8/22/2019 Molecular Basis of Inheritance Test Paper.

1/1

HSE II UNIT TEST -II Time.1hrsZOOLOGY Marks.30

1. The sequence of coding strand in a transcription unit

is written as follows:

5 ATGCATGCATGCATGCATGC 3

Write down the sequence of m RNA (1)

2.

The above figure is the representation of lac operon inE.coli

a) Name the components of lac operon.

b) Name the substance which acts as inducer.c) Explain what happens when inducer is present

in the medium of E.colid)Name the enzyme denoted by A,B & C (4)

3. The length of DNA is far greater than the

dimension of the nucleus. Mention how the DNA is

packed within the cell. (1)

4.Three DNA samples from a crime scene is given

below. (4)

DNA of Ramu DNA of Rajesh

Sample DNA collected from the crime scene

a) Identify the culprit

b) Which technique helped you to identify the culprit ?

c) What is the principle behind the above technique ?

d) What are important steps involved in the technique

5. Name A, B, C & D (1)

6. 11. Mention the functions

(4)

a) Operator gene b)DNA polymerase

c) DNA ligase d) Restriction endonuclease

7. Human Genome Project is a mega project infavour

of Mankind

a) Why HGP is called as a mega project ?

b) What are the goals of this project ?

c) List any four salient features of HGP. (5)8. Schematic structure of a transcription unit is given

below .Identify A, B, C &D (2

9. Observe the diagram and answer the following

questions.

a) Name the above experiment

b) What is the importance of this experiment.?c) What are the steps involved in this experiment ?

(4)

10. . Observe the diagram and answer the following

questions

a) Name the process shown in the above diagram.

b) Differentiate exons from introns.

c) Compare the above process with Prokaryotes. (4)