Ipomoea Testing Manual

Plant Health and Environment Laboratory Investigation and Diagnostic Centres and Response

PO Box 2095, 231 Morrin Road, Saint Johns, Auckland 1140, New Zealand

Telephone: +64-9-909 3015, Facsimile: +64-9-909 5739 www.mpi.govt.nz

Ipomoea (Sweetpotato/Kumara)

Post-Entry Quarantine Testing Manual

November 2012

Ipomoea Post-Entry Quarantine Testing Manual November 2012

ii

Ipomoea Post-Entry Quarantine Testing Manual

Contents 1. SCOPE ....................................................................................................................................................... 1 2. INTRODUCTION ..................................................................................................................................... 1 3. IMPORT REQUIREMENTS................................................................................................................... 3 4. PESTS ........................................................................................................................................................ 3

4.1 Regulated pests for which generic measures are required ........................................................... 3 4.2 Regulated pests for which specific tests are required ................................................................... 4

5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE .................... 4 5.1 Whole plants..................................................................................................................................... 4 5.2 Plants in tissue culture .................................................................................................................... 5 5.3 Pollen ................................................................................................................................................ 5

6. INSPECTION ............................................................................................................................................ 5 7. TESTING ................................................................................................................................................... 6

7.1 Specific tests for nursery stock ....................................................................................................... 7 7.1.1 Graft inoculation ......................................................................................................................... 8 7.1.2 Herbaceous indexing................................................................................................................. 10 7.1.3 Serological and molecular assays ............................................................................................ 11

7.1.3.1 Enzyme-linked immunosorbent assay (ELISA) .......................................................... 11 7.1.3.2 Polymerase chain reaction (PCR)................................................................................. 12

7.1.3.2.1 Virus reverse transcription-PCR .............................................................................. 14 7.1.3.2.1.1 Sweet potato chlorotic stunt virus ........................................................................ 18 7.1.3.2.1.2 Sweetpotato leaf curl virus ................................................................................... 18 7.1.3.2.1.3 Sweetpotato mild speckling virus ......................................................................... 18 7.1.3.2.1.4 Sweetpotato vein mosaic virus .............................................................................. 18 7.1.3.2.1.5 Tobacco streak virus ............................................................................................. 18

7.1.3.2.2 Phytoplasma PCR ....................................................................................................... 19 7.1.3.2.2.2 Sweetpotato little leaf phytoplasma ................................................................... 21

7.1.3.2.3 Bacteria PCR .............................................................................................................. 21 7.1.3.2.3.1 Dickeya chrysanthemi .......................................................................................... 21

7.1.4 Bacterial isolation on media ..................................................................................................... 22 7.1.4.1 Dickeya chrysanthemi (basonym. Erwinia chrysanthemi) ........................................... 22

7.1.5 Microscopic inspection for mites ............................................................................................. 23 7.1.5.1 Tetranychus evansi ......................................................................................................... 23

8. CONTACT POINT ................................................................................................................................. 24 9. ACKNOWLEDGEMENTS .................................................................................................................... 24 10. REFERENCES ........................................................................................................................................ 24 Appendix 1. Symptoms of significant regulated pests of Ipomoea batatas .................................................. 27

1.1 Meliodogyne incognita ................................................................................................................... 27 1.2 Rotylenchulus reniformis ............................................................................................................... 27 1.3 Tetranychus evansi ......................................................................................................................... 27 1.4 Plant damage caused by mites ...................................................................................................... 27 1.5 Streptomyces ipomoea .................................................................................................................... 28 1.6 Elsino batatas ................................................................................................................................ 28


iii

1.7 Dickeya chrysanthemi .................................................................................................................... 28 1.8 Ipomoea batatas infected with a mixture of viruses .................................................................... 29 1.9 Sweetpotato chlorotic stunt virus ................................................................................................... 29 1.10 Sweetpotato leaf curl virus ............................................................................................................. 29 1.11 Sweetpotato little leaf phytoplasma ............................................................................................. 29

Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa ............................................................... 30 2.1 Sweetpotato chlorotic stunt virus + Sweetpotato feathery mottle virus ......................................... 30 2.2 Sweetpotato virus 2 ......................................................................................................................... 30 2.3 Sweetpotato virus C6....................................................................................................................... 30 2.4 Sweetpotato leaf curl virus ............................................................................................................. 31 2.5 Sweetpotato leaf curl virus + Sweetpotato virus 2 ......................................................................... 31 2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle virus ................................................... 31

Appendix 3. Protocols referenced in manual ................................................................................................. 32 3.1 Silica-milk RNA extraction protocol ............................................................................................ 32 3.2 Phytoplasma DNA enrichment CTAB extraction protocol ........................................................ 32

Ministry for Primary Industries, November, 2012


1

1. SCOPE The scope of this manual is limited to Ipomoea batatas and Ipomoea setosa nursery stock (whole plants and plants in tissue culture), seed for sowing and pollen of Ipomoea species permitted entry into New Zealand as listed in the Ministry for Primary Industries (MPI) Plants Biosecurity Index (http://www.maf.govt.nz/cgi-bin/bioindex/bioindex.pl). At the date of publication of this manual, these species were as follows: Ipomoea alba Ipomoea aquatica Ipomoea arborescens Ipomoea batatas Ipomoea brasiliensis Ipomoea cairica Ipomoea carnea Ipomoea horsfalliae Ipomoea imperialis Ipomoea lobata Ipomoea minuta Ipomoea nil

Ipomoea noctiflora Ipomoea palmata (syn. Ipomoea cairica) Ipomoea pes-caprae Ipomoea platensis Ipomoea purpurea Ipomoea quamoclit Ipomoea sepacuitensis Ipomoea setosa Ipomoea sloteri Ipomoea tricolor Ipomoea tuberosa (syn. Merremia tuberosa)

Note: The importation of Ipomoea caerulea, Ipomoea hederacea, Ipomoea indica, Ipomoea learii (syn. Ipomoea indica), Ipomoea plebeia and Ipomoea triloba is prohibited. This manual describes the testing requirements specified in the import health standards for Ipomoea. The manual also provides an introduction to the crop and guidance on the establishment and maintenance of healthy plants in quarantine. 2. INTRODUCTION

Sweetpotato (Ipomoea batatas (L.) Lam.), a member of the family Convolvulaceae, probably originated in Central or South America, where it has been a food source for over 55,000 years. Sweetpotato was taken to Spain and early Spanish explorers are believed to have taken it to the Philippines and East Indies; from there it was soon carried to India, China, and Malaysia by Portuguese voyagers. It is not fully known how sweetpotato arrived in Polynesia, but it has been used on many of the islands in the South Pacific Ocean for at least 2000 years (Clark & Moyer, 1988).

Sweetpotato is grown in a wide range of environments under a range of farming systems, from the humid tropics to mild temperate zones, and from sea level to 2700 m altitude. Annual global production of sweetpotato currently exceeds 124 million tonnes. More than 95% of the global sweetpotato crop is grown in developing countries. China is the world's largest producer, accounting for more than 90%. Vietnam, Indonesia, and Uganda all grow more than two million tonnes per year. India and Rwanda each harvest more than a million tonnes annually. Of the 82 developing countries where sweetpotatoes grow, 36 are in Africa, 22 in Asia, and 24 in Latin America. Around 40 countries count sweetpotato among the five most important food crops produced on an annual basis.


2

The per capita income provided by sweetpotato is one of the lowest among the major food crops. Its potential benefit to poor farm households and urban consumers is only now being considered. Sweetpotato actually produces more edible energy per hectare per day than any other major food crop.

Sweetpotato is a perennial plant cultivated as an annual crop and propagated vegetatively. The sweetpotato plant is a prostrate vine system that expands horizontally and develops a shallow canopy. The sweetpotato plant produces several different types of thick and thin roots. Thick roots can differentiate into either pencil roots or storage roots, the latter being used for human consumption. Sweetpotatoes are not tubers as they are initiated at the first stem node below the soil line, to which they are attached by a stalk of thinner root (Clark & Moyer, 1988).

Although known for its tolerance to drought and its sensitivity to saturated soil condition, sweetpotato requires sufficient water and nutrients to produce good yield. Non-rooted stem cuttings (20-40 cm) with 5-8 nodes are harvested from storage roots laid out in nursery beds, and transplanted into the field. Sweetpotato can be cultivated continuously throughout the year in tropical regions, but in temperate regions the crop is planted in spring when the risk of frost is reduced. The crop requires a minimum frost-free period of 120-150 days and average daily temperatures of 22-24C along with good rainfall and good drainage (Clark & Moyer, 1988).

The flesh of sweetpotato can be white, purple, orange or yellow. Yellow and orange-fleshed varieties are valuable for their carotene (provitamin A) content. Skin colour ranges from nearly white through shades of buff to brown, or through pink to copper, even magenta and purple.

