Exp. Anim. 58(1), 31–40, 2009

Oculocutaneous Albinism in Suncus murinus: Establishment of a Strain and Identification of

Its Responsible Gene

Kie TSUBOI1, 2), Yoshitaka HAYASHI2), Takamichi JOGAHARA1), Go OGURA3), Yoshiharu MURATA2), and Sen-ichi ODA1)

1)Laboratory of Animal Management and Resources, Graduate School of Bio-Agricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, 2)Department of Genetics, Research

Institute of Environmental Medicine, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, and 3)Laboratory of Subtropical Zoology, Faculty of Agriculture,

University of the Ryukyus, Nishihara, Okinawa 903-0213, Japan

Abstract: The house musk shrew Suncus murinus (Insectivora, Soricidae) is referred to as suncus in a laboratory context. Although the capture of albino-like shrews (wild suncus) has been reported previously, albino-like strains have never been established, and the molecular basis of the character has remained elusive. We have established an OCAO mutant strain (oculocutaneous albinism Okinawa), from a wild suncus with a white coat and red eyes, which was captured in 2002. During the course of establishing the strain, it was revealed that the albino-like phenotype was inherited in an autosomal recessive manner. To elucidate the molecular basis of this phenotype, we cloned the suncus cDNAs for tyrosinase (Tyr), pink-eyed dilution (p), and solute carrier family 45, member 2 (Slc45a2), since these genes are involved in oculocutaneous albinism in various species, including humans. Several polymorphisms were identified in these genes; however, linkage analysis excluded the involvement of Tyr and p. On the other hand, two amino acid substitutions (V240A and G366E) were identified in Slc45a2 that cosegregated with the phenotype in the OCAO mutant strain. While V240A was also present in colored suncus collected from Okinawa, G366E was unique to the albino-like suncus and heterozygous carriers. Thus, we conclude that a mutation in Slc45a2 (G366E) is responsible for an albino-like phenotype in Suncus murinus.Key words: melanocyte, membrane associated transporter protein, pink-eyed dilution, Slc45a2, tyrosinase

(Received 27 May 2008 / Accepted 10 September 2008)Address corresponding: Y. Hayashi, Department of Genetics, Research Institute of Environmental Medicine, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, JapanAddress corresponding for animal resources: S. Oda, Laboratory of Animal Management and Resources, Graduate School of Bio-Agricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan

32 K. TSUBOI, ET AL.

Introduction

The house musk shrew Suncus murinus of the order Insectivore is widely distributed across Asia, from the tropics to the subtropics [5], and is referred to as “sun-cus” in a laboratory context. Several habitat-related morphological and genetic variations have been con-firmed in this species, including variations in coat colors [14, 16, 19]. Since 1973, several laboratory strains have been established from wild house musk shrew popula-tions [29], including mutant strains harboring coat ab-normalities, such as a cream coat color (cr) [15], curly hair (ch) [28], and kinky coat (kc) [17], as well as a mutant strain with abnormal eye coloration (red-eyed dilution (rd) [32]). However, no albino-like strain had been established, even though the capture of albino-like shrews has been reported since 1968 [31, 44]. In Sep-tember, 2002, a male albino-like shrew, which had a pure white coat and red eyes, was captured in the field on Okinawa Island, Japan, and brought to our laboratory [20].

Albinism is an autosomal recessive disorder, which occurs as a consequence of mutations in genes involved in regulating melanin biosynthesis [38, 41]. Many mouse strains (e.g., A, AKR, BALB/c, and ICR), which are referred to as albino strains, lack pigmentation due to mutations in the tyrosinase (Tyr) gene [2]. TYR is a copper-containing glycoenzyme that plays a key role in the rate-limiting steps of the melanin biosynthesis path-way [35] and mutations in the Tyr gene cause OCA1 in humans [42]. Mutations in p have been identified in humans with OCA2 [24, 36]. In the mouse, a mutant p allele causes hypopigmentation ranging from minor to dramatic reductions in both coat and eye color [25]. The P protein has 12 transmembrane domains and is thought to function as a membrane transporter of anions with a key role in the acidification of melanosomes [34, 43]. SLC45A2 (also called MATP: membrane associated transporter protein) is a melanosomal membrane-asso-ciated protein with 12 transmembrane domains [27]. Although the function of SLC45A2 is unknown, it is speculated that this protein plays a crucial regulatory role in the processing and intracellular trafficking of TYR and other melanosomal proteins [6, 22]. In the mouse, SLC45A2 is encoded by uw (underwhite), and

three alleles (uw, uwd, uwdbr) have been described [27, 40]. In humans, defects in SLC45A2 result in OCA4, the clinical phenotype of which varies from hypopig-mentation as severe as that seen in OCA1 to some pig-mentation with brown hair and eyes [13].

