Embed Size (px)
Citation preview
er.com/locate/ijfoodmicro
International Journal of Food Micr
Phenotypic and genotypic characterisation of Escherichia coli strains
serogrouped as enteropathogenic E. coli (EPEC) isolated
from pasteurised milk
L.A.M. Carneiro, M.C. Lins, F.R.A. Garcia, A.P.S. Silva, P.M. Mauller, G.B. Alves, A.C.P. Rosa,
J.R.C. Andrade, A.C. Freitas-Almeida, M.L.P. Queiroz *
Disciplina de Microbiologia e Imunologia, Faculdade de Ciencias Medicas, Universidade do Estado do Rio de Janeiro,
Avenida 28 de Setembro, 87, fundos, 3- andar, 20551-030 Rio de Janeiro (RJ), Brazil
Received 29 November 2004; received in revised form 28 September 2005; accepted 12 October 2005
Abstract
Fifty-six Escherichia coli strains, serogrouped as EPEC, isolated from three different brands of pasteurised milk commercialised in Rio de
Janeiro, Brazil, were tested for enteropathogenicity markers. Most of the strains (71.4%) were adherent to HEp-2 cells. The adherent strains were
distributed among 7 EPEC serogroups (O26, O55, O111, O114, O125, O127, O128, O158). Although almost half of these strains (33.9%)
presented unrecognisable adherence phenotypes, classical adherence patterns (localised-like, aggregative and diffuse adherence) described for E.
coli and epidemiologically associated with diarrheagenic strains were observed. None of the strains showed typical localised adherence, usually
associated with EPEC strains, but 4 of them displayed a localised-like adherence (LAL) phenotype, characterised by fewer and less compact
microcolonies but that is still associated with diarrheagenic strains as well as strains of non-human origin. Indeed, 3 of these 4 strains were able to
elicit the attaching–effacing lesion (FAS-positive), the central feature of EPEC pathogenesis, and hybridised with bfpA and eae DNA probes. The
other LAL-positive strain hybridised with the bfpA probe but gave negative results for the eae probe and FAS assays. Interestingly, all LAL-
positive strains produced amplicons of 200 bp in the PCR for bfpA, instead of the expected 326 bp fragment. PCR reactions for stx1 and stx2, two
shiga-toxin-encoding genes, gave negative results. Typing of LEE-associated genes by PCR showed the profile eae (h), tir (h), espA (a) and espB
(a) for one of the LAL-positive strain. The most prevalent adherence phenotype was the aggregative pattern which is observed in strains
epidemiologically associated with persistent diarrhea. Additionally, one strain promoted complete detachment of the Hep-2 cell monolayer after 3
h of infection which might be related to the production of citotoxins, a feature that has been increasingly observed in clinical strains. The
possession of EPEC-related O and H antigens is no longer deemed an essential characteristic of true pathogenic EPEC strains, emphasising the
importance of routinely screen for virulence markers in E. coli strains isolated from foods. Our results are in accordance with data from the
literature that demonstrate that environmental strains display atypical features but yet are capable of eliciting the classical A/E lesion and thus must
be considered as potentially pathogenic. Further, our results demonstrate the potential of pasteurised milk as a vehicle for transmission of
diarrheagenic E. coli in Brazil.
D 2005 Elsevier B.V. All rights reserved.
Keywords: Pasteurised milk; Enteropathogenic Escherichia coli (EPEC); Enteropathogenicity markers
1. Introduction
The contamination of food by enteric pathogens is an
important cause of diarrheal disease in developing countries
resulting in high rates of morbidity and mortality and
significant economic losses (Levine and Edelman, 1984;
0168-1605/$ - see front matter D 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2005.10.010
* Corresponding author. Tel.: +55 21 25876380; fax: +55 21 25876476.
E-mail address: [email protected] (M.L.P. Queiroz).
Law, 1994; Norazah et al., 1998; Lopez-Saucedo et al.,
2003). Enteropathogenic Escherichia coli (EPEC) is a major
cause of infantile diarrhoea in these countries and is respon-
sible for sporadic outbreaks in developed countries (Nataro and
Kaper, 1998). EPEC has been isolated from a great variety of
food such as meat, seafood, vegetables, fruits and from milk
and dairy products specially (Desmasures et al., 1997;
Lindberg et al., 1998; Nataro and Kaper, 1998; Norazah et
al., 1998; Silva et al., 2001, Araujo et al., 2002). The
obiology 108 (2006) 15 – 21
www.elsevi
L.A.M. Carneiro et al. / International Journal of Food Microbiology 108 (2006) 15–2116
substitution of breast-feeding for bottle-feeding with cow’s
milk, which is a cheap and popular food, enhances greatly the
risk of contracting EPEC diarrhoea, especially for infants less
than 6 months old (Levine and Edelman, 1984; Law, 1994;
Nataro and Kaper, 1998).