In New Zealand, sweetpotato (known as kumara) is a crop of cultural importance and an important food source. Kumara was introduced by Maori when they settled in New Zealand from Polynesia. Cultivation of this crop was undertaken on a large scale because of its importance as a food source. With the arrival of European settlers, other carbohydrate crops such as potato, wheat, and corn displaced sweetpotato in dietary importance but not the crops place in Maori culture. Since the 1950s, after efforts to select improved clones, production has steadily increased along with consumption as people rediscover kumara.

The local cultivar Owairaka Red, released in 1954, comprises 80% of the crop. Other cultivars include Toka Toka Gold, selected in 1972 (14%) and Beauregard (introduced in 1993). A range of other local varieties are also grown, usually in garden plots.

The area around Dargaville in the Kaipara district produces 85% of the national crop. Smaller plantings of approximately 5% are found around Auckland and Bay of Plenty. The area planted annually is approximately 1,100 hectares producing about 26,500 tonnes, with yields averaging 20 t/ha. Plantings range in area from garden plots to 30 ha, averaging 10 ha. Most of New Zealands production is for local fresh consumption although increasing amounts are processed and/or exported. A thorough review of this crop and its place in New Zealand agriculture is presented by Lewthwaite (1997).


3

3. IMPORT REQUIREMENTS The import requirements for I. batatas and I. setosa nursery stock (whole plant and plants in tissue culture) are set out in MPIs import health standard Importation of Nursery Stock (http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf). Imported nursery stock must meet the general requirements (sections 1-2) and the specific requirements detailed in the Ipomoea batatas schedule. On arrival in New Zealand, the nursery stock must be grown for a minimum period of 3 months in a Level 3 post-entry quarantine facility where it will be inspected, treated and/or tested for regulated pests. The import requirements for Ipomoea seed for sowing are set out in MPIs import health standard Importation of Seed for Sowing (http://www.biosecurity.govt.nz/files/ihs/155-02-05.pdf). Imported seed is only required to meet the general requirements (sections 1-2) and there are no specific requirements for the genus. An import permit is not required and seed meeting the import requirements is given biosecurity clearance at the border without the need for post-entry quarantine. The import requirements for pollen are stated in section 2.2.3 in MPIs import health standard Importation of Nursery Stock (http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf ) and further details can be found in section 5.3 of this manual. 4. PESTS The following section lists regulated pests of I. batatas and I. setosa nursery stock that require generic or specific measures. 4.1 Regulated pests for which generic measures are required Insects: Cylas formicarius Cylas puncticollis Euscepes postfasciatus Nematodes: Meliodogyne incognita [Fig. 1.1] Rotylenchulus reniformis [Fig. 1.2] Pratylenchus coffeae Pratylenchus brachyurus Fungi: Elsino batatas [Fig. 1.6] Helicobasidium mompa Bacteria: Pseudomonas batatas Streptomyces ipomoea [Fig. 1.5] Xanthomonas batatae Xylella fastidiosa


4

Viruses: Sweetpotato chlorotic fleck virus [Fig. 1.8] Sweetpotato latent virus Sweetpotato ringspot virus Sweetpotato virus C6 [Fig. 1.8, 2.3] 4.2 Regulated pests for which specific tests are required Mites: Tetranychus evansi [Fig. 1.3, 1.4] Bacteria: Dickeya chrysanthemi [Fig. 1.7] Phytoplasma: Sweetpotato little leaf phytoplasma [Fig. 1.11] Viruses: Sweetpotato caulimo-like virus Sweetpotato chlorotic stunt virus [Fig. 1.9, 2.1] Sweetpotato leaf curl virus [Fig. 1.10, 2.4, 2.5, 2.6] Sweetpotato leaf speckling virus Sweetpotato mild speckling virus Sweetpotato vein mosaic virus Sweetpotato yellow dwarf virus Tobacco streak virus 5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY

QUARANTINE 5.1 Whole plants Sweetpotato plants can be grown in the glasshouse all year round as long as a day-time temperature between 18-26C is maintained. Night-time temperatures should not fall below 12C to avoid chilling injury. Supplementary lighting may be required in winter. Sweetpotatoes require free-draining planting which is initially only moistened to avoid development of rots in quiescent storage roots. The plants can be watered more freely when the canopy has established and the plants are actively growing. The sweetpotato is a perennial plant and harvesting takes place when storage roots reach the desired size. Harvesting may be plant destructive, but if larger storage roots are removed with minimal plant disturbance, the remaining storage roots will continue to grow and new plants will form. Harvested roots should be stored in the dark at 13C. Storage temperatures should not fall below 12C which can cause chilling injury. Relative humidity during storage should be maintained at 80 to 90%. Roots stored in multi-walled paper bags can respire and maintain their own humid environment. Hessian or net bags should be avoided as they can cause abrasive injury and allow moisture and pathogen entry.


5

Whole plants should be planted into sufficiently sized pots (eg 3 L minimum) containing 50:50 (v/v) pasteurised peat:pumice planting media and a few grams of slow-release fertiliser with trace elements (e.g. Osmocote). Nodal cuttings should be taken from growing vines to maintain the clone and facilitate quarantine examination and testing. Cuttings with one or two leaves and at least two nodes can be rooted directly in pasteurised pumice sand or perlite before transferring to planting media. It would be worth preserving clonal material in tissue culture as a back-up resource, and to preserve any established virus-free status. Plants in tissue culture Tissue culture plantlets can be sub-cultured after arrival by cutting into nodal sections and placing into new tissue culture vessels with fresh nutrient media (e.g. Murashige and Skoog media). Plantlets to be tested are carefully excised from the tissue culture vessel and washed to remove any remaining agar and planted into pots of planting media containing 50:50 (v/v) pasturised peat:perlite or 50:50 (v/v) peat:vermiculite. The plantlets must be protected from desiccation for approximately three weeks by covering initially with a vented plastic tub or bag. Alternatively, the plants can be misted regularly to keep the planting media moist, and to maintain a high relative humidity. Pots should be placed in bright light, but not direct sunlight during the three weeks. After this period, any coverings should be removed and the plants moved to higher light intensity. 5.3 Pollen Anthers can be collected from mature but unopened flowers and dried in warm, light conditions. Following this drying period, pollen should be collected into a centrifuge vial or into gel capsules and stored at 4C in a sealed container in the presence of a strong desiccant such as calcium chloride. 6. INSPECTION The inspection requirements for the operator of the facility are set out in the MPI Biosecurity Authority Standard PBC-NZ-TRA-PQCON (http://www.biosecurity.govt.nz/files/regs/stds/pbc-nz-tra-pqcon.pdf ) Photographs of symptoms caused by significant regulated diseases can be found in Appendix 1. However, please note that pot-grown sweetpotato plants can be prone to nutrient deficiencies if not adequately fertilised and nutrient deficiencies can resemble virus infection, e.g. chlorosis and necrosis. Symptoms related to nutrient deficiencies can be found in Appendix 2. Further information on nutrient deficiencies is described in Clark & Moyer (1988).


6

7. TESTING Each of the specific tests required in the import health standard (as described in section 4 and summarised in Table 1) must be done irrespective of whether plants exhibit symptoms. This testing is required to detect latent infections. Samples should be tested as soon as possible after removal from the plant. If samples have to be stored before testing, the plant material must be kept whole, all surface water must be removed, and the material stored in a plastic bag at 4oC. Samples that become partially decayed or mouldy must not be tested, and further samples should be collected. Inspection for mites Inspection for mites is performed once whole plants or tissue culture plants have established successfully in planting media and have produced stems with at least 10-15 nodes. Inspection should take place before samples are taken for other testing methods. Using a hand lens, the underside of all leaves must be inspected for mite eggs, nymphs, adults and symptoms of mite presence. Following this, the 3 youngest leaves of each plant, plus any suspect leaves showing the presence of mites must be collected for further examination under a binocular microscope. See section 7.1.5 for further details. Indexing tests Graft inoculation: Grafting can begin when the whole plants or tissue culture plants have established successfully in planting media and have produced stems with at least 10-15 nodes. Grafting should take place before leaf samples are collected for other testing methods. See section 7.1.1 for further details. Each plant in the glasshouse must be tested individually by graft indexing Herbaceous indexing: Virus testing should be done in spring (or under spring-like conditions) when new growth has occurred. At least two fully expanded leaves must be sampled from each of two different branches of the main stem, one a younger leaf and one an older leaf from a mid-way position. Each plant in the glasshouse must be tested individually by herbaceous indexing. See section 7.1.2 for further details PCR and ELISA testing Viruses: For virus-testing of I. batatas by PCR and ELISA, it is recommended to test the graft-inoculated indicator plants rather than the original test plants. However, original I. setosa plants can be tested directly. Virus testing should be done in spring (or under spring-like conditions) when new growth has occurred. At least two fully expanded leaves must be sampled from each of two different branches of the main stem, one a younger leaf and one an older leaf from a mid-way position. The sampled leaves from each plant must be bulked together and tested as soon as possible after removal from the host. See section 7.1.3 for further details. Bacteria and phytoplasma: Bacteria and phytoplasma testing must be carried out using the original I. batatas and I. setosa plants and should be done in summer (or under summer-like conditions). For each plant, at least two fully expanded leaves must be sampled from each of two different branches of the main stem, one a younger leaf and one an older leaf from a mid-way position. Detection of both bacteria and phytoplasma requires testing of leaf petioles and mid-veins. The sampled leaves from each plant must be bulked together and tested as soon as possible after removal from the host. See section 7.1.3 for further details


7

Bacterial isolation on media Isolation of regulated bacteria testing must be carried out using the original I. batatas and I. setosa plants and should be done in summer (or under summer-like conditions). For each plant, at least two fully expanded leaves must be sampled from each of two different branches of the main stem, one a younger leaf and one an older leaf from a mid-way position. Detection of bacteria requires plating vascular tissue from petioles mid-veins. Each plant in the glasshouse must be tested individually. See section 7.1.4 for further details.

