Msb2 Signaling Mucin Controls Activation of Cek1 Mitogen ... · EUKARYOTIC CELL, Aug. 2009, p. 1235–1249 Vol. 8, No. 8 1535-9778/09/$08.000 doi:10.1128/EC.00081-09 Copyright ©

EUKARYOTIC CELL, Aug. 2009, p. 1235–1249 Vol. 8, No. 81535-9778/09/$08.00�0 doi:10.1128/EC.00081-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Msb2 Signaling Mucin Controls Activation of Cek1 Mitogen-ActivatedProtein Kinase in Candida albicans�

Elvira Roman,1 Fabien Cottier,2 Joachim F. Ernst,2 and Jesus Pla1*Departamento de Microbiología II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza de Ramon y Cajal s/n,

E-28040 Madrid, Spain,1 and Institut fur Mikrobiologie, Heinrich-Heine-Universitaet Dusseldorf,Universitaetsstr. 1/26.12, 40225 Dusseldorf, Germany2

Received 10 March 2009/Accepted 8 June 2009

We have characterized the role that the Msb2 protein plays in the fungal pathogen Candida albicans by theuse of mutants defective in the putative upstream components of the HOG pathway. Msb2, in cooperation withSho1, controls the activation of the Cek1 mitogen-activated protein kinase under conditions that damage thecell wall, thus defining Msb2 as a signaling element of this pathway in the fungus. msb2 mutants display alteredsensitivity to Congo red, caspofungin, zymolyase, or tunicamycin, indicating that this protein is involved in cellwall biogenesis. Msb2 (as well as Sho1 and Hst7) is involved in the transmission of the signal toward Cek1mediated by the Cdc42 GTPase, as revealed by the use of activated alleles (Cdc42G12V) of this protein. msb2mutants have a stronger defective invasion phenotype than sho1 mutants when tested on certain solid mediathat use mannitol or sucrose as a carbon source or under hypoxia. Interestingly, Msb2 contributes to growthunder conditions of high osmolarity when both branches of the HOG pathway are altered, as triple ssk1 msb2sho1 mutants (but not any single or double mutant) are osmosensitive. However, this phenomenon is inde-pendent of the presence of Hog1, as Hog1 phosphorylation, Hog1 translocation to the nucleus, and glycerolaccumulation are not affected in this mutant following an osmotic shock. These results reveal essentialfunctions in morphogenesis, invasion, cell wall biogenesis, and growth under conditions of high osmolarity forMsb2 in C. albicans and suggest the divergence and specialization of this signaling pathway in filamentousfungi.

Candida albicans is an important human fungal pathogen,causing infections that may represent a serious health problem.This yeast is found as a commensal in certain body locations(mainly, the vagina and tractointestinal duct) but is able to gainaccess to different organs under conditions of altered hostimmune defenses causing severe diseases. Dimorphism, theenvironmentally regulated differentiation program that allowsthis fungus to switch between a yeast-like-form (unicellular)and a filamentous form (multicellular) (25, 59, 95), is consid-ered to play an important—albeit not exclusive—role (27, 51,79, 82, 94) in the virulence of this fungus. Therefore, besides itsclinical importance as an opportunistic pathogen, this microberepresents an interesting model of morphogenesis and differ-entiation in lower eukaryotes.

As occurs with other microbial pathogens, C. albicans mustbe able to sense environmental signals and develop adaptiveresponses to survive within the host environment. Mitogen-activated protein (MAP) kinase (MAPK) signal transductionpathways are responsible, in part, for this process (3, 12, 76),and, perhaps not surprisingly, these pathways are importantvirulence factors (1, 14, 20, 32). The cell integrity pathway ismediated by the Mkc1 MAPK and participates in constructionof the cell wall and in response to stress as well as in invasionunder defined conditions (45, 60, 62). The Cek1 pathway is also

involved in morphogenesis and cell wall formation (14, 15, 77,83), while the HOG pathway, mediated by the Hog1 MAPK,enables adaptation to both osmotic and oxidative stress (2, 4,11, 24). Mutants defective in certain elements of the HOGpathway have been shown to be more susceptible to oxidativestress, an essential microbial adaptive mechanism that greatlyinfluences the outcome of infection (78, 91; see also reference12). They are also more efficiently killed by phagocytic cells ofeither mouse or human origin (6, 22). This route also influ-ences morphogenesis, and hog1 mutants are hyperfilamentous(1), since Hog1 is a repressor of Cek1 activation (23, 77).

In Saccharomyces cerevisiae, the HOG pathway is mediatedby two upstream branches. The first branch relies on a histi-dine-kinase two-component system that involves Sln1, Ypd1,Ssk1, and the redundant Ssk2 and Ssk22 proteins (MAPKkinase kinases [MAPKKKs]) (35, 48, 68, 69, 86). Eventually,this results in the activation of the Pbs2 MAPK kinase thatinteracts with and activates Hog1 (57) as well as downstreamtranscriptions factors that generate the appropriate adaptivetranscriptional response. The second branch requires Sho1, theCdc42 GTPase, Ste20 (PAK), and Ste11 (MAPKKK)/Ste50(see references 19 and 34 for recent reviews). Sho1 is an adap-tor membrane protein that attaches the kinase complex toregions of polarized growth at the plasma membrane and in-teracts with Pbs2 (52, 53, 71, 97, 98) via a proline-rich domainpresent in the Pbs2 MAPK kinase. Both transcriptomal andgenetic analyses have implicated the Msb2 membrane proteinin the HOG pathway (64). Msb2 encodes a mucin-like proteinidentified as a multicopy suppressor of a cdc24ts mutant (7)that interacts with Sho1 and Cdc42 (16). Recent work indicates

* Corresponding author. Mailing address: Departamento de Micro-biología II, Facultad de Farmacia, Universidad Complutense de Ma-drid, Plaza de Ramon y Cajal s/n, E-28040 Madrid, Spain. Phone: 34 913941617. Fax: 34 91 3941745. E-mail: [email protected].

� Published ahead of print on 19 June 2009.

1235

on August 19, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/EC.00081-09&domain=pdf&date_stamp=2009-08-01

http://ec.asm.org/

that Msb2 and Hkr1 are the putative osmosensors of the HOGpathway in S. cerevisiae and act coordinately with Sho1 topromote osmotic adaptation (87). Hkr1, however, seems to bespecific to the HOG pathway, whereas Msb2, which also par-ticipates in filamentous growth (FG), plays dual roles (67).These two branches seem to exist also in C. albicans, althoughimportant functional differences between them have been pre-viously demonstrated (3). Both the Ssk1 and Sho1 homologuesare involved in morphogenesis and resistance to oxidativestress (9, 11, 77), but Ssk1 is the main component responsiblefor the transmission of the oxidative activation signal to theHog1 MAPK (11, 77). Recent investigations have shown thatthe CaSSK2 homologue to ScSSK2 and ScSSK22 is the onlyMAPKKK responsible for transmitting the signal to Hog1 (13),while CaSTE11 is mainly involved in cell wall biogenesis.

Given the relevance of the HOG pathway in the virulence ofthis pathogenic fungus (1, 4, 9, 22), we have undertaken theanalysis of the MSB2 gene in this pathogen. We show here thatthe protein is not involved in the oxidative stress response butplays an important role in FG and cell wall biogenesis bycontrolling the activation of the Cek1 MAPK in cooperationwith Sho1. Most importantly, it is involved in the resistance toosmotic stress by a Hog1-independent mechanism.

MATERIALS AND METHODS

Strains and growth conditions. Strains used in this study are listed in Table 1.The prefix Ca or Sc is occasionally used to indicate the corresponding C. albicansor S. cerevisiae gene to avoid confusions in the text. Yeast strains were grown at37°C (unless otherwise stated) in yeast extract-peptone-dextrose (YEPD) me-dium (1% yeast extract, 2% peptone, 2% glucose) or SD minimal medium (2%glucose, 0.67% yeast nitrogen base [YNB] without amino acids) with the appro-priate nutritional requirements at 50 �g/ml (final concentration) for auxotrophs.The morphology of cells under different growth conditions was tested usingYEPD medium (yeast extract with 2% dextrose), YPS medium (yeast extractwith 2% sucrose) (8), YPM medium (yeast extract with 2% mannitol) (50), andsynthetic low ammonium dextrose (SLAD) medium (30). For experiments underconditions of hypoxia, YPS medium was used. Drop tests were performed byspotting 5-�l drops of serial 10-fold dilutions of exponentially growing cells at anoptical density at 620 nm (OD620) of 1 onto YEPD plates supplemented withsodium chloride, sorbitol, Congo red, tunicamycin, and caspofungin at the indi-cated concentrations. Plates were incubated for 24 h at 37°C and scanned. Tomeasure the inhibition of growth caused by zymolyase, cells from an exponen-tially growing culture were inoculated at an OD620 of 0.025 in YEPD mediumsupplemented with different amounts of zymolyase 100T (dissolved in Tris-HCl[pH 7.5]–5% glucose). The assay was performed using duplicate rows of a 96-wellplate, and cells were incubated overnight at 37°C. Growth values were calculatedas the percentage of growth of each strain in YEPD medium supplemented withthe compound compared with the growth in YEPD medium alone. Graphsrepresent the mean values of the results of at least three independent experi-ments. To assess the effect of CaCDC42 alleles on MAPK activation, the indi-cated strains of C. albicans were grown in 2% CAA–YNB medium (for theinduction of the PCK1 promoter) as previously described (85). Actin stainingwith phalloidin was performed as previously described (38). Growth in liquidmedium was assessed by measuring the absorbance of the cultures at OD620.Glycerol accumulation was measured in whole-cell extracts as previously de-scribed (81).

