Metabolic engineering of Synechocystis 6803 for isobutanol

1

Metabolic engineering of Synechocystis 6803 for isobutanol 1

production 2

3

Arul M. Varman1, Yi Xiao1, Himadri B. Pakrasi1,2 and Yinjie J. Tang 1,a 4

5

1Department of Energy, Environmental and Chemical Engineering 6

2Department of Biology, Washington University, St. Louis, MO 63130, USA 7

aCorresponding author 8

9

(Running title: Synechocystis 6803 for isobutanol production) 10

Email addresses: 11

Arul M. Varman: [email protected] 12

Yi Xiao: [email protected] 13

Himadri B. Pakrasi: [email protected] 14

Yinjie J. Tang: [email protected] 15

16

17

18

19

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02827-12 AEM Accepts, published online ahead of print on 26 November 2012

on March 17, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 20

Global warming and decreasing fossil fuel reserves have prompted great interest in the 21

synthesis of advanced biofuels from renewable resources. In an effort to address these concerns, 22

we have performed metabolic engineering of the cyanobacterium Synechocystis sp. PCC 6803 to 23

develop a strain that can synthesize isobutanol under both autotrophic and mixotrophic 24

conditions. With the expression of two heterologous genes from the Ehrlich Pathway, the 25

engineered strain can accumulate 90 mg/L of isobutanol from 50 mM bicarbonate in a gas-tight 26

shaking flask. This strain does not require any inducer (i.e., IPTG: Isopropyl β-D-1-27

thiogalactopyranoside) or antibiotics to maintain its isobutanol production. In the presence of 28

glucose, isobutanol synthesis is only moderately promoted (titer = 114 mg/L). Based on 29

isotopomer analysis, we find that compared to the wild-type strain, the mutant significantly 30

reduced its glucose utilization and mainly employed autotrophic metabolism for biomass growth 31

and isobutanol production. Since isobutanol is toxic to the cells and may also be degraded 32

photochemically by hydroxyl radicals during the cultivation process, we employed in situ 33

removal of the isobutanol using oleyl alcohol as a solvent trap. This resulted in a final net 34

concentration of 298 mg/L of isobutanol under mixotrophic culture conditions. 35

Key words: bicarbonate, Ehrlich pathway, inducer, isobutanol, isotopomer analysis, oleyl alcohol 36

37

38

39

40


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Introduction 41

Global energy needs continue to increase rapidly due to industrial and development 42

demands, furthering environmental concerns. Much of the worldwide energy consumption 43

comes from the burning of fossil fuels, which produces about 6 gigatons of CO2 annually (27). 44

Increasing CO2 levels may act as a feedback loop to increase the soil emissions of other 45

greenhouse gases such as methane and nitrous oxide, heightening global temperature (32). For 46

energy security and environmental concerns, there is an urgent demand for the development of 47

bioenergy. Bioethanol is the most common biofuel, but it also has low energy density and 48

absorbs moisture. Isobutanol (IB) is a better fuel because it is less water soluble and has an 49

energy density / octane value close to that of gasoline (18, 20). Amongst the next generation 50

biofuels synthesized from pyruvate, IB possesses fewer reaction steps (5 reaction steps from 51

pyruvate to IB) in contrast to the synthesis of 1-butanol or biodiesel. IB is less toxic to microbes 52

(1) so that it may achieve higher product titer and yield (7, 33). For example, a maximum titer of 53

50.8 g/L of IB can be achieved in an engineered E. coli (3). 54

On the other hand, cyanobacteria can not only convert CO2 into bio-products, but also 55

can play an important role in environmental bioremediations. The photosynthetic efficiency of 56

cyanobacteria (3~9%) is high compared to higher plants (≤0.25~3%) (11, 40). Furthermore, 57

some species of cyanobacteria are amenable to genetic engineering. Table 1 lists the various 58

biofuels that have been synthesized through the metabolic engineering of cyanobacteria. 59

Autotrophic IB production in cyanobacteria was first demonstrated in Synechococcus 7942 (2). 60

Moreover, a model cyanobacterium Synechocystis sp. PCC 6803 is capable of growing under 61

both photoautotrophic and mixotrophic conditions, while the presence of glucose can 62

significantly promote biomass and bioproduct synthesis (26). Thereby, we have engineered a 63


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

glucose tolerant Synechocystis 6803 strain with two key genes kivd and adhA of the Ehrlich 64

pathway (28) so that the cyanobacterial strain can convert CO2 into IB. Through both metabolic 65

engineering and bioprocess optimization, we have improved our strain’s IB production 66

capabilities. 67

Materials and methods 68

Chemicals and reagents. Restriction enzymes, T4 DNA ligase, DNase and a Revertaid first 69

strand cDNA synthesis kit were purchased from Fermentas or New England Biolabs. 70

Oligonucleotides were purchased from Integrated DNA Technologies. Toluene, IB, α-71

ketoisovaleric acid, phenol and chloroform were purchased from Sigma-Aldrich (St. Louis, MO). 72

KlenTaq-LA (4) was purchased from DNA Polymerase Technology (St. Louis, MO). TRI 73

Reagent® was purchased from Ambion, USA. 13C labeled glucose was purchased from 74