Historically, EPEC was defined as a category of diarrhea-
genic E. coli belonging to certain serogroups that had been
epidemiologically associated with outbreaks of infantile
diarrhoea (Moyenuddin et al., 1989; Nataro and Kaper,
1998). Although the detection and identification of EPEC
strains in routine laboratories are still based on O serogroup
(Campos, 1996) this E. coli category is actually quite
heterogeneous in the possession of virulence properties.
The first step in the establishment of disease by diarrhea-
genic E. coli is attachment and maintenance of bacteria on the
mucosal surface (Law, 1994; Gomes et al., 1998; Nataro and
Kaper, 1998). Virulent EPEC strains often exhibit a localised
adherence (LA) phenotype to cultured epithelial cells which is
characterised by the formation of numerous compact bacterial
clusters on the cell surface. Some strains form less compact
bacterial clusters only after prolonged incubation periods in an
adherence pattern that is referred to as LA-like (LAL) (Nataro
and Kaper, 1998). In vitro assays with eukaryotic cell lines also
allow the differentiation of two other categories of diarrhea-
genic E. coli: enteroaggregative E. coli (EAEC) and diffusely
adhering E. coli (DAEC). EAEC strains have been associated
with persistent diarrhea but the correlation between DAEC and
disease remains controversial (Nataro et al., 1987).
The attaching and effacing (A/E) lesion is the key feature of
EPEC pathogenesis and is characterised by intimate attachment
of bacteria to the apical enterocyte membrane and localised
destruction of the brush border microvilli with specific
aggregation of actin beneath the site of adherence. The genetic
determinants for the production of A/E lesions are located on
the locus of enterocyte effacement (LEE), a pathogenicity
island on the E. coli chromosome that contains the genes
encoding intimin (eae), a type III secretion system, a number of
secreted proteins (espA, espB) and the translocated intimin
receptor Tir (tir) (Levine et al., 1988; Nataro and Kaper, 1998).
Typical EPEC strains also carry the large EPEC adherence
factor (EAF) plasmid, which presents a cluster of genes that
encodes a type IV pili (bundle forming pilus — BFP), which
interconnects bacteria within microcolonies and thus promotes
their stabilisation (Jerse and Kaper, 1991; Nataro and Kaper,
1998). Intimin, an outer membrane protein, is responsible for
the intimate adherence between bacteria and enterocyte
membranes. The ESP proteins are involved in the formation
of a translocon that delivers effector molecules to the host cell
and disrupts the cytoskeleton, subverting the host cell functions
(Frankel et al., 1998). Several studies have identified variants
(a, h and g) within the eae, tir, espA and espB genes of EPEC
(Adu-Bobie et al., 1998; Beutin et al., 2003).
Typical and atypical EPEC both carry the LEE region and
are distinguished by phenotypic and genotypic characteristics,
virulence properties and reservoirs. Typical EPEC, whose only
known reservoir is human beings, expresses the LA phenotype,
carries the virulence plasmid pEAF and is a leading cause of
infantile diarrhea in developing countries. Atypical EPEC has
both animals and humans as reservoirs, can express LAL, AA
and DA phenotypes in adherence assays, does not harbour the
EAF plasmid or stx (Shiga toxin) genes and seems to be an
important cause of diarrhea in industrialised countries. Atypical
EPEC appear to be an emerging pathogen (Trabulsi et al.,
2002).
Many studies have demonstrated the presence of E. coli
strains serogrouped as EPEC in milk and dairy products.
However, to the best of our knowledge, the true pathogenic
potential of such strains has never been assessed. In the present
study EPEC virulence attributes were investigated in E. coli
strains isolated from pasteurised milk commercialised in the
city of Rio de Janeiro and serologically identified as EPEC in
order to define their true diarrheagenic potential.
2. Materials and methods
2.1. E. coli strains
Fifty-six E. coli strains serogrouped as EPEC were analysed
for virulence markers. These EPEC isolates were recovered
from three different brands of pasteurised milk commercialised
in the city of Rio de Janeiro during a bacteriological study
(Silva et al., 2001). The microbiological analysis of milk
samples showed a high enumeration of indicator microorgan-
isms (mesophilic, psychrotrophic and thermoduric microorgan-
isms, total and fecal coliform). Serological characterisation of
EPEC was carried out using slide agglutination method with
polyvalent and monovalent antisera (Probac do Brasil, Sao
Paulo, Brazil) (Silva et al., 2001).
E. coli strains E2348/69 [EPEC O127:H6; EAF; bfpA; LA;
FAS; eae(a); tir(a); espA(a); espB (a)], E40705 [EHEC
O157:H7; stx; eae(g); tir(g); espA(g); espB(g)], H-30 (EHEC
O26:H11; stx; eae(h); tir(h); espA(h); espB(h)], 239 [EAEC;
AA] and H1/1 [DAEC; DA] were used as positive controls. E.
coli DH5a (K12) was used as negative control.