We have established an albino-like strain from an albino-like shrew (wild suncus) that was brought to our laboratory in 2002. To elucidate the molecular basis of the albino-like phenotype, we analyzed multiple OCA-causative genes and identified a mutation in Slc45a2 as the source of the phenotype.

Materials and Methods

AnimalsTwo suncus strains, each with a colored coat and eyes,

were used in this study: the KAT strain, which origi-nated from one male and two females of a wild popula-tion in Kathmandu, Nepal in 1991, and which has been used as a standard strain in our laboratory because of its high reproductive rate [30], and the RYU strain, which originated from a wild population on Okinawa Island (Ryukyu archipelago), Japan in 2002. The strains were bred in closed populations but not inbreeding ones (around 10 males and 20 females) at the Research Insti-tute of Environmental Medicine and the Graduate School of Bio-Agricultural Science, Nagoya University. They have been maintained in conventional animal facilities at 25–27°C with 30–60% humidity on a 12-h light/dark cycle, with free access to water and commercial trout pellets (Nippon Formula Feed Manufacturing Co., Ltd., Yokohama, Japan).

Mating experiments using the albino-like strainTo clarify the mode of inheritance for the phenotype,

four types of crosses were performed: crosses between a KAT male and an albino-like female, crosses between carriers, crosses between a carrier male and an albino-like female, and crosses between albino-like animals. The segregation ratio of the descendants was estimated by a c2-test.

RNA extraction, cDNA cloning, and sequence analysisTotal RNA was extracted from the eyes and skin of

adult males, and used as the template for first-strand

33ALBINISM IN Suncus murinus

cDNA synthesis by means of reverse transcription. The detailed procedure has been described previously [18, 39]. Partial cDNA fragments were amplified using prim-ers designed for regions known to be highly conserved among several species (human, mouse, rhesus monkey, dog, and chicken; Table 1). The 5’ and 3’ ends of the cDNAs were then cloned using a GeneRacer Kit (Invit-rogen, Carlsbad, CA), according to the manufacturer’s instructions, and the amplified fragments were cloned using a TOPO TA Cloning Kit (Invitrogen). The se-quences of the clones were determined using a PRISM

Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems Inc., Foster City, CA) and a DNA sequencer (model 3100-Avant, Applied Biosystems Inc.). The sequences of the cDNAs were aligned using the NCBI BLAST program (www.ncbi.nlm.gov/BLAST/).

Restriction endonuclease analysisGenomic DNA was extracted from the tails of adult

animals by standard methods using Proteinase K diges-tion and phenol/chloroform extraction. The presence or absence of the mutations/polymorphisms identified by

Table 1. List of primers used

Primer name Primer sequences (5’ to 3’) Amplified region

Tyr For sequencing TYR_s-a AGCAGACTAGTAAGGACTAGAGCC 5’ end TYR_s-b AACcTGATGGAGAAGGAATGCTG exon 1 TYR_as-a TACCAAAACACTGGCATGTCCTAT exon 1 TYR_s-c GTTTACCCAGTGGCCAATGCAC exon 4 TYR_as-b ACAGTGGTATAAAAGGaACCATGTA exon 4 TYR_as-c CACAAGTCAGCGCAAGGACAGG 3’ end For AluI-RFLP TYR_gs1 AATGCACCAGTTGGCAAACAATTCCC exon 1 TYR_gas1 TCTGGATTTCTTGTTCCCACAGCAACA exon 1

p For sequencing P_s-a GAAAGCTCTGGCAGCTGTTGGC exon 6 P_s-b ATCTTCACAAACATTGGAGGAGC exon 14 P_as-a TTAGCAACCAGATGGCACCCAG exon 20 P_as-b GAAGGCCAGGGCATACATGAG exon 23 For TaqI-RFLP P_gs1 AAGCATGAGATCTCCGTGTGGC exon 16 P_gas1 CGGCAATCCAGCAGACGCTGGAG exon 16

