Operon for Biosynthesis of Lipstatin, the Beta-Lactone Inhibitor ofHuman Pancreatic Lipase

Tingli Bai,a,c Daozhong Zhang,b Shuangjun Lin,a Qingshan Long,a Yemin Wang,a Hongyu Ou,a Qianjin Kang,a Zixin Deng,a Wen Liu,b

Meifeng Taoa

State Key Laboratory of Microbial Metabolism, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, Chinaa; State Key Laboratory ofBioorganic and Natural Products Chemistry, Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences, Shanghai, Chinab; State Key Laboratory of AgriculturalMicrobiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Chinac

Lipstatin, isolated from Streptomyces toxytricini as a potent and selective inhibitor of human pancreatic lipase, is a precursor fortetrahydrolipstatin (also known as orlistat, Xenical, and Alli), the only FDA-approved antiobesity medication for long-term use.Lipstatin features a 2-hexyl-3,5-dihydroxy-7,10-hexadecadienoic-�-lactone structure with an N-formyl-L-leucine group attachedas an ester to the 5-hydroxy group. It has been suggested that the �-branched 3,5-dihydroxy fatty acid �-lactone moiety of lipsta-tin in S. toxytricini is derived from Claisen condensation between two fatty acid substrates, which are derived from incompleteoxidative degradation of linoleic acid based on feeding experiments. In this study, we identified a six-gene operon (lst) that wasessential for the biosynthesis of lipstatin by large-deletion, complementation, and single-gene knockout experiments. lstA, lstB,and lstC, which encode two �-ketoacyl–acyl carrier protein synthase III homologues and an acyl coenzyme A (acyl-CoA) synthe-tase homologue, were indicated to be responsible for the generation of the �-branched 3,5-dihydroxy fatty acid backbone. Sub-sequently, the nonribosomal peptide synthetase (NRPS) gene lstE and the putative formyltransferase gene lstF were involved indecoration of the �-branched 3,5-dihydroxy fatty acid chain with an N-formylated leucine residue. Finally, the 3�-hydroxy-steroid dehydrogenase-homologous gene lstD might be responsible for the reduction of the �-keto group of the biosyntheticintermediate, thereby facilitating the formation of the unique �-lactone ring.

Lipstatin (Fig. 1, structure 1) was originally isolated from fer-mentation broth of Streptomyces toxytricini as a very potent,

selective, irreversible inhibitor of human pancreatic lipase (1, 2).The saturated derivative of lipstatin, tetrahydrolipstatin (Fig. 1,structure 2), commonly known as orlistat, is currently the onlyavailable FDA-approved oral drug for long-term treatment ofobesity because of its cardiovascular safety and its benefits fordiabetes control in obese patients (3, 4). Orlistat blocks the activityof human pancreatic and gastric lipases, thereby reducing the ab-sorption of fat from diets (5, 6). Orlistat was also found to exhibitantitumor activity, by virtue of its ability to inhibit the thioesterasedomain of fatty acid synthase of tumor cells (7).

Lipstatin features a 2,3-trans-disubstituted �-propiolactonewith two linear alkyl chains of C6 at the �-site and C13 at the �-site,respectively (i.e., an �-branched 3,5-dihydroxy fatty acid �-lac-tone backbone), and an N-formyl-L-leucine group attached as anester to the 5-hydroxy of the long chain of the �-branched fattyacid backbone (8, 9) (Fig. 1, structure 1). Opening of the 4-mem-bered ring results in an almost complete loss of the lipase-inhibi-tory activity of lipstatin, suggesting that the �-lactone moiety ofthe molecule is pivotal to its enzymatic inhibition (10). Other�-lactone natural products produced by microorganisms includeesterastin (11, 12), panclicins (13), valilactone (14), and ebelac-tones (15, 16), which differ only in the structure of the side chainsand the nature of the linked amino acids. For instance, esterastin,a potent inhibitor of lysosomal acid lipase and esterase, has anN-acetyl asparagine side chain instead of an N-formyl-leucine(Fig. 1, structure 3) (11, 12).

The biosynthesis of lipstatin in S. toxytricini has been inten-sively studied based on 15N, 13C, and deuterium labeling experi-ments by the Bacher group (17–21). The �-branched fatty acidmoiety of lipstatin is derived from Claisen condensation between

octanoyl coenzyme A (octanoyl-CoA) and 3-hydroxytetradeca-5,8-dienoyl-CoA, both of which are obtained from incomplete�-oxidation of linoleic acid (17–21). In addition, the H-2 atom ofthe octanoic acid precursor is displaced with the solvent protonin the final product lipstatin (20). In contrast, the two long-chain fatty acid substrates of the mycolic acids (complex�-branched �-hydroxy long-chain fatty acids) of mycobacteriaand corynebacteria are synthesized by type I and type II fattyacid synthetase systems (FASI and FASII, respectively) (22).Subsequently, Pks13, a type I polyketide synthase (PKS) withmultiple functional domains, takes the two substrates by attachingthem to two phosphopantetheine-binding (PPB) domains andcatalyzes Claisen condensation between two tethered sub-strates by the ketosynthase (KS) domain (23). Furthermore,when [13C-formyl,15N]-N-formyl-leucine was fed to S. toxytri-cini fermentation broth, only the 15N-leucine moiety of thedouble-labeled chemical was incorporated into lipstatin, sug-gesting that the incorporation of leucine takes place after hy-drolysis of the formamide motif and that the formyl group istransferred to the L-leucine residue afterwards (21).

Received 28 May 2014 Accepted 16 September 2014

Published ahead of print 19 September 2014

Editor: H. Nojiri

Address correspondence to Meifeng Tao, tao_meifeng@sjtu.edu.cn.

T.B. and D.Z. contributed equally to this work.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01765-14.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.01765-14

December 2014 Volume 80 Number 24 Applied and Environmental Microbiology p. 7473–7483 aem.asm.org 7473

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Here we report the identification of the lipstatin biosyntheticoperon based on genome sequencing, bioinformatics analyses,and genetic manipulations. A six-gene operon, encoding homo-logues of two �-ketoacyl-acyl carrier protein synthases III (FabH),an acyl-CoA synthetase, a 3�-hydroxysteroid dehydrogenase, anonribosomal peptide synthetase (NRPS), and a formyltrans-ferase, was found to be sufficient for the production of lipstatin inStreptomyces. Furthermore, new metabolites were produced bythree S. toxytricini gene deletion strains. The model of the lipstatinbiosynthetic pathway is updated accordingly.

MATERIALS AND METHODSBacterial strains, plasmids, and culture conditions. S. toxytricini NRRL15443was provided by the ARS Culture Collection. Streptomyces lividans TK24(24) was used as the host for heterologous expression of the lipstatinbiosynthetic operon. Escherichia coli DH10B was used for routine cloningexperiments. E. coli XL1-Blue MR (Stratagene) was used as the host forconstruction of the genomic cosmid library. E. coli BW25113/pIJ790 wasused for �-red-mediated recombination (25). E. coli ET12567 carryingRK2-derived conjugation helper plasmid pUZ8002 was used as the donorfor E. coli-Streptomyces intergeneric conjugation (26).

pJTU2554 containing an origin of transfer (oriT) from RK2, a func-tional int-attP (integrase gene-attachment site of phage) region of actino-mycete phage �C31, and two lambda phage cos sites was used as the vectorfor the genomic cosmid library (27). 27F11, a genomic cosmid clone contain-ing 46.5 kb of S. toxytricini genomic DNA including the putative lipstatinbiosynthetic operon, was used to construct gene deletion mutants. oriT-containing plasmid pOJ260 (28), which does not replicate in streptomy-cetes, was used as a suicide vector for gene replacement in S. toxytricini.

E. coli strains were grown in the Luria-Bertani (LB) broth (29) at 37°C,except for BW25113/pIJ790, which was grown at 30°C. S. lividans strainswere grown on MS agar at 30°C for sporulation and conjugation (24). S.toxytricini strains were grown on International Streptomyces Project Me-dium 4 (ISP4; BD Biosciences, San Jose, CA, USA) for sporulation andconjugation. Fermentation seed medium (10 g of soya bean flour, 5 g ofBacto soytone, 5 ml of glycerol, 10 ml of soya oil, and 2 ml of Triton X-100[pH 6.5] per liter) and fermentation medium (30 g of soya bean flour, 14ml of glycerol, 1 g of Bacto soytone, 1 ml of Triton X-100, and 60 ml ofsoya oil [pH 7.0] per liter) (30) were used for shake flask fermentation ofS. toxytricini and S. lividans strains.