Molecular biology procedures and plasmid constructions. Standard molecularbiology procedures were used for all genetic constructs (6). For the disruption ofthe MSB2 gene, the primers MSB2UP1 (GGTACCTTTCTTTGTTTGTGGAGTGG) and MSB2LP2 (CTCGAGAAAAAGGAATTGTTTAGTTGG) wereused to amplify a 1.75-kbp 5� region flanking the open reading frame (ORF) andsubcloned in pGEM-T (underlined letters indicate the restriction sites intro-duced for cloning purposes). Similarly, oligonucleotides MSB2UP3 (GCGGCCGCTTGACTGGTGATCCTAATGG) and MSB2LP4 (GAGCTCTTAGCAAGGATTGAAAAAGG) were used to amplify a 1.79-kbp 3� flanking region of theORF from C. albicans strain SC5314 and subcloned in pGEM-T. The 5� and 3�regions were excised from these constructions by using a combination of enzymes

KpnI and XhoI and enzymes NotI and SacI, respectively, and were accommo-dated in the disruption plasmid pSF2A (75), which comprises the SAT1 markerthat confers resistance to nourseothricin, by a four-fragment ligation to generatepDMSB2. DNA was digested with KpnI and SacI to generate a region of DNAused to force recombination at the MSB2 locus following the SAT1 flippingscheme (75). Genomics DNAs were digested with ClaI or BglII and probed withthe 1.75-kb 5� region of the gene for the Southern hybridization. This strategywas used for MSB2 deletion in the wild-type (wt) (RM100) or ssk1 (strainCSSK21) background. Next, SHO1 was disrupted in the msb2 and ssk1 msb2backgrounds following the URA-blaster scheme (26) and using the constructionsalready described (77). The strains used in this study were all Ura positive (seeTable 1). For the analysis of CaCDC42-mutated alleles we used pSU48 andpSU50 plasmids containing CaCDC42G12V and CaCDC42D118A under the con-trol of the PCK1 promoter (89). Each plasmid was made linear using a uniqueHpaI restriction site and transformed into Ura-negative strains; Ura-positivetransformants were selected, and proper integration (at the PCK1 locus) wasconfirmed by Southern blot analysis before using them. For Hog1 translocationexperiments, an ACT1PR-HOG1-green fluorescent protein (ACT1PR-HOG1-GFP) fusion was integrated in the LEU2 locus after digestion with KpnI (4).MSB2 reintegration was performed as follows. The plasmid pDS1044-1-MSB2-HA (E. Szafranski and J. F. Ernst, unpublished data) was digested withEcoRV, and the MSB2-hemagglutinin (MSB2-HA) fusion was integrated in theLEU2 locus. Ura-positive transformants were selected and checked.

Protein extracts and immunoblot assays. Cells were grown and samples wereprocessed as previously described (77). The procedures employed for cell col-lection, lysis, protein extraction, fractionation by sodium dodecyl sulfate-poly-acrylamide gel electrophoresis, and transfer to nitrocellulose membranes havebeen previously described (54). Anti-phospho-p44/p42 MAPK (Thr202/Tyr204)antibody (New England Biolabs) was used to detect dually phosphorylated Mkc1and Cek1 MAPKs; phospho-p38 MAPK (Thr180/Tyr182) 28B10 monoclonal an-tibody (Cell Signaling Technology, Inc.) and ScHog1 polyclonal antibody (SantaCruz Biotechnology) were used to detect the phosphorylated Hog1 and Hog1protein, respectively. Mkc1 and Cek1 proteins were detected by using polyclonalantibodies against them (61, 77). Western blots were developed according to themanufacturer’s specifications using a Hybond ECL kit (Amersham PharmaciaBiotech). To make equal the amounts of protein loaded, samples were firstnormalized by measuring the absorbance at 280 nm and then by pre-sodiumdodecyl sulfate-polyacrylamide gel electrophoresis and Coomasie staining.

Animal experiments. Virulence assays were performed essentially as describedpreviously (20). Briefly, C. albicans cells from fresh YEPD plates of strains to betested were collected by low-speed centrifugation and washed twice with phos-phate-buffered saline (PBS). A total of 106 yeast cells (in 250 �l) were inoculatedinto the lateral tail vein of BALB/c mice, and the mortality results were followedduring 30 days. Postmortem analyses were carried with three to five animals, andclearance of the infection was assessed by counting CFU on Saboureaud-chlor-amphenicol solid medium as described previously (20).

Quantitative real-time PCR (qRT-PCR). Total RNA was isolated and purifiedfrom cells by mechanical disruption using an RNeasy Mini kit (Qiagen, Hilden,Germany). RNA (2 �g) was reverse transcribed into cDNA (Promega), and 5 �lof the 1:100 dilutions was used for PCR assays, together with 10 �l of SYBRgreen mix (Applied Biosystems) and 1.2 �l of each of the forward and reverseoligonucleotide primers. The primers selected were CEK1upRT (TTAGAAATTGTTGGAGAAGGAGCAT), CEK1lowRT (GCAACTTTTTGTTGTGATGGTTTATG), ACT1upRT (TGGTGGTTCTATCTTGGCTTCA), andACT1lowRT (ATCCACATTTGTTGGAAAGTAGA). Transcript levels of agene in a single strain were calculated relative to ACT1 transcript levels byconsidering the amplification efficiencies of the primers (e values) and thecycle numbers at a fixed threshold of fluorescence intensity in the logarithmicphase of amplification (CT values). For each mRNA, mean CT values forreference and target transcripts were determined from three amplificationreactions.

Fluorescence microscopy. Yeast strains were grown at 37°C in SD medium toan OD of 0.8. In the case of treated cells, NaCl was added to the concentrationspecified in the figure legend and the mixture was incubated for 5 min or asindicated. Samples were centrifuged and washed twice with PBS. Cells were fixedwith ice-cold 70% ethanol for 1 min, centrifuged, and washed twice with PBS.DAPI (4�,6�diamidino-2-phenylindole) was added to achieve a final concentra-tion of 2 mg/ml to stain the nucleus. Viable cells were directly observed under themicroscope and challenged with osmotic shock. Fluorescence microscopy wascarried out with a Nikon Eclipse TE2000-U microscope at �100 magnification.Images were captured using a Hamamatsu ORCA-ER charge-coupled-devicecamera and AquaCosmos 1.3 software. All images were processed identicallyusing Adobe Photoshop 7.0.

1236 ROMAN ET AL. EUKARYOT. CELL


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

RESULTS

msb2 mutants have cell wall defects. To analyze the role ofthe MSB2 gene in C. albicans, we used the SAT1 flipper strat-egy that makes use of the dominant nourseothricin SAT1marker (56). 5� and 3� fragments adjacent to the MSB2 ORF(from the 19th Candida assembly) were amplified by PCR andintroduced in the pSF2A vector, thus obtaining the pDMSB2deletion plasmid (see Materials and Methods). We also de-leted the gene in sho1, ssk1, and sho1 ssk1 genetic backgroundsto analyze the relation of MSB2 to these other elements of theHOG pathway in C. albicans (see list of strains in Table 1).

Given the relationship between Sho1 and Msb2 in S. cerevi-siae (16, 90) and the role of Sho1 in the cell wall constructionin C. albicans (77), we tested the phenotype of msb2 anddouble msb2 sho1 mutants treated with compounds that inter-fere with the cell wall. We used both Congo red (a compoundthat interacts with chitin and interferes with cell wall construc-tion) and caspofungin [an inhibitor of the �-(1,3)-glucan syn-thase]. As shown in Fig. 1A, MSB2 deletion resulted in Congored sensitivity (250 �g/ml), a phenotype which is similar to thatobserved for sho1 mutants. Deletion of MSB2 in a sho1 back-ground did not result in enhanced sensitivity, suggesting that

TABLE 1. Strains used in this study

Microorganism Strain Genotype Nomenclature inmanuscript and figures Source

E. coli DH5�F� F� K12� (lacZYA-argF)u169 supE44 thi1 recA1 endA1 hsdR17 gyrA relA1 (Ao80lacZ�M15) 33C. albicans SC5314 29C. albicans CAF-2 ura3�imm434/URA3 wt 26C. albicans RM100 ura3�::imm434/ura3�::imm434his1�::hisG/his1�hisG-URA3-hisG wt 63C. albicans CNC13 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG hog1::hisG/hog1::hisG-URA3-hisG hog1 81C. albicans REP3 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG sho1::hisG/sho1::hisG-URA3-hisG sho1 77C. albicans REP4 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG sho1::hisG/sho1::hisG 77C. albicans REP12 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1::hisG sho1::hisG/sho1::hisG-URA3-hisG sho1 ssk1 77C. albicans CSSK21 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1::hisG-URA3-hisG ssk1 9C. albicans REP14 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG-URA3-hisG

MSB2/msb2�::FRT-FLIP-SAT1-FRTThis work

C. albicans REP15 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG-URA3-hisG MSB2/msb2�FRT This workC. albicans REP16 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG-URA3-hisG

msb2�::FRT/msb2�::FRT-FLIP-SAT1-FRTThis work

C. albicans REP17 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�:: hisG-URA3-hisGmsb2�::FRT/msb2�::FRT

msb2 This work

C. albicans REP18 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG msb2�::FRT/msb2�::FRT This workC. albicans REP19 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG msb2�::FRT/msb2�::FRT

SHO1/sho1::hisG-URA3-hisGThis work

C. albicans REP20 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG msb2�::FRT/msb2�::FRTSHO1/sho1::hisG

This work

C. albicans REP21 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG msb2�::FRT/msb2�::FRTsho1::hisG/sho1::hisG-URA3-hisG

msb2 sho1 This work

C. albicans REP22 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG- msb2�::FRT/msb2�::FRTsho1::hisG/sho1::hisG

This work

C. albicans REP23 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG-URA3-hisGMSB2/msb2�::FRT-FLIP-SAT1-FRT

This work

C. albicans REP24 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG-URA3-hisG MSB2/msb2�::FRT This workC. albicans REP25 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG-URA3-hisG

msb2�::FRT/msb2�::FRT-FLIP-SAT1-FRTThis work

C. albicans REP26 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG-URA3-hisG msb2�::FRT/msb2�::FRT ssk1 msb2 This workC. albicans REP26-u ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG msb2�::FRT/msb2�::FRT This workC. albicans REP27 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG msb2�::FRT/msb2�::FRT

SHO1/sho1::hisG-URA3-hisGThis work

C. albicans REP28 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG msb2�::FRT/msb2�::FRTSHO1/sho1::hisG

This work

C. al�bicans REP29 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG msb2�::FRT/msb2�::FRTsho1::hisG/sho1::hisG–URA3-hisG

ssk1 msb2 sho1 This work

C. albicans REP30 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG msb2�::FRT/msb2�::FRTsho1::hisG/sho1::hisG

This work

C. albicans CASU84 ura3/ura3 CaCDC42/cacdc42::hisG PCK1-CaCDC42::hisG-URA3-hisG 89C. albicans CASU64 ura3/ura3 CaCDC42/cacdc42::hisG PCK1-CaCDC42G12V::hisG-URA3-hisG 89C. albicans CASU69 ura3/ura3 CaCDC42/cacdc42::hisG PCK1-CaCDC42 D118A::hisG-URA3-hisG 89C. albicans CDH25 ura3�::imm434/ura3�::imm434 cst20::hisG/cst20::hisG cst20 46C. albicans CLJ5 ura3�::imm434/ura3�::imm434 cla4::hisG/cla4::hisG cla4 47C. albicans CDH12 ura3�::imm434/ura3�::imm434 hst7::hisG/hst7::hisG hst7 46C. albicans REPc-1 ura3�::imm434/ura3�::imm434 cst20::hisG/cst20::hisG