Slc45a2 For sequencing SLC45A2_s-a GCCAAGCTCCATGACACATCC 5’ end SLC45A2_s-b GGCAGGTTCTCTACCCAGTG 5’ end SLC45A2_s-c AAAGCcTACTTGTTTGATGTCTGC exon 2 SLC45A2_as-a GGCCCCTCTCCTTATCCTGATGG exon 2 SLC45A2_as-b CCAGAGCACCTCCAAACCCTGTG exon 3 SLC45A2_s-d TGGGGTCTGTGCATCAACTCCATG exon 5 SLC45A2_s-e AGCTTTGGTCTCCTACATCGGATTA exon 6 SLC45A2_as-c TcCCCAGgCCAAAsAGcAAATA exon 6 SLC45A2_as-d ATTCAATCTACATATCTAACAAAGAG exon 7 SLC45A2_as-e TGAGTTTTGGAAGAAAGTGGTTT 3’ end For MwoI-RFLP SLC45A2_gs1 TGGGAAGAGTGTTGGGAACTGAG exon 3 SLC45A2_gas1 AATGTCCTTTATCACATCTGcAAGTGG exon 3 For MboII-RFLP SLC45A2_gs2 GTGTACCATGGGAACCCCTAC exon 5 SLC45A2_gas2 CAGACCCCAGCACCCCACTTCAtCT exon 5

Bold, lower-case nucleotides indicate mismatches to the suncus cDNA sequences.

34 K. TSUBOI, ET AL.

sequencing was confirmed as follows. Genomic regions containing the suspected mutant/polymorphic nucleotide were amplified by PCR, and the products were digested with the specific restriction enzymes. The digested frag-ments were then separated by agarose gel electrophore-sis, stained with ethidium bromide, and visualized using a UV transilluminator. The mutant/polymorphic alleles were confirmed based on the banding patterns in the gels.

Results

Phenotype of the albino-like suncus and mating experimentsAn albino-like suncus with a pure white coat and red

eyes and a colored animal are representatively shown in

Fig. 1. Genetic analyses were conducted using KAT as the colored strain. The crosses between the colored and wild albino-like animals produced 33 offspring, all of which were colored. As shown in Table 2, mating of KAT × albino-like, carrier × carrier, carrier × albino-like, and albino-like × albino-like produced colored and al-bino-like offspring at ratios of 1:0 (80:0), 3:1 (116:34), 1:1 (31:26), and 0:1 (0:53), respectively. These results are in agreement with the expected ratio based on Men-delian inheritance patterns and show that the albino-like phenotype is controlled by a single autosomal recessive gene. We named the mutant gene “oculocutaneous al-binism Okinawa (gene symbol: ocao)”.

Fig. 1. Appearance of each type of suncus. (A) Albino-like suncus with a pure white coat and red eyes; (B) KAT suncus with a colored coat and black eyes.

Table 2. Segregation of the albino-like phenotype in the four mating types

Mating No. of No. of No. by colors Expected c2

Female × Male matings progeny Colored Albino-like segregation (probability) Male Female Male Female ratio

KAT × albino-like 19 80 38 42 0 0 1:0(+/+) (ocao/ocao*)Carrier × carrier 26 150 56 60 16 18 3:1 0.4356(+/ocao) (+/ocao) (0.5<P<0.6)Carrier × albino-like 16 57 18 13 16 10 1:1 0.4386(+/ocao) (ocao/ocao) (0.5<P<0.6)Albino-like × albino-like 19 53 0 0 29 24 0:1(ocao/ocao) (ocao/ocao)

Based on the presumption of single autosomal recessive inheritance. *Presumed genotype of the albino-like phenotype: oculocutaneous albinism Okinawa (ocao).

35ALBINISM IN Suncus murinus

Establishment of an albino-like strainThe founder shrew (wild suncus captured in Okinawa)

mated with KAT females and their descendants were repeatedly crossed to KAT strain females by the partial cross-intercross system (Fig. 2), and the albino-like shrew was established as an OCAO mutant strain. To preserve the Y chromosome of the albino-like suncus, it and its male descendants were mated with a KAT female. The albino-like strain was bred at the Research Institute of Environmental Medicine under the conditions de-scribed above. The albino-like animals obtained during the course of establishing the OCAO mutant strain were used in our subsequent analyses.

Cloning and sequence analysis of suncus Tyr cDNATo elucidate whether Tyr is involved in the albino-like

phenotype, we cloned full-length suncus Tyr cDNA from RNA extracted from the retina of KAT and albino-like suncus. The suncus Tyr cDNA contained a 1,587-bp ORF and the deduced primary sequence showed 91, 90, and 93% identity with those of human, mouse, and dog, respectively (data not shown; GenBank AB430855 and AB430856). A comparison of the cDNA sequence with that of Tyr cDNA derived from an albino-like suncus revealed four nucleotide substitutions that alter encoding amino acids: F26S, V128I, K153I, and A154T. Among these nucleotide substitutions, a guanine to adenine tran-sition at nucleotide position 460 created an AluI (GCTA) restriction site polymorhpism that was present in KAT

Tyr cDNA but not in RYU Tyr cDNA. Accordingly, we designed primers to amplify the genomic region (487 bp) containing the mutated/polymorphic AluI site (Fig. 3). As shown in Fig. 3, only digested 277- and 210-bp fragments were obtained from the KAT animals (Lanes 1 and 2), however, three out of four albino-like animals (Lanes 5–8) also showed digested fragments, indicating that the mutation/polymorphism in Tyr cDNA is not linked to the albino-like phenotype. On the other hand, only the undigested 487-bp fragment was obtained from the RYU animals (Lanes 9 and 10), suggesting that the differences in the cDNA sequences are a consequence of the long distance separating the habitats of the found-ers (Kathmandu and Okinawa). Our results also suggest that these particular polymorphisms are not critically involved in the function of TYR, since the RYU strain has a colored coat.