2.2. HEp-2 adherence assay
E. coli colonies were tested individually by adherence assays
in HEp-2 cells (ATTCC CCL23) (Cravioto et al., 1979). The
cells were grown in Eagle’sMinimumEssentialMedium (MEM,
Sigma Chemical Co., St. Louis, USA) supplemented with fetal
calf serum 5%, gentamicin 50 Ag ml�1 and amphotericin B 2.5
Ag ml�1. Subconfluent cell monolayers grown on 13 mm
diameter glass coverslips placed in 24-well tissue culture plates
(Nunc International, Rochester, USA) were washed twice with
Dulbecco’s phosphate-buffered saline (PBS-D) pH 7.2 and
covered with 1 ml of fresh MEM without antibiotics and
containing d-mannose 1%. Samples (35 Al) of each bacterial
culture grown overnight in Brain Heart Infusion (BHI, Difco
Laboratories, Detroit, USA) were incubated with cell mono-
layers for 3 or 6 h at 37 -C in CO2 5%. In 6 h assays, cells were
washed with PBS-D and freshmediumwas added after 3 h. After
two washes to remove unbound bacteria, cells were fixed with
methanol and stained with Giemsa 5% stain. The stained
L.A.M. Carneiro et al. / International Journal of Food Microbiology 108 (2006) 15–21 17
coverslips were mounted on glass slides and examined by oil
immersion light microscopy. Adherence patterns were identified
as previously described (Nataro et al., 1987).
2.3. Fluorescent actin staining (FAS) test
E. coli strains were examined by the FAS test (Knutton et
al., 1989). After 6 h HEp-2 adherence assay the cells were
fixed, permeabilised with Triton X-100 1%, treated with
fluorescein isothiocyanate-labeled phaloidin (Sigma) and ex-
amined by incident fluorescence microscopy.
2.4. DNA probes and hybridisation analysis
E. coli strains were streaked onto Mac Conkey Agar (Difco)
and incubated at 37 -C overnight. Different colonies from the
same strain were transferred to Whatman 541 paper (Whatman,
Clifton, USA) and the filters were processed and hybridised as
previously described (Maas, 1983). The DNA probe fragments
were radiolabeled with [a-32P] dCTP by the random primer
method and results were revealed by autoradiography. The eae
probe was a 1000-bp SalI–KpnI fragment of pCVD434 (Jerse
et al., 1990) and bfpA was an 852-bp EcoRI fragment of
pMSD207 (Giron et al., 1993). The pCVD432 probe was a
1000-bp XbaI–SmaI fragment of pUC19 (Baudry et al., 1990).
Table 1
Primers used in this study
Target genes Primer designation and sequence (5VY3V)
eae B52 AGGCTTCGTCACAGTTG
B53 CCATCGTCACCAGAGGA
stx1 B54 AGAGCGATGTTACGGTTTG
B55 TTGCCCCCAGAGTGGATG
stx2 B56 TGGGTTTTTCTTCGGTATC
B57 GACATTCTGGACTCTCTT
bfpA bfp1 AATGGTGCTTGCGCTTGCTGC
bfp2 GCCGCTTTATCCAACCTGGTA
eaea B73 TACTGAGATTAAGGCTGATAA
B138 GACCAGAAGAAGATCCA
eaeh B73 TACTGAGATTAAGGCTGATAA
B137 TGTATGTCGCACTCTGATT
eaeg B73 TACTGAGATTAAGGCTGATAA
B74 AGGAAGAGGGTTTTGTGTT
tira B139 C(AG)CC(TG)CCA(CT)TACCTTCACA
B152 CGCTAACCTCCAAACCATT
tirh B139 C(AG)CC(TG)CCA(CT)TACCTTCACA
B140 GATTTTTCCCTCGCCACTA
tirg B139 C(AG)CC(TG)CCA(CT)TACCTTCACA
B141 GTCGGCAGTTTCAGTTTCAC
espAa B163 TGAGGCATCTAA(AG)G(AC)GTC
B165 GCTGGCTATTATTGACCG
espAh B163 TGAGGCATCTAA(AG)G(AC)GTC
B166 TGCCTTTCTTATTCTTGTCA
espAg B163 TGAGGCATCTAA(AG)G(AC)GTC
B164 ATCACGAATACCAGTTACCA
espBa B148 GCCGTTTTTGAGAGCCA
B151 TCCCCAGGACAGATGAGAT
espBh B148 GCCGTTTTTGAGAGCCA
B149 CTTTCCGTTGCCTTAGT
espBg B148 GCCGTTTTTGAGAGCCA
B150 GCACCAGCAGCCTTTGA
2.5. Polymerase chain reaction (PCR) assays
The primers used in this study are listed in Table 1. E. coli
strains were grown on Tryptic Soy agar (Difco) at 37 -C for
18 to 24 h. A direct colony suspension of the culture was
prepared in 250 Al of deionised water, vortexed and boiled for
10 min for DNA extraction, and 5 Al of the suspension was
used for each 45 Al reaction mixture. The PCR mixture
contained 10� PCR buffer (100 mM TRIS–HCl, 500 mM
KCl [pH 8.4], Perkin Elmer/Roche, Norwalk, USA), supple-
mented with MgCl2 to final concentration of 1.5 mM, 2.5
mM of dNTP (Invitrogen, Sao Paulo, Brasil), 0.5 Al (400 nM)
of each primer (Invitrogen), and 1 U of Taq DNA polymerase
(Invitrogen). PCR reactions were performed in a DNA
termocycler (PTC-100, MJ Research, Watertown, USA). For
eae, stx1 and stx2, the following cycles were used: 30� (94
-C for 30 s, 52 -C for 30 s, 72 -C for 90 s). For espA
subtypes, the following cycles were used: 29� (94 -C for 30
s, 48 -C for 30 s, 72 -C for 30 s) and for eae, tir and espB
subtypes 29� (94 -C for 30 s, 50 -C for 30 s, 72 -C for 30
s). For bfpA, the following cycles were used: 29� (94 -C for
30 s, 56 -C for 60 s, 72 -C for 120 s). The PCR products
were resolved by gel electrophoresis in 1% agarose (Sigma),
stained with ethidium bromide, and visualised under UV
transillumination.