Cambridge Isotope Laboratories. 75

Culture medium and growth conditions. A glucose tolerant wild-type strain of Synechocystis 76

6803 (WT) and the recombinant strain AV03 were grown at 30°C in liquid BG-11 medium or 77

solid BG-11 medium at a light intensity of 50 µmol of photons m-2 s-1 in ambient air. 78

Kanamycin at a concentration of 20 µg/mL was added to the BG 11 medium when required. 79

Growth of the cells was monitored by measuring OD730 of the cultures on an Agilent Cary 60 80

UV-Vis Spectrophotometer. Cultures for the synthesis of IB were grown in 10 mL medium 81

(Initial OD730 of 0.4) in 50 mL shake flasks for 4 days. The mid-log phase cultures were then 82

closed with rubber caps to prevent the loss of IB during incubation, and the cultures were 83

supplemented with 50 mM NaHCO3 as an inorganic carbon source. Mixotrophic cultures of 84

Synechocystis 6803 were started in a BG-11 medium containing a known amount of glucose as 85

an organic carbon source. E. coli strain DH10B was the host for all plasmids constructed in this 86


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

study. E. coli cells were grown in falcon tubes containing Luria-Bertani (LB) medium at 37°C 87

under continuous shaking. Ampicillin (100 µg/mL) or kanamycin (50 µg/mL) was added to the 88

LB medium when required, for the propagation of plasmids in E. coli. 89

Plasmid construction and transformation of Synechocystis 6803. The vector pTAC-KA 90

containing an ampicillin resistance cassette (AmpR) and two genes (kivd and adhA from 91

Lactococcus lactis) was constructed as described (36). The pTAC-KA vector was modified using 92

the following steps to convert it into a Synechocystis 6803 vector. To clone the flanking regions 93

of a potential neutral site into pTAC-KA, a Synechocystis 6803 vector pSL2035 containing both 94

the flanking regions and the kanamycin resistance cassette (KmR) was used as a template. 95

pSL2035 is a Synechocystis 6803 vector designed to integrate any foreign DNA into the genome 96

of Synechocystis 6803 by replacing the psbA1 gene and its promoter. psbA1 is a member of psbA 97

gene family and is found to be silent under most conditions (24, 25). pSL2035 was constructed 98

by cloning the flanking regions for the psbA1 gene and the KmR into pUC118. The 5’ flanking 99

region from pSL2035 was PCR amplified along with KmR by respective primers (Table 2) and 100

cloned into the PciI and Bsu36I site of pTAC-KA, resulting in the vector pTKA2. The 3’ 101

flanking region was PCR amplified from pSL2035 by the respective primers and inserted into the 102

AhdI site of pTKA2, disrupting the native AmpR and henceforth creating the vector pTKA3. 103

Transformation was performed by using a double homologous recombination system, and 104

the genes were integrated into the target site of the Synechocystis genomic DNA. Specifically, 2 105

mL of Synechocystis 6803 from a mid-log phase (1~3×108 cells mL-1) culture was centrifuged at 106

10,000 × g for 2 min. The pellet was suspended in a fresh BG-11 medium (200 µL) to a final cell 107

density of 1~3×109 cells mL-1. Plasmid DNA was added to a final DNA concentration of 5~10 108

µg/mL (38) to this dense Synechocystis 6803 cell culture. The mixture was then incubated under 109


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

normal light conditions (50 µE m-2 s-1) overnight. The culture was then spread onto a BG-11 agar 110

plate containing 20 µg/mL of kanamycin. Recombinant colonies usually appear between 7 and 111

10 days. Colonies were propagated on a fresh BG-11 plate containing kanamycin, and a colony 112

PCR was performed to verify successful integration of the insert into the genomic DNA of the 113

recombinant. The positive colonies were propagated continuously onto BG-11 plates containing 114

kanamycin, to get a high segregation of the insert in the recombinant (34). To verify the integrity 115

of the promoter and gene sequences, the heterologous DNA integrated into the genome of the 116

mutant AV03 was PCR amplified and sent for sequencing with the respective primers. 117

Reverse transcription PCR (RT-PCR). Total RNA isolation of Synechocystis 6803 was 118

performed using a TRI Reagent® (Ambion, USA) by following the manufacturer protocol with 119

modifications. 1 mL of RNAwiz was prewarmed to 70°C and pipetted into the frozen cells 120

directly. Immediately, the mixture was vortexed and incubated for 10 min at 70°C in a heater 121

block. 0.2 mL of chloroform was added to the mixture and mixed vigorously followed by 122

incubation at room temperature for 10 min. The aqueous and the organic phase were separated 123

by centrifugation at 10,000 × g at 4°C. The RNA containing aqueous phase was transferred into 124

an eppendorf tube, to which, equal volumes of phenol and chloroform were added. The mixture 125

was mixed vigorously followed by centrifugation to separate the aqueous and the organic phase. 126

The aqueous phase was removed to a clean tube, to which 0.5 mL of diethyl pyrocarbonate 127

(DEPC) treated water was added. RNA in the solution was precipitated by the addition of room 128

temperature isopropanol and centrifuged at 10,000 × g at 4°C to pellet the RNA. The RNA was 129

washed with ethanol and resuspended in a fresh 50 µL of DEPC treated water. The quantity and 130

quality of the isolated RNA was determined using a Nanodrop ND-1000 (Thermo Scientific, 131