PCK1-CaCDC42G12V::hisG-URA3-hisGThis work

C. albicans REPc-2 ura3�::imm434/ura3�::imm434 cla4::hisG/cla4::hisGPCK1-CaCDC42G12V::hisG-URA3-hisG

This work

C. albicans REPc-3 ura3�::imm434/ura3�::imm434 hst7::hisG/hst7::hisGPCK1-CaCDC42G12V::hisG-URA3-hisG

This work

C. albicans REPc-4 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG sho1::hisG/sho1::hisGPCK1-CaCDC42G12V::hisG-URA3-hisG

This work

C. albicans REPc-5 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG msb2�::FRT/msb2�::FRTPCK1-CaCDC42G12V::hisG-URA3-hisG

This work

C. albicans REPc-6 ura3�::imm434/ura3�::imm434 his1�::hisG/his1�::hisG msb2�::FRT/msb2�::FRTsho1::hisG/sho1::hisG PCK1-CaCDC42G12V::hisG-URA3-hisG

This work

C. albicans REP30-HG1 ura3�::imm434/ura3�::imm434 ssk1::hisG/ssk1:: hisG msb2�::FRT/msb2�::FRTsho1::hisG/sho1::hisG LEU2/leu2::ACT1PR-HOG1-GFP-URA3

This work

VOL. 8, 2009 ACTIVATION OF THE Cek1 MAP KINASE 1237


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

the two proteins share overlapping roles with respect to thisparticular trait. Under these conditions, however, hog1 cellswere found to be resistant to the drug, in accordance with whathas already been described (1) (Fig. 1A). A lower drug con-centration (125 �g/ml) gave overall similar results (data notshown). We also observed clear behavior by the use of the�-glucan synthesis inhibitor caspofungin (40, 88): msb2 cellsshowed a clearly augmented sensitivity to caspofungin, a phe-notype that was also observed with sho1 cells but that increasedslightly with the double msb2 sho1 mutant (Fig. 1B). This resultsuggested functional differences in the glucan moiety of the cell

wall in msb2 mutants. This led us to test the susceptibility ofcells in liquid culture to zymolyase, a glucanase-enriched en-zymatic cocktail. Cells were allowed to grow in media supple-mented with zymolyase, and we measured the final OD of thecell suspension as indicative of growth. As shown in Fig. 1C,the sho1 and msb2 mutants and the double msb2 sho1 mutantdisplayed higher susceptibility to zymolyase, as evidenced usinga dose of 160 U/ml. Interestingly, the sho1 mutant displayed amore sensitive phenotype than msb2 cells, as evidenced at 80U/ml, under which conditions the reduction of growth of a sho1mutant was more than 50% whereas that of an msb2 single

FIG. 1. Msb2 is involved in cell wall biogenesis. (A and B) Sensitivity of the indicated strains to Congo red (CR) (250 �g/ml) (A) andcaspofungin (20 and 30 ng/ml) (B) after 24 h at 37°C. Samples of 10-fold dilutions from exponentially growing cells were spotted on YEPD platessupplemented with the indicated drug concentrations and incubated at 37°C for 24 h before being scanned. (C) Susceptibility to zymolyase 100T.Values represent percentages of growth in YEPD medium supplemented with zymolyase compared to YEPD medium alone. Mean values aregiven, with bars indicating standard deviations.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

mutant was less than 20% (compare 45% to 85% for sho1 andmsb2 mutants, respectively). This effect was prevented byusing an osmotic stabilizer in the assay (1 M sorbitol) (datanot shown), although the final OD reached was lower for allstrains. These results indicate that the defect in the MSB2and/or SHO1 gene led to measurable defects in cell wall for-mation and suggest that the genes may functionally overlap.

Msb2 controls Cek1 phosphorylation. As Sho1 controls theactivation of Cek1 by phosphorylation in C. albicans (77), wetested whether Msb2 is also involved in Cek1 phosphorylation.We tested this assumption by analyzing the pattern of MAPKactivation after the addition of either Congo red or caspofun-gin to exponentially growing cultures of our strains. The con-centration of these compounds was chosen to minimize theirdeleterious effects on growth while it was still maintained at alevel over the threshold needed to generate a functional re-sponse (data not shown). As shown in Fig. 2A, Congo red (60�g/ml) induced clear Cek1 phosphorylation which was effec-tively blocked in sho1, msb2, and msb2 sho1 mutants. Caspo-fungin (20 ng/ml) also induced Cek1 phosphorylation, and thisprocess was Msb2 and Sho1 dependent, although less intense(3� to 4� less, as determined by densitometry) than thatobserved with Congo red. Caspofungin also induced Mkc1phosphorylation, a result consistent with the role of thisMAPK in the cell integrity pathway (61, 62). However, phos-phorylation of Mkc1 was completely independent of the pres-ence of Msb2 or Sho1 (Fig. 2A), indicating the specificity of theeffect of the presence of Msb2 and Sho1 proteins in Cek1

activation. We also tested an additional experimental condi-tion that results in Cek1 phosphorylation at the restart ofgrowth from stationary phase (77); when stationary phase cellsare diluted in fresh medium, Cek1 becomes quickly phosphor-ylated, being detected as early as 5 min. Stationary-phase cellsshowed no detectable phosphorylated Cek1 despite the pres-ence of Cek1 protein (Fig. 2B) in all strains. After 1 h ofgrowth, Cek1 became quickly phosphorylated in wt cells; Cek1phosphorylation was, however, severely reduced in msb2 cellsand completely blocked in sho1 cells (and also, as expected, inthe double msb2 sho1 mutant). These results indicate thatMsb2 (as well as Sho1) controls Cek1 activation in response todefined experimental conditions that affect the cell wall.

Inhibition of N-glycosylation activates Cek1 in an Msb2-dependent manner. Defects in mannose utilization and/or al-tered protein glycosylation induce the activation of the phero-mone response pathway in S. cerevisiae (measured by theincreased FUS1-lacZ transcription). This process requires mem-bers of the SVG (sterile vegetative growth) pathways and, specif-ically, the Sho1 protein (17). In C. albicans, both cell wall alter-ations associated with mannosylation defects (pmt mutants [70])and tunicamycin-induced altered glycosylation induce the phos-phorylation of Cek1 (10). We determined whether Sho1 andMsb2 could play a role in this process by measuring the pattern ofMAPK activation after treatment with tunicamycin. We testedthe effect of this drug in experiments in which mid exponentialphase cells were grown at 37°C; tunicamycin 5 �g/ml was thenadded and cells were collected after 2 h of additional growth. As

FIG. 2. Msb2 controls the activation of the Cek1 MAPK. (A) Effect of Congo red (CR) and caspofungin at the indicated concentrations on thepattern of Cek1 and Mkc1 MAPK activation (phospho-Cek1 [P-Cek1] and phospho-Mkc1 [P-Mkc1] in the figure) in exponentially growing cells(OD620 1) after 2 h of incubation. Anti-ScHog1 and anti-rabbit-Cek1 antibodies were used for loading protein controls. (B) Cek1 activation(P-Cek1 in the figure) during the resumption of growth from the stationary phase. Cells were diluted in fresh YEPD medium at OD620 0.2 andgrown at 37°C for 1 h. Samples were collected and processed for Western blot analysis.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

shown in Fig. 3A, tunicamycin induced both phosphorylation andsynthesis of Cek1 in wt cells (three- to fivefold, as determined bydensitometry). Phosphorylation—but not synthesis—was almostcompletely dependent on Sho1 and was completely dependent onMsb2 (no activation was observed in the double mutant; notshown). Activation of Cek1 was recovered in a reconstitutedstrain in which an Msb2-HA construct was integrated at theLEU2 locus (not shown). This effect was specific to the Cek1MAPK, whereas Hog1 was not activated during a similar period(not shown) and Hog1 levels remained constant. The increase inCek1 protein levels was shown to be specific to the presence oftunicamycin and independent of that of Sho1/Msb2, and the ad-dition of zymolyase (a �-glucan-enriched enzymatic preparationthat acts on the cell wall) did not have any effect on Cek1 synthesisbut did have an effect on its activation in a Sho1/Msb2-dependentmanner.

As the final targets of MAPK cascades are transcriptionfactors, we wondered whether this pathway could be subjectedto positive transcriptional regulation and whether this wouldbe dependent on P-Cek1. We therefore measured CEK1mRNA levels by qRT-PCR analysis (see Materials and Meth-ods) under these experimental conditions. As shown in Fig. 3B,CEK1 mRNA levels increased in a 2.5- to 3.5-fold range inresponse to the drug (in RM100 and CAF2 wt strains). Thisincrease was independent of Cek1 phosphorylation, as it wasalso found to occur with msb2 and sho1 mutants (2� and 2.5�,respectively), although basal levels were found to be slightlylower in these strains. Collectively, these experiments indicate

that the Cek1-mediated pathway responds to tunicamycin-me-diated glycosylation inhibition by an increase in Cek1 synthesisand phosphorylation, this latter effect being dependent on thepresence of Msb2 and Sho1.

MSB2 deletion prevents Ssk1-mediated Cek1 hyperactiva-tion. Previous results from our group have shown that ssk1(and hog1) mutants display enhanced basal activation of Cek1and that this correlates with their resistance to certain cell wallinhibitors (1, 77). We tried to determine the role of Msb2 inthis cross-talk mechanism. For this reason, we deleted theMSB2 and SHO1 genes in an ssk1 mutant and performedexperiments similar to those described above. While ssk1 cellswere resistant to Congo red, deletion of SHO1 in ssk1 cellsresulted in sensitivity to this compound, indicating that SHO1deletion is dominant over SSK1 in this assay (Fig. 4A). MSB2deletion had also an effect, although less drastic, on Congo redsensitivity in an ssk1 mutant, since its deletion in this back-ground partially abolished the ssk1 resistance to this com-pound but was found to have blocked the enhanced ability ofthe ssk1 cells to grow on caspofungin plates (a result that wassimilar to what was observed with wt cells; Fig. 1B). The mostdrastic sensitivity to caspofungin was observed with a cek1mutant (Fig. 4B). These results reveal important functionaldifferences between Sho1 and Msb2 in terms of signaling thatcould be explained by their differential effects on Cek1 activa-tion. This hypothesis was tested by analyzing the MAPK pat-tern in the resumption of growth from the stationary phase. Asshown in Fig. 4C, Cek1 was clearly activated in wt cells at 1 h

FIG. 3. Tunicamycin activates Cek1 in a MSB2-dependent manner. (A) The effect of tunicamycin (5 �g/ml) or zymolyase 100T (2 U/ml) onCek1 and phospho-Cek1 (P-Cek1) activation was tested on exponentially growing cells (OD620 1) of the indicated strains after 2 h of treatmentat 37°C. (B) CEK1 transcript levels were measured by quantitative PCR. Values represent ratios to untreated CAF-2 levels () for each strain afterincubation with (�) or without () 5 �g of tumicamycin/ml for 2 h in exponentially growing cells (OD620 1). Mean values are given, with barsindicating standard deviation.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

after dilution of the culture. However, sho1 mutants (singleand msb2 background) completely blocked the activation ofCek1, which was undetectable at that time (Fig. 4C) and for anadditional 2 to 3 h (not shown). The behavior of an ssk1 mutantwas consistent with the presence of a derepressed Cek1 signal-ing phenotype, as (i) phosphorylated Cek1 was still detectablein overnight cultures and (ii) both the maximum levels and thelengths of the activation period were increased compared to wtcell results (Fig. 4D). Deletion of MSB2 in a ssk1 backgroundonly partially blocked Cek1 activation, which was still detect-able at 1 and 2 h after growth. Collectively, these results dem-

onstrate that the Ssk1-mediated Cek1 hyperactivation was de-pendent mainly on Sho1 and only partially on Msb2.