Cloning and sequence analysis of suncus p cDNASince the involvement of Tyr in the albino-like phe-

notype was eliminated, we analyzed the p gene. We cloned a partial suncus p cDNA that contained a 571-bp coding region (GenBank AB430859 and AB430860). The deduced primary sequence showed 85, 84, and 86% identity with those of human, mouse, and dog, respec-tively. A comparison of the KAT p cDNA sequence with that from an albino-like suncus (referred to as RYU in Fig. 4), revealed five nucleotide substitutions; however, none resulted in an amino acid substitution. As in the

Fig. 2. Pedigree of the albino-like strain, OCAO. Partial pedigree for the albino-like strain is shown. A wild albino-like suncus and its descendants were crossed to KAT females and an OCAO mutant strain was established. Except for the founder wild albino-like suncus, all the albino-like animals, the parental animals of which were not indicated, were derived from intercross mating of the strain. Squares, male; circles, female; filled symbols, colored; open symbols, albino-like.

36 K. TSUBOI, ET AL.

case of the Tyr gene, a guanine to thymine transversion that generated a TaqI (TCGA) restriction site was iden-tified; thus, we designed primers to amplify the region containing the mutant/polymorphic site (125 bp) from genomic DNA. As shown in Fig. 4, only the undigested 125-bp fragment was obtained from KAT animals (Lanes 1 and 2), whereas only the digested 96-bp fragment was obtained from RYU animals (Lanes 9 and 10). The heterozygous carriers as well as the albino-like suncus showed variable patterns (Lanes 3–8); thus, linkage be-tween the p gene and the albino-like phenotype was eliminated.

Cloning and sequence analysis of suncus Slc45a2 cDNA

We next analyzed the suncus Slc45a2 gene homolog. The suncus Slc45a2 cDNA contains a 1,596-bp ORF, and the deduced primary sequence showed 84, 84, and 83% identity with those of human, mouse, and dog, re-spectively (Fig. 5; GenBank AB430857 and AB430858). Two missense substitutions were detected between the KAT and albino-like cDNAs: 719T/C (V240A) and 1097G/A (G366E, see Fig. 6B). As these sequence variations did not produce alternative restriction sites,

we used mismatch primers designed to generate a restric-tion site only in the presence of the mutations/polymor-phisms present in the albino-like animals.

As shown in Fig. 6A, fragments containing 719T/C were amplified using a mismatch primer set and digest-ed by MwoI (GC[N]7GC). While the fragments of the KAT animals were undigested (128 bp; Lanes 1 and 2), those of the albino-like suncus were completely digest-ed (Lanes 5–8). Heterozygous carriers showed both undigested and digested fragments (Lanes 3 and 4), in-dicating positive linkage between the albino-like pheno-type and 719T/C (V240A). The fragments amplified from RYU were also completely digested, indicating that 719C originated from the wild suncus of Okinawa. Since the RYU strain has a colored coat, the V240A substitu-tion is not responsible for the albino-like phenotype.

Simultaneously, fragments containing 1097G/A (87 bp) were amplified using a mismatch primer set and digested by MboII (GAAGA[N]8, Fig. 6B). The frag-ments amplified from the albino-like suncus were com-pletely digested (73 bp; Lanes 5–8), whereas those from the KAT and RYU animals remained undigested (Lanes 1, 2, 9, and 10). The heterozygous carriers showed both digested and undigested fragments (Lanes 3 and 4): thus,

Fig. 3. Restriction enzyme digestion analysis of Tyr. The ge-nomic region containing the polymorphic AluI site (shad-ed area) was amplified using the primers TYR-gs1 and TYR-gas1 (Fig. 3 and Table 1; upper panel). The amplified 487-bp fragment was digested into 277- and 210-bp frag-ments in the presence of the AluI site and analyzed on 1.2% agarose gels (lower panel). Lanes 1 and 2: KAT suncus. Lanes 3 and 4: KAT and albino-like heterozy-gotes. Lanes 5–8: albino-like suncus. Lanes 9 and 10: RYU suncus. M1, 1-kb ladder. M2, 100-bp ladder.