USA). The RNA was incubated at room temperature with DNase to degrade any genomic DNA, 132


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

if present in the RNA sample. Synthesis of cDNA was performed by utilizing a Reverse 133

transcriptase enzyme from Fermentas along with dNTPs and random primers in a reaction buffer. 134

The mixture was incubated at 42°C for 60 min. The synthesized cDNA was used as a template 135

for the PCR, to detect the expression of the mRNA of interest. 136

Isobutanol quantification assay. IB synthesized in the culture was quantified using a gas 137

chromatograph (Hewlett Packard model 7890A, Agilent Technologies, equipped with a DB5-MS 138

column, J&W Scientific) and a mass spectrometer (5975C, Agilent Technologies). IB extraction 139

was done using a modified procedure (5). Samples of the cyanobacterial culture (400 µL) were 140

collected and centrifuged at 10000 × g for 5 min. IB was extracted from the supernatant by 141

vortexing for 1 min with 400 µL of toluene, and methanol was used as the internal standard. A 1 142

µL sample of the organic layer was injected into the gas chromotagraph (GC) with helium as the 143

carrier gas. The GC oven was held at 70°C for 2 min and then raised to 200°C with a 144

temperature ramp of 30°C min-1, and the post run was set at 300°C for 6 min. The range of the 145

mass spectrometer (MS) scan mode was set between m/z of 20 and 200. The concentration of IB 146

present in the culture was determined based on a calibration curve prepared with known 147

concentrations of IB ranging from 25 mg/L to 400 mg/L. 148

13C-experiment to detect carbon contribution of glucose. The 13C-abundance of some 149

important metabolites was measured for both the wild-type and the mutant strain AV03, to 150

estimate the carbon contribution of both glucose (fully labeled by 13C) and nonlabeled 151

bicarbonate for biomass and IB synthesis. Mixotrophic cultures of both the wild-type 152

Synechocystis 6803 and the mutant AV03 were grown in BG-11 medium (with 50mM 153

nonlabeled NaHCO3), which contained 0.5% glucose (U-13C, Cambridge Isotope Laboratories, 154

MA). Cultures were collected on day 3, 6 and 9, and proteinogenic amino acids were hydrolyzed 155


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

and then derivatized with TBDMS (N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide, 156

Sigma-Aldrich). The derivatized amino acids were analyzed for their mass isotopomer 157

abundance by GC-MS, as described before (13, 37). The m/z ion [M-57]+, which corresponds to 158

the entire amino acid, was used to calculate the 13C abundance in amino acids [m0 m1…. mn]. 159

The fraction of carbon (FA) derived from fully labeled glucose for each amino acid was estimated 160

based on the following equation: n

miF

n

i iA =

×= 1 (Equation 1) 161

where i is the number of labeled carbons, mi is the mass fraction for different isotopomers of the 162

corresponding amino acid and n represents the total number of carbons in the corresponding 163

amino acid. The m/z of [M-15]+ was used only for leucine and isoleucine, since their [M-57]+ 164

overlaps with other mass peaks (35). IB extraction was performed for samples obtained from the 165

above cultures and was analyzed using the GC-MS. The fraction of carbon derived from glucose 166

for isobutanol (FIB) was estimated based on the isobutanol MS peak abundances: 167

=

=×

=4

0

4

1

4i i

i iIB

A

AiF (Equation 2) 168

where Ai is the abundance of the mass-to-charge ratio peaks for the various isobutanol 169

isotopomers (i.e., A0~A4 for m/z=74~78). 170

Results 171

Construction of an isobutanol producing Synechocystis 6803 strain. IB synthesis in 172

Synechocystis 6803 requires the expression of two heterologous genes of the Ehrlich pathway. 173

The enzymes 2-keto-acid decarboxylase and alcohol dehydrogenase can convert 2-keto acids 174

into alcohols. In this work, we constructed a plasmid pTKA3 containing the genes kivd and adhA 175

from Lactococcus lactis under the control of an IPTG inducible promoter, Ptac. The plasmid was 176


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

designed to integrate the genes into a neutral site in the genome of Synechocystis 6803, along 177

with a kanamycin resistance cassette (Fig. 1a - Left). The wild-type strain of Synechocystis 6803 178

was transformed with pTKA3, resulting in the recombinant strain AV03. The integration of the 179

insert genes into the genome was verified by a colony PCR after several rounds of segregation 180

(Fig. 1a - Right). 181

To identify the optimal IPTG concentration required for IB synthesis, the AV03 strain 182

was grown under different concentrations of IPTG. IB analysis from the cultures indicated that 183

IB was highly synthesized even without the addition of IPTG (Fig. 1b). To verify if this 184

observation was an artifact of any mutations that might have occurred in lacI or the promoter, the 185

foreign DNA integrated into the chromosome of AV03 was sequenced. Sequencing results for 186

the lacI and the promoter Ptac in the genome of AV03 revealed that the nucleotide sequence was 187

completely intact. There have been reports of leaky expressions with IPTG inducible promoters 188

