Microarray profiling reveals suppressed interferon ... Open Access Microarray profiling reveals suppressed…

  • Published on
    23-Jun-2018

  • View
    212

  • Download
    0

Embed Size (px)

Transcript

<ul><li><p>Lindahl et al. Respiratory Research 2013, 14:80http://respiratory-research.com/content/14/1/80</p><p>RESEARCH Open Access</p><p>Microarray profiling reveals suppressed interferonstimulated gene program in fibroblasts fromscleroderma-associated interstitial lung diseaseGisela E Lindahl1*, Carmel JW Stock1, Xu Shi-Wen2, Patricia Leoni1, Piersante Sestini3, Sarah L Howat4,George Bou-Gharios5, Andrew G Nicholson6, Christopher P Denton2, Jan C Grutters7, Toby M Maher1,Athol U Wells1, David J Abraham2 and Elisabetta A Renzoni1</p><p>Abstract</p><p>Background: Interstitial lung disease is a major cause of morbidity and mortality in systemic sclerosis (SSc), withinsufficiently effective treatment options. Progression of pulmonary fibrosis involves expanding populations offibroblasts, and the accumulation of extracellular matrix proteins. Characterisation of SSc lung fibroblast geneexpression profiles underlying the fibrotic cell phenotype could enable a better understanding of the processesleading to the progressive build-up of scar tissue in the lungs. In this study we evaluate the transcriptomes offibroblasts isolated from SSc lung biopsies at the time of diagnosis, compared with those from control lungs.</p><p>Methods: We used Affymetrix oligonucleotide microarrays to compare the gene expression profile of pulmonaryfibroblasts cultured from 8 patients with pulmonary fibrosis associated with SSc (SSc-ILD), with those from controllung tissue peripheral to resected cancer (n=10). Fibroblast cultures from 3 patients with idiopathic pulmonaryfibrosis (IPF) were included as a further comparison. Genes differentially expressed were identified using twoseparate analysis programs following a set of pre-determined criteria: only genes significant in both analyses wereconsidered. Microarray expression data was verified by qRT-PCR and/or western blot analysis.</p><p>Results: A total of 843 genes were identified as differentially expressed in pulmonary fibroblasts from SSc-ILD and/or IPF compared to control lung, with a large overlap in the expression profiles of both diseases. We observedincreased expression of a TGF- response signature including fibrosis associated genes and myofibroblast markers,with marked heterogeneity across samples. Strongly suppressed expression of interferon stimulated genes,including antiviral, chemokine, and MHC class 1 genes, was uniformly observed in fibrotic fibroblasts. Thisexpression profile includes key regulators and mediators of the interferon response, such as STAT1, and CXCL10, andwas also independent of disease group.</p><p>Conclusions: This study identified a strongly suppressed interferon-stimulated gene program in fibroblasts fromfibrotic lung. The data suggests that the repressed expression of interferon-stimulated genes may underpin criticalaspects of the profibrotic fibroblast phenotype, identifying an area in pulmonary fibrosis that requires furtherinvestigation.</p><p>Keywords: SSc-ILD, IPF, Pulmonary fibroblasts, Interferon regulated genes</p><p>* Correspondence: g.lindahl@imperial.ac.ukEqual contributors1Interstitial Lung Disease Unit, Royal Brompton Hospital and National Heartand Lung Institute, Imperial College London, Emmanuel Kaye Building, 1BManresa Road, London SW3 6LR, UKFull list of author information is available at the end of the article</p><p> 2013 Lindahl et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.