Genomic sequencing and bioinformatics analyses. S. toxytriciniNRRL15443 genomic DNA was prepared as described previously (24).The genome sequence was determined by using the Roche 454 GS (FLX

Titanium) sequencing platform. All reads, providing �25-fold genomecoverage, were assembled by using Newbler 2.5.3 software (Roche Di-agnostics, Branford, CT), and 212 contigs were obtained. The assem-bled genome sequence was annotated on a high-performance server(NF8560M2; Inspur) with the program Glimmer 3.0 for identificationof protein-coding genes (31). The genes in the lipstatin biosyntheticlocus were analyzed by a BLASTp search against the NCBI nonredun-dant protein sequence, UniProtKB/Swiss-Prot, and Conserved Do-main Database (CDD) databases (32–34).

S. toxytricini NRRL15443 genomic cosmid library. pJTU2554 vectorDNA was digested by BamHI and HpaI, and the resulting cos-containing6.8-kb and 2.7-kb fragments were gel purified. Genomic DNA of S.toxytricini NRRL15443 was partially digested with Sau3AI, and DNA frac-tions of 35 to 45 kb were obtained by agarose gel electrophoresis separa-tion and gel extraction. Ligation, competent-cell preparation, librarypackaging, transfection, storage, and screening of the library were con-ducted according to standard molecular biology protocols (29). Thegenomic library was screened for cosmids that contained DNA of theputative lipstatin biosynthetic operon (lst) by Southern hybridization us-ing a PCR-amplified 429-bp DNA fragment internal to the formyltrans-ferase gene lstF. Oligonucleotides used for PCR amplification of the429-bp DNA were lstF-F (5=-GTCGCTGGGGCTCCGCATCGT-3=) andlstF-R (5=-TCGGCGACTTCGGGTGCGTG-3=).

Construction of the large-deletion mutant strain SBT11. SBT11, alarge-fragment-deletion mutant of S. toxytricini, was generated by remov-ing a 38.4-kb genomic DNA fragment, including the lst operon from thewild-type chromosome, via homologous recombination using a suicideconstruct, pHTL6. The gene displacement construct pHLTL6 was derivedfrom pOJ260, harboring a 4.9-kb BamHI fragment and a 2.7-kb XbaI-BamHI fragment identical to the left and right ends of the S. toxytricinigenomic DNA insert of cosmid 27F11, respectively. pHLTL6 was conju-gated into S. toxytricini, and offspring single colonies of the exconjugantswere screened for double-crossover events, indicated by a loss of apramy-cin resistance and PCR amplification band patterns. The resulting mutantstrain, named SBT11, was verified by PCR experiments to carry the38.4-kb large-fragment deletion (Table 1 and Fig. 2a; see also Fig. S1 in thesupplemental material).

Construction of 27F11-derived integrative plasmids carrying genedeletions. 27F11-derived integrative plasmids carrying deletions in the lstoperon and flanking sequences were constructed by �-red-mediated re-combination (PCR targeting technology) between 27F11 and PCR-ampli-fied DNA fragments harboring the spectinomycin/streptomycin resis-tance gene aadA (24, 25). PmeI restriction sites (GAAATTTC) were set insome pairs of oligonucleotides for amplification of the aadA cassette. TheaadA cassettes of some 27F11-derived plasmids were removed to generatein-frame deletion mutants, when necessary, by PmeI restriction digestionand religation after �-red-mediated recombination (see below). Oligonu-cleotides for construction and verification of gene deletion mutants arelisted in Tables 1 and 2, respectively.

Thirteen integrative plasmids carrying different gene deletions weregenerated from integrative cosmid 27F11 by employing these methods.These plasmids included (i) pDelL, in which a 15-kb left-terminal fragment ofthe genomic DNA insert of 27F11 was deleted; (ii) pDelR, in which a 9-kbright-terminal fragment of the genomic DNA insert of 27F11 was deleted; (iii)pDlstF and pDorf4, in which the open reading frames of lstF and orf4 werereplaced by aadA, respectively; and (iv) pDlstA, pDlstB, pDlstC, pDlstD, pDl-stE, pDorf1, pDorf2, pDorf3, and pDorf6, in which internal fragments of lstA,lstB, lstC, lstD, lstE, orf1, orf2, orf3, and orf6 were deleted from 27F11, respec-tively, affording in-frame deletion mutants of these genes.

Construction of S. toxytricini gene deletion mutants. 27F11-derivedintegrative plasmids carrying deletions in the lst operon and flanking se-quences were transferred by E. coli-Streptomyces conjugation into large-deletion mutant strain SBT11 separately. Integration of these plasmidsinto the chromosome of S. toxytricini SBT11 resulted in the generation ofgene disruption strains with deletions in the ectopic copy of the lst genes

FIG 1 Structures of lipstatin (1), tetrahydrolipstatin (2), and esterastin (3).

Bai et al.

7474 aem.asm.org Applied and Environmental Microbiology

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

and adjacent sequences. For instance, integration of pDlstF and pDorf4into the chromosome of S. toxytricini SBT11 resulted in the generation ofthe �lstF::aadA and �orf4::aadA mutant strains, respectively. Similarly, S.toxytricini �left, �right, �lstA, �lstB, �lstC, �lstD, �lstE, �orf1, �orf2,�orf3, and �orf6 mutant strains were generated by transferring pDelL,pDelR, pDlstA, pDlstB, pDlstC, pDlstD, pDlstE, pDorf1, pDorf2,pDorf3, and pDorf6, respectively, into SBT11. These mutants were

verified by PCR experiments (Table 1; see also Fig. S2 to S4 in thesupplemental material).

Analysis of lipstatin and new metabolites in fermentation broths.Fermentation broths of wild-type or mutated S. toxytricini strains weretreated as described previously (35). Briefly, 50 ml of fermentation brothof each strain was extracted with 150 ml of acetone-hexane (3:2, vol/vol)four times. The organic phase was combined, dried with sodium sulfate,

TABLE 1 Primers used for verification of the deletion mutants of S. toxytricini NRRL15443

Mutant strain Primer designed to verify mutant strain Primer sequence (5=¡3=)

Size of desired PCR fragment(bp)

Mutant Wild type

SBT11 rightArm-F GGCTTCGGTGGTGTTCTCCC No band 938rightArm-R TGGCGTCACTCCTGGCTCCT

SBT11 Scar-F CAGACGACGAAGCCGACC 891 No bandScar-R CCTACGAGGCGATGACCC

SBT11 leftArm-F CCGAGCAGGGTGAGGCAGAC No band 785leftArm-R GGCGACCAGAGCGTCAAGG

�right deRight-dgF GGATGTGCTGCAAGGCGATTA 401 No banddeRight-dgR CCGAAGGCGGGTTCAAGGT