Overexpression of Cdc42pG12V hyperactivates Cek1 in aSho1/Msb2/Hst7-dependent manner. Cdc42 is an essentialGTPase of the RAS superfamily (55). Overexpression of mu-tant alleles of this enzyme in C. albicans results in multinucle-ate cells that are either unbudded or multibudded, dependingon the enzymatic activity of the protein (89). However, nodirect evidence has been obtained about the role of this proteinin the activation of the SVG pathway in C. albicans despiteseveral reports that indicate its involvement in polarized and

FIG. 4. MSB2 deletion suppresses Cek1 hyperactivation in ssk1 mutants. (A and B) Sensitivity of the indicated strains on plates supplementedwith Congo red (CR) (250 �g/ml) (A) and caspofungin (20 or 50 ng/ml) (B). Plates were incubated at 37°C for 24 h before being scanned. (C andD) Western blots showing Cek1 phosphorylation (phospho-Cek1 [P-Cek1]) and Cek1 protein during the resumption of growth from the stationaryphase (st) and 1 or 2 h after dilution in fresh YEPD medium at OD620 0.2. Samples were processed as described in Materials and Methods. Thefilm was intentionally overexposed to produce the image presented in panel D.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

pseudohyphal growth in S. cerevisiae. We analyzed the activa-tion of MAPKs during the resumption of growth from thestationary phase in point mutants in which CaCDC42 expres-sion was regulated by the PCK1 promoter (89). These includedthe G12V mutant, which has an intrinsic decreased GTPaseactivity that results in a protein locked in a GTP-bound state(hyperactive), and the D118A mutant, which cannot exchangeGDP with GTP, resulting in a protein locked in the GDP-bound (inactive) state (dominant negative). To assess the effectof the ectopic expression of the PCK1PR-CaCDC42 wt andmutants, cells carrying these constructions (see Table 1) weregrown for 24 h either in liquid YEPD (repressing conditions)or in YNB–2% CAA (inducing conditions) at 37°C, diluted toan OD620 of 0.1 in the same media, and allowed to grow for3 h. Cells were then collected and analyzed for MAPK activa-tion (see Materials and Methods). Under these conditions, thewt and D118A mutant showed a mainly filamentous morphol-ogy, while the G12V mutant displayed several aberrant struc-tures as previously described (89) (data not shown).

As shown in Fig. 5A, Cek1 was hyperphosphorylated com-pared to wt cells when the GTP-bound locked Cdc42 proteinwas overexpressed (the G12V mutant in YNB–2% CAA liquidmedium). In contrast, a signal that was clearly reduced com-pared to that seen with the wt was observed when the inactiveform of Cdc42 (GDP) was overexpressed (D118 mutant allele).No significant differences with respect to the amount of Cek1were found in these extracts. Such effects were mainly detectedunder overexpressing conditions (YNB–2% CAA medium),although in repressing media (YEPD), a faint signal could stillbe detected for Cek1 in the G12V allele (data not shown).Resting stationary-phase cells switched off Cek1 phosphoryla-tion (as previously shown for wt cells [77]); interestingly, how-ever, this happened even with the G12V mutant, suggestingthat dephosphorylation mechanisms are dominant over Cdc42activation. These results indicate that Cdc42 is a mediator ofCek1 phosphorylation.

In order to determine which elements are involved in sig-naling to Cek1, we integrated the PCK1PR-CDC42G12V con-struction in different mutant strains (sho1, msb2, cla4, hst7,cst20, and msb2 sho1) and checked the activation of the path-way under similar sets of inducing conditions (Fig. 5B). Whencells were transfer to YNB–2% CAA medium, no phosphory-lation of Cek1 could be detected when Sho1, Msb2, or Hst7was absent. However, even 15 min after the dilution into freshmedium, Cek1 was detected in a phosphorylated state in cla4and cst20 mutants, suggesting either that these proteins do notparticipate in signaling or that they are redundant in this pro-cess. Interestingly, under these conditions, activation of the cellwall integrity pathway MAPK Mkc1 occurred when Sho1and/or Msb2—but not the Hst7 MAPK kinase—was absent,suggesting that the lack of these upstream mediators of Cek1results in cross-talk toward the cell integrity pathway, maybe asa rescue mechanism. Morphological alterations associated withCDC42G12V expression were still observed for msb2 sho1 mu-tants under these conditions (Fig. 5C), indicating that Cek1activation is not the main kinase responsible of Cdc42-medi-ated morphological effects.

Collectively, these results indicate that Cdc42 may be anupstream mediator of Cek1 activation in C. albicans and im-plicate Sho1, Msb2, and Hst7 proteins in this process.

Msb2 contributes to the osmosensitivity of ssk1 sho1 mu-tants by an Hog1-independent mechanism. Previous work inour laboratory suggested the existence of a third input com-ponent of the HOG pathway in C. albicans, as double sho1 ssk1mutants, which are impaired in the two upstream branches ofthe pathway in S. cerevisiae, are not as osmosensitive as thehog1 mutant (77). This behavior clearly contrasts with whatoccurs in S. cerevisiae, for which a double deletion mutant isosmosensitive (64, 66). We addressed the role of MSB2 inresistance to osmotic stress by spotting exponentially growingcells onto YEPD plates supplemented with different osmolytessuch as sodium chloride and sorbitol at different concentra-tions. As shown in Fig. 6A, deletion of MSB2 did not rendercells osmosensitive and growth of msb2 mutants was quite

FIG. 5. Effect of ectopic expression of hyperactive (G12V) or dom-inant-negative (D118A) CaCDC42 alleles on the Cek1-mediated path-way. (A) Strains CASU64 (ectopic expression of CaCdc42pG12V in theheterozygous disruptant strain CaDH85), CASU69 (ectopic expressionof CaCdc42pD118A in the heterozygous disruptant strain CaDH85), andCASU84 (CDC42wt) were grown overnight either in YEPD medium orin YNB–2% CAA (a medium that induces the PCK1 promoter). Cellswere diluted at OD620 0.1 in the same media and allowed to grow 3 hbefore collection and processing for phospho-Cek1 (P-Cek1) and Cek1detection. (B) Ectopic expression of CaCdc42pG12V in wt and sho1,msb2, msb2 sho1, cla4, hst7, and cst20 mutant cells was induced bygrowing the cells in YNB–2% CAA overnight at 37°C. Cells werediluted in fresh medium at an OD620 of 0.2 and allowed to grow 3 hat 37°C before being processed for Western blotting. (C) Cells (stationaryphase) of the msb2 sho1 mutant with the PCK1-CaCDC42G12V::hisG-URA3-hisG construction integrated were washed with PBS and dilutedinto 2% glucose (for PCK1 promoter repression) or YNB–2% CAAmedium (for PCK1 promoter expression). Cells were photographed after6 h of incubation at 37°C.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

FIG. 6. Osmotic response in msb2 mutants. (A) Exponentially growing cells of the strains indicated were spotted onto YEPD plates supple-mented with 1.5 M sorbitol or 1 M sodium chloride (NaCl). (B) Growth under osmotic stress conditions (1.5 and 2 M NaCl) in liquid media after



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

similar to that of wt cells (RM100 strain) on 1 M NaCl solidYEPD plates. In contrast, the hog1 mutant failed to growunder similar conditions, which is consistent with previouslydescribed results (81). The situation was essentially similar fora different osmolyte (sorbitol), and no effects were observedfor msb2 mutant cells when grown under conditions of 1.5 or 2M (not shown) sorbitol plates (Fig. 6A).

Deletion of MSB2 had no effect on the osmosensitivity ofssk1 or sho1 cells as well, and double mutant ssk1 msb2 or msb2sho1 cells showed behavior similar to that seen with single sho1or ssk1 mutants on solid media. However, the triple ssk1 msb2sho1 mutant displayed significant osmosensitivity that wasclose to that shown by hog1 cells. These effects were alsoreproduced in liquid medium. Cells were grown in 1.5 or 2 MNaCl YEPD medium, and the final OD reached in the station-ary phase was taken as an estimation of their ability to surviveor resist osmotic stress under these conditions. As shown inFig. 6B, sho1, msb2, and msb2 sho1 mutants grew similarly towt cells in 1.5 M NaCl (OD620 8 to 9). The msb2 mutationalso had no effect on the ssk1 background, although the growthseen with ssk1 cells was lower (OD620 5.8 to 6). The SHO1mutation increased the osmosensitivity of ssk1 cells, and dele-tion of MSB2 in this background aggravated this phenotype(OD620 2.32 for sho1 ssk1; OD620 1.85 for ssk1 msb2sho1). Finally, the hog1 mutant showed the most severe phe-notype (OD620 1). Results were qualitatively similar in ex-periments using 2 M NaCl. A reconstituted ssk1 msb2 sho1strain in which an Msb2-HA construct was integrated in theLEU2 locus showed, as expected, a sho1 ssk1 phenotype andwas able to grow in high osmolarity medium (data not shown).These results suggest a role for Msb2 growing under conditionsof high osmolarity that is only evident when both (Ssk1-depen-dent and Sho1-dependent) putative branches of the HOGpathway are impaired. Under these restrictive conditions, thecell morphology was significantly altered. The morphology ofhog1 cells has been described before (1) and consists of fre-quent chained cells that fail to separate. wt cells and sho1 ormsb2 mutants gave rise to slightly elongated cells under con-ditions of high osmolarity (2 M) (not shown). In contrast, thetriple ssk1 msb2 sho1 mutant generated rounded, huge, andalso frequently multibudded cells (Fig. 6C). These effects werealso observed with some cells of the sho1 ssk1 mutant but wereaggravated in ssk1 msb2 sho1 cells. Under these conditions, thecells had a severe cell polarity defect, as revealed by actinstaining, and cytoskeleton polarization was clearly lost (Fig.6C). These results suggest the crucial role that the Sho1 andMsb2 protein complexes play in maintaining the polarizationof the actin cytoskeleton under conditions of hyperosmoticstress.