Table 1: Summary of the regulated pests for I. batatas and I. setosa indicating the specific tests that are required (), alternative () or optional ()

Organism Type Graft Inoculation1

Herbaceous Indexing

ELISA PCR

Isolation on media

Inspection

Mites Tetranychus evansi Bacterium Dickeya chrysanthemi Phytoplasma Sweetpotato little leaf phytoplasma

Viruses Sweetpotato caulimo-like virus Sweetpotato chlorotic stunt virus

Sweetpotato leaf curl virus2 Sweetpotato leaf speckling virus

Sweetpotato mild speckling virus

Sweetpotato vein mosaic virus Sweetpotato yellow dwarf virus Tobacco streak virus

1Not required for I. setosa; 2ssDNA Geminivirus 7.1 Specific tests for nursery stock Each plant must be tested separately with the following exceptions, samples from up to 5 plants may be bulked for testing provided that either:

(a) the plants are derived from a single imported plant or plant established from a storage root from which separate cuttings have been taken upon arrival in New Zealand, in the presence of a MPI inspector; or

(b) in the case of tissue culture where plants are clonal, and this is confirmed by evidence from the national plant protection organisation in the exporting country.


8

7.1.1 Graft inoculation Each I. batatas plant must be tested by graft inoculation using a minimum of 3 replicate indicator plants of either I. setosa or I. nil Scarlet O Hara. Indicator plants must be maintained in a healthy, vigorous state, as symptoms associated with abiotic stresses, such as water and nutrient deficiencies, may mask and interfere with observations of disease symptoms. The indicator plants can be grown from seed or from young cuttings. If using seed, sow 3-4 weeks before grafting. Sweetpotato seed requires scarification prior to germination. Indicator seeds are soaked in concentrated sulphuric acid (98%) for 20 minutes (I. nil) or 60 minutes (I. batatas). Seeds are then rinsed in running tap water 3-4 times prior to planting in moist planting media. The method for propagating sweetpotato plants from seed is described in full by Saladaga et al. (1991). The indicator plants are ready for grafting when they have two or more fully expanded leaves. To avoid cross-contamination of plants during the grafting process, use a sterile scalpel for each sweetpotato plant to be tested. Recommended method 1. Begin grafting by cutting indicator plants back to 2 true leaves. 2. Sweetpotato plants are tested by wedge-grafting. Each sweetpotato plant that is to be

used for indexing should be established with a minimum of five nodes. Remove a branch from the sweetpotato plant to be indexed and cut the branch into 5 sections, each containing a node with a fully expanded leaf attached.

3. Wedge-graft each node section onto a separate indicator plant. 4. To prevent desiccation, wrap the graft with parafilm, or similar. 5. Cover the whole plant with a plastic bag to reduce airflow around the graft. 6. Remove the plastic bag 5-7 days after grafting. 7. Fertilise the indicator plant with a slow-release fertiliser (e.g. Osmocote) and insert a

bamboo-stake into the pot to support the growth of the plant. 8. Grow the indicator plants to at least 10-15 nodes; this will take approximately 3-5 weeks.

During the growth period, monitor the indicator plants daily for virus symptoms which may only show for a short period of time.

9. Some sweetpotato grafts may grow faster than the indicator plant, cut any sweetpotato growth back to ensure the indicator plant grows well.

10. At the end of the 3-5 week growth period, cut the indicator plants back to 1-2 buds and re-grow for 3-5 weeks. Re-growth should again be closely monitored daily for virus symptoms.

11. A positive control must be included with each batch of inoculations. For the positive control, graft a sweetpotato plant known to be infected with a non-regulated virus, e.g. Sweetpotato feathery mottle virus (SPFMV).

12. It is recommended to include a negative control with each batch of inoculations. For the negative indicator, cut back to 2 true leaves, as for grafted plants, but do not graft.


9

Note: Sweetpotato plants are sensitive to some pesticides and spray damage can induce mosaic-like symptoms. In addition, plants suffering from nutrient deficiencies can show leaf chlorosis and necrosis.

Interpretation of results Symptoms on I. setosa usually appear within 2-4 weeks, and on I. nil around one week. However, the severity of virus symptoms and length of time before they appear on the indicator plants depends upon the virus and the amount of virus inoculum present in the scion. The graft inoculation results will only be considered valid if:

(a) no symptoms are produced on the negative control (non-grafted) indicator plant; and (b) the expected symptoms are produced on the indicator hosts with the positive control

(non-regulated virus). If SPFMV was used as the positive control, the following symptoms will be produced on the indicator plants:

I. setosa vein clearing followed by remission. I. nil systemic vein clearing, vein banding, ringspots. The symptoms produced by each of the regulated viruses on the indicator species I. setosa and I. nil are described below. Sweetpotato caulimo-like virus: I. setosa chlorotic flecks along the secondary veins and interveinal chlorotic spots on

leaves.

Sweetpotato chlorotic stunt virus: I. setosa stunting, yellowing and leaf deformation, although symptoms maybe mild

depending on isolate. I. nil stunting, yellowing and leaf deformation, although symptoms maybe mild

depending on isolate. Sweetpotato leaf curl virus: I. setosa curling of young leaves. I. nil curling of young leaves. Sweetpotato leaf speckling virus: I. setosa chlorotic and necrotic spotting, dwarfing and leaf curling. I. nil chlorotic and necrotic spotting, dwarfing and leaf curling.

Sweetpotato mild speckling virus: I. setosa mild mosaic sometimes observed in first two true leaves.

Sweetpotato vein mosaic virus: I. setosa systemic vein-clearing and mosaic. I. nil systemic vein-clearing and mosaic. Sweetpotato yellow dwarf virus: I. setosa chlorotic leaf mottling.


10

7.1.2 Herbaceous indexing Each I. batatas and I. setosa plant must be tested for mechanically-transmitted regulated viruses using herbaceous indicators, this is in addition to graft inoculation. Sap must be inoculated onto two plants of each herbaceous species as follows: Chenopodium quinoa, Nicotiana benthamiana, N. clevelandii and N. tabacum. It is important that the pre- and post-inoculation growing conditions of the herbaceous indicator plants promote their susceptibility. Plants must be grown at 18-25oC. The stage of development to ideally inoculate the indicator plants is 4-6 fully expanded true leaves for Chenopodium spp., and 4 fully expanded leaves for Nicotiana spp. Recommended method 1. Place indicator plants in dark for 16-24 hours prior to inoculation to increase

susceptibility. 2. Grind leaf tissue (approximately 1/4; w/v) in 0.1 M sodium phosphate buffer (pH 7.5),

containing 5% (w/v) polyvinylpyrrolidone (PVP-40) and 0.12% (w/v) sodium sulphite (Na2SO3). A negative (inoculation buffer only) and a positive control must be included in each batch of inoculations. The positive control is a non-regulated virus which is moderately transmissible and produces clear symptoms on the herbaceous indicators, (e.g. Arabis mosaic virus). The plants must be inoculated in the following order: (a) inoculation buffer only; then (b) imported plants to be tested; then (c) positive control (non-regulated virus).

3. Select two young fully expanded leaves preferably opposite leaves, to be inoculated on each plant and mark them by piercing holes with a pipette tip.

4. Lightly dust the leaves with Celite or carborundum powder. Alternatively, a small amount of Celite or carborundum powder may be mixed with the sap extract.

5. Using a gloved finger gently apply the sap to the marked leaves of the indicator plants, stroking from the petiole towards the leaf tip while supporting the leaf below with the other hand.

6. After 3-5 minutes rinse inoculated leaves with water. 7. Grow inoculated plants for a minimum of 4 weeks. Inspect and record plants twice per

week for symptoms of virus infection. The Arabis mosaic virus positive control may be obtained from: 1. ATCC Cat. No. PV-192, PV-589, PV-590 (http://www.atcc.org). 2. DSMZ Cat. No. PV-0045, PV-0046, PV-0215, PV-0216, PV-0217, PV-0230, PV-0232

(http://www.dsmz.de). 3. The MPI (see the Contact Point, section 8) (available as freeze-dried leaf material or

nucleic acid). A charge may be imposed to recover costs. Interpretation of results The herbaceous indexing results will only be considered valid if:

(a) no symptoms are produced on the indicator hosts with the negative control (inoculation buffer only); and

(b) the correct symptoms are produced on the indicator hosts with the positive control (non-regulated virus). If Arabis mosaic virus was used as the positive control, the following symptoms will be produced on the herbaceous indicators: C. quinoa local lesions, and systemic chlorotic mottling.