Amplicon size (bp) Reference
570 [China et al., 1996]
388 [China et al., 1996]
807 [China et al., 1996]
326 [Gunzburet et al., 1995]
452 [China et al., 1999]
520 [China et al., 1999]
778 [China et al., 1999]
342 [China et al., 1999]
560 [China et al., 1999]
781 [China et al., 1999]
269 [China et al., 1999]
101 [China et al., 1999]
172 [China et al., 1999]
94 [China et al., 1999]
233 [China et al., 1999]
188 [China et al., 1999]
Fig. 2. PCR amplification of bfpA from extracts of E. coli cultures. Lanes: 1
and 11, 100-bp ladder; 2, negative control; 3, E. coli C600 (bfpA negative); 4
to 8, bfpA-positive EPEC strains E30, E141, E196, E249 (colonies A and B)
L.A.M. Carneiro et al. / International Journal of Food Microbiology 108 (2006) 15–2118
3. Results
Of the 56 strains isolated from 90 milk samples and
previously serogrouped as EPEC, 40 (71.4%) strains were
adherent to HEp-2 cells and 4 (7.1%), 15 (26.7%) and 2 (3.5%)
strains displayed LAL, AA and DA, respectively (Fig. 1).
Nineteen (33.9%) strains presented unrecognisable adherence
patterns, distinct from those described in the literature. One
strain (serogroup O127) promoted complete detachment of the
HEp-2 monolayer in the 3-h adherence assay. The strains
exhibiting LAL belonged to serogroups O114, O125, O127 and
O158. The AA was found in strains serogrouped as O26, O55,
O111, O114, O125, O128 and O158, while those strains
showing DA were serogrouped as O26 (Table 2).
The ability to elicit the A/E lesion was demonstrated in three
of the 4 strains that showed LAL by the FAS test (Table 2).
Fig. 1. Adherence phenotypes among E. coli strains from pasteurised milk
commercialised in the city of Rio de Janeiro. a) Localised adherence-like
(LAL), strain E30 (O158); b) aggregative adherence (AA), strain E149 (O125).
from serogroups O158, O114, O125 and O127, respectively; 9 and 10, EPEC
E2348/69 (O127:H6, bfpA positive). The sizes of the PCR amplicons were
indicated.
A good correlation between phenotypic and genotypic
markers was observed. All strains were tested for the presence
of bfpA and eae genes, but only the 3 strains (serogroups
O114, O127, O158) showed LAL and gave positive results in
the FAS test hybridised with bfpA and eae probes. The other
strain displaying LAL (serogroup O125) hybridised with bfpA
probe but not with the eae probe and consistent with that did
not elicit the A/E lesion.
In the PCR assays, it was found that all strains were
negative for stx1 and stx2 and even those eae-probe positive
strains were negative for eae amplification. The bfpA probe-
positive strains produced 200 bp amplicons with bfpA primers,
instead of the expected fragments of 326 bp (Fig. 2).
Only one strain (1.7%) was positive for all EPEC
enteropathogenicity markers tested. This strain (serogroup
O127) was LAL, FAS, hybridised with bfpA and eae probes
and had the LEE genes typed by PCR: eae (h), tir (h), espA(a) and espB (a) (Table 2).