(17). Besides, Fig. 1b indicates that as the concentration of IPTG went higher than 1mM, the IB 189

synthesis reduced. The OD730 of the different cultures indicated that the addition of IPTG did 190

not apparently interfere with the growth rate of the culture. RT-PCR showed the expression 191

levels of the genes kivd and adhA under different IPTG concentrations. The result of RT-PCR 192

experiment (Fig. 1b - Inset) indicated that the levels of kivd and adhA mRNA synthesized in the 193

mutant were higher with IPTG than without. Henceforth, lower expression of the two genes is 194

sufficient for IB synthesis, possibly because the Ehrlich pathway may not be the rate-limiting 195

step for IB production. 196

Isobutanol synthesis under autotrophic and mixotrophic growth. Under autotrophic 197

conditions, Synechocystis 6803 utilizes light as an energy source (ATP and NADPH) for the 198

conversion of CO2 into biomass and IB. Fig. 2a compares the autotrophic growth of the mutant 199


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

and the wild strain. Under autotrophic conditions, we found that the growth rate of the mutant 200

AV03 remains unaltered as compared to the wild-type strain. IB accumulation in the mutant was 201

tested under autotrophic condition (Fig. 2b), and the strain was found to synthesize a maximum 202

of 90 mg/L of IB (the only extracellular product detected by GC-MS) in a 6-day culture. In a 203

sealed shaking flask, NaHCO3 in the medium (50mM) was consumed by AV03 within six days, 204

and then both the biomass and IB started declining. 205

The wild-type strain of Synechocystis 6803 grows about 5 times faster under mixotrophic 206

conditions compared to autotrophic conditions (Fig. 2a). However, our mutant AV03 did not 207

exhibit an increased growth rate under mixotrophic conditions. To measure the glucose 208

utilization by wild-type and mutant AV03, we fed cells with 0.5% fully labeled glucose and 209

nonlabeled bicarbonate. Isotopomer analysis of 13C-abundance in cell metabolites (Fig. 2c) 210

showed that the wild-type synthesized 70~90% of its amino acids using carbons from glucose, 211

whereas the mutant produced biomass only using 5~10% carbon from glucose, and 12% of the 212

carbon of IB was labeled (i.e., derived from glucose). These results indicated that the mutant 213

tended to limit glucose metabolism for IB production. The AV03 strain was found to synthesize 214

a maximum of 114 mg/L of IB mixotrophically after 9 days (Fig. 2b), whereas cells with only 215

glucose (heterotrophic without bicarbonate or CO2) synthesized a maximum of 27 mg/L of IB. 216

This result suggests that the Synechocystis 6803 mutant is unable to take significant advantage of 217

its glucose metabolism to have a fast rate of IB production. 218

In situ alcohol concentrating system using a solvent trap. IB is toxic to the cells and our 219

study revealed that IB inhibited Synechocystis 6803 growth at external concentrations of only 2 220

g/L (Fig. 3). Moreover, our control experiments indicated the loss of IB after 9 days of 221

continuous incubation. IB can be slowly degraded by photo-chemically-produced hydroxyl 222


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

radicals in aerobic cyanobacterial cultures (6, 16, 31). Therefore, a system with continuous 223

removal of the synthesized alcohol products will be beneficial (19, 29). We have demonstrated 224

the use of an in situ alcohol removal system by using oleyl alcohol (12, 15) as a solvent trap for 225

increasing IB titer. In previous studies, gas stripping is one efficient way for IB recovery, but it 226

requires an expensive cooling system due to very low concentrations of IB from photo-227

bioreactors. Here, inside each cultivation flask, we placed a small glass vial containing 0.5 or 1 228

mL oleyl alcohol solvent, so that oleyl alcohol was not mixed with the culture solution (Fig. 4). 229

Volatile IB in the headspace can be trapped in the solvent vial because of the high solubility of 230

IB in oleyl alcohol. This method will effectively trap the IB while the solvent will not directly 231

interfere with light and cell culture conditions. 232

To test the effect of oleyl alcohol on IB productivity, we did a 3-week time-course study 233

(Fig. 4) by adding 50 mM NaHCO3 intermittently (every 4 days). During the cultivation, the pH 234

of the cultures was also adjusted to be between 8 and 9 before the addition of excess bicarbonate. 235

Every 3 days, the oleyl alcohol in the vials was taken out for IB measurement, and then replaced 236

with fresh oleyl alcohol. The mixotrophic cultures with alcohol trap (0.5 mL) reached the highest 237

net IB concentration of 298 mg/L. The autotrophic cultures with 0.5 mL and 1 mL oleyl alcohol 238

had a maximum net IB titer of 180 mg/L and 240 mg/L, respectively, whereas the autotrophic 239

cultures without the oleyl alcohol trap were able to achieve a maximum of only 108 mg/L of IB. 240

IB levels in the organic phase reached concentrations of up to 500 mg/L with only 3 days of 241

trapping. 242

Discussion 243

Isobutanol (IB) is a promising biofuel for the replacement of gasoline. So far, E. coli has 244

remained the most successful microbial host for IB production. In this study, we have focused 245


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

our efforts on a cyanobacterial species, Synechocystis 6803, which can grow on both CO2 and 246

glucose. The mixotrophic cultivation may offer industrial flexibility and economic benefits 247

because the gas-liquid mass transfer of CO2 is often a rate-limiting step in efficient 248

photobioreactor operations. Attempts in creating a stable strain of Synechococcus 7942 that can 249

transport and utilize glucose has been barely successful (39). The glucose tolerant strain of 250