11

N. benthamiana not susceptible. N. clevelandii local lesions, systemic chlorotic spots, rings and lines. N. tabacum local lesions, systemic chlorotic spots, rings and lines.

The virus symptoms produced on herbaceous indicators are described below. Sweetpotato yellow dwarf virus: C. quinoa susceptible, but no information is available on symptoms.

Tobacco streak virus: N. tabacum systemic vein clearing, then downward curling of the leaf and its margins. 7.1.3 Serological and molecular assays ELISA OR PCR MUST be carried out for the following viruses:

Sweetpotato vein mosaic virus Tobacco streak virus

ELISA OR PCR is OPTIONAL for the following virus:

Sweetpotato mild speckling virus

PCR MUST be carried out for the following organisms: Sweetpotato chlorotic stunt virus Sweetpotato leaf curl virus Sweetpotato little leaf phytoplasma

PCR OR selective media MUST be carried out for the following bacterium:

Dickeya chrysanthemi

7.1.3.1 Enzyme-linked immunosorbent assay (ELISA) Recommended method 1. Perform the ELISA according to the manufacturers instructions. The following controls

must be included on each ELISA plate: (a) positive control: infected leaf tissue or equivalent (Table 2); and (b) negative control: sweetpotato tissue that is known to be healthy; and (c) buffer control: extraction buffer only.

2. Add each of the samples and controls to the ELISA plate as duplicate wells. It is not recommended to perform ELISA with plant samples or sap that has been frozen.

3. Measure the optical density 60 minutes after addition of the substrate (or as per manufacturers instructions).


12

Table 2: Source of antisera and positive controls for ELISA

Pathogen Antisera Positive/negative control2

Sweetpotato vein mosaic virus and Sweetpotato mild speckling virus

Agdia Cat No. PSA27200 (Potyvirus group: Pathoscreen kit) 1,2

Agdia Cat No. LNC 27200 Agdia Cat No. LNP 27200

Tobacco streak virus Agdia Cat No. PSA25500 (Pathoscreen kit) 1,2

Agdia Cat No. LPC25500

1Catalogue numbers for the complete reagent sets are given, the antisera and reagents can also be purchased separately.

2The positive control is included if the Pathoscreen set is purchased. Further information about the kits and the supplier listed in Table 2 can be found at the following website:

Agdia Incorporated, USA (http://www.agdia.com). Interpretation of results A result is considered positive if the mean absorbance of the two replicate wells is greater than 2 times the mean absorbance of the negative control. The test will only be considered valid if:

(a) the absorbance for the positive and negative controls are within the acceptable range specified by the manufacturer; and

(b) the coefficient of variation (standard deviation / mean 100), between the duplicate wells is less than 20%.

If the test is invalid, it must be repeated with freshly-extracted sample. Samples that are close to the cut-off must be retested or tested using an alternative method recommended in the import health standard (see Table 1). 7.1.3.2 Polymerase chain reaction (PCR) The following section describes the molecular tests required for regulated pests listed on the import health standard for I. batatas and I. setosa. The recommended published PCR primers for these tests are listed in Table 3 along with plant internal control primers for RNA and DNA. The inclusion of an internal control assay is recommended to eliminate the possibility of PCR false negatives due to extraction failure, nucleic acid degradation or the presence of PCR inhibitors. It is strongly recommended to extract nucleic acid from indicator plants (I. setosa or I. nil), 3 to 5 weeks after grafting rather than extracting directly from I. batatas test plants. Viruses present in I. batatas can be unevenly distributed in the plant and virus titre can fluctuate over time. Virus levels in grafted indicator plants have been found to be higher in comparison with I. batatas (Kokkinos & Clark, 2006). The PCR reagents listed for the methods described in this section have been tested by the Plant Health & Environment Laboratory, MPI. Alternative reagents may give similar results but will require validation.


13

Table 3: PCR primers used for the detection of regulated pests of I. batatas and I. setosa, and plant internal controls

Target organism

Primer name

Sequence (5-3) TM (C)

Band (bp)

Reference

Bacterium Dickeya chrysanthemi (Use both assays to detect all pathovars)

ADE1 ADE2

GATCAGAAAGCCCGCAGCCAGAT CTGTGGCCGATCAGGATGGTTTTGTCGTGC

72 420 Nassar et al., 1996

recAF recAR

GGTAAAGGGTCTATCATGCG CCTTCACCATACATAATTTGGA

47 760 Waleron et al., 2002

Phytoplasma Sweetpotato little leaf phytoplasma

P1 P7

AAGAGTTTGATCCTGGCTCAGGATT CGTCCTTCATCGGCTCTT

53 1800 Deng & Hiruki, 1991; Schneider et al., 1995

R16F2 R16R2

ACGACTGCTAAGACTGG TGACGGGCGGTGTGTACAAACCCCG

50 1248 Lee et al., 1993

Phyto-F Phyto-R Phyto-P2

CGTACGCAAGTATGAAACTTAAAGGA TCTTCGAATTAAACAACATGATCCA FAM-TGACGGGACTCCGCACAAGCG -NFQ3

60 75 Christensen et al., 2004

Viruses Sweetpotato chlorotic stunt virus (Use both assays to detect East & West African strains)

SPCSV-F SPCSV-R SPCSV-P2

CGAATCAACGGATCGGAATT CCACCGACTATTACATCACCACTCT (MGB)FAM-ATCCCAACGTGTTTATCT A-NFQ3

60 71 Kokkinos & Clark, 2006

EASPCSV-38F EASPCSV-126R EASPCSV-67P2

GGAGTTTATTCCCACCTGTYTATCT GTAATTGCGAAGAATCYAAAACCT FAM-CGGCTACAGGCGACGTGGTTG TTG-NFQ3

60 90 N. Boonham (Unpublished)

Sweetpotato leaf curl virus1

SPG1 SPG2

ATCCVAAYWTYCAGGGAGCTAA CCCCKGTGCGWRAATCCAT

58 934 Li et al., 2004

SPLCV-F SPLCV-R SPLCV-P2

GGCGCCTAAGTATGGCTGAA AACCGTATAAAGTATCTGGGAGT GGT (MGB)FAM-GTGGGACCCTTTGC-NFQ3

66 60 Kokkinos & Clark, 2006

Sweetpotato mild speckling virus and Sweetpotato vein mosaic virus

Oligo1n Oligo2n

ATGGTHTGGTGYATHGARAAYGG TGCTGCKGCYTTCATYTG

50 327 Marie-Jeanne et al., 2000

Tobacco streak virus IlarlF5 IlarlR7

GCNGGWTGYGGDAARWCNAC AMDGGWAYYTGYTYNGTRTCACC

48 300 Untiveros et al., 2010

Internal Control Plant DNA control Gd1

Berg54 ACGGAGAGTTTGATCCTG AAAGGAGGTGATCCAGCCGCACCTTC

50-62 1500 Andersen et al., 1998

Plant RNA control Nad5-s Nad5-as

GATGCTTCTTGGGGCTTCTTGTT CTCCAGTCACCAACATTGGCATAA

50-60 180 Menzel et al., 2002

Plant NA control COX-F COX-R COX- P2

CGTCGCATTCCAGATTATCCA CAACTACGGATATATAAGAGCCAAAACTG FAM-TGCTTACGCTGGATGGAATG CCCT- NFQ3

60 74 Weller et al., 2000

1Single stranded DNA virus; 2Real-time probe; 3NFQ = Non-fluorescent quencher.


14

7.1.3.2.1 Virus reverse transcription-PCR Recommended method for RNA viruses: conventional RT-PCR 1. Extract total RNA from leaf tissue according to a standard protocol. Successful RT-PCR

amplification can be achieved using the following RNA extraction procedures: (a) Qiagen RNeasy Plant Mini Kit (Qiagen Cat. No. 74904); or (b) a silica-based method as described by Menzel et al. (2002); or (c) InviMag Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL

workstation. Commercial kits are used as described by the manufacturer. See Appendix 3 for details of other extraction methods. Alternative methods may also be used after validation.

2. Optional: Perform a one-step RT-PCR on the RNA with the Nad5 internal control primers (Table 3) using the components and concentrations listed in Table 4 and cycle under the conditions listed in Table 6. The Nad5 primers amplify mRNA from plant mitochondria.

3. Perform a one-step RT-PCR on the RNA with the pathogen-specific primers (Table 3) using the components and concentrations listed in Table 4 and cycle under the conditions listed in Table 6. The following controls must be included for each set of RT-PCR reactions: (a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and (b) no template control: water is added instead of RNA template. When setting up the test initially, it is advised that a negative control (RNA extracted from healthy Ipomoea leaf tissue) is included. Please note that the Nad5 internal control primers do not reliably amplify a product from RNA extracted from freeze-dried material. We therefore recommend mixing fresh healthy Ipomoea leaf material with freeze-dried positive control material (3:1 w/w) prior to carrying out the extraction.