Fig. 4. Restriction enzyme digestion analysis of p. The genomic region containing the polymorphic TaqI site (shaded area) was amplified using the primers P-gs1 and P-gas1 (Table 1; upper panel). The amplified 125-bp fragment was di-gested into 96- and 29-bp fragments in the presence of the TaqI site and analyzed on 4.0% agarose gels (lower panel). The 29-bp fragments are invisible. Lanes 1 and 2: KAT suncus. Lanes 3 and 4: KAT and albino-like heterozygotes. Lanes 5–8: albino-like suncus. Lanes 9 and 10: RYU sun-cus. M1, 1-kb ladder. M2, 100-bp ladder.

37ALBINISM IN Suncus murinus

the 1097A (G366E) allele is specific to the albino-like suncus and carriers, but is not present in the RYU strain, which inhabits the same geographical region where the founder animal (wild albino-like suncus) was cap-tured.

Discussion

In this study, we established an OCAO mutant strain (oculocutaneous albinism Okinawa) of suncus. By clon-ing the genes involved in OCA and linkage analyses, we

Fig. 5. Deduced primary sequence of suncus Slc45a2. Alignment of the deduced primary sequences of the Slc45a2 homologs from RYU, KAT, human, and mouse is shown. Asterisks indicate residues conserved among all species/strains. Colons indicate residues that are conserved in humans and mice, but not in the suncus strains. Arrows indicate the region used to design the PCR primers: (a) MwoI-RFLP for detection of the V240A polymor-phism, (b) MboII-RFLP for detection of the G366E mutation. Inverted triangles mark the MwoI (GC[N]7GC) and MboII (GAAGA[N]8) restriction sites. The mutated glycine residue in the albino-like suncus is indicated in bold letters with a shaded square.

38 K. TSUBOI, ET AL.

identified a mutation in Slc45a2, which is responsible for the albino-like phenotype. Although there have been several reports on albinism in other species of Insec-tivora [7, 8, 45], our study is the first to identify the re-sponsible gene for such a phenotype.

The glycine residue at position 366 in suncus SLC45A2, which is replaced by glutamate in the albino-like suncus, is conserved in all species (medaka fish, mouse, human, horse, chicken, Japanese quail, pig, and dog) for which the sequence of the homologous protein has been determined [9, 10, 26, 27, 33, 37]. According to the molecular models reported to date, this glycine residue is located at the first position of the eighth trans-membrane domain. Substitution of this residue by a glutamate with an acidic side chain may alter the struc-ture of the transmembrane domain, and may decrease insertion of SLC45A2 into the membrane or intrinsic SLC45A2 activity. So far, 24 different mutations in SLC45A2 have been reported in humans, and all of the missense mutations are located within or very close to transmembrane domains [12]. Homologous mutations affecting the aspartic acid in the fourth transmembrane domain, resulting in light beige and cream coat colors, have been reported in the mouse (uwdbr) and horse, re-spectively [26, 27, 40]. Moreover, D157N, a missense mutation that lies in the second cytoplasmic loop close to the fourth transmembrane domain, is the most frequent mutation in Japanese OCA4 patients [13]. However, functional studies of these mutant SLC45A2s have not been reported. Recently, abnormal trafficking of TYR from the trans-Golgi network to melanosomes was dem-onstrated in melanocytes derived from underwhite mice, suggesting that SLC45A2 plays a crucial role in modu-lating the processing and intracellular trafficking of TYR and other melanosomal proteins [6].

In addition to the G366E mutation responsible for the albino-like phenotype, we found that residue 240 in sun-cus SLC45A2 is valine and alanine in the KAT and RYU strains, respectively. Animals of both strains have col-ored coats and both valine and alanine are non-polar hydrophobic amino acids; therefore, this variation is unlikely to affect the function of SLC45A2. The ho-mologous residue is alanine in both humans and mice (see Fig. 6), further supporting this notion. We speculate that the V240A variation developed after the separation

Fig. 6. Restriction enzyme digestion analysis of Slc45a2. (A) PCR-RFLP analysis of the 719T/C(V240A) polymorphism. The genomic region containing the 719T/C, is shown in the upper panel. The region was amplified using a mismatch primer, which converts an A residue to a G residue (shown in italics) and produces a MwoI site only in the presence of 719C. The amplified 128-bp fragment was digested into 105- and 23-bp fragments in the presence of the MwoI site. The digested fragments were analyzed on 4.0% agarose gels (lower panel). The 23-bp fragments are invisible. Lanes 1 and 2: KAT suncus. Lanes 3 and 4: KAT and albino-like heterozygotes. Lanes 5–8: albino-like suncus. Lanes 9 and 10: RYU suncus. M1, 1-kb ladder. M2, 100-bp ladder. (B) PCR-RFLP analysis of the 1097G/A(G366E) mutation. The genomic region containing the 1097G/A is shown in the upper panel. The region was amplified using a mismatch primer, which converts a T residue to an A residue (shown in italics) and produces an MboII site only in the presence of 1097A. The amplified 87-bp fragment is digested into 73- and 14-bp fragments in the presence of the MboII site. The digested fragments were analyzed on 4.0% agarose gels (lower panel). The 14-bp fragments are invisible.