�left deLeft-dgF GGCCGTCGAAAGGTCAGTG 739 No banddeLeft-dgR GCCGTGCGGACATAGGAAG

�lstA deA-dgF GGATGCGGTGATGACGATGC 201 1,230deA-dgR TGACGGCCCTCAGCCATTTAC

�lstB deB-dgF CGAAGGCGAGGGCGAACAGT 878 1,650deB-dgR AGCGACCGCAGCCAGGGAAT

�lstC deC-dgF1 GCTGGAGACGAACACGAACCG 912 3,410deC-dgR1 CGACTACCCCTACGCCGACC

�lstC deC-dgF2 GAAGCGTTCCAGAGCGTCG No band 602deC-dgR2 GCATCACCAAGGGCACCAAG

�lstD deD-dgF ACCTGCGGTGAGGTCGAAGC 709 2,314deD-dgR GCAGGAGTTCCTGCACCACC

�lstE deE-dgF1 GACCGACCAGACGATCCCG 772 No banddeE-dgR1 TCCACCGAACAGCCCTTCC

�lstE deE-dgF2 CGGAATACCTCCCGCACCCA No band 652deE-dgR2 CGTACCTCGCGTCAGGCAACA

�lstF::aadA deF-dgF TCGTCTGGTCGGTCAACA 1,729 472deF-dgR GGCGACTTCGGGTGCGTG

�orf1 de1-dgF TGCCCACCCGCTTCCACA 357 885de1-dgR GCAGGCGAACTCCACATCCA

�orf2 de2-dgF CGGCTGGTGATGATGTGCG 882 1,407de2-dgR AAGCAGCAGGACGGCAAGG

�orf3 de3-dgF TTTCTCCGGTCGTCGTTCGTC 537 1,362de3-dgR CGCACCATCTGGGATTCCTGT

�orf4::aadA de4-dgF AGCTGTTGGCCGTCCAGTACC 1,751 494de4-dgR CCCAGGTGGCGAGGGATT

�orf6 de6-dgF TGCCATCAGTGCCTGTTGTCC 287 792de6-dgR CGCCATCCATGCCTGTGAA

Lipstatin Biosynthetic Operon

December 2014 Volume 80 Number 24 aem.asm.org 7475

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

and concentrated by evaporation to yield a yellow oil with a volume of �1ml. One hundred microliters of the crude extract was dissolved in 1 mlmethanol and centrifuged at 12,000 rpm for 5 min. The supernatant wasfiltered and subjected to high-performance liquid chromatography(HPLC) or HPLC-mass spectrometry (MS) analysis. HPLC analyses wereperformed on an Agilent 1260 Infinity HPLC system or an Agilent 1100series HPLC system (with a diode array detector set at 210 nm). HPLC-MSanalysis was performed on the same Agilent 1100 HPLC series instrumentcoupled with a mass-selective detector (MSD) ion trap mass spectrometrysystem with an electrospray ionization (ESI) source. HPLC andHPLC-MS were conducted with a Cosmosil Cholester reversed-phaseHPLC column (4.6 by 150 mm) under the following conditions. Thecolumn was equilibrated with 20% solvent A (H2O) and 80% solvent B(methanol). Water (solvent A)-methanol (solvent B) mobile phases wereused (20% solvent A– 80% solvent B from 0 to 10 min, from 20% solventA– 80% solvent B to 10% solvent A–90% solvent B from 10 to 11 min, 10%solvent A–90% solvent B from 11 to 20 min, from 10% solvent A–90%solvent B to 100% solvent B from 20 to 21 min, 100% solvent B from 21 to25 min, from 100% solvent B to 20% solvent A– 80% solvent B from 25 to26 min, and 20% solvent A– 80% solvent B from 26 to 35 min) at a flowrate of 200 �l/min. Under these conditions, lipstatin was eluted at 16 minwhen the Agilent 1100 HPLC system was used or at 13.5 min when theAgilent 1260 Infinity HPLC system was used.

High-resolution mass spectrometry and nuclear magnetic reso-nance analyses. High-resolution mass spectrometry (HR-MS) was per-formed by using a 6530 Accurate-Mass quadrupole time of flight (QTOF)

spectrometer coupled to an Agilent 1200 series HPLC system. Nuclearmagnetic resonance (NMR) spectra were recorded on an Agilent 500-MHz spectrometer. Proton chemical shifts are reported in ppm () rela-tive to internal tetramethylsilane (TMS) (, 0.0 ppm) or with the solventreference relative to chloroform (CHCl3) (, 7.26 ppm). Data are reportedas follows: chemical shift (multiplicity [singlet {s}, doublet {d}, triplet {t},multiplet {m}, and broad singlet {brs}], coupling constants, and integra-tion). Carbon chemical shifts are reported in ppm () relative to TMS withCDCl3 as the internal standard.

Isolation and structure elucidation of compound 4 from the S.toxytricini �lstF::aadA mutant. The S. toxytricini �lstF::aadA strain wasfermented in 4 liters of fermentation medium at 220 rpm at 30°C for 5days. Mycelium harvested by centrifugation was soaked overnight in 400ml acetone and extracted three times with 600 ml hexane. The organicphase was combined, dried with sodium sulfate, and concentrated to yielda yellow oil. The yellow crude extract was extracted with 2 volumes ofacetonitrile and centrifuged at 12,000 rpm for 5 min. The resulting yellowlayer was further purified twice by semipreparative HPLC on an Agilent1260 Infinity HPLC system under the following elution conditions, wheresolvent A is H2O plus 0.1% formic acid and solvent B is acetonitrile plus0.1% formic acid: 20% solvent A– 80% solvent B from 0 to 10 min, from20% solvent A– 80% solvent B to 10% solvent A–90% solvent B from 10 to11 min, 10% solvent A–90% solvent B from 11 to 20 min, from 10%solvent A–90% solvent B to 100% solvent B from 20 to 21 min, and 100%solvent B from 21 to 30 min. Compound 4 was eluted at 16.9 min underthese conditions. Finally, 22.7 mg of pure compound was obtained. The

FIG 2 Localization of the DNA sequence essential for lipstatin biosynthesis by large deletion, complementation, and heterologous expression. (a)Schematic representation of the 46.5-kb DNA region spanning the putative lst operon in the S. toxytricini wild-type (WT) strain, a large-deletion mutant(SBT11), and three integrative plasmids (27F11, pDelL, and pDelR). Thick lines represent genomic DNA. Dash lines indicate deleted regions. Wide arrowsmarked by letters or numbers on the top line are genes in the 19.4 kb-DNA fragment shared by three integrative plasmids, including 6 genes (lstA-F) of theputative lst operon and 8 downstream genes (orf1 to orf8). (b) Detection of lipstatin production in S. toxytricini large-deletion and complementation strains byHPLC performed on an Agilent 1100 HPLC system (210 nm) under standard conditions. Lipstatin (marked by 1) is eluted at 16 min. (c) Detection of lipstatinproduction in the S. lividans/27F11 heterologous expression strain. HPLC was performed on an Agilent 1260 Infinity HPLC system (210 nm). Lipstatin (markedby 1) was eluted at 13.5 min. pJTU2554 is the int-attP�C31 integrative vector for construction of cosmid 27F11. ST, lipstatin standard; mAU, milli-absorbanceunits.

Bai et al.

7476 aem.asm.org Applied and Environmental Microbiology

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

chemical structure was elucidated based on high-resolution ESI-QTOF-MS, 1H NMR, 13C NMR, 1H-1H two-dimensional correlated spectros-copy (COSY), distortionless enhancement by polarization transfer at 135°(DEPT135), heteronuclear single quantum coherence (HSQC), and het-eronuclear multiple-bond correlation (HMBC) spectra (see Table S1 andFig. S5 and S6 in the supplemental material). For compound 4, HR-ESI-QTOF-MS m/z 351.2891; 1H NMR (500 MHz, CDCl3) 5.54 (m, 1H),5.42 (m, 2H), 5.31 (m, 1H), 4.76 (m, 1H), 4.29 (brs, 1H), 2.8 (t, J 7 Hz,2H), 2.52 (m, 1H), 2.44 (m, 1H), 2.3 (m, 1H), 2.12 (m, 1H), 2.09 (m, 1H),2.04 (m, 2H), 1.75 (m, 1H), 1.57 (m, 1H), 1.43 (m, 1H), 1.36 (m, 1H), 1.3(m, 12H), 0.89 (m, 6H); 13C NMR (500 MHz, CDCl3) 173.0, 131.8,130.8, 127.1, 123.1, 75.2, 64.8, 46.3, 35.6, 33.4, 31.7, 31.5, 29.3, 29.2, 27.3,27.0, 26.5, 25.8, 22.6, 22.6, 14.0, 14.0 (see Table S1 in the supplementalmaterial for more detailed NMR data).

Isolation and structure elucidation of compound 5 from the S.toxytricini �lstD strain. Compound 5 was isolated from the S. toxytricini�lstD strain by employing the same method as that used for compound 4.Compound 5 was eluted at 25.3 min under the same semipreparativeHPLC conditions. Finally, 38.2 mg of compound 5 was purified from 2liters of fermentation broth. The chemical structure was elucidated basedon high-resolution ESI-QTOF-MS, 1H NMR, 1H-1H COSY, 13C NMR,and DEPT135 spectra (see Tables S2 and S3 and Fig. S7 and S8 in thesupplemental material). For compound 5, HR-ESI-QTOF MS m/z 486.3555; 1H NMR (500 MHz, CDCl3) 8.20 (s, 1H), 5.99 (brs, 1H), 5.52(td, J 11 Hz, 7 Hz, 1H), 5.41 (td, J 11 Hz, 7 Hz, 1H), 5.35 (m, 3H), 4.66(td, J 9 Hz, 5 Hz, 1H), 2.78 (m, 2H), 2.75 (dd, J 12 Hz, 8 Hz, 1H), 2.63(dd, J 12 Hz, 5 Hz, 1H), 2.40 (m, 4H), 2.04 (td, J 7 Hz, 7 Hz, 2H), 1.58(m, 5H), 1.32 (m, 14H), 0.94 (m, 6H), 0.89 (m, 6H); 13C NMR (500 MHz,CDCl3) 207.4, 171.9, 160.5, 132.1, 130.8, 126.9, 123.1, 71.1, 49.4, 45.7,43.4, 41.8, 31.6, 31.6, 31.5, 29.1, 29.05, 28.3, 27.3, 25.7, 24.8, 23.6, 22.8,22.6, 22.6, 21.9, 14.1, 14.0 (see Tables S2 and S3 in the supplementalmaterial for more detailed NMR data).

Nucleotide sequence accession number. The DNA sequence of the19.4-kb lipstatin biosynthetic operon and downstream region was depos-

ited in the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/GenBank/) under accession number KJ872771.