</p><p>mailto:g.lindahl@imperial.ac.ukhttp://creativecommons.org/licenses/by/2.0</p></li><li><p>Lindahl et al. Respiratory Research 2013, 14:80 Page 2 of 14http://respiratory-research.com/content/14/1/80</p><p>BackgroundPulmonary fibrosis, characterised by the destruction oflung architecture leading to organ failure, is, togetherwith pulmonary hypertension (PH), the leading cause ofdeath in patients with systemic sclerosis (SSc) [1]. Intersti-tial lung disease is more common in SSc (SSc-ILD) thanin any other connective tissue disease, occurring in &gt; 70%of patients [2], and is most frequently associated with apattern of non-specific interstitial pneumonia (NSIP) [3].Despite intense research efforts, the underlying mecha-nisms of SSc-ILD remain largely unknown [4], and thereare currently limited therapeutic options for this seriouscomplication [2].While a large number of hypothesis-driven studies</p><p>have identified potential profibrotic mediators [4,5], transla-tion of these into therapeutic targets has so far been largelydisappointing [6]. The search for more effective targets inlung fibrosis is now being addressed using hypothesisgenerating microarray-based strategies [7,8]. The majorityof these studies have investigated gene expression in wholelung tissue samples, mostly in the idiopathic setting [5].Matrix metalloproteinase (MMP) 7 [9], osteopontin [10],Twist1 [11], and MMP19 [12], are among suggested media-tors identified using this strategy in idiopathic pulmonaryfibrosis (IPF), a disease characterised by a histological pat-tern of usual interstitial pneumonia (UIP) [13,14]. In SSc,most microarray studies have been performed on skin biop-sies and dermal fibroblasts [7]. However, a recent studycompared whole lung tissue and fibroblasts isolated, at thetime of transplant, from SSc-ILD lungs with a histologicalpattern of UIP, with those from IPF and idiopathic PH. Theinvestigators reported gene profiles of SSc-ILD/UIP, with ei-ther predominant fibrosis or PH, overlapping with profilesof IPF and idiopathic PH, respectively [15].While the initiating factors for fibrosis development</p><p>may vary between diseases, the progressive accumulationof scar tissue in the lung is characterised by commonthemes, including expanding populations of activated fi-broblasts, and excessive accumulation of extracellularmatrix (ECM) proteins [5]. An important strategy to iden-tify potential therapeutic targets, therefore, is to define fi-brotic fibroblast phenotypes so as to delineate underlyingkey mechanisms for fibrosis progression.Here we report analysis of the transcriptome of fibro-</p><p>blasts isolated from surgical lung biopsies at the time ofdiagnosis, from patients with well defined SSc-ILD andthe histopathological pattern of NSIP. Although the mainaim of this study was to compare SSc-ILD/NSIP fibroblastgene expression profiles with those of control lung fibro-blasts, we also included a small number of IPF-derivedfibroblast lines, as a separate fibrotic group. Our studyconfirms, with a robust signature in both diseases, the ab-errant expression of previously reported myofibroblastmarkers and fibrosis mediators, and identifies a number of</p><p>novel, co-expressed putative disease targets. We also ob-served the suppression of a large gene program, the inter-feron stimulated genes (ISGs), reported here for the firsttime. From the known function of some of these genes[16], it is possible to hypothesise that this suppressed pro-gram underlies key fibrotic fibroblast properties, such ashyper-proliferation, and apoptosis resistance. This studytherefore identifies a potential new area for investigationand possible intervention in pulmonary fibrosis.