4. Analyse the PCR products by agarose gel electrophoresis. Recommended method for DNA viruses: conventional PCR 1. Extract total DNA from leaf tissue according to a standard protocol. Successful PCR

amplification can be achieved using (a) Qiagen DNeasy Plant Mini Kit (Qiagen Cat. No. 69104); or (b) InviMag Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL

workstation. Commercial kits are used as described by the manufacturer. Alternative methods may also be used after validation.

2. Optional: Perform a PCR on the DNA with the Gd1/Berg54 internal control primers (Table 3) using the components and concentrations listed in Table 5 and cycle under the conditions listed in Table 6. The Gd1/Berg54 primers amplify the 16S rRNA gene from most prokaryotes as well as from chloroplasts.

3. Perform a PCR on the DNA with the pathogen-specific primers (Table 3) using the components and concentrations listed in Table 5 and cycle under the conditions listed in Table 6. The following controls must be included for each set of PCR reactions: (a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and (b) no template control: water is added instead of DNA template. When setting up the test initially, it is advised that a negative control (DNA extracted from healthy Ipomoea leaf tissue) is included.

4. Analyse the PCR products by agarose gel electrophoresis.


15

Interpretation of results for conventional (RT) PCR The RT-PCR or PCR test will only be considered valid if:

(a) the positive control produces the correct size product as indicated in Table 3; and (b) no bands are produced in the negative control (if used) and the no template control.

If the Nad5 or Gd1/Berg54 internal control primers are also used, then the negative control (if used), positive control and each of the test samples must produce a 181 bp (Nad5) or 1500 bp (Gd1/Berg54) band. Failure of the samples to amplify with the internal control primers suggests that the nucleic acid extraction has failed or compounds inhibitory to PCR are present in the nucleic acid extract, or the nucleic acid has degraded.

Table 4: RT-PCR reaction components for RNA templates using Invitrogen SuperScript III One-step RT-PCR System with Platinum Taq DNA polymerase

Reagent Volume per reaction (l) Nuclease-free water 4.2 10 Reaction mix (Invitrogen 12574-026) 10.0 5 M Forward primer (250 nM) 1.0 5 M Reverse primer (250 nM) 1.0 SuperScript III/ RT/ Platinum Taq Mix 0.8 10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888) 1.0 RNA template 2.0 Total volume 20.0

Table 5: PCR reaction components for DNA templates using Promega GoTaq Green Master Mix

Reagent Volume per reaction (l) Nuclease-free water 4.0 GoTaq Green Master Mix (Promega M7122) 10.0 50 mM MgSO4 (4 mM final)* 1.0* 5 M Forward primer (250 nM) 1.0 5 M Reverse primer (250 nM) 1.0 10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888) 1.0 DNA template 2.0 Total volume 20.0

*Li et al. (2004) PCR only, for all other primers, adjust water volume accordingly

Table 6: Generic PCR cycling conditions

Step Temperature Time No. of cycles RT step only 50oC 30 min 1 Initial denaturation 94oC 2 min 1 Denaturation 94oC 30 sec

40 Annealing See Table 3 30 sec

Elongation 72oC 30 to 45 sec (virus/bacteria) 1 min (phytoplasma) Final elongation 72oC 7 min 1


16

Recommended method for RNA viruses: real-time RT-PCR 1. Extract total RNA from leaf tissue according to a standard protocol (as described above). 2. Set-up a one-step RT-PCR using pathogen-specific primers (Table 3) and the components

and concentrations listed in Table 7 and cycle under the conditions listed in Table 8. Please note that reaction and cycling conditions can be changed depending on the real-time machine used, but this would require validation.

3. Optional: Perform a one-step RT-PCR on the nucleic acid using the COX internal control primers (Table 3) and the components and concentrations listed in Table 7 and cycle under the conditions listed in Table 8. The COX primers amplify the constitutive cytochrome oxidase 1 gene found in plant mitochondria (note: this assay is not RNA specific).

4. The following controls must be included for each set of reactions: (a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and (b) no template control: water is added instead of RNA template.

5. When setting up the test initially, it is advised that a negative control (RNA extracted from healthy Ipomoea leaf tissue) is included.

6. Analyse real-time amplification data according to the manufacturers instructions accompanying the real-time PCR machine.

Recommended method for DNA viruses: real-time PCR 1. Extract total DNA from leaf tissue according to a standard protocol (as described above). 2. Set-up the PCR using pathogen-specific primers (Table 3) and the components and

concentrations listed in Table 9 and cycle under the conditions listed in Table 10. Please note that reaction and cycling conditions can be changed depending on the real-time machine used, but this would require validation.

3. Optional: Perform PCR on the nucleic acid using the COX internal control primers (Table 3), and using the components and concentrations listed in Table 9 and cycle under the conditions listed in Table 10.

4. The following controls must be included for each set of reactions: (a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and (b) no template control: water is added instead of DNA template

5. When setting up the test initially, it is advised that a negative control (DNA extracted from healthy Ipomoea leaf tissue) is included.

6. Analyse real-time amplifcation data according to the manufacturers instructions accompanying the real-time PCR machine.

Table 7: Real-time RT-PCR reaction components for RNA templates using Invitrogen Superscript III One-step qRT PCR system

Reagent Volume per reaction (l) Nuclease-free water 4.3 2 Reaction Mix (Invitrogen 11730-017) 10.0 10 g/l Bovine Serum Albumin (BSA) (Sigma A7888) 0.5 5 M Forward primer (300 nM) 1.2 5 M Reverse primer (300 nM) 1.2 5 M Dual-labelled fluorogenic probe (100 nM) 0.4 Superscript III RT/Platinum Taq Mix 0.4 RNA 2.0 Total volume 20.0


17

Table 8: Generic cycling conditions for RNA real-time RT-PCR

Step Temperature Time No. of cycles RT-Step 50C 30 min 1 Initial denaturation 95oC 2 min 1 Denaturation 95oC 10 sec 40 Annealing & elongation See Table 3 40 sec

Table 9: Real-time PCR reaction componnets for DNA templates using Invitrogen Platinum qPCR SuperMix-UDG

Reagent Volume per reaction (l) Nuclease-free water 4.6 Platinum Quantitative PCR Supermix-UDG (Invitrogen 11730-017) 10.0 10 g/l Bovine Serum Albumin (BSA) (Sigma A7888) 0.6 5 M Forward primer (300 nM) 1.2 5 M Reverse primer (300 nM) 1.2 5 M Dual-labelled fluorogenic probe (100 nM) 0.4 DNA 2.0 Total volume 20.0

Table 10: Generic cycling conditions for DNA real-time PCR

Step Temperature Time No. of cycles UDG incubation hold (Invitrogen only)

50C 2 min 1

Initial denaturation 95C 2 min (Invitrogen) 5 min (Roche)

1

Denaturation 95C 10 sec 40 Annealing & elongation See Table 3 40 sec

Interpretation of results for real-time PCR The real-time PCR or RT-PCR test will only be considered valid if:

(a) the positive control produces an amplification curve with the pathogen-specific primers; and

(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative control (if used) and the no template control.

If the COX internal control primers are also used, then the negative control (if used), positive control and each of the test samples must produce an amplification curve. Failure of the samples to produce an amplification plot with the internal control primers suggests that the nucleic acid extraction has failed or compounds inhibitory to PCR are present in the nucleic acid extract, or the nucleic acid has degraded. Virus positive controls for PCR Tobacco streak virus positive control controls may be obtained from the following sources: 1. American Type Culture Collection (ATCC; http://www.atcc.org): No. PV-276, PV-31,

PV-352, PV-353, PV-360. 2. DSMZ Culture Collection (http://www.dsmz.de): PV-0309, PV-0612, PV-0738. 3. The commercial source listed in Table 2.