4. Discussion
Important procedures combining elimination of bacteria
causing disease at the farm level and pasteurisation of milk
before distribution have been applied by the dairy industry,
but yet several studies have identified EPEC and other
potentially pathogenic bacteria in pasteurised milk and its
products (Baird Parker, 1994; Norazah et al., 1998). There are
many points at which the milk might be contaminated
including inappropriate milking conditions, insufficient pas-
teurisation, post-pasteurisation contamination due to contam-
inated equipment or improper storage conditions. The
identification of the source of contamination was beyond
the scope of this study since we aimed to analyse the
potential of pasteurised milk commercially available as a
vehicle for the dissemination of diarrheagenic E. coli as it
reaches the final customer. Still, it is interesting to notice that
E. coli strains presenting important enteropathogenicity
markers were isolated from all the three different brands
Table 2
Enteropathogenicity markers in E. coli strains serogrouped as EPEC isolated from pasteurised milk in Rio de Janeiro, Brazil
Serogroups
(strains)
HEp-2 adherence Assay
FAS
test
DNA probes PCR
LA LAL DA AA NC NA eae bfpA eae tir espA espB bfpA stx pCVD432
O26 (5) – – 2 1 1 1 – – – – – – – – – 1
O55 (7) – – – 2 4 1 – – – – – – – – – 2
O86 (5) – – – – 2 3 – – – – – – – – – –
O111 (5) – – – 1 2 2 – – – – – – – – – 1
O114 (9) – 1 – 3 2 3 1 1 1 N N N N – – 3
O119 (1) – – – – 1 – – – – – – – – – – –
O125 (5) – 1 – 2 1 1 – – 1 – – – – – – 2
O126 (1) – – – – 1 – – – – – – – – – – –
O127 (6)a – 1 – 1 2 2 1 1 1 h h a a – – 1
O128 (5) – – – 4 1 – – – – – – – – – – 4
O142 (2) – – – – 1 1 – – – – – – – – – –
O158 (4) – 1 – 1 2 – 1 1 1 N N N N – – 1
Total (56) – 4 2 15 20 14 3 3 4 1 1 1 1 0 0 15
LA, localized adherence; LAL, localized-like adherence; AA, aggregative adherence; DA, diffuse adherence; NC, adherence without a recognizable pattern; NA, not
adherent.
N, non-a, h or g subtypes.
L.A.M. Carneiro et al. / International Journal of Food Microbiology 108 (2006) 15–21 19
analysed showing no indication of a common source of
contamination.
In this study forty (71.4%) of the 56 strains recovered from
pasteurised milk and serogrouped as EPEC adhered to the
HEp-2 cells. However, none of the strains showed a typical LA
pattern commonly observed with clinical strains from human
origin. Four (7.1%) strains presented a LAL phenotype,
characterised by few and less compact microcolonies observed
only in adherence tests carried out in 6-h incubation periods.
This adherence phenotype has been observed in E. coli strains
isolated from children with acute diarrhea in several studies and
also in strains of non-human origin (Rodrigues et al., 1996;
Gomes et al., 1998; Nataro and Kaper, 1998). Usually the LAL
phenotype is a result of the loss of the EAF plasmid but since
these strains carry the eae gene they are still able to induce
microvilli effacement.
Interestingly in this work most LAL-positive strains
possessed both bfpA (present within the EAF plasmid) and
eae genes as detected by colony hybridisation tests and were
able to induce A/E lesion, as established by a positive FAS test.
One strain (serogroup O125) that carried the bfpA gene but not
the eae gene still adhered in a LAL pattern but as expected was
incapable of eliciting the A/E lesion.
The bfpA and eae genes were detected by DNA hybridisa-
tion, but not by PCR tests. Other studies have described
difficulties in the detection of virulence genes in clinical
isolates of EPEC that were able of eliciting A/E lesion (Jallat et
al., 1993; Yamamoto et al., 1994; Polotsky et al., 1997). In this
case, it has to be noticed that the primers used were designed
for typical EPEC strains of human origin and it is possible that
variations in the genes present in atypical strains from human
and environmental sources are not detected by the more
specific PCR technique. For example, the LAL-positive strains
(serogroups O114, O125, O127 and O158) consistently
presented amplification products below the expected size in
PCR assays for bfpA suggesting a deletion on this gene that
could contribute for the lower efficiency with which these
strains attached to cells, producing a LAL-type adherence
phenotype only in 6-h adherence tests. Additionally, it was
found that in the colony hybridisation tests only a few colonies
of each strain reacted with the DNA probes suggesting a
heterogeneous distribution of these genes in the bacterial
strains tested. Only one strain (serogroup O127) presenting
LAL and FAS-positive phenotype was positive in PCR tests to
the LEE genes types tested.
The adherence assay in HEp-2 cells allowed the identifi-
cation of two other categories of potentially diahrreagenic E.
coli: 15 (26.7%) strains were classified as EAEC while 2
(3.5%) other strains were considered to belong to the DAEC
category. In the aggregative phenotype displayed by EAEC
the bacteria assume a characteristic ‘‘stacked brick’’ pattern
which is evident both on the surface of the cells as well as on
the glass coverslip. In the diffuse adherence pattern the cell
surface is uniformly covered with adherent bacteria, mostly as
single organisms. The correlation between EAEC and
persistent diarrhea is well established now but the association
of DAEC with disease remains controversial.