</p><p>MethodsPatients and primary lung fibroblastsPrimary adult pulmonary fibroblasts were cultured fromcontrol tissue samples of unaffected lung from patientsundergoing cancer-resection surgery (n=10), and fromsurgical lung biopsy samples of 11 patients with pul-monary fibrosis (SSc-ILD n=8 and IPF n=3). Independ-ent reviews of the clinical and histopathologic diagnoseswere performed and conformed to established criteria[17,18]. All of the SSc-ILD biopsies were characterisedby a fibrotic NSIP pattern, and the IPF biopsies by a UIPpattern, based on current consensus criteria for thesehistological patterns [19]. The control tissue was histo-logically normal. Median age (range) was 60 (5278) incontrols, 48 (3869) in SSc-ILD, and 61 (4467) in IPF.The gender distribution (M/F) was as follows: controls6/4; SSc-ILD 2/6; IPF 2/1. Four of the SSc-ILD and twoof the IPF patients were ex-smokers. Smoking status wasnot available for all control cases. In SSc-ILD patients,median (range) percent predicted FVC was 72.5% (61106), median FEV1 was 79% (5892) and median DLCOwas 50% (2458). In IPF patients, median FVC was 70%(6475), median FEV1 was 66% (5579), and medianDLCO was 50% (3553). Patients had not been on corti-costeroids or other immunosuppressants prior to surgicalbiopsy, as the biopsy was performed at the time of diagno-sis of the ILD pattern, prior to initiation of treatment. In-formed written consent was given by all subjects, andauthorisation given by the Royal Brompton Hospital Eth-ics Committee. Fibroblasts were obtained from the biop-sies by explant culture, and cell cultures maintained, aspreviously described [20,21]. Experiments were performedon fibroblasts at passage 25. Only one sample (S1) wasused at passage 2. There was no difference in the medianpassage number between the control (median: 4.5; range:35), SSc-ILD (median: 4; range: 25) and IPF (median: 4;range 35) groups.</p><p>Microarray gene expression and analysisAt confluence, lung fibroblasts were serum-deprived for42 hours (media changed at 18 hours) in the presence of0.1% bovine serum albumin (Sigma). Total RNA washarvested (Trizol, Life Technologies), quantified, and theintegrity verified by denaturing gel electrophoresis. Samples</p></li><li><p>Table 1 qRT-PCR primers</p><p>Gene Forward primer Reverse primer</p><p>Normalisation genes</p><p>HPRT1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT</p><p>YWHAZ ACTTTTGGTACATTGTGGCTTCAA CCGCCAGGACAAACCAGTAT</p><p>Genes of interest</p><p>CXCL10 GAAAGCAGTTAGCAAGGAAAG ATCCTTGGAAGCACTGCATC</p><p>ID1 CCAGAACCGCAAGGTGAG GGTCCCTGATGTAGTCGATGA</p><p>IFITM1 TTCTTGAACTGGTGCTGTCT ATGAGGATGCCCAGAATCAG</p><p>IL11 CCTGTGGGGACATGAACTGT AGGGTCTGGGGAAACTCG</p><p>IRF1 CAGCCCAAGAAAGGTCCTC TTGAACGGTACAGACAGAGCA</p><p>NOX4 CTGCTGACGTTGCATGTTTC CGGGAGGGTGGGTATCTAA</p><p>Serpine1</p><p>GGAAAGGCAACATGACCAG CAGGTTCTCTAGGGGCTTCC</p><p>STAT1 GGATCAGCTGCAGAACTGGT TTTCTGTTCCAATTCCTCCAA</p><p>Shown are the primers, written 5 to 3, used for measuring expression levelsby qRT-PCR for validation of the microarray results. All primer pairs except forYWHAZ, IRF1, and ID1, are intron spanning.</p><p>Lindahl et al. Respiratory Research 2013, 14:80 Page 3 of 14http://respiratory-research.com/content/14/1/80</p><p>with a 28S:18S ratios of approximately 2:1 were acceptedfor further analysis by the Genomics Laboratory, CSC-MRC, Imperial College London, Hammersmith. RNAsamples were prepared for chip hybridisation followingmanufacturers guidelines (Affymetrix). Hybridisation ofcRNA to Affymetrix human U133Av2 chips, containingapproximately 14,500 well characterised human genes,signal amplification, and data collection were performedusing an Affymetrix fluidics station and chip reader,according to manufacturers protocol. Array normalisa-tion, using the invariant set normalisation method, andsubsequent calculation of model-based expression values,was performed using DNA-Chip Analyzer (dChip) [22]. Alist of differentially expressed genes was generated indChip using fold change 2, difference in means 100,and p</p></li><li><p>Lindahl et al. Respiratory Research 2013, 14:80 Page 4 of 14http://respiratory-research.com/content/14/1/80</p><p>IPF (n=3 for each phenotype), were cultured for a fur-ther 24 hours in fresh serum-free media. Cells werelysed and western blot analysis was performed using thefollowing primary antibodies: CTGF and STAT1 (SantaCruz Biotechnology); SMA (Dako); IFITM1-3, ISG15and GAPDH (Abcam); IRF-1 (Cell Signaling Technol-ogy); horseradish peroxidise conjugated secondary anti-bodies (Dako and Cell Signaling Technology); and ECLdetection (Amersham).