18

Positive control material, in the form of nucleic acid, for Sweetpotato chlorotic stunt virus and Sweetpotato leaf curl virus and Tobacco streak virus may be obtained from MPI (see the Contact Point, section 8). Positive control material for Sweetpotato vein mosaic virus and Sweetpotato mild speckling virus is currently unobtainable; however, an alternative Potyvirus may be used for the PCR. Potyvirus positive controls in the form of nucleic acid may also be obtained from the MPI. A charge may be imposed to recover costs. 7.1.3.2.1.1 Sweet potato chlorotic stunt virus Plants must be tested for Sweetpotato chlorotic stunt virus by real-time PCR using the primer pairs listed in Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of results. Please note that SPCSV should be tested with both sets of primers listed in Table 3 in order to detect both East and West African strains. 7.1.3.2.1.2 Sweetpotato leaf curl virus Plants must be tested for Sweetpotato leaf curl virus by PCR or real-time PCR using the primer pairs listed in Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of results. Please note the Li et al., (2004) PCR should be cycled as shown in Table 11

Table 11: Cycling conditions for SPLCV PCR

Step Temperature Time No. of Cycles Initial denaturation 94oC 2 min 1 Denaturation 94oC 30 sec

40 Annealing 58C 30 sec Elongation 68oC 90 sec Final elongation 68oC 3 min 1

7.1.3.2.1.3 Sweetpotato mild speckling virus Plants can be tested for Sweetpotato mild speckling virus by RT-PCR using the primer pairs listed in Table 3. Please note that a suitable positive control is not available for Sweetpotato mild speckling virus, however, the PCR has been validated with other potyviruses. See section 7.1.3.2.1 for details of test methods and interpretation of results. 7.1.3.2.1.4 Sweetpotato vein mosaic virus Plants must be tested for Sweetpotato vein mosaic virus by RT-PCR using the primer pairs listed in Table 3. Please note that a suitable positive control is not available for Sweetpotato vein mosaic virus, however, the PCR has been validated with other potyviruses. See section 7.1.3.2.1 for details of test methods and interpretation of results. 7.1.3.2.1.5 Tobacco streak virus Plants must be tested for Tobacco streak virus by RT-PCR using the primer pair listed in Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of results.


19

7.1.3.2.2 Phytoplasma PCR Recommended method phytoplasma: conventional PCR 1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol.

Successful PCR amplification can be achieved using the following DNA extraction procedures: (a) Qiagen DNeasy Plant Mini Kit (Qiagen Cat. No. 69104); or (b) phytoplasma enrichment procedure as described by Kirkpatrick et al. (1987) and

modified by Ahrens & Seemller (1992); or (c) InviMag Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL

workstation. Commercial kits are used as described by the manufacturer. See Appendix 3 for details of other extraction methods. Alternative methods may also be used after validation.

2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers (Table 3) using the components and concentrations listed in Table 5 (section 7.1.3.2.1) and cycle under the conditions listed in Table 6 (section 7.1.3.2.1). The Gd1/Berg54 primers amplify the 16S rRNA gene from most prokaryotes as well as from chloroplasts.

3. Perform a nested PCR on the purified DNA using the universal phytoplasma primer pair P1/P7 (Table 3), for the first-stage PCR, followed by the R16F2/R16R2 primer pair (Table 3) for the second-stage PCR.

4. Set-up the first-stage and second-stage PCR reactions using the components and concentrations listed in Table 5 (section 7.1.3.2.1) and cycle under the conditions listed in Table 6 (section 7.1.3.2.1). The first-stage PCR products are diluted 1:25 (v/v) in water prior to re-amplification using the second-stage PCR primers.

5. The following controls must be included for each set of PCR reactions: (a) positive control: total DNA or a cloned fragment from the appropriate organism may

be used. If the internal control primers are not used, then the DNA must be mixed with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; and

(b) no template control: water is added instead of DNA template. When setting up the test initially, it is advised that a negative control (DNA extracted from healthy Ipomoea leaf tissue) is included.

6. Analyse the PCR products (second-stage PCR products only) by agarose gel electrophoresis.

Interpretation of results The pathogen-specific PCR test will only be considered valid if:


If the Gd1/Berg54 internal control primers are also used, then the negative control (if used), positive control and each of the test samples must produce a 1500 bp band. Failure of the samples to amplify with the control primers suggests that either the DNA extraction has failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An effective method to further purify the DNA is by using MicroSpin S-300 HR columns (GE Healthcare Cat. No. 27-5130-01). Recommended method for phytoplasma: Real-time PCR 1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol (as

described above). 2. Set-up the real-time PCR using pathogen-specific primers (Table 3) and the components

and concentrations listed in Table 12 and cycle under the conditions listed in Table 10.


20

The reaction and cycling conditions can be changed depending on the real-time reagents and machine used, but this would require validation.

3. Optional: Perform PCR on the nucleic acid using the COX internal control primers (Table 3), and using the components and concentrations listed in Table 12 and cycle under the conditions listed in Table 10.

4. The following controls must be included for each set of reactions: (a) Positive control: total DNA or a cloned fragment from the appropriate organism

may be used. If the internal control primers are not used, then the DNA must be mixed with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; and

(b) no template control: water is added instead of DNA template 5. When setting up the test initially, it is advised that a negative control (DNA extracted

from healthy Ipomoea leaf tissue) is included. 6. Analyse real-time amplification data according to the real-time thermocycler

manufacturers instructions.

Table 12: Real-time PCR reaction components for phytoplasma using Roche LightCycler 480 Probes Mastermix

Reagent Volume per reaction (l) Nuclease-free water 4.3 2 Reaction Mix (Roche 04707494001) 10.0 10 g/l Bovine Serum Albumin (BSA) (Sigma A7888) 0.8 5 M Forward primer (300 nM) 1.2 5 M Reverse primer (300 nM) 1.2 5 M Dual-labelled fluorogenic probe (100 nM) 0.5 DNA 2.0 Total volume 20.0

Interpretation of results for real-time PCR The real-time PCR test will only be considered valid if:

(a) the positive control produces an amplification curve with the pathogen-specific primers; and

(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative control (if used) and the no template control.

If the COX internal control primers are also used, then the negative control (if used), positive control and each of the test samples must produce an amplification curve. Failure of the samples to produce an amplification plot with the internal control primers suggests that the DNA extraction has failed or compounds inhibitory to PCR are present in the DNA extract or the DNA has degraded. The effect of inhibitors may be overcome by adding Bovine Serum Albumin (BSA) to a final concentration of 0.5g/l. Alternatively, DNA may be further purified using MicroSpin S-300 HR columns (GE Healthcare Cat. No. 27-5130-01). Phytoplasma positive controls for PCR Positive control material for Sweetpotato little leaf phytoplasma (available as DNA) may be obtained from MPI (see the Contact Point, section 8). A charge may be imposed to recover costs.


21

7.1.3.2.2.2 Sweetpotato little leaf phytoplasma Plants must be tested for Sweetpotato little leaf phytoplasma using the universal primers listed in Table 3. See section 7.1.3.2.2 for details of test methods and interpretation of results. 7.1.3.2.3 Bacteria PCR Recommended method bacteria: conventional PCR 1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol.

Successful PCR amplification can be achieved using the following DNA extraction procedures: (a) Qiagen DNeasy Plant Mini Kit (Qiagen Cat. No. 69104); or (b) InviMag Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL

workstation. 2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers listed in Table 3

using the components and concentrations listed in Table 5 and cycled as shown in table 6. 3. Perform a PCR with bacteria-specific primers on the purified DNA using the components

and concentrations listed in Table 5. See Table 13, section 7.1.3.2.3.1 for details of PCR cycling conditions. The following controls must be included for each set of PCR reactions: (a) positive control: total DNA or a cloned fragment from the appropriate organism may

be used. If the internal control primers are not used, then the DNA must be mixed with healthy Ipomoea DNA to rule out the presence of PCR inhibitors;

(b) no template control: water is added instead of DNA template. When setting up the test initially, it is advised that a negative control (DNA extracted from healthy Ipomoea tissue) is included.

4. Analyse the PCR products by agarose gel electrophoresis. Interpretation of results The pathogen-specific PCR test will only be considered valid if:


If the Gd1/Berg54 internal control primers are also used, then the negative control (if used), positive control and each of the test samples must produce a 1500 bp band. Failure of the samples to amplify with the control primers suggests that either the DNA extraction has failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An effective method to further purify the DNA is by using MicroSpin S-300 HR columns (GE Healthcare Cat. No. 27-5130-01). Bacterial positive controls for PCR Positive control material for Dickeya chrysanthemi (available as DNA) may be obtained from MPI (see the Contact Point, section 8). A charge may be imposed to recover costs.

7.1.3.2.3.1 Dickeya chrysanthemi Plants must be tested for Dickeya chrysanthemi using the primer pairs ADE1/ADE2 and recAF/recAR (Table 3). See section 7.1.3.2.3 for details of test methods and interpretation of results. Please note that PCRs are cycled as shown in Tables 13 and 14.


22

(a) Primers recAF/recAR (Waleron et al., 2002) detects bacteria at the generic level belonging to the former Erwinia genus; however, sequencing of the resulting recA PCR product will provide resolution to the sub-species level.

(b) Primers ADE1/ADE2 (Nassar et al., 1996) will detect pectinolytic strains of Dickeya spp.