To further characterize this phenotype, we checked the stateof Hog1 activation under conditions of an osmotic stress chal-

lenge in these mutants during exponential growth. Cells weregrown to an OD620 of 1 and subjected to 0.8, 1, 1.5, or 2 MNaCl for 10 min; cells were then collected and processed toquantify Hog1 activation. Osmotic stress induced Hog1 activa-tion in all strains tested and to similar extents. Surprisingly, thiswas also found to be the case with the triple ssk1 msb2 sho1mutant (Fig. 6D), indicating that deletion of these three puta-tive upstream components of the pathway does not block thetransmission of the signal. In fact, this experiment showed thatthe solute concentration threshold needed to activate the path-way was even slightly lower for the triple mutant, as 1 M NaClactivated the pathway in this mutant but not so strongly in therest of strains (Fig. 6D). We confirmed this result by measuringthe intracellular glycerol concentration following an osmoticshock in a time course assay. Basal glycerol levels were close to0.02 �M/mg (dry weight) for wt, hog1, or ssk1 msb2 sho1 cells.However, accumulation was evident at 4 and 6 h after thechallenge for the wt and the triple mutant (reaching values of0.16 to 0.18 �M/mg) but almost absent for the hog1 mutant(Fig. 6E). In addition, translocation of an Hog1-GFP fusion tothe nucleus was found to occur upon a shift to high osmolaritymedium (Fig. 6F).

These experiments indicated that Hog1 activation is notsufficient to sustain growth under conditions of high osmolaritywhen the Msb2/Sho1/Ssk1 proteins are absent and collectivelyimplicate the Msb2/Sho1 complex in sustaining growth underconditions of high osmolarity by a mechanism that is, appar-ently, not dependent on Hog1 phosphorylation.

Msb2 is involved in invasion on solid media. We tested theeffect of the MSB2 mutation on morphogenesis by the use ofdifferent solid media. On SLAD (nitrogen starvation) medium(30), mutants showed no obvious differences (not shown).When assayed on YPS (sucrose carbon source) medium, wefound msb2 cells to be less filamentous, as evidenced by themorphology of the colony border (Fig. 7A). This was not ob-served with the sho1 mutant but was evident with the msb2sho1 mutants, indicating the dominance of the MSB2 deletion.On YPM (mannitol carbon source) medium (50), msb2 mu-tants showed a clear difference compared to wt cells; whereaswt cells generated filamentous colonies, the absence of Msb2partially suppressed this phenotype (Fig. 7B). This was alsoobserved with the sho1 mutant and the double msb2 sho1mutant. In addition, deletion of MSB2 and/or SHO1 also sup-pressed such effects in an ssk1 background. Thus, the Sho1 andMsb2 proteins partially block filamentous growth on both me-dia. We also tested the effects of MSB2/SHO1 mutations underconditions of hypoxia, as it has been recently shown that theseconditions require a different signaling pathway than aerobic-normoxic conditions (21, 84). This situation probably bettermimics the environment found during host infection, and it wastherefore of interest to determine the role of Msb2 under these

24 h at 37°C. Mean values of final ODs (y axis) are given, with bars indicating the standard deviations. (C) Phalloidin staining of an ssk1 msb2 sho1mutant after 24 h of growth in YEPD medium () or 2 M NaCl–YEPD medium (�). (D) Hog1 MAPK phosphorylation in the presence ofincreasing amounts of NaCl in exponentially growing cells (OD620 1) of the indicated mutants after 10 min of incubation. (E) Internal glycerol(Glyc) quantification of the results of three different experiments after treatment with 1 M NaCl of exponentially growing cells at the timesindicated. (F) An ssk1 msb2 sho1 strain with ACT1PR-HOG1-GFP integrated in the LEU2 locus was grown in SD medium and exposed to 1 M NaClfor 5 min. Cells were fixed, stained with DAPI, and visualized with a fluorescence microscope.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

conditions. During hypoxia in an atmosphere containing 0.2%oxygen and 6% CO2, colonies of msb2 and sho1 mutants indifferent backgrounds contained fewer hyphi compared to wtstrain colonies. In contrast, the ssk1 mutant was hyperfilamen-tous under these conditions (Fig. 7C). Deletion of SHO1 orMSB2 or both in the ssk1 background suppressed the invasion,as assayed by the standard plate washing procedure. Resultsare shown for 30°C, but essentially the same results were ob-served at 37°C (not shown). Although filamentation and inva-sion are different morphogenetic programs, we tested whether

msb2 mutants would be defective in filamentation. We assayedthe behavior of the msb2 mutant at 37°C in YEPD mediumsupplemented with 1%, 5% (not shown), or 10% serum. Cellswere able to form normal filaments under these conditions, andno differences were observed regarding the morphology andlength of filaments, indicating that Msb2 is not required for thedimorphic transition (Fig. 7D). In addition, deletion of MSB2 didnot alter the filamentation pattern of sho1, ssk1, or ssk1 sho1mutants (data not shown). Collectively, these results indicate thatMsb2 is an important mediator of invasion on certain solid media.

FIG. 7. Effect of Msb2 on morphological transitions. Stationary-phase cultures of the indicated strains were collected from exponentiallygrowing cells, washed with PBS, and counted. (A and B) A total of 50 CFU was spread on YPS (sucrose) (A) or YPM (mannitol) (B) plates andincubated at 30°C for 7 to 12 days before the colonies were photographed. (C) Cells were grown in YPS medium under conditions of hypoxia (6%CO2, 0.2% O2). On the indicated days after plating (D�2 and D�2), photographs of the border colony morphology were taken. Colonies werealso eventually washed and photographed. (D) A total of 105 cells of the indicated strains/ml were inoculated in liquid YEPD supplemented with1 and 10% serum or left unsupplemented and were incubated at 37% for 3 h.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

Msb2 is not involved in resistance to oxidative stress orvirulence. Given the involvement of the HOG pathway in C.albicans in oxidative stress resistance and virulence (2, 5), wechecked whether Msb2 could play a significant role in thisprocess. However, the absence of MSB2—either alone (wtbackground) or in combination with other mutations (ssk1 andsho1)—did not significantly alter the resistance of these strainsto hydrogen peroxide or menadione. Activation of Hog1 inmsb2 mutants in response to hydrogen peroxide treatment wasdetectable and similar to that seen with wt cells, whereas suchactivation was absent in ssk1 backgrounds, confirming previousresults that indicate that Ssk1 is the main upstream elementinvolved in the transmission of the oxidative stress signal (11)(not shown). We also tested the virulence of mutants in theupstream components of the HOG pathways in a mouse sys-temic infection model (Fig. 8). msb2 mutants were found to beas virulent as wt cells (at least according to the mean survivaltime parameter). In contrast, sho1 mutants displayed reducedvirulence (40 to 60% survival after 21 days). These differenceswere not the result of altered expression of the URA3 marker,as determined by qRT-PCR (data not shown).

DISCUSSION

In S. cerevisiae, adaptation to high osmolarity depends onthe activation of the Hog1 MAPK (34, 66, 71). In hog1 mu-tants, osmotic stress activates the mating pheromone responseby a process that is partially dependent on the Sho1 membraneprotein. MSB2 was identified as a suppressor of this cross-talkactivity (determined using a FUS1-LACZ gene reporter [65])and was shown later to encode a signaling mucin that is situ-ated upstream of Sho1 and physically interacts with it (16).

We have characterized the role that Msb2 plays in the fungalpathogen C. albicans by the analysis of mutants deleted fromthis gene either alone or in combination with other signalingelements. We present evidence that Msb2 participates in thebiosynthesis of the cell wall and in the invasion of solid surfacesand propose on the basis of two main lines of experimentaldata that this occurs through the activation of the Cek1MAPK. First, deletion of MSB2 results in sensitivity to twocompounds that affect the construction of the fungal cell wall,

namely, Congo red and caspofungin, in similarity to what hasbeen observed in studies of cek1 mutants (23, 77). Congo redis known to bind chitin as well as to inhibit �-(1,3)-glucansynthesis in vitro (80), and resistance or sensitivity to thiscompound has been associated with the activation or deacti-vation of the Cek1 pathway (77). msb2, sho1, msb2 sho1, andcek1 mutants are also sensitive to caspofungin, a compoundthat inhibits glucan synthesis (41), and to zymoliase, a glu-canase-enriched preparation, suggesting a relation of the Cek1pathway to the glucan moiety of the cell wall. Second, deletionof MSB2 blocks Cek1 activation under conditions (Congo redand caspofungin challenge) that involve substantial cell wallstress. As is consistent with this, ssk1 and hog1 mutants, whichhyperactivate Cek1 (1, 77), are more resistant to these com-pounds, and this effect is mostly suppressed by MSB2 and/orSHO1 deletions. This role of Msb2 in Cek1 activation supportsprevious data from our group showing that the Hog1 and Cek1MAPKs play complementary roles in cell wall biogenesis (23)and is in close agreement with recent data in S. cerevisiae, inwhich the FG and HOG pathways mutually regulate eachother (96). While the final effects of Msb2/Sho1 deletion on thecell wall are evident, the triggering molecular mechanisms arepresently unknown. In S. cerevisiae, however, cleavage of theMsb2 protein by the Yps1 aspartyl protease is required forsignaling (90), as this step releases an inhibitory domainpresent in the heavily glycosylated ScMsb2 extracellular do-main (18). Also, defects in glycosylation (pmi40-101 mutants)activate the invasion MAPK pathway (17). Finally, the O-mannosyl transferase PMT4 is involved in Msb2 glycosylation,and tunicamycin inhibition of Msb2 glycosylation results inactivation of the FG pathway MAPK Kss1 in a pmt4 back-ground (96). Therefore, Msb2 seems to behave as a membranesensor which connects the FG and HOG pathways (96). Sucha role may be similar to that played in a C. albicans homolog.CaMsb2 shows little primary similarity to ScMsb2 but shares asimilar overall organization, which consists of a signal peptide(amino acids [aa] 1 to 24), a transmembrane domain (aa 1297to 1319), and internal repeats that lie in the external domain ofthe protein. It could also be the case that CaMsb2 behaves asa sensor monitoring cell wall damage, either by detecting al-tered glycosylation (in response to tunicamycin) or throughindirect independent mechanisms (use of Congo Red, zymo-liase, or caspofungin). Interestingly, increased P-Cek1 basallevels are found in C. albicans pmt1 and pmt4 mutants (10),supporting the notion that these Pmts may be involved in Msb2glycosylation.