</p><p>ResultsGene expression profiles of fibrotic lung fibroblasts:approximately two-thirds of differentially expressedgenes are down-regulatedUsing an Affymetrix platform (U133Av2), we determinedbasal (serum free) global gene expression levels in fibro-blasts prepared from lung tissue of 8 patients with SSc-ILD and 10 control lungs. As a further comparison wealso included 3 fibroblast cultures from lung tissue ofIPF patients. Unsupervised hierarchical cluster analysisof samples and genes resulted in an overall separation offibrotic samples from controls (Figure 1). Two of theSSc-ILD samples clustered among the normal controls,demonstrating recognised fibrotic fibroblast sampleheterogeneity.When stringent criteria were applied, as described in</p><p>the methods section, 478 and 744 probe sets (probes infuture), equivalent to 360 and 547 genes, displayed dif-ferential expression by at least two-fold in SSc-ILD andIPF fibroblasts, respectively, compared to control fibro-blasts. In SSc-ILD fibroblasts, 125 probes (99 genes)showed significantly higher, and 353 probes (261 genes)lower expression levels compared with controls (Additionalfile 1). In IPF fibroblasts, 239 and 505 probes (181 and 366genes) had significantly higher and lower expression, re-spectively, compared with control fibroblasts (Additionalfile 2). Thus, approximately two thirds of differentiallyexpressed genes were expressed at lower levels in fibro-blasts from the two disease groups compared with con-trols. The sets of underexpressed genes in the diseasegroups, compared to normal controls, also contained themost significantly differentially expressed genes. Table 2lists the 20 most significantly differentially expressed, andhighest ranking (fold change) genes in SSc-ILD and IPF</p><p>S2</p><p>C8</p><p>C9</p><p>C7</p><p>S5</p><p>C3</p><p>C10</p><p>C1</p><p>C2</p><p>C5</p><p>C4</p><p>Figure 1 Unsupervised clustering of samples based on full microarrayclustering using all 22 K probes, shows clustering of samples by phenotype</p><p>samples, separately, versus controls. It should be notedhere that, while 379 out of a total of 843 probes weredifferentially expressed in both SSc-ILD and IPF vs.controls, most genes falling outside this overlap werevery nearly significant in the other disease group, i.e.followed similar trends without meeting cut-off criteria.When the two disease groups were compared directly,only 8 probes (7 genes) were significantly differentiallyexpressed (Additional file 3). The 843 probes differen-tially expressed in SSc-ILD and/or IPF, which also in-clude the genes differentially expressed between thesetwo groups, are listed in Additional file 4. Within thepooled fibrotic samples (IPF and SSc-ILD), no significantdifference was observed in the 843 probes according tosmoking status (SAM analysis, data not shown).Expression levels of a subset of genes identified by the</p><p>present microarray analysis were verified by qRT-PCR inthe microarray RNA samples demonstrating good cor-relation between these two techniques (Figure 2). Pro-tein levels for six differentially expressed genes, fibrosisrelated genes; connective tissue growth factor (CTGF),and alpha-smooth muscle actin (SMA), and interferonstimulated genes (ISG); signal transducer and activatorof transcription 1 (STAT1), IFITM1-3 (all three isoformsare detected by this antibody), ISG15 and IR...</p></li></ul>