Table 13: Cycling conditions for Waleron et al., 2002 PCR

Step Temperature Time No. of cycles Initial denaturation 94oC 3 min 1 Denaturation 94oC 1 min

35 Annealing 47C 1 min Elongation 72oC 2 min Final elongation 72oC 5 min 1

Table 14: Cycling conditions for Nassar et al., 1996 PCR

Step Temperature Time No. of cycles Initial denaturation 94oC 3 min 1 Denaturation 94oC 1 min

25 Annealing 72C 1 min Elongation 72oC 2 min Final elongation 72oC 5 min 1

7.1.4 Bacterial isolation on media Isolation of regulated bacteria from plants is a required test on the Ipomoea IHS. Plants should be tested separately. Aseptic techniques should be used throughout the test procedure. 7.1.4.1 Dickeya chrysanthemi (basonym. Erwinia chrysanthemi) Dickeya chrysanthemi primarily occurs on storage roots but the bacteria can also move into the vascular tissues of the aerial parts of the plant and become systemic. For testing the aerial parts of sweetpotato plants, leaf petioles and mid-veins (vascular strands) should be tested in summer or under summer-like conditions. At least two fully expanded leaves must be sampled from the indicator plant, one young leaf from the top of the plant and one older leaf from a mid-way position. Leaves should be tested as soon as possible after removal from the plant. Recommended method Macerate a small amount of tissue in 500 l of sterile distilled water. Pipette 100 l of macerate into 5 ml of PT (pectate tergitol) broth and incubate anaerobically at 27C for 48 h. Undiluted broth (100 l) and a 10-fold serial dilution of broth are spread onto crystal violet pectate agar plates and incubated at 27C for 3 days. Suspected pectolytic Dickeya can be transferred to Potato Dextrose Agar (PDA) and colony morphology examined. Interpretation of results D. chrysanthemi bacteria are mottled, gram-negative, non-sporing, straight rods with rounded ends. The bacteria can occur as single cells or in pairs. The average cell size is 1.8 0.6 m


23

and the average number of peritichous flagellae is 8-11. On PDA media, depending on the moisture content, young colonies can be circular, convex, smooth and entire, or sculptured with irregular margins. After 4-5 days, both types of colonies resemble a fried egg, with a pinkish, round, raised centre and a lobed periphery, which later becomes feathery. 7.1.5 Microscopic inspection for mites Microscopic examination of plants for regulated mites is a required test on the Ipomoea IHS. 7.1.5.1 Tetranychus evansi Recommended method For each plant, use a hand lens to inspect the underside of all leaves for mite eggs, nymphs, adults and symptoms of mite presence. Following this, for each plant, the 3 youngest leaves of each plant plus any suspect leaves showing the presence of mites must be collected for further examination using a binocular microscope. For species identification, both male and female mites must be collected. Male mites should be mounted laterally onto a microscope slide and female mites should be mounted dorsally to expose the diagnostic characters. To improve transparency, the mites can be cleared in lactic acid under a table lamp prior to mounting. Interpretation of results If mites are present the following symptoms may be observed on the underside of leaves; webbing, distinct small yellow spots (which get larger over time), leaf browning and in extreme cases the leaves may shrivel up and die. Overall, plant vigour and growth may be affected (Fig. 1.4). Mites of the Tetranychus genus can be green, yellow, orange or red in colour. Adult males are smaller than the females for all Tetranychus spp. T. evansi female mites are reddish in colour and the males are straw-coloured with a more pointed abdomen (Fig. 1.3). Species level identification requires examination of the male aedeagus (i.e. the male genitalia). For T. evansi, the male adeagus will appear upright at a 90C angle.


24

8. CONTACT POINT This manual was developed by: Dr Lisa Ward Plant Health & Environment Laboratory, Investigation and Diagnostic Centres and Response, Ministry for Primary Industries (MPI), 231 Morrin Road, St Johns, PO Box 2095, Auckland 1140 Tel: +64 9 909 3015 Fax: +64 9 909 5739 Email: [email protected] Website: http://www.biosecurity.govt.nz/regs/imports/plants/high-value-crops 9. ACKNOWLEDGEMENTS We would like to acknowledge the following people who contributed to the preparation of this manual: Mr John Fletcher (The New Zealand Institute for Plant & Food Research Ltd, Lincoln,

New Zealand) for drafting the introduction and propagation sections of the manual, for valuable discussion and advice on sweetpotato viruses, and for providing photographs of virus-infected sweetpotato.

Dr Chris Clark and Ms Mary Hoy (Louisiana State University, USA) for valuable discussion on sweetpotato viruses, for supplying isolates of SPV2 and SPLCV, and for supplying several photographs of virus-infected I. batatas and I. setosa.

Dr Steve Lewthwaite (The New Zealand Institute for Plant & Food Research Ltd, Pukekohe, New Zealand) for providing the front cover image of the sweetpotato cultivar 'Radical' (the first New Zealand sweetpotato cultivar to receive plant variety rights) and for providing information on seed propagation.

Dr Segundo Fuentes (International Potato Centre (CIP), Peru) for valuable discussion on sweetpotato viruses.

Ms Susan Sim (Foundation Plant Services, University of California, Davis, USA) for valuable advice on graft inoculation.

Dr Karen Gibb (Charles Darwin University, Australia) for supplying phytoplasma DNA and the photograph of the Sweetpotato little leaf phytoplasma.

The American Phytopathological Society (APS) for permission to use images from the Diseases of Root and Tuber Crops CD-Rom, 2000, St Paul, MN, USA.

10. REFERENCES Ahrens, U; Seemller, E (1992) Detection of DNA of plant pathogenic mycoplasma-like organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene. Phytopathology 82: 828-832.


25

Andersen, M T; Beever, R E; Gilman, A C; Liefting, L W; Balmori, E; Beck, D L; Sutherland, P W; Bryan, G T; Gardner, R C Forster, R L S (1998) Detection of Phormium yellow leaf phytoplasma in New Zealand flax (Phormium tenax) using nested PCRs. Plant Pathology 47: 188-196. Chen, J; Chen, J; Adams, M J (2001) A universal PCR primer to detect members of the Potyviridae, and its use to examine the taxonomic status of several members of the family. Archives of Virology 146: 757-766. Christensen, N M; Nicolaisen, M; Hansen, M; Schulz, A (2004) Distribution of phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Molecular Plant Microbe Interactions 17: 1175-1184. Clark, C A; Moyer, J W (1988) Compendium of sweetpotato diseases. The American Phytopathological Society Press. Deng, S; Hiruki, D (1991) Amplification of 16S rRNA genes from culturable and nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61. Fletcher, J D; Lewthwaite, S L; Fletcher, P J; Dannock, J (2000) Sweetpotato (Kumara) virus disease surveys in New Zealand. International Workshop on Sweetpotato Cultivar Decline Study, Miyakonojo, Japan. Kirkpatrick, B C; Stenger, D C; Morris, T J; Purcell, A H (1987) Cloning and detection of DNA from a nonculturable plant pathogenic mycoplasma-like organism. Science 238: 197-200. Kokkinos, C D; Clark, C A (2006) Real-time PCR assays for detection and quantification of sweetpotato viruses. Plant Disease 90:783-788. Lee, I M; Hammond, R W; Davis, R E; Gundersen, D E (1993) Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike organisms. Phytopathology 83: 834-842. Lewthwaite, S L (1997) Commercial sweetpotato production in New Zealand: foundations for the future. In: Proceedings of the International Workshop on Sweetpotato production System toward the 21st Century, Miyakonojo, Miyazaki, Japan, (eds, D R La Bonte; Yamashita, M; Mochida, H), Kyushu National Agricultural Experiment Station, Japan. p. 33-50. Li, R; Salih, S; Hurtt, S (2004) Detection of geminiviruses in sweetpotato by polymerase chain reaction. Plant Disease 88: 1347-1351. Marie-Jeanne, V; Ioos, R; Peyre, J; Alliot, B; Signoret, P (2000) Differentiation of Poaceae Potyviruses by reverse transcription-polymerase chain reaction and restriction analysis. Journal of Phytopthaology 148: 141-151. Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods 99: 81-92.


26

Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, M;. Dervin, A; Vedel, R; Bertheau, Y (1996) Characterisation of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and restriction fragment length polymorphism analysis of PCR-amplification fragments of pel genes. Applied and Environmental Microbiology 62: 2228-2235. Saladaga, F A; Takagi, H; Cherng, S J; Opena, R T (1991) Handling and selecting improved clones from true seed populations of sweetpotato. Asian Vegetable Research and Development Centre International Cooperator Guide 91: 384. Schneider, B; Seemller, E; Smart, C D; Kirkpatrick, B C (1995) Phylogenetic classification of plant pathogenic mycoplasma-like organisms or phytoplasmas. In Razin, S & Tully, J G (eds) Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 1. Academic Press, San Diego, CA; p. 369-380. Univertos, M; Perez-Egusquiza, Z; Clover, G R (2010) PCR assays for the detection of members of the genus Ilarvirus and family Bromoviridae. Journal of Virological Methods 165: 97-104 Waleron, M; Waleron, K; Podhajska, A.J; Kojkowska, E (2002) Genotyping of bacteria belonging to the former Erwinia genus by PCR-RFLP analysis of a recA gene fragment. Microbiology 148: 583-595. Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N; Stead, D E (2000) Detection of Ralstonia solanacearum strains with a quantitative multiplex real-time, fluorogenic PCR (TaqMan) assay. Applied and Environmental Microbiology 66: 2853-2858.