Which are the final effectors of this signaling pathway? Oneattractive candidate is the repressor protein Sko1, as this pro-tein mediates caspofungin resistance, and Sko1 levels aredownregulated in hst7 mutants (73); Msb2/Sho1 could ulti-mately influence Psk1, a kinase that regulates Sko1 (73). Itshould be also noted that recent transcriptomal analyses indi-cate that the CEK1 pathway represses the chitinase-encodinggene CHT2 (36), suggesting that cek1 mutants could have alower chitin content. This could contribute to the increasedsensitivity of msb2 and sho1 mutants to caspofungin, as thesetwo polymers play compensatory roles in the cell wall (72) andas their synthesis is coordinated in response to cell wall damage(28, 92). Genetic analysis of the he Cek1 and the Sko1 pathwaymay clarify this point.

FIG. 8. Role of Msb2 in Candida albicans virulence. Survival curvesof BALB/c mice infected systemically with 106 cells of the indicatedstrains of C. albicans.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

We also demonstrate that Cek1 becomes activated uponreceiving an upstream stimulatory signal from the Cdc42GTPase. In C. albicans, activated alleles of the Cdc42 GTPaseare able to activate the Cek1-MAPK pathway via the Hst7MAPK kinase and this process requires both the Sho1 andMsb2 proteins (but not the Cla4 or Cst20 kinases). As deletionof CST20 (but not CLA4) suppresses the lethality associatedwith these alleles in C. albicans (89), activation of this cascadeis not the primary mechanism of cellular death in these mu-tants, suggesting that Cdc42 interacts with other cellular tar-gets, as occurs in S. cerevisiae (39). Although we do not provideevidence here for a direct (i.e., physical) interaction of Sho1with Msb2, our studies suggest that the two proteins act to-gether in cooperation with Cdc42 to promote activation of theCek1 pathway and we have experimental support for the ideaof a Sho1-Cdc42 interaction. It must be emphasized that thephenotypes of sho1 and msb2 are not similar, with Sho1 havingmore drastic effects on Cek1 activation and Msb2 having moredrastic effects on morphogenesis and invasion. This couldmimic the S. cerevisiae situation, where there are both Sho1-dependent and Sho1-independent roles for Msb2 (87). One ofthe main functions of a putative Msb2/Sho1 complex would beto attach the Cdc42 kinase to the membrane to promote inva-sion on solid surfaces via P-Cek1, in close agreement with thephenotypes of cek1 and hst7 (15, 42) (hyphally defective) mu-tants, ssk1 (9) and hog1 (1) mutants, or cpp1 (31) (hyphallyenhanced) mutants. Our results do not eliminate the possibil-ity, however, that another MAPK may also contribute to inva-sion under these conditions. An attractive candidate is Mkc1,the cell integrity pathway MAPK (3, 62), as the route involvingthis MAPK promotes polarized growth in S. cerevisiae (60) andmediates invasion in C. albicans (45). Such cross-talk occursand Cdc42G12V can efficiently mediate the activation of the cellintegrity Mkc1 MAPK when the Msb2/Sho1 proteins are ab-sent. A finding that must be considered in this context is thatwhile caspofungin activates Cek1, equinocandines also activatethe cell integrity pathway via the Mkc1 MAPK (61), althoughthis occurs independently of the putative Msb2/Sho1 complex.

Another important conclusion derived from our work is thatMsb2 contributes to omosensitivity in C. albicans under con-ditions of defined genetic backgrounds. As previously de-scribed, double sho1 hog1 mutants show a more drastic growthdefect under conditions of osmotic stress compared to hog1mutants (77), suggesting a role for Sho1 in osmotic stressindependent of the MAPK. We demonstrate here that deletionof MSB2 in a mutant with the two upstream branches impaired(sho1 ssk1 mutants) seriously compromises growth under con-ditions of high osmolarity (i.e., in the presence of sorbitol andsodium chloride). In S. cerevisiae, the simultaneous deletion ofSSK1 and SHO1 results in a failure to activate the Hog1MAPK (64) upon osmotic stress challenge. However, and insharp contrast to the results of experiments with S. cerevisiae,CaHog1 phosphorylation is not blocked in an ssk1 msb2 sho1mutant. Furthermore, CaHog1 is efficiently translocated to thenucleus (as determined using a GFP-Hog1 fusion [4]) andleads to accumulation of glycerol, a compatible solute in thisorganism (81). It has been recently shown that CaHog1 isregulated by the MAPKKK Ssk2 only under conditions ofstress (13). Ssk2—but not Ste11—appears to be essential forthe activation of the Hog1 MAPK in response to osmotic and

oxidative stress and its translocation to the nucleus, suggestingthat the putative Sho1/Msb2-Ste11 complex has no apparentrole in signaling for the HOG pathway. Our results clearlysupport this model and indicate that other as-yet-undefinedupstream components feed into the Ssk2 MAPKKK. It is in-teresting that in S. cerevisiae, two proteins, Hkr1 and Msb2, areinvolved in growth under conditions of high osmolarity (87).Hkr1, however, seems to be specialized with respect to theHOG pathway, whereas Msb2 is involved in the FG pathway(67). Therefore, although both proteins interact with Sho1,they are specialized for specific responses. The existence of aC. albicans Hkr1 homolog could partially account for the dif-ferences in phenotypes attributed to Sho1 and Msb2.

Importantly, we demonstrate that activation of Hog1 in C.albicans is not sufficient to sustain growth under conditions ofhigh osmolarity. Different explanations, such as differences intranscriptional responses between ssk1 msb2 sho1 and hog1mutants (in terms of quality or quantity of genes differentiallyexpressed and/or levels attained) or even an inconvenientlydeveloped (spatial or temporal) adaptive response, can be in-voked to explain this behavior. In S. cerevisiae, for example,Msb2 and Sho1 are localized to regions of polarized growth(16, 71), where they promote Hog1 activation. A putativeMsb2/Sho1 complex could be involved in the maintenance ofthe cellular polarity necessary for growth under restrictive con-ditions in C. albicans. A more novel mechanism explaining therole of Msb2 in osmotic stress could involve differential local-ization. In S. cerevisiae, Msb2 is cleaved by the Yps1 aspartylprotease (90) to activate the MAPK pathway. This processmimics the situation with the MUC1 mammalian homologue(49), whose cytoplasmic tail associates with �-catenin (93) andlocalizes to the nucleus, promoting gene expression. It istempting to speculate that CaMsb2 could be similarly pro-cessed, as a similar cleavage domain exists (approximately 170aa in a C-terminal domain) in the protein, with aspartyl pro-teases (37, 58) being testable candidates.

In conclusion, our results support a model in which Msb2would be involved in invasive growth and cell wall biosynthesisin C. albicans via the Cek1 MAPK. Our results also provideexperimental support for a functional specialization of thisbranch in filamentous fungi, as recently suggested (43, 44).Such a scenario is in agreement with recent results that showhow changes in turgor in S. cerevisiae activate the HOG path-way via the SLN1 and not the SHO1 branch (74) and that in C.albicans Ssk2 is the only MAPKKK signaling to Hog1 (13).They also indicate that the signaling mucin Msb2 is involved ingrowth under conditions of high osmolarity in C. albicans (andmaybe other fungi) by a mechanism that is independent of theactivation of the Hog1 MAPK.

ACKNOWLEDGMENTS

We thank M. Whiteway for sharing strains and Cdc42 gene con-structions and J. Morshchausser for plasmid pSFS2A.

This work was supported by grants BIO2006-03637 and GEN2006-27775-C2-1-EPAT to J.P. and EU project “Galar Fungail II” (MRTN-CT-2003-504148) and by a grant from the Deutsche Forschungsge-meinschaft (SFB590 and DFG priority program 1160) to J.F.E.

REFERENCES

1. Alonso-Monge, R., F. Navarro-García, G. Molero, R. Diez-Orejas, M. Gus-tin, J. Pla, M. Sanchez, and C. Nombela. 1999. Role of the mitogen-activated



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

protein kinase Hog1p in morphogenesis and virulence of Candida albicans.J. Bacteriol. 181:3058–3068.

2. Alonso-Monge, R., F. Navarro-García, E. Roman, A. I. Negredo, B. Eisman,C. Nombela, and J. Pla. 2003. The Hog1 mitogen-activated protein kinase isessential in the oxidative stress response and chlamydospore formation inCandida albicans. Eukaryot. Cell 2:351–361.

3. Alonso-Monge, R., E. Roman, C. Nombela, and J. Pla. 2006. The MAPkinase signal transduction network in Candida albicans. Microbiology 152:905–912.

4. Arana, D. M., C. Nombela, R. Alonso-Monge, and J. Pla. 2005. The Pbs2MAP kinase kinase is essential for the oxidative-stress response in the fungalpathogen Candida albicans. Microbiology 151:1033–1049.

5. Arana, D. M., R. Alonso-Monge, C. Du, R. Calderone, and J. Pla. 2007.Differential susceptibility of mitogen-activated protein kinase pathway mu-tants to oxidative-mediated killing by phagocytes in the fungal pathogenCandida albicans. Cell. Microbiol. 9:1647–1659.

6. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 1993. Current protocols in molecular biology. GreenePublishing Associates and Wiley Interscience, New York, NY.

7. Bender, A., and J. R. Pringle. 1992. A Ser/Thr-rich multicopy suppressor ofa cdc24 bud emergence defect. Yeast 8:315–323.

8. Brown, D. H., Jr., A. D. Giusani, X. Chen, and C. A. Kumamoto. 1999.Filamentous growth of Candida albicans in response to physical environmen-tal cues and its regulation by the unique CZF1 gene. Mol. Microbiol. 34:651–662.

9. Calera, J. A., X. J. Zhao, and R. Calderone. 2000. Defective hyphal devel-opment and avirulence caused by a deletion of the SSK1 response regulatorgene in Candida albicans. Infect. Immun. 68:518–525.

10. Cantero, P., C. Lengsfeld, M. Subanovic, E. Roman, J. Pla, and J. Ernst.2007. Transcriptional and physiological adaptation to defective protein-O-mannosylation in Candida albicans. Mol. Microbiol. 64:1115–1128.

11. Chauhan, N., D. Inglis, E. Roman, J. Pla, D. Li, J. A. Calera, and R.Calderone. 2003. Candida albicans response regulator gene SSK1 regulates asubset of genes whose functions are associated with cell wall biosynthesis andadaptation to oxidative stress. Eukaryot. Cell 2:1018–1024.

12. Chauhan, N., J. P. Latge, and R. Calderone. 2006. Signalling and oxidantadaptation in Candida albicans and Aspergillus fumigatus. Nat. Rev. Micro-biol. 4:435–444.

13. Cheetham, J., D. A. Smith, D. A. da Silva, K. S. Doris, M. J. Patterson, C. R.Bruce, and J. Quinn. 2007. A Single MAPKKK regulates the Hog1 MAPKpathway in the pathogenic fungus Candida albicans. Mol. Biol. Cell 18:4603–4614.