Synechocystis 6803 unlike other cyanobacterial strains, can perform both autotrophic and 251

mixotrophic metabolisms. In our work, we found that the wild-type strain of Synechocystis 6803 252

under mixotrophic conditions grew at a rate 5 times faster than the autotrophic condition. 253

Moreover, the engineered Synechocystis 6803 strain accumulated 90 mg/L of IB, whereas the 254

Synechococcus 7942 strain expressing the same two enzymes (keto-acid decarboxylase and 255

alcohol dehydrogenase) only accumulated a maximum of 18 mg/L (2). Switching the condition 256

from autotrophic to mixotrophic for the mutant AV03 increased the maximum IB titer to 114 257

mg/L. Interestingly, the mutant tended to grow autotrophically and had minimal glucose 258

utilization compared to the wild-type strain (Fig 2c). 259

IB can be inhibitory to cell physiologies. Moreover, our experiments also observed IB 260

degradation (by hydroxyl radicals) during the incubation process. Thereby, efforts in coming up 261

with product recovery are important to improve IB titer in cyanobacterial culture. This work 262

employed an in situ IB removal system by growing cultures in shake flasks with vials containing 263

oleyl alcohol. Mixotrophic growth of AV03 along with in situ IB removal synthesized a 264

maximum of 298 mg/L IB, which is lower than the highest IB titer (450 mg/L) reported in 265

Synechococcus 7942 mutant expressing 3 more genes of the keto acid pathway. On the other 266

hand, our strain design has two apparent advantages for industrial application. First, our strain 267

does not require any antibiotics to maintain its IB production because the two heterologous genes 268


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

in the mutant show good stability during normal cultivation conditions. Second, the strain does 269

not need any inducer (IPTG) for IB production, which can significantly reduce the industrial 270

costs. 271

Overexpressing the keto acid pathway can increase the IB titer in Synechococcus 7942 272

(2). Furthermore, optimizing CO2 and light conditions of the cyanobacterial strain can also 273

increase the final titer and productivity. Liu et. al., (23) have reported a doubling time of 7.4 274

hours for Synechocystis 6803, by growing them under 140 µmol of photons m-2 s-1 of light and 275

by bubbling 1% CO2 enriched air. Therefore, our strain can serve as a springboard for future 276

development of higher performance Synechocystis 6803 strains with increased IB titer and 277

productivity. 278

In summary, IB synthesis under autotrophic conditions in a cyanobacterium 279

Synechocystis 6803 was demonstrated by the expression of two heterologous genes. It was 280

further demonstrated that mixotrophic cultures of the mutant can significantly increase IB 281

synthesis with minimal glucose consumption. The mechanism behind the reduced glucose-282

utilizing metabolism of AV03 compared to the wild-type strain remains unclear. A possible 283

explanation is that the cells tend to avoid the intracellular metabolic imbalance or IB 284

intermediate inhibition by down-regulating glucose uptake. Using oleyl alcohol as a simple 285

solvent trap, IB production can be improved by 2~3 times. Therefore, in situ IB recovery may 286

reduce the product loss and separation cost. We have also demonstrated that a simple expression 287

of the Ehrlich pathway with bioprocess modification can synthesize IB without other major 288

waste products, while still achieving comparable levels of IB to an extensive genetically 289

modified Synechococcus 7942 strain (Table 1) (2). 290

291


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

Acknowledgment 292

The authors wish to thank Dr. Abhay Singh and Dr. Anindita Bandyopadhyay for their 293

technical guidance. The authors would also like to thank Amelia Nguyen and Amelia Chen for 294

their assistance with data collection for a few experiments. This research was funded by an NSF 295

Career Grant to YT (MCB0954016), a grant to HBP from the Office of Science (BER), U.S. 296

Department of Energy, and a grant to HBP from the Consortium for Clean Coal Utilization at 297

Washington University. We would also like to thank Seema Mukhi Dahlheimer from the 298

Engineering Communication Center of Washington University in St. Louis for her close reading 299

of this manuscript. 300

Authors’ contributions 301

YJT initiated this study. HP, YJT and AV designed the experiments. AV and YX performed the 302

experiments. AV wrote the manuscript. All authors revised and approved the final manuscript. 303

References 304

1. Atsumi, S., T. Hanai, and J. C. Liao. 2008. Non-fermentative pathways for synthesis of 305 branched-chain higher alcohols as biofuels. Nature 451:86-9. 306

2. Atsumi, S., W. Higashide, and J. C. Liao. 2009. Direct photosynthetic recycling of 307 carbon dioxide to isobutyraldehyde. Nature Biotechnology 27:1177-1180. 308

3. Baez, A., K.-M. Cho, and J. C. Liao. 2011. High-flux isobutanol production using 309 engineered Escherichia coli: a bioreactor study with in situ product removal. Applied 310 Microbiology and Biotechnology 90:1681-1690. 311

4. Barnes, W. M. 1994. PCR amplification of up to 35 kb DNA with high fidelity and high 312 yield from bacteriophage templates. Proceedings of the National Academy of Sciences of 313 the United States of America 91:2216-2220. 314