RESULTSGene organization of the putative lipstatin biosynthetic operonand its downstream region. The genome of S. toxytriciniNRRL15443 was sequenced for searching for genes likely to be asso-ciated with lipstatin biosynthesis. In the assembled draft genomesequence of S. toxytricini, a nonribosomal peptide synthetase(NRPS) homologue attracted our attention because it was situatednext to a formyltransferase homologue. The NRPS homologueshowed similarity to many NRPS genes, such as the mycosubtilinsynthase subunit C gene (mycC) (36). The derived NRPS proteincontained one unknown domain (amino acids [aa] 202 to 602; Evalue, 3.8 � 10�4), one adenylation domain (A domain) (aa 799 to1324; E value, 2.4 � 10�55), and one peptidyl carrier protein (PCP)domain (aa 1499 to 1543; E value, 3.4 � 10�14) according to predic-tion by PKS/NRPS analysis (37). The predicted Stachelhaus code ofthe A domain of the NRPS was DIFALGGVAK, which shared 70%identity to the signature of leucine-specified A domains (38, 39). TheN-terminal unknown domain (aa 202 to 602) showed marginal sim-ilarity (E value, 1.7 �10�2) to the condensation domain of the start-ing module (CDAPS1_C1_start) of the CDAS1 NRPS governing bio-synthesis of the lipopeptide calcium-dependent antibiotic (CDA),with 39% identity over a 59-aa aligned segment (aa 296 to 351 of thequery NRPS) when analyzed by using the Natural Product Domainseeker (40). However, it is worth noting that an HXXXDG catalyticmotif, which was reported previously to be essential for the con-densation reaction (41, 42), present in this short aligned region.We therefore named this unknown domain the condensation-like domain (C# domain), on the basis of its low-level similar-

TABLE 2 Oligonucleotides used for PCR targeting to construct mutants

Oligonucleotide Nucleotide sequence (5=¡3=)a

deRight-vec-F GGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCTCTAGATGACGATGCGTGGAGACCdeRight-R CGAGCGCACCGCCAGTGGCTACCGCGTCTACACCCCGCTGCACTCTAGATGCGGATGTTGCGATTACdeLeft-F CCATGTTCACCTCGATGACGTACGGGAACGCCATGTCGATGCCACTAGTTGACGATGCGTGGAGACCdeLeft-vec-R GCCAGTTCATCCATCGCTTTCTTGTCTGCTGCCATTTGCTTTGTACTAGTTGCGGATGTTGCGATTACdelstA-F ATGAGTACCACCGAGCGCCGCAGCCGAATAGAGGCCCTCGGCGCgtttaaacTGACGATGCGTGGAGACCdelstA-R TCAGGCCCCTGCGTGGGTGACGGTTGCGGACAGCGCGCCGGTGAgtttaaacTGCGGATGTTGCGATTACdelstB-F ATGGGCATCGTCATCACCGCATCCGCGACCGCCACCCACACCGAgtttaaacTGACGATGCGTGGAGACCdelstB-R TCACCATCCCTGCGGGCGGTAGGAGGCGACGGCTGCTCGCGGTCgtttaaacTGCGGATGTTGCGATTACdelstC-F GTGGCGACCACGACCGCCACCCCGGCGGCGGCCCGGCCCGCAGCgtttaaacTGACGATGCGTGGAGACCdelstC-R TCACAGCTGCCGCCACCAGGTCGCCCCGTAGAGCATGGTCAGGCgtttaaacTGCGGATGTTGCGATTACdelstD-F GTGAAGATCCTGATCACCGGAGCCACCGGCTTCCTCGGCGGCCAgtttaaacTGACGATGCGTGGAGACCdelstD-R TCATCGTGAGGTGTCCTCTCGGCCGGCAGGTCCGGCCGGATCGGgtttaaacTGCGGATGTTGCGATTACdelstE-F ATGAGCACCAGCACACCGAACCCGCCCGGCACCTCGGAACCACAgtttaaacTGACGATGCGTGGAGACCdelstE-R TCATGCGGTGGTTCCTTCGCGTACGGCGGCGAGGCGGTCGCAGAgtttaaacTGCGGATGTTGCGATTACdelstF-F1 CCGACGGGATCGTCTGGTCGGTCAACAACCGGCAGCTTTTCCGTGTGACGATGCGTGGAGACCdelstF-R1 CCGATCGGGAAGCGGTGCTCGGCGAGGACGGGGCCGGTGTCGATGTGCGGATGTTGCGATTACdeorf1-F GTGCGCCGACTCGTCTACTACATCGCCACCACGCTCGACGGCTTgtttaaacTGACGATGCGTGGAGACCdeorf1-R TCAGGCGGTGTCGGTGTCGGTGTCGGTGTCGGTGGGGCGGGTGTgtttaaacTGCGGATGTTGCGATTACdeorf2-F GTGGGCAGGGACATGGCACGACCCCGCGGCGTCGAGGACGCGGTgtttaaacTGACGATGCGTGGAGACCdeorf2-R TCATCGTTCCTCCGGGCGTGGGTGGTGGGGTTGGTGGGCGCGGAgtttaaacTGCGGATGTTGCGATTACdeorf3-F ATGACGTACGCCACCCCCGCCCGGCCCCTCGCCGGCAAGGTCGCgtttaaacTGACGATGCGTGGAGACCdeorf3-R CTACAGCGGCTCGCCGAGGGGGCCGTGGACCGGTTCGAGGGCATgtttaaacTGCGGATGTTGCGATTACdeorf4-F GTCTTCGGCCACAGCATGGGCTCGCTCGTCGCGTACGAGACCGTCTGACGATGCGTGGAGACCdeorf4-R AGGGCATCAGGAGCTCGCGGAGCTCGGGGATGTCGTACACCTCGGTGCGGATGTTGCGATTACdeorf6-F GTGAGGATCCTCCTGGTCGGAGCGGGCGGCACGCTCGGCGGCGCgtttaaacTGACGATGCGTGGAGACCdeorf6-R TCAGTGGACGCGGTAGATCCGGCCCGTCTGGGCGCCCTCGATCGgtttaaacTGCGGATGTTGCGATTACa Underlined sequences are homologous to the ends of the aadA gene cassette. The PmeI restriction site (gtttaaac, shown in lowercase) in some oligonucleotides was used forremoval of the inserted aadA gene cassette by restriction digestion after � Red-mediated recombination.

Lipstatin Biosynthetic Operon

December 2014 Volume 80 Number 24 aem.asm.org 7477

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

ity, short aligned region, and predicted catalytic motif missingone of the two histidines of canonical condensation domains(HHXXXDG) (41, 42).

Furthermore, the NRPS gene and formyltransferase homo-logue were located at a six-gene operon, here named lst for puta-tive lipstatin biosynthesis. The relative orientation of the six lstgenes (lstA to lstF) and a few downstream genes (orf1 to orf8) areschematically shown in Fig. 2a (top). lstE is the NRPS homologue.lstF is the formyltransferase homologue. Other genes of the lstoperon encode homologues of two �-ketoacyl–acyl carrier pro-tein (ACP) synthetases III (FabH) (LstA and LstB), one acyl-CoAsynthetase (LstC), and a 3�-hydroxysteroid dehydrogenase(LstD). The proposed functions, predicted active sites or con-served domains, and BLASTp search results for the six putative Lstproteins (LstA to LstF) and eight downstream gene products(Orf1 to Orf88) are summarized in Table 3.

Localization of the DNA region essential for lipstatin biosyn-thesis by large deletion, complementation, and heterologous ex-pression. Genetic experiments, including large deletion and com-plementation, were carried out to localize the DNA region thatwas essential for lipstatin biosynthesis. First, a 429-bp fragmentinternal to lstF, the formyltransferase gene, was used to screen thegenomic library by Southern hybridization, resulting in the isola-tion of 16 cosmids carrying the speculated lst operon. One ofthem, cosmid 27F11, containing a 46.5-kb insert of genomic DNAincluding the putative lst operon, was then used to construct agene replacement vector (pHL6) to generate a large deletion mu-tant of the S. toxytricini strain via homologous recombination. Inthe resulting double-crossover strain, SBT11, a 38.4-kb DNA frag-ment covering the putative lst operon was deleted from the S.toxytricini genome (Fig. 2a; see also Fig. S1 in the supplementalmaterial). To genetically complement the large deletion, the int-attP�C31 integrative cosmid 27F11 was transferred into SBT11.The empty vector pJTU2554, as a negative control, was alsotransferred. S. toxytricini strains SBT11, SBT11/27F11, andSBT11/pJTU2554 and the wild type were fermented under stan-dard conditions, and productions of lipstatin in these strains wereanalyzed by HPLC. No lipstatin was detected in the organic extract

obtained from deletion mutant strain SBT11, and lipstatin pro-duction was restored in complementation strain SBT11/27F11(Fig. 2b, peaks marked by 1). Furthermore, when 27F11 was trans-ferred into the heterologous host Streptomyces lividans, the result-ing exconjugant produced lipstatin although at a yield �30% ofthat of the original producer S. toxytricini (Fig. 2c, peaks markedby 1).