39ALBINISM IN Suncus murinus

of ancestral wild suncus into geographically distant re-gions. A phylogenetic tree deduced from the sequence of mitochondrial DNA control regions classifies KAT and RYU (OKI:Okinawa) into continental and insular groups [21], and indicates the substantial distance be-tween KAT and RYU. The several variations in TYR identified between KAT and RYU strains, as well as the V240A variation in SLC45A2, may be used to elucidate how wild suncus segregated in different regions of Asia. In addition, the amino acid sequence variations in TYR between the KAT and RYU strains (F26S, V128I, K153I, A154T) should be of use for the molecular modeling of TYR, since TYR appears to function normally in both strains.

Tyr mutants have been identified in many animals including the mouse [2, 23], rabbit [1], rat [3], cat [11], and ferret [4]. Mutations in Slc45a2 have been identified in an increasing number of animal species [9, 10, 26, 27, 33, 37], and the phenotype of Slc45a2 varies from hy-popigmentation as severe as that seen in OCA1 to some pigmentation with brown hair and eyes [13]. The OCAO suncus described herein, having almost pure white coats, may serve as a unique disease model of human OCA4 and will provide some insights to the function of SLC45A2.

Acknowledgment(s)

We thank Prof. Yasushi Tomita, Department of Der-matology, Nagoya University Graduate School of Med-icine, for his helpful discussion and encouragement for this work. We are indebted to the staff of the animal care unit at Nagoya University Research Institute of Envi-ronmental Medicine Futuristic Environmental Simula-tion Center for their help in the maintenance of ani-mals.

References

1. Aigner, B., Besenfelder, U., Muller, M., and Brem, G. 2000. Tyrosinase gene variants in different rabbit strains. Mamm. Genome 11: 700–702.

2. Beermann, F., Orlow, S.J., and Lamoreux, M.L. 2004. The Tyr (albino) locus of the laboratory mouse. Mamm. Genome 15: 749–758.

3. Blaszczyk, W.M., Arning, L., Hoffmann, K.P., and Epplen, J.T. 2005. A Tyrosinase missense mutation causes albinism

in the Wistar rat. Pigment Cell Res. 18: 144–145. 4. Blaszczyk, W.M., Distler, C., Dekomien, G., Arning, L.,

Hoffmann, K.P., and Epplen, J.T. 2007. Identification of a tyrosinase (TYR) exon 4 deletion in albino ferrets (Mustela putorius furo). Anim. Genet. 38: 421–423.

5. Corbet, G.B. and Hill, J.E. 1992. The Mammals of the Indomalayan Region—A Systematic Review. Oxford University Press, New York.

6. Costin, G.E., Valencia, J.C., Vieira, W.D., Lamoreux, M.L., and Hearing, V.J. 2003. Tyrosinase processing and intracellular trafficking is disrupted in mouse primary melanocytes carrying the underwhite (uw) mutation. A model for oculocutaneous albinism (OCA) type 4. J. Cell Sci. 116: 3203–3212.

7. Dexter, R.W. 1961. An albino shrew from Ohio. J. Mammal. 42: 96.

8. Elder, W.H. 1960. An albino Cryptosis from Missouri. J. Mammal. 41: 506–507.

9. Fukamachi, S., Shimada, A., and Shima, A. 2001. Mutations in the gene encoding B, a novel transporter protein, reduce melanin content in medaka. Nat. Genet. 28: 381–385.

10. Gunnarsson, U., Hellstrom, A.R., Tixier-Boichard, M., Minvielle, F., Bed’hom, B., Ito, S., Jensen, P., Rattink, A., Vereijken, A., and Andersson, L. 2007. Mutations in SLC45A2 cause plumage color variation in chicken and Japanese quail. Genetics 175: 867–877.

11. Imes, D.L., Geary, L.A., Grahn, R.A., and Lyons, L.A. 2006. Albinism in the domestic cat (Felis catus) is associated with a tyrosinase (TYR) mutation. Anim. Genet. 37: 175–178.