14. Csank, C., C. Makris, S. Meloche, K. Schroppel, M. Rollinghoff, D. Dignard,D. Y. Thomas, and M. Whiteway. 1997. Derepressed hyphal growth andreduced virulence in a VH1 family-related protein phosphatase mutant ofthe human pathogen Candida albicans. Mol. Biol. Cell 8:2539–2551.

15. Csank, C., K. Schroppel, E. Leberer, D. Harcus, O. Mohamed, S. Meloche,D. Y. Thomas, and M. Whiteway. 1998. Roles of the Candida albicansmitogen-activated protein kinase homolog, Cek1p, in hyphal developmentand systemic candidiasis. Infect. Immun. 66:2713–2721.

16. Cullen, P. J., W. Sabbagh, Jr., E. Graham, M. M. Irick, E. K. van Olden, C.Neal, J. Delrow, L. Bardwell, and G. F. Sprague, Jr. 2004. A signaling mucinat the head of the Cdc42- and MAPK-dependent filamentous growth path-way in yeast. Genes Dev. 18:1695–1708.

17. Cullen, P. J., J. Schultz, J. Horecka, B. J. Stevenson, Y. Jigami, and G. F.Sprague, Jr. 2000. Defects in protein glycosylation cause SHO1-dependentactivation of a STE12 signaling pathway in yeast. Genetics 155:1005–1018.

18. Cullen, P. J., R. Xu-Friedman, J. Delrow, and G. F. Sprague. 2006. Genome-wide analysis of the response to protein glycosylation deficiency in yeast.FEMS Yeast Res. 6:1264–1273.

19. de Nadal, E., P. M. Alepuz, and F. Posas. 2002. Dealing with osmostressthrough MAP kinase activation. EMBO Rep. 3:735–740.

20. Diez-Orejas, R., G. Molero, F. Navarro-García, J. Pla, C. Nombela, and M.Sanchez-Perez. 1997. Reduced virulence of Candida albicans MKC1 mu-tants: a role for a mitogen-activated protein kinase in pathogenesis. Infect.Immun. 65:833–837.

21. Doedt, T., S. Krishnamurthy, D. P. Bockmuhl, B. Tebarth, C. Stempel, C. L.Russell, A. J. Brown, and J. F. Ernst. 2004. APSES proteins regulate mor-phogenesis and metabolism in Candida albicans. Mol. Biol. Cell 15:3167–3180.

22. Du, C., R. Calderone, J. Richert, and D. Li. 2005. Deletion of the SSK1response regulator gene in Candida albicans contributes to enhanced killingby human polymorphonuclear neutrophils. Infect. Immun. 73:865–871.

23. Eisman, B., R. Alonso-Monge, E. Roman, D. M. Arana, C. Nombela, and J.Pla. 2006. The Cek1 and Hog1 mitogen-activated protein kinases play com-plementary roles in cell wall biogenesis and chlamydospore formation in thefungal pathogen Candida albicans. Eukaryot. Cell 5:347–358.

24. Enjalbert, B., D. A. Smith, M. J. Cornell, I. Alam, S. Nicholls, A. J. Brown,and J. Quinn. 2006. Role of the Hog1 stress-activated protein kinase in theglobal transcriptional response to stress in the fungal pathogen Candidaalbicans. Mol. Biol. Cell 17:1018–1032.

25. Ernst, J. F. 2000. Transcription factors in Candida albicans—environmentalcontrol of morphogenesis. Microbiology 146:1763–1774.

26. Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and genemapping in Candida albicans. Genetics 134:717–728.

27. Gantner, B. N., R. M. Simmons, and D. M. Underhill. 2005. Dectin-1 me-diates macrophage recognition of Candida albicans yeast but not filaments.EMBO J. 24:1277–1286.

28. García, R., C. Bermejo, C. Grau, R. Perez, J. M. Rodriguez-Pena, J. Fran-cois, C. Nombela, and J. Arroyo. 2004. The global transcriptional response totransient cell wall damage in Saccharomyces cerevisiae and its regulation bythe cell integrity signaling pathway. J. Biol. Chem. 279:15183–15195.

29. Gillum, A. M., E. Y. H. Tsay, and D. R. Kirsch. 1984. Isolation of theCandida albicans gene for orotidine-5�-phosphate decarboxylase by comple-mentation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet.198:179–182.

30. Gimeno, C. J., P. O. Ljungdahl, C. A. Styles, and G. R. Fink. 1992. Unipolarcell divisions in the yeast S. cerevisiae lead to filamentous growth: regulationby starvation and RAS. Cell 68:1077–1090.

31. Guhad, F. A., C. Csank, H. E. Jensen, D. Y. Thomas, M. Whiteway, and J.Hau. 1998. Reduced pathogenicity of a Candida albicans MAP kinase phos-phatase (CPP1) mutant in the murine mastitis model. APMIS 106:1049–1055.

32. Guhad, F. A., H. E. Jensen, B. Aalbaek, C. Csank, O. Mohamed, D. Harcus,D. Y. Thomas, M. Whiteway, and J. Hau. 1998. Mitogen-activated proteinkinase-defective Candida albicans is avirulent in a novel model of localizedmurine candidiasis. FEMS Microbiol. Lett. 166:135–139.

33. Hanahan, D. 1988. Techniques for transformation of E. coli, p. 109–135. InD. M. Glover (ed.), DNA cloning. IRL Press, Oxford, United Kingdom.

34. Hohmann, S. 2002. Osmotic stress signaling and osmoadaptation in yeasts.Microbiol. Mol. Biol. Rev. 66:300–372.

35. Horie, T., K. Tatebayashi, R. Yamada, and H. Saito. 2008. PhosphorylatedSsk1 prevents unphosphorylated Ssk1 from activating the Ssk2 MAP kinasekinase kinase in the yeast HOG osmoregulatory pathway. Mol. Cell. Biol.28:5172–5183.

36. Huang, H., D. Harcus, and M. Whiteway. 2008. Transcript profiling of aMAP kinase pathway in C. albicans. Microbiol. Res. 163:380–393.

37. Hube, B., and J. Naglik. 2001. Candida albicans proteinases: resolving themystery of a gene family. Microbiology 147:1997–2005.

38. Jimenez, J., V. J. Cid, R. Cenamor, M. Yuste, G. Molero, C. Nombela, andM. Sanchez. 1998. Morphogenesis beyond cytokinetic arrest in Saccharomy-ces cerevisiae. J. Cell Biol. 143:1617–1634.

39. Johnson, D. I. 1999. Cdc42: an essential Rho-type GTPase controlling eu-karyotic cell polarity. Microbiol. Mol. Biol. Rev. 63:54–105.

40. Johnson, M. D., and J. R. Perfect. 2003. Caspofungin: first approved agent ina new class of antifungals. Expert Opin. Pharmacother. 4:807–823.

41. Kartsonis, N. A., J. Nielsen, and C. M. Douglas. 2003. Caspofungin: the firstin a new class of antifungal agents. Drug Resist. Updat. 6:197–218.

42. Kohler, J., and G. R. Fink. 1996. Candida albicans strains heterozygous andhomozygous for mutations in mitogen-activated protein kinase signalingcomponents have defects in hyphal development. Proc. Natl. Acad. Sci. USA93:13223–13228.

43. Krantz, M., E. Becit, and S. Hohmann. 2006. Comparative analysis of HOGpathway proteins to generate hypotheses for functional analysis. Curr.Genet. 49:152–165.

44. Krantz, M., E. Becit, and S. Hohmann. 2006. Comparative genomics of theHOG-signalling system in fungi. Curr. Genet. 49:137–151.

45. Kumamoto, C. A. 2005. A contact-activated kinase signals Candida albicansinvasive growth and biofilm development. Proc. Natl. Acad. Sci. USA 102:5576–5581.

46. Leberer, E., D. Harcus, I. D. Broadbent, K. L. Clark, D. Dignard, K.Ziegelbauer, A. Schmidt, N. A. R. Gow, A. J. P. Brown, and D. Y. Thomas.1996. Signal transduction through homologs of the Ste20p and Ste7p proteinkinases can trigger hyphal formation in the pathogenic fungus Candidaalbicans. Proc. Natl. Acad. Sci. USA 93:13217–13222.

47. Leberer, E., K. Ziegelbauer, A. Schmidt, D. Harcus, D. Dignard, J. Ash, L.Johnson, and D. Y. Thomas. 1997. Virulence and hyphal formation of Can-dida albicans require the Ste20p-like protein kinase CaCla4p. Curr. Biol.7:539–546.

48. Li, S., A. Ault, C. L. Malone, D. Raitt, S. Dean, L. H. Johnston, R. J.Deschenes, and J. S. Fassler. 1998. The yeast histidine protein kinase, Sln1p,mediates phosphotransfer to two response regulators, Ssk1p and Skn7p.EMBO J. 17:6952–6962.

49. Li, X. S., M. S. Reddy, D. Baev, and M. Edgerton. 2003. Candida albicansSsa1/2p is the cell envelope binding protein for human salivary histatin 5.J. Biol. Chem. 278:28553–28561.

50. Liu, H., J. Kohler, and G. R. Fink. 1994. Suppression of hyphal formation inCandida albicans by mutation of a STE12 homolog. Science 266:1723–1726.

51. Lo, H. J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti, andG. R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell90:939–949.

52. Maeda, T., M. Takekawa, and H. Saito. 1995. Activation of yeast PBS2



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

MAPKK by MAPKKKs or by binding of an SH3-containing osmosensor.Science 269:554–558.

53. Marles, J. A., S. Dahesh, J. Haynes, B. J. Andrews, and A. R. Davidson. 2004.Protein-protein interaction affinity plays a crucial role in controlling theSho1p-mediated signal transduction pathway in yeast. Mol. Cell 14:813–823.

54. Martín, H., J. M. Rodriguez-Pachon, C. Ruiz, C. Nombela, and M. Molina.2000. Regulatory mechanisms for modulation of signaling through the cellintegrity Slt2-mediated pathway in Saccharomyces cerevisiae. J. Biol. Chem.275:1511–1519.

55. Michel, S., S. Ushinsky, B. Klebl, E. Leberer, D. Thomas, M. Whiteway, andJ. Morschhauser. 2002. Generation of conditional lethal Candida albicansmutants by inducible deletion of essential genes. Mol. Microbiol. 46:269–280.

56. Morschhauser, J., P. Staib, and G. Kohler. 2005. Targeted gene deletion inCandida albicans wild-type strains by MPAR flipping. Methods Mol. Med.118:35–44.

57. Murakami, Y., K. Tatebayashi, and H. Saito. 2008. Two adjacent dockingsites in the yeast Hog1 mitogen-activated protein (MAP) kinase differentiallyinteract with the Pbs2 MAP kinase kinase and the Ptp2 protein tyrosinephosphatase. Mol. Cell. Biol. 28:2481–2494.