To further narrow down the DNA region needed for lipstatinbiosynthesis, a 15-kb left-end fragment and a 9-kb right-end frag-ment were removed from 27F11 by PCR targeting technology toyield two int-attP�C31 integrative plasmids, pDelL and pDelR, re-spectively (Fig. 2a). pDelL and pDelR were introduced intoSBT11, and the resulting strains were fermented and analyzed byHPLC. Lipstatin was found to be produced in both SBT11/pDelL(�left) and SBT11/pDelR (�right) (Fig. 2b). This indicated thatthe 19.4-kb DNA region shared by pDelL and pDelR, encoding the6 lst genes and 8 downstream genes, carried the whole set of genesfor lipstatin biosynthesis.

Probing the function of the putative lst genes by single-geneknockouts. All 6 genes of the putative lst operon (lstA to lstF) and5 of 8 genes immediately downstream of the lst operon (orf1, -2, -3,-4, and -6) were disrupted in cosmid 27F11 separately by usingPCR targeting technology (Table 2). Among these genes, lstF andorf4 were disrupted by replacement with a marker gene, aadA. Asgene disruption of lstA, lstB, lstC, lstD, lstE, orf1, orf2, orf3, and orf6by marker insertion or marker replacement would likely cause apolar effect on their downstream genes that might be transcribedfrom shared promoters, disruptions of these genes were made byin-frame deletion to exclude the probable polar effect. The result-ing modified plasmid constructs that carried single-gene disrup-tion mutations were introduced into large-deletion mutant strainSBT11 separately, to afford single-gene-disrupted S. toxytricinistrains (see Fig. S2 to S4 in the supplemental material). Thesestrains were fermented and analyzed by HPLC under standardconditions. HPLC analyses showed that lipstatin production wasabolished in the �lstA, �lstB, and �lstC single-gene mutants (Fig.3a), suggesting that lstA, lstB, and lstC play an essential role in thelipstatin biosynthetic pathway. Meanwhile, the �orf1, �orf2,

TABLE 3 Summary of bioinformatics analysis of gene products of the putative lipstatin biosynthetic operon and downstream sequence

Protein No. of aa Proposed functionPredicted active site(s) and/ordomain(s) (reference[s])a

Top BLAST hit from the Swiss-Prot database

Accession no. Name No. of aaIdentity/similarity/coverage (%)

LstA 374 �-Ketoacyl-ACP synthase III Cys128, His271, Asn305 (43–45) C5CSE2 FabH 325 30/44/83LstB 288 �-Ketoacyl-ACP synthase III Cys96 (43–45) Q1IQ32 FabH 333 32/48/46LstC 874 Acyl-CoA synthetase FAC_like_1 (46) O31826 YngI 549 24/38/57LstD 563 Dehydrogenase/isomerase Asn89, Ser113, Tyr142, Lys146,

Rossmann fold (47–49)P9WQP6 Rv1106c 370 35/48/60

LstE 1,581 Nonribosomal peptidesynthetase

C#, A, PCP (37–42; this study) Q9R9I9 MycC 2,609 34/50/35

LstF 230 Formyltransferase Asn88, His90, Asp128 (50) Q8KCG8 FMT 314 36/50/62Orf1 206 Unknown NA P45862 YwjB 169 31/41/79Orf2 202 TetR family regulator NA B4SHW1 BetI 196 29/41/53Orf3 306 Putative dehydrogenase NA Q99L04 DhrS1 313 36/53/89Orf4 268 Putative thioesterase NA P33586 PabT 361 35/48/96Orf5 297 Transcriptional regulator NA P77559 YnfL 297 31/47/92Orf6 199 Putative dehydrogenase NA P50161 AflM 262 32/47/75Orf7 156 Unknown NA Q44115 CpcE 273 32/50/55Orf8 396 Putative esterase NA P05789 EreB 419 23/39/89a NA, not applicable.

Bai et al.

7478 aem.asm.org Applied and Environmental Microbiology

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

�orf3, �orf4::aadA, and �orf6 single-gene mutants kept produc-ing lipstatin (Fig. 3a, peaks marked by 1), suggesting that thesegenes are not involved in biosynthesis.

In the organic extracts obtained from the �lstE and �lstF::aadA mutants, lipstatin production was not detected in theHPLC-UV and MS chromatograms (Fig. 3b; see also Fig. S9 inthe supplemental material), suggesting that both lstE and lstFare involved in lipstatin production. Furthermore, a new peak(Fig. 3b, asterisks) emerged at 11 min in HPLC traces of boththe �lstE and �lstF::aadA mutants. The new peaks of two mu-tants produced a quasimolecular ion peak at m/z 351.3 ([M H] ) and an ammonium adduct peak at m/z 373.2 ([M NH4] ) by liquid chromatography (LC)-ESI-MS analyses (Fig.3b, insets; see also Fig. S10 in the supplemental material), sug-gesting that these two mutants accumulate compounds with anidentical m/z of 350.3.

In the organic extract obtained from the �lstD mutant, lip-statin production was not detected, indicating that lstD is es-sential for lipstatin production. In addition, a new peak wasobserved by HPLC analysis (at 21 min) (Fig. 3c, filled circle; seealso Fig. S11a in the supplemental material). This new peak ofthe �lstD organic extract at 21 min produced a quasimolecularion peak at m/z 464.4 ([M H] ) and adduct peaks at m/z

486.3 ([M Na] ) and m/z 481.3 ([M NH4] ) by LC-ESI-MS analyses (Fig. 3c, inset; see also Fig. S11b in the sup-plemental material), suggesting that the �lstD strain accumu-lates a new metabolite with an m/z of 463.4, whose m/z valuewas 27.99 lower than that of lipstatin.

Compound 4 accumulated by the S. toxytricini �lstF::aadAstrain. The �lstF::aadA strain was fermented (4 liters), and 22.7mg of the compound was purified from the fermentation broth.The structure of this compound was assigned as (3S,4S,6S)-3-hexyl-4-hydroxy-6-((2Z,5Z)-undeca-2,5-dien-1-yl)tetrahydro-2H-pyran-2-one, on the basis of analysis of the 1H NMR, 13CNMR, 1H-1H COSY, and HMBC NMR spectroscopic data (com-pound 4) (Fig. 4; see also Table S1 in the supplemental material).The configurations at C2 and C3 were determined to be 2S and 3Sbased on analysis of the NOESY NMR spectrum, assuming thatthe configuration at C5 was 5S (the same as that of lipstatin) (seeFig. S6g in the supplemental material). The HR-ESI-QTOF-MSanalysis of compound 4 afforded a quasimolecular ion peak at m/z351.2891, consistent with the [M H] ion of the molecularformula C22H38O3 H (calculated m/z 351.2899). Compound 4was isolated previously from alkaline hydrolysis of esterastin(compound 3), a lipstatin congener (12). Most of the chemical

FIG 3 Detection of lipstatin and new metabolites in S. toxytricini strains carrying single-gene disruptions by HPLC. (a) Detection of lipstatin production in �lstA,�lstB, �lstC, �orf1, �orf2, �orf3, �orf4::aadA, and �orf6 single-gene mutants. An Agilent 1260 Infinity HPLC system (210 nm) was used. Lipstatin peaks aremarked by 1. (b) Detection of lipstatin and a new metabolite in �lstE and �lstF::aadA single-gene mutants. An Agilent 1100 HPLC system (210 nm) was used.Lipstatin is marked by 1 (production) or a dashed line (abolishment). New peaks (asterisks) at 11 min were further analyzed by ESI-MS (insets) (see Fig. S10 inthe supplemental material). MS, positive-ion-mode MS. (c) Detection of lipstatin and a new metabolite in the �lstD mutant. An Agilent 1100 HPLC system(210 nm) was used. Lipstatin is marked by 1 (production) or a dashed line (abolishment). The new peak (filled circle) at 21 min was further analyzed byLC-ESI-MS (inset) (see Fig. S11b in the supplemental material).

Lipstatin Biosynthetic Operon

December 2014 Volume 80 Number 24 aem.asm.org 7479

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

shifts of 22 carbons and protons matched well with those from theliterature, except that the chemical shifts of C4 and C6 were ex-changed, as supported by two-dimensional NMR spectra (see Ta-ble S1 and Fig. S6 in the supplemental material).