5. Bond-Watts, B. B., R. J. Bellerose, and M. C. Chang. 2011. Enzyme mechanism as a 315 kinetic control element for designing synthetic biofuel pathways. Nat Chem Biol 7:222-7. 316

6. Cameron, J. C., and H. B. Pakrasi. 2011. Glutathione Facilitates Antibiotic Resistance 317 and Photosystem I Stability during Exposure to Gentamicin in Cyanobacteria. Applied 318 and Environmental Microbiology 77:3547-3550. 319

7. Colletti, P., Y. Goyal, A. Varman, x. Feng, B. Wu, and Y. Tang. 2011. Evaluating 320 factors that influence microbial synthesis yields by linear regression with numerical and 321 ordinal variables. Biotechnology and Bioengineering 108:893-901. 322


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

8. Deng, M. D., and J. R. Coleman. 1999. Ethanol synthesis by genetic engineering in 323 cyanobacteria. Applied and Environmental Microbiology 65:523-528. 324

9. Dexter, J., and P. Fu. 2009. Metabolic engineering of cyanobacteria for ethanol 325 production. Energy & Environmental Science 2:857-864. 326

10. Ducat, D. C., G. Sachdeva, and P. A. Silver. 2011. Rewiring hydrogenase-dependent 327 redox circuits in cyanobacteria. Proceedings of the National Academy of Sciences 328 108:3941-3946. 329

11. Ducat, D. C., J. C. Way, and P. A. Silver. 2011. Engineering cyanobacteria to generate 330 high-value products. Trends in Biotechnology 29:95-103. 331

12. Ezeji, T., C. Milne, N. D. Price, and H. P. Blaschek. 2010. Achievements and 332 perspectives to overcome the poor solvent resistance in acetone and butanol-producing 333 microorganisms. Applied Microbiology and Biotechnology 85:1697-1712. 334

13. Feng, X., A. Bandyopadhyay, B. Berla, L. Page, B. Wu, H. B. Pakrasi, and Y. J. 335 Tang. 2010. Mixotrophic and photoheterotrophic metabolism in Cyanothece sp. ATCC 336 51142 under continuous light. Microbiology 156:2566-74. 337

14. Gao, Q., W. Wang, H. Zhao, and X. Lu. 2012. Effects of fatty acid activation on 338 photosynthetic production of fatty acid-based biofuels in Synechocystis sp. PCC 6803. 339 Biotechnology for Biofuels 5. 340

15. Green, E. M. 2011. Fermentative production of butanol - the industrial perspective. 341 Current Opinion in Biotechnology 22:337-343. 342

16. Grosjean, D. 1997. Atmospheric chemistry of alcohols. Journal of the Brazilian 343 Chemical Society 8:433-442. 344

17. Huang, H.-H., D. Camsund, P. Lindblad, and T. Heidorn. 2010. Design and 345 characterization of molecular tools for a Synthetic Biology approach towards developing 346 cyanobacterial biotechnology. Nucleic acids research 38:2577-2593. 347

18. Keasling, J. D., and H. Chou. 2008. Metabolic engineering delivers next-generation 348 biofuels. Nat Biotech 26:298-299. 349

19. Kraemer, K., A. Harwardt, R. Bronneberg, and W. Marquardt. 2010. Separation of 350 butanol from acetone-butanol-ethanol fermentation by a hybrid extraction-distillation 351 process. Computers & Chemical Engineering 35:949-963. 352

20. Lamsen, E. N., and S. Atsumi. 2012. Recent progress in synthetic biology for microbial 353 production of C3-C10 alcohols. Frontiers in Microbiology 3. 354

21. Lan, E. I., and J. C. Liao. 2012. ATP drives direct photosynthetic production of 1-355 butanol in cyanobacteria. Proceedings of the National Academy of Sciences of the United 356 States of America 109:6018-6023. 357

22. Lan, E. I., and J. C. Liao. 2011. Metabolic engineering of cyanobacteria for 1-butanol 358 production from carbon dioxide. Metabolic Engineering 13:353-363. 359

23. Liu, X. Y., J. Sheng, and R. Curtiss. 2011. Fatty acid production in genetically 360 modified cyanobacteria. Proceedings of the National Academy of Sciences of the United 361 States of America 108:6899-6904. 362

24. Mohamed, A., J. Eriksson, H. D. Osiewacz, and C. Jansson. 1993. Differential 363 expression of the psbA genes in the cyanobacterium Synechocystis 6803. Molecular & 364 General Genetics 238:161-168. 365

25. Mohamed, A., and C. Jansson. 1989. Influence of light on accumulation of 366 photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803. Plant 367 Molecular Biology 13:693-700. 368


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

26. Okamoto, S., M. Ikeuchi, and M. Ohmori. 1999. Experimental analysis of recently 369 transposed insertion sequences in the cyanobacterium Synechocystis sp. PCC 6803. DNA 370 research : an international journal for rapid publication of reports on genes and genomes 371 6:265-73. 372

27. Rittmann, B. E. 2008. Opportunities for renewable bioenergy using microorganisms. 373 Biotechnology and Bioengineering 100:203-212. 374

28. Sentheshanmuganathan, S., and S. R. Elsden. 1958. The mechanism of the formation 375 of tyrosol by Saccharomyces cerevisiae. The Biochemical journal 69:210-8. 376