58. Naglik, J., A. Albrecht, O. Bader, and B. Hube. 2004. Candida albicansproteinases and host/pathogen interactions. Cell. Microbiol. 6:915–926.

59. Nantel, A., D. Dignard, C. Bachewich, D. Harcus, A. Marcil, A. P. Bouin,C. W. Sensen, H. Hogues, H. M. Van Het, P. Gordon, T. Rigby, F. Benoit,D. C. Tessier, D. Y. Thomas, and M. Whiteway. 2002. Transcription profilingof Candida albicans cells undergoing the yeast-to-hyphal transition. Mol.Biol. Cell 13:3452–3465.

60. Navarro-García, F., R. Alonso-Monge, H. Rico, J. Pla, R. Sentandreu, and C.Nombela. 1998. A role for the MAP kinase gene MKC1 in cell wall construc-tion and morphological transitions in Candida albicans. Microbiology 144:411–424.

61. Navarro-Garcia, F., B. Eisman, S. M. Fiuza, C. Nombela, and J. Pla. 2005.The MAP kinase Mkc1p is activated under different stress conditions inCandida albicans. Microbiology 151:2737–2749.

62. Navarro-García, F., M. Sanchez, J. Pla, and C. Nombela. 1995. Functionalcharacterization of the MKC1 gene of Candida albicans, which encodes amitogen-activated protein kinase homolog related to cell integrity. Mol. Cell.Biol. 15:2197–2206.

63. Negredo, A., L. Monteoliva, C. Gil, J. Pla, and C. Nombela. 1997. Cloning,analysis and one-step disruption of the ARG5,6 gene of Candida albicans.Microbiol. 143:297–302.

64. O’Rourke, S. M., and I. Herskowitz. 2002. A third osmosensing branch inSaccharomyces cerevisiae requires the Msb2 protein and functions in parallelwith the Sho1 branch. Mol. Cell. Biol. 22:4739–4749.

65. O’Rourke, S. M., and I. Herskowitz. 1998. The Hog1 MAPK prevents crosstalk between the HOG and pheromone response MAPK pathways in Sac-charomyces cerevisiae. Genes Dev. 12:2874–2886.

66. O’Rourke, S. M., I. Herskowitz, and E. K. O’Shea. 2002. Yeast go the wholeHOG for the hyperosmotic response. Trends Genet. 18:405–412.

67. Pitoniak, A., B. Birkaya, H. S. Dionne, N. Vadiae, and P. J. Cullen. Thesignaling mucins Msb2 and Hkr1 differentially regulate the filamentationMAPK pathway and contribute to a multimodal response. Mol. Biol. Cell, inpress.

68. Posas, F., and H. Saito. 1998. Activation of the yeast SSK2 MAP kinasekinase kinase by the SSK1 two-component response regulator. EMBO J.17:1385–1394.

69. Posas, F., S. M. Wurgler-Murphy, T. Maeda, E. A. Witten, T. C. Thai, andH. Saito. 1996. Yeast HOG1 MAP kinase cascade is regulated by a multistepphosphorelay mechanism in the SLN1-YPD1-SSK1 “two-component” osmo-sensor. Cell 86:865–875.

70. Prill, S. K., B. Klinkert, C. Timpel, C. A. Gale, K. Schroppel, and J. F. Ernst.2005. PMT family of Candida albicans: five protein mannosyltransferaseisoforms affect growth, morphogenesis and antifungal resistance. Mol. Mi-crobiol. 55:546–560.

71. Raitt, D. C., F. Posas, and H. Saito. 2000. Yeast Cdc42 GTPase and Ste20PAK-like kinase regulate Sho1-dependent activation of the Hog1 MAPKpathway. EMBO J. 19:4623–4631.

72. Ram, A. F., J. C. Kapteyn, R. C. Montijn, L. H. Caro, J. E. Douwes, W.Baginsky, P. Mazur, E. H. van den, and F. M. Klis. 1998. Loss of the plasmamembrane-bound protein Gas1p in Saccharomyces cerevisiae results in therelease of �-1,3-glucan into the medium and induces a compensation mech-anism to ensure cell wall integrity. J. Bacteriol. 180:1418–1424.

73. Rauceo, J. M., J. R. Blankenship, S. Fanning, J. J. Hamaker, J. S. Deneault,F. J. Smith, A. Nantel, and A. P. Mitchell. 2008. Regulation of the Candidaalbicans cell wall damage response by transcription factor Sko1 and PASkinase Psk1. Mol. Biol. Cell 19:2741–2751.

74. Reiser, V., D. C. Raitt, and H. Saito. 2003. Yeast osmosensor Sln1 and plantcytokinin receptor Cre1 respond to changes in turgor pressure. J. Cell Biol.161:1035–1040.

75. Reuss, O., A. Vik, R. Kolter, and J. Morschhauser. 2004. The SAT1 flipper,an optimized tool for gene disruption in Candida albicans. Gene 341:119–127.

76. Roman, E., D. M. Arana, C. Nombela, R. Alonso-Monge, and J. Pla. 2007.MAP kinase pathways as regulators of fungal virulence. Trends Microbiol.15:181–190.

77. Roman, E., C. Nombela, and J. Pla. 2005. The Sho1 adaptor protein linksoxidative stress to morphogenesis and cell wall biosynthesis in the fungalpathogen Candida albicans. Mol. Cell. Biol. 25:10611–10627.

78. Romani, L. 2004. Immunity to fungal infections. Nat. Rev. Immunol. 4:1–23.79. Romani, L., F. Bistoni, and P. Puccetti. 2003. Adaptation of Candida albi-

cans to the host environment: the role of morphogenesis in virulence andsurvival in mammalian hosts. Curr. Opin. Microbiol. 6:338–343.

80. Roncero, C., and A. Duran. 1985. Effect of Calcofluor white and Congo redon fungal cell wall morphogenesis: in vivo activation of chitin polymerization.J. Bacteriol. 163:1180–1185.

81. San Jose, C., R. Alonso-Monge, R. M. Perez-Díaz, J. Pla, and C. Nombela.1996. The mitogen-activated protein kinase homolog HOG1 gene controlsglycerol accumulation in the pathogenic fungus Candida albicans. J. Bacte-riol. 178:5850–5852.

82. Saville, S. P., A. L. Lazzell, C. Monteagudo, and J. L. Lopez-Ribot. 2003.Engineered control of cell morphology in vivo reveals distinct roles for yeastand filamentous forms of Candida albicans during infection. Eukaryot. Cell2:1053–1060.

83. Schroppel, K., K. Sproßer, M. Whiteway, D. Y. Thomas, M. Rollinghoff, andC. Csank. 2000. Repression of hyphal proteinase expression by the mitogen-activated protein (MAP) kinase phosphatase Cpp1p of Candida albicans isindependent of the MAP kinase Cek1p. Infect. Immun. 68:7159–7161.

84. Setiadi, E. R., T. Doedt, F. Cottier, C. Noffz, and J. F. Ernst. 2006. Tran-scriptional response of Candida albicans to hypoxia: linkage of oxygen sens-ing and Efg1p-regulatory networks. J. Mol. Biol. 361:399–411.

85. Stoldt, V. R., A. Sonneborn, C. E. Leuker, and J. F. Ernst. 1997. Efg1p, anessential regulator of morphogenesis of the human pathogen Candida albi-cans, is a member of a conserved class of bHLH proteins regulating mor-phogenetic processes in fungi. EMBO J. 16:1982–1991.

86. Tao, W., C. L. Malone, A. D. Ault, R. J. Deschenes, and J. S. Fassler. 2002.A cytoplasmic coiled-coil domain is required for histidine kinase activity ofthe yeast osmosensor, SLN1. Mol. Microbiol. 43:459–473.

87. Tatebayashi, K., K. Tanaka, H. Y. Yang, K. Yamamoto, Y. Matsushita, T.Tomida, M. Imai, and H. Saito. 2007. Transmembrane mucins Hkr1 andMsb2 are putative osmosensors in the SHO1 branch of yeast HOG pathway.EMBO J. 26:3521–3533.

88. Turner, M. S., R. H. Drew, and J. R. Perfect. 2006. Emerging echinocandinsfor treatment of invasive fungal infections. Expert Opin. Emerg. Drugs11:231–250.

89. Ushinsky, S. C., D. Harcus, J. Ash, D. Dignard, A. Marcil, J. Morchhauser,D. Y. Thomas, M. Whiteway, and E. Leberer. 2002. CDC42 is required forpolarized growth in human pathogen Candida albicans. Eukaryot. Cell 1:95–104.

90. Vadaie, N., H. Dionne, D. S. Akajagbor, S. R. Nickerson, D. J. Krysan, andP. J. Cullen. 2008. Cleavage of the signaling mucin Msb2 by the aspartylprotease Yps1 is required for MAPK activation in yeast. J. Cell Biol. 181:1073–1081.

91. Vazquez-Torres, A., and E. Balish. 1997. Macrophages in resistance to can-didiasis. Microbiol. Mol. Biol. Rev. 61:170–192.

92. Walker, L. A., C. A. Munro, I. de Bruijn, M. D. Lenardon, A. McKinnon, andN. A. Gow. 2008. Stimulation of chitin synthesis rescues Candida albicansfrom echinocandins. PLoS Pathog. 4:e1000040.

93. Wen, Y., T. C. Caffrey, M. J. Wheelock, K. R. Johnson, and M. A. Holling-sworth. 2003. Nuclear association of the cytoplasmic tail of MUC1 andbeta-catenin. J. Biol. Chem. 278:38029–38039.

94. Whiteway, M., and C. Bachewich. 2007. Morphogenesis in Candida albicans.Annu. Rev. Microbiol. 61:529–553.

95. Whiteway, M., and U. Oberholzer. 2004. Candida morphogenesis and host-pathogen interactions. Curr. Opin. Microbiol. 7:350–357.

96. Yang, H. Y., K. Tatebayashi, K. Yamamoto, and H. Saito. 2009. Glycosyla-tion defects activate filamentous growth Kss1 MAPK and inhibit osmoreg-ulatory Hog1 MAPK. EMBO J. 28:1380–1391.

97. Zarrinpar, A., R. P. Bhattacharyya, M. P. Nittler, and W. A. Lim. 2004. Sho1and Pbs2 act as coscaffolds linking components in the yeast high osmolarityMAP kinase pathway. Mol. Cell 14:825–832.

98. Zarrinpar, A., S. H. Park, and W. A. Lim. 2003. Optimization of specificityin a cellular protein interaction network by negative selection. Nature 426:676–680.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

Documents

Msb2 Signaling Mucin Controls Activation of Cek1 Mitogen ... · EUKARYOTIC CELL, Aug. 2009, p. 1235–1249 Vol. 8, No. 8 1535-9778/09/$08.000 doi:10.1128/EC.00081-09 Copyright ©