12. Inagaki, K., Suzuki, T., Ito, S., Suzuki, N., Adachi, K., Okuyama, T., Nakata, Y., Shimizu, H., Matsuura, H., Oono, T., Iwamatsu, H., Kono, M., and Tomita, Y. 2006. Oculocutaneous albinism type 4: six novel mutations in the membrane-associated transporter protein gene and their phenotypes. Pigment Cell Res. 19: 451–453.

13. Inagaki, K., Suzuki, T., Shimizu, H., Ishii, N., Umezawa, Y., Tada, J., Kikuchi, N., Takata, M., Takamori, K., Kishibe, M., Tanaka, M., Miyamura, Y., Ito, S., and Tomita, Y. 2004. Oculocutaneous albinism type 4 is one of the most common types of albinism in Japan. Am. J. Hum. Genet. 74: 466–471.

14. Iseki, R. 1985. Strains and marker genes. pp. 117–120. In: Suncus murinus: Biology of the Laboratory Shrew (Oda, S., Kitoh, J., Ota, K., and Isomura, G. eds.), Japan Scientific Societies Press, Tokyo (in Japanese).

15. Iseki, R., Namikawa, T., and Kondo, K. 1984. Cream, a new coat-color mutant in the musk shrew. J. Hered. 75: 144–145.

16. Ishikawa, A., Akadama, I., Namikawa, T., and Oda, S. 1989. Development of a laboratory line (SRI line) derived from the wild house musk shrew, Suncus murinus, indigenous to Sri Lanka. Jikken Dobutsu 38: 231–237.

17. Ishikawa, A., Hirunagi, K., Oda, S., Namikawa, T., and Tomita, T. 1992. Kinky coat, a new autosomal recessive mutation in the musk shrew, Suncus murinus. Jikken Dobutsu 41: 203–214.

18. Ito, T., Hayashi, Y., Ohmori, S., Oda, S., and Seo, H. 1998. Molecular cloning of sucrase-isomaltase cDNA in the house

40 K. TSUBOI, ET AL.

musk shrew Suncus murinus and identification of a mutation responsible for isolated sucrase deficiency. J. Biol. Chem. 273: 16464–16469.

19. Jogahara, T., Koyasu, K., Oda, S., Kawai, T., and Hanamura, H. 2007. Quest for the cause of oligodontia in Suncus murinus (Soricomorpha, Soricidae): morphological re-examination. Arch. Oral Biol. 52: 836–843.

20. Jogahara, T., Ogura, G., Higa, G., Ishibashi, O., and Oda, S. 2008. Survey and capture of albino-like house musk shrews (Suncus murinus) in Okinawa, Japan, and a preliminary report regarding inheritance of the albino-like mutation. Mamm. Study 33: 121–124.

21. Kurachi, M., Chau, B.L., Dang, V.B., Dorji, T., Yamamoto, Y., Nyunt, M.M., Maeda, Y., Chhum-Phith, L., Namikawa, T., and Yamagata, T. 2007. Population structure of wild musk shrews (Suncus murinus) in Asia based on mitochondrial DNA variation, with research in Cambodia and Bhutan.Biochem. Genet. 45: 165–183.

22. Kushimoto, T., Valencia, J.C., Costin, G.E., Toyofuku, K., Watabe, H., Yasumoto, K., Rouzaud, F., Vieira, W.D., and Hearing, V.J. 2003. The Seiji memorial lecture: the melanosome: an ideal model to study cellular differentiation. Pigment Cell Res. 16: 237–244.

23. Kwon, B.S., Haq, A.K., Wakulchik, M., Kestler, D., Barton, D.E., Francke, U., Lamoreux, M.L., Whitney 3rd, J.B., and Halaban, R. 1989. Isolation, chromosomal mapping, and expression of the mouse tyrosinase gene. J. Invest. Dermatol. 93: 589–594.

24. Lee, S.T., Nicholls, R.D., Jong, M.T., Fukai, K., and Spritz, R.A. 1995. Organization and sequence of the human P gene and identification of a new family of transport proteins. Genomics 26: 354–363.

25. Lyon, M.F., King, T.R., Gondo, Y., Gardner, J.M., Nakatsu, Y., Eicher, E.M., and Brilliant, M.H. 1992. Genetic and molecular analysis of recessive alleles at the pink-eyed dilution (p) locus of the mouse. Proc. Natl. Acad. Sci. U. S. A. 89: 6968–6972.

26. Mariat, D., Taourit, S., and Guerin, G. 2003. A mutation in the MATP gene causes the cream coat colour in the horse. Genet. Sel. Evol. 35: 119–133.