Compound 5 accumulated by the S. toxytricini �lstD strain.The new metabolite accumulated by the �lstD mutant was puri-fied to yield a yellow oil (38.2 mg) readily dissolved in chloroformand acetonitrile. The chemical structure of this metabolite waselucidated as (S)-(S,12Z,15Z)-8-oxohenicosa-12,15-dien-10-yl2-formamido-4-methylpentanoate (compound 5) (Fig. 4) on thebasis of analysis of the 1H NMR, 13C NMR, and 1H-1H COSYNMR spectroscopic data (see Tables S2 and S3 and Fig. S8 in thesupplemental material). High-resolution ESI-QTOF-MS analysisof the purified compound produced a sodium adduct ion at m/z486.3555 (see Fig. S7 in the supplemental material), consistentwith the [M Na] ion of the molecular formula C28H49NO4

(calculated m/z 486.3559).

DISCUSSION

In this study, we have identified a six-gene operon that was essen-tial for lipstatin biosynthesis by genetic manipulations. Deletionsof lstA, lstB, lstC, lstD, lstE, and lstF all abolished lipstatin produc-tion. Meanwhile, both the �lstE and �lstF::aadA mutants pro-duced a new metabolite with the same HPLC retention times,equal molecular masses, and probably identical chemical struc-tures. The metabolite produced by the �lstF::aadA mutant waspurified and elucidated as (3S,4S,6S)-3-hexyl-4-hydroxy-6-((2Z,5Z)-undeca-2,5-dien-1-yl)tetrahydro-2H-pyran-2-one (com-pound 4). In addition, the �lstD mutant produced another newmetabolite, which was purified and elucidated as (S)-(S,12Z,15Z)-8-oxohenicosa-12,15-dien-10-yl 2-formamido-4-methylpen-tanoate (compound 5).

We therefore propose that the LstA, LstB, and LstC enzymesare involved in early steps of the lipstatin biosynthetic pathway,

FIG 4 Plausible lipstatin biosynthetic pathway in S. toxytricini. Octanoic acid may be activated by LstC (an acyl-CoA synthetase homologue), the acyl-CoAcarboxylase (ACCase) complex (33), and ACP borrowed from primary metabolism. Two FabH homologues, LstA and LstB, may conduct Claisen condensationbetween 3-hydroxytetradeca-5,8-dienoyl-CoA and hexylmalonyl-ACP, affording the 22-carbon �-branched fatty acid backbone (compound 6) (17–21). LstE(NRPS) and LstF (a formyltransferase homologue) are responsible for the attachments of leucine and formyl groups. LstD (a 3�-hydroxysteroid dehydrogenase/isomerase homologue) is involved in the reduction of the 3-keto group of compound 7. The �-lactone ring may be formed spontaneously by attack of the3-hydroxy group on the carbonyl of the ACP-tether acyl intermediate, in analogy with the ebelactone biosynthesis pathway (53). SCoA, CoA thioester; C#,condensation-like domain; A, adenylation domain; T, thiolation domain or PCP domain. Compound 4 is accumulated by both the �lstE and �lstF::aadAmutants. Compound 5 is accumulated by the �lstD mutant (see the text for more explanation).

Bai et al.

7480 aem.asm.org Applied and Environmental Microbiology

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

while the LstE, LstF, and LstD enzymes are responsible for thefollowing steps. On the basis of the genetic data, bioinformaticsanalyses, biosynthetic logics of nonribosomal peptides andfatty acids, and previously reported lipstatin biosynthetic mod-els, we update the lipstatin biosynthetic pathway as follows(Fig. 4).

Formation of the 22-carbon �-branched fatty acid backbone.According to lipstatin biosynthesis models established on the basisof early feeding experiments with S. toxytricini, the first commit-ted step is Claisen condensation between (3S,5Z,8Z)-3-hy-droxytetradeca-5,8-dienoyl-CoA and activated octanoic acid toafford the 22-carbon �-branched fatty acid backbone (17–21).Both substrates of Claisen condensation are obtained from in-complete degradation of linoleic acid. One substrate, 3-hy-droxytetradeca-5,8-dienoyl-CoA, is directly obtained from �-ox-idation. However, in analogy to the initiation of fatty acidsynthesis, activation and carboxylation of octanoic acid areneeded to form hexylmalonyl-CoA to serve as the second sub-strate (17–21). LstA, LstB, LstC, and a few enzymes from primarymetabolism are plausibly involved in these substrate activationand condensation steps. First, the acyl-CoA synthetase homo-logue LstC might catalyze the ATP-dependent activation of oc-tanoic acid to produce an acyl-CoA thioester via an acyl-adenylateintermediate (46). The octanoyl-CoA ester is then carboxylated togive hexylmalonyl-CoA, probably by an acyl-CoA carboxylase(ACCase) complex, the inactivation of which caused a decrease oflipstatin production by �80% in S. toxytricini (30). An unknownroute may be present to complement the ACCase pathway for thegeneration of hexylmalonyl-CoA, however. The hexylmalonyl-CoA thioester is then transferred to ACP borrowed from primarymetabolism. The resulting hexylmalonyl-ACP serves as one of twosubstrates for Claisen condensation. The C14 substrate of the con-densation, as mentioned above, is directly obtained from the in-complete degradation of linoleic acid. Next, LstA, probably to-gether with LstB, both of which are FabH homologues, catalyzesthe decarboxylation of hexylmalonyl-ACP and successive conden-sation with 3-hydroxyl-5,8-tetradecadienoyl-CoA to afford a3-keto-5-hydroxy-C22-ACP intermediate (compound 6) (Fig. 4).Double-FabH homologues may be employed to incorporate un-usual starter units into final products in some biosynthetic path-ways, for instance, AsuC3/C4 in the asukamycin production path-way (51). Substrate selectivity and stereochemistry of LstAB andLstC enzymology will be subjects of further research. Neverthe-less, the formation of �-branched �-hydroxylated fatty acid deriv-ative in S. toxytricini is different from the synthesis of mycolicacids in corynebacteria and mycobacteria, which is carried out bya multifunctional type I polyketide synthase, Pks13 (23).

Incorporation of formyl and leucine groups into the 3-keto-5-hydroxy-C22-ACP intermediate. The subsequent steps are theincorporation of leucine and formyl groups into the 3-keto-5-hydroxy-C22-ACP intermediate (21). Accumulation of com-pound 4 in the �lstE and �lstF::aadA mutants supports that theNRPS LstE and the formyltransferase LstF are responsible for theattachment of leucine and formyl groups and that the attachmentoccurs after Claisen condensation. First, LstE might activate leu-cine with ATP to form a leucinyl-AMP intermediate by the Adomain and then load the activated leucinyl group onto the PCPdomain at the serine-attached 4=-phospho-pantethine side chainas a thioester. LstF then transfers a formyl group to the �-aminegroup of the PCP-tethered leucine residue to form a PCP-tethered

formyl-leucine. Finally, LstE might catalyze the nucleophilic at-tack of the 5-hydroxyl of intermediate compound 6 on the acylcarbon of the PCP-tethered formyl-leucine by its C# domain toyield intermediate compound 7, probably via a mechanism anal-ogous to that of acyltransferase reactions (Fig. 4, curved arrow)(41). Thus, because of the absence of either functional LstE or LstFproteins in the �lstE and �lstF::aadA mutant strains, the free 5-hy-droxy of the 3-keto-5-hydroxy-C22-ACP intermediate (com-pound 6) attacks on the C-1 carbonyl to give a -lactone derivativespontaneously (52). The 3-keto of the resulting -lactone deriva-tive might be reduced by LstD or an unknown enzyme to givecompound 4 (see below).

Reduction of the 3-keto group and formation of �-lactone.The next steps are reduction of the 3-keto group and formation ofthe �-lactone to afford the final product lipstatin. The productionof metabolite 5 in the �lstD mutant supports that the reduction ofthe 3-keto group and the formation of �-lactone are the final stepsleading to lipstatin. In addition, the displacement of the H-2 pro-ton with the solvent proton, which was shown by deuterium feed-ing experiments, may also occur before the formation of �-lactone(20). The LstD protein sequence is similar to those of many mem-bers of the 3�-hydroxysteroid dehydrogenase extended-short-chain dehydrogenase/reductase (3�-HSD-like eSDR) superfam-ily, such as Rv1106c (53). It is worth noting that the characterized3�-HSD from animals is a bifunctional dehydrogenase/isomeraseenzyme (54). Therefore, it is plausible that LstD is involved in thereduction of the 3-keto group to a 3-hydroxyl group, which isprobably also involved in the exchange of the H-2 proton with thesolvent proton by an unknown mechanism. After the 3-keto isreduced, the resulting 3-hydroxy group may attack spontaneouslyon the carbonyl moiety of the ACP-tether acyl intermediate to givethe �-lactone ring, in analogy with the formation of the �-lactonering in the ebelactone biosynthesis pathway (55). On the otherhand, the production of compound 4 in the �lstE and �lstF::aadAmutants implies that the LstD dehydrogenase might also reducethe 3-keto group to a 3-hydroxyl in the absence of a 5-O-formyl-leucine group to afford compound 4, or another, unknown en-zyme in S. toxytricini contributes to this reduction. The catalyticmechanism and substrate specificity of LstD will be the subjects offurther research.