Stx-producing E. coli (STEC) were not detected among the
E. coli strains serogrouped as EPEC isolated from pasteurised
milk. Bovine sources seem to be a major reservoir of STEC
and this microorganism has been recovered in high numbers
from beef products and bovine faeces in Brazil (Cerqueira et
al., 1999). DAEC and EAEC are considered emerging
pathogens and have been implicated in diarrheal outbreaks
(Bhan et al., 1989; Gomes et al., 1989; Giron et al., 1991;
Gonzalez et al., 1997; Beutin et al., 2003). In this work both
categories were found. EAEC strains were positive (100%)
with the pCVD432 probe in colony-hybridisation tests. Case–
control studies in South America and in Europe reported that
DAEC and EAEC were by far most frequent to patients than
in its matched controls indicating they must be considered
pathogens although their pathogenicity mechanisms are still
L.A.M. Carneiro et al. / International Journal of Food Microbiology 108 (2006) 15–2120
not clear (Forestier et al., 1996; Gomes et al., 1998; Pabst et
al., 2003).
One E. coli strain (serogroup O127) promoted complete
detachment of the HEp-2 monolayer in the 3-h adherence
assay. This event has also been observed in clinical isolates and
is possibly related to cytotoxin production (Echeverria et al.,
1987; Jallat et al., 1993; Gomes et al., 1998).
Most E. coli strains serogrouped as EPEC produced
negative results when tested for pathogenicity markers such
as eae, bfpA, FAS and cell adherence. The possession of
EPEC-related O and H antigens is no longer deemed an
essential characteristic of true pathogenic EPEC strains,
emphasising the importance of routinely screen for virulence
markers in E. coli strains isolated from foods, regardless of
whether they have been serogrouped as EPEC (Gonzalez et al.,
2000). Several studies have been successful in showing good
correlation between adherence assays, the FAS test and the
presence of adherence-related genes to detect diarrheagenic
strains (Levine et al., 1988; Moyenuddin et al., 1989;
Tornieporth et al., 1995; Gomes et al., 1998; Nataro and
Kaper, 1998, Vidal et al., 2004).
In this study, EPEC pathogenicity markers and other
virulence genes were sought in E. coli strains isolated from a
popular and highly consumed food. Our results are in
accordance with data from the literature that demonstrate that
environmental strains display atypical features, i.e. distinct
from those observed in clinical strains from human origin, but
yet are capable of eliciting the classical A/E lesion and thus
must be considered as potentially pathogenic. These results
demonstrated the potential of pasteurised milk as a vehicle for
transmission of diarrheagenic E. coli in Brazil.
References
Adu-Bobie, J., Frankel, G., Bain, C., Goncalves, A.G., Trabulsi, L.R., Douce,
G., Knutton, S., Dougan, G., 1998. Detection of intimins a, h, g, and y,four intimin derivatives expressed by attaching and effacing microbial
pathogens. J. Clin. Microbiol. 36, 662–668.
Araujo, V.S., Pagliares, V.A., Queiroz, M.L.P., Freitas-Almeida, A.C., 2002.
Ocurrence of Staphylococcus and enteropathogens in soft cheese
commercialised in the city of Rio de Janeiro, Brazil. J. Appl. Microbiol.
92, 1172–1177.
Baird Parker, A.C., 1994. Foods and microbiological risks. Microbiology 140,
687–695.
Baudry, B., Savarino, S.J., Vial, P., Kaper, J.B., Levine, M.M., 1990. A sensitive
and specific DNA probe to identify enteroaggregative Escherichia coli, a
recently discovered diarrheal pathogen. J. Infect. Dis. 161, 1249–1251.
Beutin, L., Marches, O., Bettelheim, K.A., Gleier, K., Zimmermann, S.,
Schmidt, H., Oswald, E., 2003. HEp-2 cell adherence, actin aggregation,
and intimin types of attaching and effacing Escherichia coli strains
isolated from healthy infants in Germany and Australia. Infect. Immun.
71, 3995–4002.
Bhan, M.K., Raj, P., Levine, M.M., Kaper, J.B., Bhandari, N., Srivastava, R.,
Kumar, R., Sazawal, S., 1989. Enteroaggregative Escherichia coli
associated with persistent diarrhea in a cohort of rural children in India.
J. Infect. Dis. 159, 1061–1064.
Campos, L.C., 1996. Conventional methods for the diagnosis of enteropatho-
genic Escherichia coli infections. Rev. Microbiol. 27 (Suppl.1), 1–6.
Cerqueira, A.M., Guth, B.E., Joaquim, R.M., Andrade, J.R.C., 1999. High
occurrence of Shiga toxin-producing Escherichia coli (STEC) in healthy
cattle in Rio de Janeiro State, Brazil. Vet. Microbiol. 70, 111–121.
China, B., Pirson, V., Mainil, J., 1996. Typing of bovine attaching and effacing
Escherichia coli by multiplex in vitro amplification of virulence-associated
genes. Appl. Environ. Microbiol. 62, 3462–3465.