27

Appendix 1. Symptoms of significant regulated pests of Ipomoea batatas

1.1 Meliodogyne incognita (a) (b)

(a) Galls and egg masses produced by M. incognita on fibrous roots; (b) cracking of fleshy storage roots associated with injury by M. incognita. (Courtesy W.J. Martin (a) & G.W. Lawrence (b) reproduced with permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).

1.2 Rotylenchulus reniformis

Cracking of fleshy storage roots associated with injury by R. reniformis (Courtesy C.A. Clark reproduced with

permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA). 1.3 Tetranychus evansi

T. evansi mites, male (left) and female (right). (Courtesy EcoPort http://www.ecoport.org

: image 13039, E.A. Ueckerman).

1.4 Plant damage caused by mites

Plant damage caused by feeding Tetranychus evansi (Courtesy EcoPort http://www.ecoport.org

: image 13043, ARC-PPRI)


28

.

1.5 Streptomyces ipomoea (a) (b)

(a) Soil pox lesions caused by S. ipomoea on storage roots of I. batatas clone L4-89 (b) I. batatas rootlet rot on sweetpotato fibrous roots, caused by S. ipomoea. (Courtesy W.J. Martin (a) & (b) reproduced with permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA). 1.6 Elsino batatas

Petiole and stem lesions on I. batatas caused by Elsino batatas. (Courtesy R. Gapsin reproduced with permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).

1.7 Dickeya chrysanthemi

Bacterial rot on I. batatas Jewel storage root caused by Dickeya chrysanthemi. (Courtesy C. A. Clark reproduced with permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).


29

1.8 Ipomoea batatas infected with a mixture of viruses

Leaf symptoms on I. batatas Toka Toka Gold infected with Sweetpotato feathery mottle virus, Sweetpotato chlorotic fleck virus, and Sweetpotato virus C6. (Courtesy J. Fletcher, The New Zealand Institute for Plant & Food Research Ltd, Lincoln, New Zealand). 1.9 Sweetpotato chlorotic stunt virus

Interveinal purpling on Regal sweetpotato infected with the White Bunch or US strain of Sweetpotato chlorotic stunt virus (Courtesy C. Clark, Louisiana State University., USA).

1.10 Sweetpotato leaf curl virus

Sweetpotato leaf curl virus symptoms in plant bed on sweetpotato line W-359 (Courtesy C. Clark, Louisiana State University, USA).

1.11 Sweetpotato little leaf phytoplasma

Sweetpotato little leaf phytoplasma infecting I. batatas LO323. (Courtesy K. Gibb, Charles Darwin University, Australia).


30

Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa 2.1 Sweetpotato chlorotic stunt virus +

Sweetpotato feathery mottle virus

Symptoms on Ipomoea setosa inoculated with the White Bunch or US strain of Sweetpotato chlorotic stunt virus and the russet crack strain of Sweetpotato feathery mottle virus (Courtesy C. Clark, Louisiana State University, USA).

2.2 Sweetpotato virus 2

Initial symptoms of Sweetpotato virus 2 in Ipomoea setosa (Courtesy C. Clark, Louisiana State University, USA).

2.3 Sweetpotato virus C6

Symptoms induced in Ipomoea setosa by C6 virus (Courtesy C. Clark, Louisiana State University, USA).


31

2.4 Sweetpotato leaf curl virus

Ipomoea setosa infected with SWFT-1 showing leaf curling (Courtesy C. Clark, Louisiana State University, USA).

2.5 Sweetpotato leaf curl virus + Sweetpotato virus 2

Ipomoea setosa infected with SPLCV (SWFT-1) and SPV-2 (LSU-2) showing prominent leaf curling (Courtesy C. Clark, Louisiana State University, USA).

2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle virus

Ipomoea setosa showing leaf rolling, chlorosis and interveinal necrosis after being grafted with a sweetpotato, infected

with SPLCV and SPFMV-Russet Crack (Courtesy C. Clark, Louisiana State University, USA).


32

Appendix 3. Protocols referenced in manual 3.1 Silica-milk RNA extraction protocol (Menzel et al., 2002)

1. Grind 0.2-0.5 g leaf tissue (1/10; w/v) in RNA extraction buffer (6 M guanidine hydrochloride, 0.2 M sodium acetate, 25 mM EDTA, 2.5% [w/v] PVP-40 adjusted to pH 5 with acetic acid).

2. Transfer 500 l of the homogenised extract to a micro-centrifuge tube containing 100 l of 10% (w/v) SDS.

3. Incubate at 70oC for 10 minutes with intermittent shaking, and then place on ice for 5 minutes.

4. Centrifuge at 13,000 rpm for 10 minutes. 5. Transfer 300 l supernatant to a new micro-centrifuge tube and add 300 l high salt buffer

(6 M sodium iodide, 0.15 M sodium sulphite), 150 l absolute ethanol and 25 l silica milk (1 g/ml silicon dioxide, 1-5 M size particles, suspended in 100 mM glycine, 100 mM NaCl, 100 mM HCl, pH 2).

6. Incubate at room temperature for 10 minutes with intermittent shaking. 7. Centrifuge at 3,000 rpm for 1 minute and discard the supernatant. 8. Resuspend the pellet in 500 l of wash buffer (10 mM Tris-HCl pH 7.5, 0.05 mM EDTA, 50

mM NaCl, 50% [v/v] absolute ethanol), centrifuge at 3,000 rpm for 1 minute and discard the supernatant. Repeat this wash step.

9. Centrifuge at 3,000 rpm for 1 minute and remove any remaining wash buffer from the pellet. 10. Resuspend the pellet in TE buffer (10mM Tris-HCl pH 7.5, 0.05 mM EDTA). 11. Incubate at 70oC for 4 minutes then centrifuge at 13,000 rpm for 5 minutes. 12. Transfer 100 l of the supernatant to a sterile nuclease-free micro-centrifuge tube, being

careful not to disturb the pellet. Store at -80oC.

3.2 Phytoplasma DNA enrichment CTAB extraction protocol (Kirkpatrick et al., 1987 and modified by Ahrens & Seemller, 1992)

1. Grind approximately 0.3 g tissue (petioles, veins) in 3 ml ice-cold isolation buffer (0.1 M

Na2HPO4, 0.03 M NaH2PO4, 10 mM EDTA (pH 8.0), 10% (w/v) sucrose, 2% (w/v) PVP-40; Adjust pH to 7.6 and filter sterilise. Just prior to use add 0.15% (w/v) Bovine Serum Albumin (BSA) and 1 mM ascorbic acid).

2. Transfer crude sap to a cold 2 ml micro-centrifuge tube. 3. Centrifuge at 4C for 5 min at 4500 rpm. 4. Transfer supernatant into a clean 2 ml micro-centrifuge tube. 5. Centrifuge at 4C for 15 min at 13000 rpm. 6. Discard the supernatant. 7. Resuspend the pellet in 750 l of hot (55 C) CTAB buffer (2% (w/v) CTAB, 100 mM Tris-

HCl [pH 8.0], 20 mM EDTA [pH 8.0], 1.4 M NaCl, 1% (w/v) PVP-40). The pellet is easier to resuspend in a smaller volume of CTAB buffer (e.g. 100 l) then the remaining volume of CTAB buffer is added (e.g. 650 l).

8. Incubate tubes at 55 C for 30 min with intermittent shaking. 9. Cool the tubes on ice for 30 sec. 10. Add 750 l chloroform:octanol (24:1 v/v) and vortex thoroughly. 11. Centrifuge at 4C or at room temperature for 4 min at 13000 rpm. 12. Carefully remove upper aqueous layer into a clean 1.5 ml micro-centrifuge tube. 13. Add 1 volume ice-cold isopropanol and vortex thoroughly. 14. Incubate on ice for 4 min. 15. Centrifuge at 4C or at room temperature for 10 min at 13000 rpm. 16. Discard supernatant.


33

17. Wash DNA pellets with 500 l ice-cold 70% (v/v) ethanol, centrifuge at 4oC or at room temperature for 10 min at 13000 rpm.

18. Dry DNA pellets in the DNA concentrator or air-dry. 19. Resuspend in 20 l sterile distilled water. Incubating the tubes at 55oC for 10 min can aid

DNA resuspension. 20. Store DNA at -20C for short-term storage or -80C for long-term storage.

Contents1. SCOPE 2. INTRODUCTION3. IMPORT REQUIREMENTS4. PESTS4.1 Regulated pests for which generic measures are required4.2 Regulated pests for which specific tests are required

5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE5.1 Whole plants5.2 Plants in tissue culture5.3 Pollen

6. INSPECTION7. TESTING7.1 Specific tests for nursery stock

8. CONTACT POINT9. ACKNOWLEDGEMENTS10. REFERENCESAppendix 1. Symptoms of significant regulated pests of Ipomoea batatasAppendix 2. Virus symptoms on graft inoculated Ipomoea setosaAppendix 3. Protocols referenced in manual

Documents

Ipomoea Testing Manual