29. Shi, Z. P., C. Y. Zhang, J. X. Chen, and Z. G. Mao. 2005. Performance evaluation of 377 acetone-butanol continuous flash extractive fermentation process. Bioprocess and 378 Biosystems Engineering 27:175-183. 379

30. Tan, X., L. Yao, Q. Gao, W. Wang, F. Qi, and X. Lu. 2011. Photosynthesis driven 380 conversion of carbon dioxide to fatty alcohols and hydrocarbons in cyanobacteria. 381 Metabolic Engineering 13:169-176. 382

31. Tichy, M., and W. Vermaas. 1999. In Vivo Role of Catalase-Peroxidase 383 inSynechocystis sp. Strain PCC 6803. Journal of Bacteriology 181:1875-1882. 384

32. van Groenigen, K. J., C. W. Osenberg, and B. A. Hungate. 2011. Increased soil 385 emissions of potent greenhouse gases under increased atmospheric CO2. Nature 475:214-386 216. 387

33. Varman, A., Y. Xiao, E. Leonard, and Y. Tang. 2011. Statistics-based model for 388 prediction of chemical biosynthesis yield from Saccharomyces cerevisiae. Microbial Cell 389 Factories 10:45. 390

34. Vermaas, W. 1996. Molecular genetics of the cyanobacterium Synechocystis sp. PCC 391 6803: Principles and possible biotechnology applications. Journal of Applied Phycology 392 8:263-273. 393

35. Wahl, S. A., M. Dauner, and W. Wiechert. 2004. New tools for mass isotopomer data 394 evaluation in (13)C flux analysis: mass isotope correction, data consistency checking, and 395 precursor relationships. Biotechnol Bioeng 85:259-68. 396

36. Xiao, Y., X. Feng, A. M. Varman, L. He, H. Yu, and Y. J. Tang. 2012. Kinetic 397 modeling and isotopic investigation of isobutanol fermentation by two engineered 398 Escherichia coli strains. Industrial & Engineering Chemistry Research Under Review. 399

37. You, L., L. Page, X. Feng, B. Berla, H. B. Pakrasi, and Y. J. Tang. 2012. Metabolic 400 Pathway Confirmation and Discovery Through 13C-labeling of Proteinogenic Amino 401 Acids. J Vis Exp:e3583. 402

38. Zang, X. N., B. Liu, S. M. Liu, K. Arunakumara, and X. C. Zhang. 2007. Optimum 403 conditions for transformation of Synechocystis sp. PCC 6803. Journal of Microbiology 404 45:241-245. 405

39. Zhang, C. C., R. Jeanjean, and F. Joset. 1998. Obligate phototrophy in cyanobacteria: 406 more than a lack of sugar transport. Fems Microbiology Letters 161:285-292. 407

40. Zhou, J., and Y. Li. 2010. Engineering cyanobacteria for fuels and chemicals 408 production. Protein & Cell 1:207-210. 409

410 411 412 413 414


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

Figure Legend 415 416 Figure 1: (a) Schematic representation to show the integration of the genes kivd and adhA into 417

the genome of Synechocystis 6803. Colony PCR performed to verify the integration of the insert 418

into the genomic DNA of the mutant (AV03). The vector ptka3 was used as a template for the 419

positive control and wild-type cells were used as negative control. Colony PCR of AV03, 420

showed the presence of a band (8.3kb) the same size as the positive control (+ve) and the 421

absence of the negative control (WT) band. (b) IB synthesized by engineered Synechocystis 6803 422

under different IPTG concentrations (n=3). (Inset) Result of an RT-PCR performed to detect the 423

expression of the heterologous genes kivd (Top: 500bp from kivd) and adhA (Bottom: 200bp 424

from adhA). Lane 1, wild-type 6803 (WT); Lane 2, AV03 with 0 mM IPTG; Lane 3, AV03 425

with 0.5mM IPTG; Lane 4, AV03 with 1mM IPTG. 426

427

Figure 2: (a) Growth curves of Synechocystis 6803 WT and AV03 (n=3, shake flask cultures): 428

WT under autotrophic, ♦ WT under mixotrophic, ○ AV03 under autotrophic and ● AV03 under 429

mixotrophic conditions (note: growth curve of AV03 under mixotrophic condition overlaps with 430

autotrophic growth curves of AV03 and WT). (b) IB synthesized in AV03 under autotrophic 431

conditions (only HCO3), heterotrophic (only glucose) and mixotrophic (both HCO3 and glucose) 432

conditions (n=3, shake flask cultures with closed caps). (c) Percentage carbon contribution of 433

glucose for synthesizing amino acids and isobutanol in the wild-type (WT) and the mutant strain 434

(AV03) as measured on day 9 (shake flask cultures with closed caps). Isotopomer analysis 435

(TBDMS based method) of proteinogenic amino acids confirms the low 13C-glucose utilization 436

by the mutant. The error bar represents the 2% technical error of the instrument. 437

438


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

Figure 3: Toxic effects of IB on the growth of Synechocystis 6803. IB was added to a final 439

concentration (g/L, n=2) of ◊ 0, □ 0.2, Δ 0.5, ○ 1, ■ 2 and ● 5 to a Synechocystis 6803 culture 440

with an initial OD730 ~ 0.8. 441

Figure 4: Net concentration of IB synthesized (columns) and biomass growth (curves) by the 442