China, B., Goffaux, F., Pirson, V., Mainil, J., 1999. Comparison of eae, tir, esp
A and esp B genes of bovine and human attaching and effacing Escherichia
coli by multiplex polimerase chain reaction. FEMS Microbiol. Lett. 178,
177–182.
Cravioto, A., Gross, R.J., Scotland, S.M., Rowe, B., 1979. An adhesive factor
found in strains of Escherichia coli belonging to the traditional infantile
enteropathogenic serotypes. Curr. Microbiol. 3, 98–99.
Desmasures, N., Bazin, F., Gueguen, M., 1997. Microbiological composition
of raw milk from selected farms in the Camembert region of Normandy.
J. Appl. Microbiol. 83, 53–58.
Echeverria, P., Taylor, D.N., Rolfe, A.D., Supawat, K., Ratchrachenchai, O.,
Kaper, J., Keusch, G.T., 1987. HeLa cell adherence and cytotoxin
production by enteropthogenic Escherichia coli isolated from infants with
diarrhea in Thailand. J. Clin. Microbiol. 25, 1519–1523.
Forestier, C., Meyer, M., Favre-Bonte, S., Rich, C., Malpuech, G., Bouguenec,
C., Sirot, J., Joly, B., Champs, C., 1996. Enteroadherent Escherichia coli
and diarrhea in children: a prospective case–control study. J. Clin.
Microbiol. 34, 2897–2903.
Frankel, G., Phillips, A.D., Rosenshine, I., Dougan, G., Kaper, J.B., Knutton,
S., 1998. Enteropathogenic and enterohaemorragic Escherichia coli more
subversive elements. Mol. Microbiol. 30, 911–921.
Giron, J.A., Jones, T., Millan-Velasco, F., Castro-Munoz, E., Zarate, L., Fry, J.,
Frankel, G., Moseley, S.L., Baudry, B., Kaper, J.B., Schoolnik, J.K., Riley,
L.W., 1991. Diffuse-adhering Escherichia coli (DAEC) as a putative cause
of diarrhea in Mayan children of Mexico. J. Infect. Dis. 163, 507–513.
Giron, J.A., Donnenberg, M.S., Martin, W.C., Jarvis, K.G., Kaper, J.B.,
1993. Distribution of the bundle forming pilus structural gene (bfpA)
among enteropathogenic Escherichia coli. J. Infect. Dis. 168, 1037–1041.
Gomes, T.A.T., Blake, P.A., Trabulsi, L.R., 1989. Prevalence of Escherichia
coli strains with localised, diffuse, and aggregative adherence to HeLa
cells in infants with diarrhea and matched controls. J. Clin. Microbiol.
164, 266–269.
Gomes, T.A.T., Vieira, M.A.M., Abe, C.M., Rodrigues, D., Griffin, P.M.,
Ramos, S.R., 1998. Adherence patterns and adherence-related DNA
sequences in Escherichia coli isolates from children with and without
diarrhea in Sao Paulo city, Brazil. J. Clin. Microbiol. 36, 3609–3613.
Gonzalez, R., Diaz, C., Marino, M., Claoralt, R., Pequenez, M., Perez-Schael,
I., 1997. Age-specific prevalence of Escherichia coli with localized and
aggregative adherence in Venezuelan infants with acute diarrhea. J. Clin.
Microbiol. 35, 1103–1107.
Gonzalez, A.G.M., Rosa, A.C.P., Andrade, J.R.C., Tibana, A., 2000. Enter-
opathogenicity markers in Escherichia coli strains isolated from soft white
cheese and poultry in Rio de Janeiro, Brazil. Food Microbiol. 17, 321–328.
Gunzburg, S.T., Tornieporth, N.G., Riley, L.W., 1995. Identification of
enterophatogenic Escherichia coli by PCR-based detection of the bundle-
forming pilus gene. J. Clin. Microbiol. 33, 1375–1377.
Jallat, C., Livrelli, V., Michaud, A.D., Rich, C., Joly, B., 1993. Escherichia coli
strains involved in diarrhea in France: high prevalence and heterogeneity of
diffusely adhering strains. J. Clin. Microbiol. 31, 2031–2037.
Jerse, A.E., Kaper, J.B., 1991. The eae gene of enteropathogenic Escherichia
coli encodes a 94-kilodalton membrane protein, the expression of which is
influenced by the EAF plasmid. Infect. Immun. 59, 4302–4309.
Jerse, A.E., Yu, J., Tall, B.D., Kaper, J.B., 1990. A genetic locus of
enteropathogenic Escherichia coli necessary for the production of attaching
and effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. U. S. A.
87, 7839–7843.
Knutton, S., Baldwin, T., Willians, P.H., McNeish, A.S., 1989. Actin
accumulation at sites of bacterial adhesion to tissue culture cells: basis of
a new diagnostic test for enteropathogenic and enterohemorrhagic Escher-
ichia coli. Infect. Immun. 57, 1290–1298.