ACKNOWLEDGMENTS

This work was supported by the National Science Foundation of China(no. 31170084 and 31370134), the Ministry of Science and Technology(863; no. 2010AA10A201), the Ministry of Education, and the ShanghaiMunicipality.

REFERENCES1. Hadváry P, Hochuli E, Kupfer E, Lengsfeld H, Weibel EK. July 1986.

Leucine derivatives. US patent 4,598,089.2. Weibel EK, Hadváry P, Hochuli E, Kupfer E, Lengsfeld H. 1987.

Lipstatin, an inhibitor of pancreatic lipase, produced by Streptomycestoxytricini. I. Producing organism, fermentation, isolation and biologicalactivity. J. Antibiot. (Tokyo) 40:1081–1085.

3. Kang JG, Park CY. 2012. Anti-obesity drugs: a review about their effectsand safety. Diabetes Metab. J. 36:13–25. http://dx.doi.org/10.4093/dmj.2012.36.1.13.

4. Torgerson JS, Hauptman J, Boldrin MN, Sjöström L. 2004. XENical inthe prevention of diabetes in obese subjects (XENDOS) study: a random-ized study of orlistat as an adjunct to lifestyle changes for the prevention oftype 2 diabetes in obese patients. Diabetes Care 27:155–161. http://dx.doi.org/10.2337/diacare.27.1.155.

5. Hadváry P, Lengsfeld H, Wolfe H. 1988. Inhibition of pancreatic

Lipstatin Biosynthetic Operon

December 2014 Volume 80 Number 24 aem.asm.org 7481

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

lipase in vitro by the covalent inhibitor tetrahydrolipstatin. Biochem. J.256:357–361.

6. Borgström B. 1988. Mode of action of tetrahydrolipstatin: a derivative ofthe naturally occurring lipase inhibitor lipstatin. Biochim. Biophys. Acta962:308 –316. http://dx.doi.org/10.1016/0005-2760(88)90260-3.

7. Kridel SJ, Axelrod F, Rozenkrantz N, Smith JW. 2004. Orlistat is a novelinhibitor of fatty acid synthase with antitumor activity. Cancer Res. 64:2070 –2075. http://dx.doi.org/10.1158/0008-5472.CAN-03-3645.

8. Hochuli E, Kupfer E, Maurer R, Meister W, Mercadal Y, Schmidt K.1987. Lipstatin, an inhibitor of pancreatic lipase, produced by Streptomy-ces toxytricini. II. Chemistry and structure elucidation. J. Antibiot. (To-kyo) 40:1086 –1091. http://dx.doi.org/10.7164/antibiotics.40.1086.

9. Barbier P, Schneider F. 1987. Syntheses of tetrahydrolipstatin and abso-lute configuration of tetrahydrolipstatin and lipstatin. Helv. Chim. Acta70:196 –202. http://dx.doi.org/10.1002/hlca.19870700124.

10. Stalder H, Oesterhelt G, Borgström B. 1992. Tetrahydrolipstatin: deg-radation products produced by human carboxyl-ester lipase. Helv. Chim.Acta 75:1593–1603. http://dx.doi.org/10.1002/hlca.19920750513.

11. Umezawa H, Aoyagi T, Hazato T, Uotani K, Kojima F, Hamada M,Takeuchi T. 1978. Esterastin, an inhibitor of esterase, produced by acti-nomycetes. J. Antibiot. (Tokyo) 31:639 – 641. http://dx.doi.org/10.7164/antibiotics.31.639.

12. Kondo S, Uotani K, Miyamoto M, Hazato T, Naganawa H, Aoyagi T.1978. The structure of esterastin, an inhibitor of esterase. J. Antibiot. (To-kyo) 31:797– 800. http://dx.doi.org/10.7164/antibiotics.31.797.

13. Yoshinari K, Aoki M, Ohtsuka T, Nakayama N, Itezono Y, Mutoh M,Watanabe J, Yokose K. 1994. Panclicins, novel pancreatic lipase inhibi-tors. II. Structural elucidation. J. Antibiot. (Tokyo) 47:1376 –1384. http://dx.doi.org/10.7164/antibiotics.47.1376.

14. Kitahara M, Asano M, Naganawa H, Maeda K, Hamada M, Aoyagi T,Umezawa H, Iitaka Y, Nakamura H. 1987. Valilactone, an inhibitor ofesterase, produced by actinomycetes. J. Antibiot. (Tokyo) 40:1647–1650.http://dx.doi.org/10.7164/antibiotics.40.1647.

15. Umezawa H, Aoyagi T, Uotani K, Hamada M, Takeuchi T, TakahashiS. 1980. Ebelactone, an inhibitor of esterase, produced by actinomycetes.J. Antibiot. (Tokyo) 33:1594 –1596. http://dx.doi.org/10.7164/antibiotics.33.1594.

16. Uotani K, Naganawa H, Kondo S, Aoyagi T, Umezawa H. 1982. Struc-tural studies on ebelactone A and B, esterase inhibitors produced by acti-nomycetes. J. Antibiot. (Tokyo) 35:1495–1499. http://dx.doi.org/10.7164/antibiotics.35.1495.

17. Eisenreich W, Kupfer E, Weber W, Bacher A. 1997. Tracer studies withcrude U-13C-lipid mixtures. Biosynthesis of the lipase inhibitor lipstatin. J.Biol. Chem. 272:867– 874.

18. Eisenreich W, Kupfer E, Stohler P, Weber W, Bacher A. 2003. Biosyn-thetic origin of a branched chain analogue of the lipase inhibitor, lipstatin.J. Med. Chem. 46:4209 – 4212. http://dx.doi.org/10.1021/jm030780x.

19. Goese M, Eisenreich W, Kupfer E, Stohler P, Weber W, Bacher A. 2000.Biosynthetic origin of hydrogen atoms in the lipase inhibitor lipstatin. J. Biol.Chem. 275:21192–21196. http://dx.doi.org/10.1074/jbc.M003094200.

20. Goese M, Eisenreich W, Kupfer E, Stohler P, Weber W, LeuenbergerHG, Bacher A. 2001. Biosynthesis of lipstatin. Incorporation of multiplydeuterium-labeled (5Z,8Z)-tetradeca-5,8-dienoic acid and octanoic acid.J. Org. Chem. 66:4673– 4678. http://dx.doi.org/10.1021/jo010230b.

21. Schuhr CA, Eisenreich W, Goese M, Stohler P, Weber W, Kupfer E,Bacher A. 2002. Biosynthetic precursors of the lipase inhibitor lipstatin. J.Org. Chem. 67:2257–2262. http://dx.doi.org/10.1021/jo016285v.

22. Takayama K, Wang C, Besra GS. 2005. Pathway to synthesis and pro-cessing of mycolic acids in Mycobacterium tuberculosis. Clin. Microbiol.Rev. 18:81–101. http://dx.doi.org/10.1128/CMR.18.1.81-101.2005.

23. Portevin D, De Sousa-D’Auria C, Houssin C, Grimaldi C, Chami M,Daffé M, Guilhot C. 2004. A polyketide synthase catalyzes the last con-densation step of mycolic acid biosynthesis in mycobacteria and relatedorganisms. Proc. Natl. Acad. Sci. U. S. A. 101:314 –319. http://dx.doi.org/10.1073/pnas.0305439101.

24. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. 2000.Practical Streptomyces genetics. John Innes Foundation, Norwich, UnitedKingdom.

25. Gust B, Challis GL, Fowler K, Kieser T, Chater KF. 2003. PCR-targetedStreptomyces gene replacement identifies a protein domain needed forbiosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci.U. S. A. 100:1541–1546. http://dx.doi.org/10.1073/pnas.0337542100.

26. Flett F, Mersinias V, Smith CP. 1997. High efficiency intergeneric con-

jugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol. Lett. 155:223–229. http://dx.doi.org/10.1111/j.1574-6968.1997.tb13882.x.