AV03 culture under different conditions (n=3). a – IB with 0.5 mL oleyl alcohol (Autotrophic); b 443

– IB with 1 mL oleyl alcohol (Autotrophic); c – IB with 0.5 mL oleyl alcohol and glucose 444

(Mixotrophic); d – IB with no oleyl alcohol (Autotrophic, negative control); a1 – OD730 with 0.5 445

mL oleyl alcohol (Autotrophic); a2 – OD730 with 1 mL oleyl alcohol (Autotrophic); a3 – OD730 446

with 0.5 mL oleyl alcohol and glucose (Mixotrophic); a4 – OD730 with no oleyl alcohol 447

(Autotrophic, negative control). (Inset) Schematic representation of the in situ IB removal 448

system used to increase the production of IB. 449

450

451

452

453

454

455

456

457

458

459

460

461


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

Table 1: Metabolic engineering of cyanobacterial strains for biofuel production. 462

Product Species Titer or Productivity

Overexpressed genes

Promoters Culture vessel / Remarks

Culture Days

Ref.

Ethanol Synechococcus 7942

230 mg/L pdc and adh

rbcLS Shake flask 28 days (8)

Ethanol Synechocystis 6803

552 mg/L pdc and adh

psbA2 Photobioreactor 6 days (9)

Isobutyraldehyde

Synechococcus 7942

1100 mg/L alsS, ilvC, ilvD, kivd and rbcls

LlacO1 , trc and tac

Roux culture bottle with NaHCO3

8 days (2)

Isobutanol Synechococcus 7942

18 mg/L kivd and yqhD

trc Shake flask with NaHCO3

1 day (2)

Isobutanol Synechococcus 7942

450 mg/L alsS, ilvC, ilvD, kivd and yqhD

LlacO1 , trc Shake flask with NaHCO3

6 days (2)

Fatty alcohol

Synechocystis 6803

200±8 µg/L far rbc Photobioreactor with 5% CO2

18 days (30)

Alkanes Synechocystis 6803

162±10 µg/OD/L

accBCDA rbcl Shake flask - (30)

Fatty acids

Synechocystis 6803

197 ±14 mg∕L

tesA, accBCDA, fatB1, fatB2, tesA137

psbA2, cpc, and trc

1% CO2 bubbling 17 days (23)

Hydrogen Synechococcus 7942

2.8 µmol/hr/mg Chl-a*

hydEF, hydG and hydA

psbA1, lac Anaerobic conditions with DCMU treatment**

- (10)

1-Butanol Synechococcus 7942

14.5 mg/L hbd, crt, adhE2, ter and atoB

trc, LlacO1 Dark roux culture bottle under anoxic condition

7 days (22)

Fatty alcohol

Synechocystis 6803

20 ± 2 µg/L/OD

far, aas rbc, psbA2 Shake flask - (14)

1-Butanol Synechococcus 7942

30 mg/L ter, nphT7, bldh, yqhD, phaJ, phaB

trc, LlacO1 Shake flask 18 days (21)

463

where *Chl-a is chlorophyll a; **DCMU is 3-(3,4-dichlorophenyl)-1,1-dimethylurea. 464

465

466

467

468

469

470


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

Table 2: Primer sequences used in this study. 471

Name Sequence (5’→3’)

AMV14F GCGCACATGTCGGAACAGGACCAAGCCTTGAT

AMV15R GCGC CCTGAGGCCTTTACCATGACCTGCAGGG

AMV16F GCGCGACGGGGAGTCAATTGTGCCATTGCCATAACTGCTTTCG

AMV17R GCGCGACTCCCCGTCTTTGACTATCCTTTTTAGGATGGGGCA

ps1_up_fwd TACCGGAACAGGACCAAGCCTT

AMV01 GCGCCATATGTATACAGTAGGAGATTACCTATTAGAC

AMV12 GCAGCAGCAACATCAACTGGTAAG

AdhA-TMs TCAACTAGTGGTACCAGGAGATATAATATGAAAGCAGCAGTAGTAAG

adhA_RTr GACAATTCCAATTCCTTCATGACCAAG

Rnpbr CGGTATTTTTCTGTGGCACTGTCC

Rnpbf CAGCGGCCTATGGCTCTAATC

AV03_6F GAATCCGTAATCATGGTCATAGCTG

AV03_4R GCCAAAGCTAATTATTTCATGTCCTGT

AV03_1R TGTCGGGGCGCAGCCATGA

AV03_2F AGAGGATCCTTCTGAAATGAGCTG

AV03_3F CAGAGCCTAATCTTAAAGAATTCGTGG

AV03_4F GGGTAAACTATTTGCTGAACAAAATAAATC

AV03_2R CCGCTTCTGCGTTCTGATTTAATC

AV03_5F GTTGATCGGCGCGAGATTTAATCG

AV03_7F CCGTTGAAATTGACCGAGTACTTTCT

AV03_8F CAGTCGAAAGAGAAATTCATGGACC

AV03_5R CGCTACGGCGTTTCACTTCTG

472

473

474

475


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Documents

Metabolic engineering of Synechocystis 6803 for isobutanol