Law, D., 1994. Adhesion and its role in the virulence of enterophatogenic
Escherichia coli. Clin. Microbiol. Rev. 7, 152–173.
Levine, M.M., Edelman, R., 1984. Enterophatogenic Escherichia coli of classic
serotypes associated infant diarrhea: epidemiology and pathogenesis.
Epidemiol. Rev. 6, 31–51.
L.A.M. Carneiro et al. / International Journal of Food Microbiology 108 (2006) 15–21 21
Levine, M.M., Prado, V., Robins-Browne, R., Lior, H., Kaper, J.B., Moseley,
S.L., Gicquelais, K., Nataro, J.P., Vial, P., Tall, B., 1988. Use of DNA
probes and Hep-2 cell adherence assay to detect diarrheagenic Escherichia
coli. J. Infect. Dis. 158, 224–228.
Lindberg, A.M., Ljungh, A., Ahrne, S., Lofdahl, S., Molin, G., 1998.
Enterobacteriaceae found in high numbers of fish, minced meat and
pasteurised milk or cream and the presence of toxin encoding genes. Int. J.
Food Microbiol. 39, 11–17.
Lopez-Saucedo, C., Cerna, J.F., Villegas-Sepulveda, N., Thompson, R.,
Velazquez, F.R., Torres, J., Tarr, P.I., Estrada-Garcia, T., 2003. Single
multiplex polymerase chain reaction to detect diverse loci associated with
diarrheagenic Escherichia coli. Emerg. Infect. Dis. 9, 127–131.
Maas, R., 1983. An improved colony hybridisation method with significantly
increased sensitivity for detection of single genes. Plasmid 10, 296–298.
Moyenuddin, M., Wachsmuth, I.K., Moseley, S.L., Bopp, C.A., Blake, P.A.,
1989. Serotype, antimicrobial resistance and adherence properties of
Escherichia coli strains associated with outbreaks of diarrheal illness in
children in the United States. J. Clin. Microbiol. 27, 2234–2239.
Nataro, J.P., Kaper, J.B., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol.
Rev. 11, 142–201.
Nataro, J.P., Kaper, J.B., Robins-Browne, R., Prado, V., Vial, P., Levine, M.,
1987. Patterns of adherence of diarrheagenic Escherichia coli to Hep-2
cells. J. Pediatr. Infect. Dis. 6, 829–831.
Norazah, A., Rahizan, I., Zainuldin, T., Rohani, M.Y., Kamel1, A.G.M., 1998.
Enterophatogenic Escherichia coli in raw and cooked food. South Asian J.
Trop. Med. Public Health 29, 91–93.
Pabst, W.L., Altwegg, M., Kind, C., Mirjanic, S., Hardegger, D., Nadal,
D., 2003. Prevalence of enteroaggregative Escherichia coli among
children with and without diarrhea in Switzerland. J. Clin. Microbiol. 41,
2289–2293.
Polotsky, Y., Nataro, J.P., Kotler, D., Barret, T.J., Orestein, J.M., 1997. Hep-2
cell adherence patterns, serotyping and DNA analysis of Escherichia coli
isolates from eight patients with AIDS and chronic diarrhea. J. Clin.
Microbiol. 35, 1952–1958.
Rodrigues, J., Scaletsky, I.C.A., Campos, L.C., Gomes, T.A.T., Whittman,
T.S., Trabulsi, L.R., 1996. Clonal structure and virulence factors in strains
of Escherichia coli of the classic serogroup O55. Infect. Immun. 64,
2680–2686.
Silva, Z.N., Cunha, A.S., Lins, M.C., Carneiro, L.A.M., Freitas-Almeida, A.C.,
Queiroz, M.L.P., 2001. Isolation and serological identification of entero-
pathogenic Escherichia coli in pasteurized milk in Brazil. Rev. Saude
Publica 35, 375–379.
Tornieporth, N.G., John, J., Salgado, K., Jesus, P., Latham, E., Melo, M.C.N.,
Gunzburg, S.T., Riley, L.W., 1995. Differentiation of pathogenic Escher-
ichia coli strains in Brazilian children by PCR. J. Clin. Microbiol. 33,
1371–1374.
Trabulsi, L.R., Keller, R., Gomes, T.A.T., 2002. Typical and atypical
enteropathogenic Escherichia coli. Emerg. Infect. Dis. 6, 508–513.
Vidal, R., Vidal, M., Lagos, R., Levine, M., Prado, V., 2004. Multiplex PCR for
diagnosis of enteric infections associated with diarrheagenic Escherichia
coli. J. Clin. Microbiol. 42, 1787–1789.
Yamamoto, T., Kaneko, M., Changchawalit, S., Serichantalergs, O., Ijuin, S.,
Echeverria, P., 1994. Actin accumulation associated with clustered and
localized adherence in Escherichia coli isolated from patients with diarrhea.
Infect. Immun. 62, 2917–2929.