27. Newton, J.M., Cohen-Barak, O., Hagiwara, N., Gardner, J.M., Davisson, M.T., King, R.A., and Brilliant, M.H. 2001. Mutations in the human orthologue of the mouse underwhite gene (uw) underlie a new form of oculocutaneous albinism, OCA4. Am. J. Hum. Genet. 69: 981–988.

28. Oda, S. 1989. Curly hair mutant in the house musk shrew.Ann. Res. Inst. Environment. Med. 40: 268–271 (in Japanese).

29. Oda, S. 1991. Development of laboratory lines in the house musk shrew, Suncus murinus characterized by various numbers of chromosomes (Robertsonian translocations). Rep. of Grant-in-Aid for Sci. Res. (in Japanese).

30. Oda, S., Koyasu, K., and Shrestha, K.C. 1992. Breeding of the house musk shrew, suncus murinus, originating from a wild population in Kathmandu, Nepal. Ann. Res. Inst. Environ. Med. 43: 239–240 (in Japanese).

31. Oda, S. and Shigehara, N. 1978. Capture of the riukiu house

musk shrew, Suncus murinus riukiuanus in the suburbs of Naha, Okinawa. J. Mamm. Soc. Jpn. 7: 150–154 (in Japanese).

32. Ohno, T., Oda, S., Ishikawa, A., and Namikawa, T. 1992. Red-eyed dilution (rd), a novel coat-color mutant gene in the musk shrew (Suncus murinus, Insectivora). Jikken Dobutsu 41: 173–179.

33. Okumura, N., Hayashi, T., Sekikawa, H., Matsumoto, T., Mikawa, A., Hamasima, N., and Awata, T. 2006. Sequencing, mapping and nucleotide variation of porcine coat colour genes EDNRB, MYO5A, KITLG, SLC45A2, RAB27A, SILV and MITF. Anim. Genet. 37: 80–82.

34. Puri, N., Gardner, J.M., and Brilliant, M.H. 2000. Aberrant pH of melanosomes in pink-eyed dilution (p) mutant melanocytes, J. Invest. Dermatol. 115: 607–613.

35. Ray, K., Chaki, M., and Sengupta, M. 2007. Tyrosinase and ocular diseases: some novel thoughts on the molecular basis of oculocutaneous albinism type 1. Prog. Retin. Eye Res. 26: 323–358.

36. Rinchik, E.M., Bultman, S.J., Horsthemke, B., Lee, S.T., Strunk, K.M., Spritz, R.A., Avidano, K.M., Jong, M.T., and Nicholls, R.D. 1993. A gene for the mouse pink-eyed dilution locus and for human type II oculocutaneous albinism. Nature 361: 72–76.

37. Schmutz, S.M. and Berryere, T.G. 2007. The genetics of cream coat color in dogs. J. Hered. 98: 544–548.

38. Sturm, R.A. and Frudakis, T.N. 2004. Eye colour: portals into pigmentation genes and ancestry. Trends Genet. 20: 327–332.

39. Sun, X.Y., Chen, Z.Y., Hayashi, Y., Kanou, Y., Takagishi, Y., Oda, S., and Murata, Y. 2008. Insertion of an intracisternal A particle retrotransposon element in plasma membrane calcium ATPase 2 gene attenuates its expression and produces an ataxic phenotype in joggle mutant mice. Gene 411: 94–102.

40. Sweet, H.O., Brilliant, M.H., Cook, S.A., Johnson, K.R., and Davisson, M.T. 1998. A new allelic series for the underwhite gene on mouse chromosome 15. J. Hered. 89: 546–551.

41. Tomita, Y. and Suzuki, T. 2004. Genetics of pigmentary disorders. Am. J. Med. Genet. C Semin. Med. Genet. 131C: 75–81.

42. Tomita, Y., Takeda, A., Okinaga, S., Tagami, H., and Shibahara, S. 1989. Human oculocutaneous albinism caused by single base insertion in the tyrosinase gene. Biochem. Biophys. Res. Commun. 164: 990–996.

43. Toyofuku, K., Valencia, J.C., Kushimoto, T., Costin, G.E., Virador, V.M., Vieira, W.D., Ferrans, V.J., and Hearing, V.J. 2002. The etiology of oculocutaneous albinism (OCA) type II: the pink protein modulates the processing and transport of tyrosinase. Pigment Cell Res. 15: 217–224.

44. Tsuji, K. and Ishikawa, T. 1982. Life mode and behabior of the ryukyu musk shrew (Suncus murinus var riukiuanus). J. Mamm. Soc. Jpn. 9: 96–103 (in Japanese).

45. Williams, M.W. 1962. An albino short-tailed shrew from Vermont. J. Mammal. 43: 424–425.