorders, and cancer research.



Irina ZhdanovaMost of this is yet to come, however,

there have been some notable steps in the direction of using data gained from zebrafish studies to the development of treatment techniques in humans.

Not surprisingly, Zhdanova has several publications, and seminar talks on just that sort of research pathway.

Irina ZhdanovaMost of this is yet to come, however,

there have been some notable steps in the direction of using data gained from zebrafish studies to the development of treatment techniques in humans.

Not surprisingly, Zhdanova has several publications, and seminar talks on just that sort of research pathway.

Melatonin and Sleep:Melatonin and Sleep: Zebrafish & Humans: Zebrafish & Humans: The puzzle is completeThe puzzle is complete

Melatonin and Sleep:Melatonin and Sleep: Zebrafish & Humans: Zebrafish & Humans: The puzzle is completeThe puzzle is complete

Conlcusion

The study of circadian rhythms and regulation in Zebrafish is an excellent example of a fully translational study, utilizing clinical knowledge, model systems and experiments in uniting participants from various backgrounds and fields for the sake of one cause.

Conlcusion

The study of circadian rhythms and regulation in Zebrafish is an excellent example of a fully translational study, utilizing clinical knowledge, model systems and experiments in uniting participants from various backgrounds and fields for the sake of one cause.

Documents

pieces of the puzzle towards clinical application Melatonin Production In Zebrafish: pieces of the puzzle towards clinical application Imran bin Rafi