27. Li L, Xu Z, Xu X, Wu J, Zhang Y, He X, Zabriskie TM, Deng Z. 2008.The mildiomycin biosynthesis: initial steps for sequential generation of5-hydroxymethylcytidine 5=-monophosphate and 5-hydroxymethylcyto-sine in Streptoverticillium rimofaciens ZJU5119. Chembiochem 9:1286 –1294. http://dx.doi.org/10.1002/cbic.200800008.

28. Bierman M, Logan R, O’Brien K, Seno ET, Rao RN, Schoner BE. 1992.Plasmid cloning vectors for the conjugal transfer of DNA from Escherichiacoli to Streptomyces spp. Gene 116:43– 49. http://dx.doi.org/10.1016/0378-1119(92)90627-2.

29. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a labora-tory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

30. Demirev AV, Khanal A, Sedai BR, Lim SK, Na MK, Nam DH. 2010. Therole of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis ofStreptomyces toxytricini. Appl. Microbiol. Biotechnol. 87:1129 –1139. http://dx.doi.org/10.1007/s00253-010-2587-2.

31. Delcher AL, Bratke KA, Powers EC, Salzberg SL. 2007. Identifyingbacterial genes and endosymbiont DNA with Glimmer. Bioinformatics23:673– 679. http://dx.doi.org/10.1093/bioinformatics/btm009.

32. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic localalignment search tool. J. Mol. Biol. 215:403– 410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2.

33. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK,DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, GwadzM, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH,Mullokandov M, Omelchenko MV, Robertson CL, Song JS, ThankiN, Yamashita RA, Zhang D, Zhang N, Zheng C, Bryant SH. 2011.CDD: a Conserved Domain Database for the functional annotation ofproteins. Nucleic Acids Res. 39:D225–D229. http://dx.doi.org/10.1093/nar/gkq1189.

34. O’Donovan C, Martin MJ, Gattiker A, Gasteiger E, Bairoch A, ApweilerR. 2002. High-quality protein knowledge resource: SWISS-PROT andTrEMBL. Brief. Bioinform. 3:275–284. http://dx.doi.org/10.1093/bib/3.3.275.

35. Erdei J, Gulyas E, Balogh G, Toth L, Keri V, Csorvasi A. January 2005.Fermentation process for lipstatin and method of extracting lipstatin froma fermentation broth. US patent 6,844,174.

36. Duitman EH, Hamoen LW, Rembold M, Venema G, Seitz H, SaengerW, Bernhard F, Reinhardt R, Schmidt M, Ullrich C, Stein T, LeendersF, Vater J. 1999. The mycosubtilin synthetase of Bacillus subtilisATCC6633: a multifunctional hybrid between a peptide synthetase, anamino transferase, and a fatty acid synthase. Proc. Natl. Acad. Sci. U. S. A.96:13294 –13299. http://dx.doi.org/10.1073/pnas.96.23.13294.

37. Bachmann BO, Ravel J. 2009. Methods for in silico prediction of micro-bial polyketide and nonribosomal peptide biosynthetic pathways fromDNA sequence data. Methods Enzymol. 458:181–217. http://dx.doi.org/10.1016/S0076-6879(09)04808-3.

38. Röttig M, Medema MH, Blin K, Weber T, Rausch C, Kohlbacher O.2011. NRPSpredictor2—a Web server for predicting NRPS adenylationdomain specificity. Nucleic Acids Res. 39:W362–W367. http://dx.doi.org/10.1093/nar/gkr323.

39. Stachelhaus T, Mootz HD, Marahiel MA. 1999. The specificity-conferringcode of adenylation domains in nonribosomal peptide synthetases. Chem.Biol. 6:493–505. http://dx.doi.org/10.1016/S1074-5521(99)80082-9.

40. Ziemert N, Podell S, Penn K, Badger JH, Allen E, Jensen PR. 2012. Thenatural product domain seeker NaPDoS: a phylogeny based bioinformatictool to classify secondary metabolite gene diversity. PLoS One 7:e34064.http://dx.doi.org/10.1371/journal.pone.0034064.

41. Marahiel MA, Stachelhaus T, Mootz HD. 1997. Modular peptide syn-thetases involved in nonribosomal peptide synthesis. Chem. Rev. 97:2651–2674. http://dx.doi.org/10.1021/cr960029e.

42. Garcia I, Vior NM, Braña AF, González-Sabin J, Rohr J, Moris F,Méndez C, Salas JA. 2012. Elucidating the biosynthetic pathway for thepolyketide-nonribosomal peptide collismycin A: mechanism for forma-tion of the 2,2=-bipyridyl ring. Chem. Biol. 19:399 – 413. http://dx.doi.org/10.1016/j.chembiol.2012.01.014.

43. Heath RJ, White SW, Rock CO. 2001. Lipid biosynthesis as a target forantibacterial agents. Prog. Lipid Res. 40:467– 497. http://dx.doi.org/10.1016/S0163-7827(01)00012-1.

44. Smirnova N, Reynolds KA. 2001. Branched-chain fatty acid biosynthesis

Bai et al.

7482 aem.asm.org Applied and Environmental Microbiology

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

in Escherichia coli. J. Ind. Microbiol. Biotechnol. 27:246 –251. http://dx.doi.org/10.1038/sj.jim.7000185.

45. Rock CO, Jackowski S. 2002. Forty years of bacterial fatty acid synthesis.Biochem. Biophys. Res. Commun. 292:1155–1166. http://dx.doi.org/10.1006/bbrc.2001.2022.

46. Watkins PA. 1997. Fatty acid activation. Prog. Lipid Res. 36:55– 83. http://dx.doi.org/10.1016/S0163-7827(97)00004-0.

47. Persson B, Kallberg Y, Oppermann U, Jörnvall H. 2003. Coenzyme-basedfunctional assignments of short-chain dehydrogenases/reductases (SDRs).Chem. Biol. Interact. 143–144:271–278. http://dx.doi.org/10.1016/S0009-2797(02)00223-5.

48. Kavanagh KL, Jörnvall H, Persson B, Oppermann U. 2008. Medium-and short-chain dehydrogenase/reductase gene and protein families: theSDR superfamily. Functional and structural diversity within a family ofmetabolic and regulatory enzymes. Cell. Mol. Life Sci. 65:3895–3906. http://dx.doi.org/10.1007/s00018-008-8588-y.

49. Jörnvall H, Persson B, Krook M, Atrian S, Gonzàlez-Duarte R, JefferyJ, Ghosh D. 1995. Short-chain dehydrogenases/reductases (SDR). Bio-chemistry 34:6003– 6013. http://dx.doi.org/10.1021/bi00018a001.

50. Williams GJ, Breazeale SD, Raetz CR, Naismith JH. 2005. Structure andfunction of both domains of ArnA, a dual function decarboxylase and a form-

yltransferase, involved in 4-amino-4-deoxy-L-arabinose biosynthesis. J. Biol.Chem. 280:23000–23008. http://dx.doi.org/10.1074/jbc.M501534200.

51. Rui Z, Petrícková K, Skanta F, Pospísil S, Yang Y, Chen CY, Tsai SF,Floss HG, Petrícek M, Yu TW. 2010. Biochemical and genetic insightsinto asukamycin biosynthesis. J. Biol. Chem. 285:24915–24924. http://dx.doi.org/10.1074/jbc.M110.128850.

52. Mandolini L. 1978. Ring-closure reactions. 11. The activation parametersfor the formation of four-to six-membered lactones from �-bromoal-kanoate ions. The role of the entropy factor in small- and common-ringformation. J. Am. Chem. Soc. 100:550 –554.

53. Yang X, Dubnau E, Smith I, Sampson NS. 2007. Rv1106c from Myco-bacterium tuberculosis is a 3beta-hydroxysteroid dehydrogenase. Bio-chemistry 46:9058 –9067. http://dx.doi.org/10.1021/bi700688x.

54. Simard J, Ricketts ML, Gingras S, Soucy P, Feltus FA, Melner MH. 2005.Molecular biology of the 3�-hydroxysteroid dehydrogenase/�5-�4 isomerasegene family. Endocr. Rev. 26:525–582. http://dx.doi.org/10.1210/er.2002-0050.

55. Wyatt MA, Ahilan Y, Argyropoulos P, Boddy CN, Magarvey NA,Harrison PH. 2013. Biosynthesis of ebelactone A: isotopic tracer, ad-vanced precursor and genetic studies reveal a thioesterase-independentcyclization to give a polyketide �-lactone. J. Antibiot. (Tokyo) 66:421–430. http://dx.doi.org/10.1038/ja.2013.48.

Lipstatin Biosynthetic Operon

December 2014 Volume 80 Number 24 aem.asm.org 7483

on July 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from