In The Name of God - anatomydept.mums.ac.ir · In The Name of God ðvOwned Iranian Society of Anatomical Sciences ðvChairman Manager Joghataei Mohammad Taghi, Ph.D. ðvEditor in

In The Name of God

OwnedIranian Society of Anatomical Sciences

Chairman ManagerJoghataei Mohammad Taghi, Ph.D.

Editor in ChiefRezazadeh Mojtaba, Ph.D.

Executive ManagerRezaei Fatemeh Sadat, M.Sc.

Technical ExpertMehdizadeh Mehdi, Ph.D.Rezaei Fatemeh Sadat, M.Sc. Editorial Board (A-Z)Abolhasani Farid. (Tehran University of Medical Sciences, Iran)Abroun Saeid, Ph.D. (University of Tarbiat Modares, Tehran, Iran)Akbari Mohammad, Ph.D. (Tehran University of Medical Sciences, Iran)Alavi Abbas, M.D., Ph.D., D.Sc (University of Pennsylvania, Philadelphia, USA)Amiri Iraj (Hamedan University of Medical Sciences, Iran)Asadi Mohammad Hossein, Ph.D. (Baghiatallah University of Medical Sciences, Iran)Esfandiari Ebrahim, M.D., Ph.D. (University Esfahan of Medical Sciences, Iran)Ebrahimzadeh Bideskan Alireza, Ph.D. (Mashhad University of Medical Sciences, Iran)Fazel AliReza, Ph.D. (Mashhad University of Medical Sciences, Iran)Ghorbani Rostam, Ph.D. (Kermanshah University of Medical Sciences, Iran)Hassanzadeh Gholamreza, Ph.D. (Tehran University of Medical Sciences, Iran)Hekmat Hossein, M.D., Ph.D. (Shahid Beheshti University of Medical Sciences, Tehran, Iran)Hosseini Ahmad, Ph.D. (Shahid Beheshti University of Medical Sciences, Tehran, Iran)Jalali Alireza, M.D., LMCC, DESMS (University of Ottawa, Canada)Joghataei Mohammad Taghi, Ph.D. (Tehran University of Medical Sciences, Iran)Li Yun-Qing, M.D., Ph.D. (4th Military Medical University, China)Mehdizadeh Mehdi, Ph.D. (Tehran University of Medical Sciences, Iran)Movahedin Mansoureh, Ph.D. (University of Tarbiat Modares, Tehran, Iran)Nasr-Esfahani Mohammad Hossein, Ph.D. (Royan Institute, Esfahan, Iran)Nematollahi Noreddian, Ph.D. (Kerman University of Medical Sciences, Iran)Nikzad Hossein, Ph.D. (Tabriz University of Medical Sciences, Iran)Norani, Mohammd Reza Ph.D. (Baghiatallah University of Medical Sciences, Iran)Nottola Stefania A., M.D., Ph.D. (University of Rome La Sapienza, Italy)Orazizadeh Mahmoud, Ph.D. (Ahwaz University of Medical Sciences, Iran)Parivar Mohammad Kazem, Ph.D. (Tarbiat Moalem University, Tehran, Iran)Sadeghi Yousef, M.D., Ph.D. (Shahid Beheshti University of Medical Sciences, Tehran, Iran)Shakibaei Mehdi, Ph.D. (University of Munich, Germany)Sobhani Aligholi, Ph.D. (Tehran University of Medical Sciences, Iran)Soleimani Masoud, Ph.D. (University of Tarbiat Modares, Tehran, Iran)Soleimani Rad Jafar, Ph.D. (Tabriz University of Medical Sciences, Iran)Talaei Tahereh, Ph.D. (Shiraz University of Medical Sciences, Iran)

Consultats Committee (A-Z)Bayat Mohammad, Ph.D., Ebrahimi Bita, Ph.D.Mahmoudzadeh Sagheb Hamidreza., Ph.D., Naghdi Majid, Ph.D.Norani Mohammd Reza, Ph.D.,Piryaei Abbas, Ph.D., Rafighdoost Houshang, Ph.D.

Language Editor, Type and layoutBest Journalist Center Language Editor in This NumberVagharfard Kim, Mohammadi Ozra Type and Layout in This NumberSargoli Batool

Address of JournalP.O.Box: 15875-6349, Tehran, Iran, Phone&Fax: +982188622689Website: http://anatomyjournal.hbi.irE-mail: [email protected], Contact person: Rezaei Fatemeh Sadat, M.Sc. Address of PublisherP.O.Box: 15875-6349, Tehran, Iran, Phone&Fax: +982188622689E-mail: [email protected], Contact person: Mehdizadeh Mehdi, Ph.D.

Indexing: IMEMR, Index Copernicus, ISC, SID, Magiran, Iran Medex The entire contents of Iranian Anatomical Sciences Journal are protected under international copyright. This journal is for your personal noncommercial use. You may not modify copy, distribute, transmit, display, or publish any materials contained onthe journal without the prior written permission of it or the appropriate copyrightowner. And this journal is member of Cope.

Contents

Evalauation of Laminin Expression during Mouse Lens developmentHoushang Rafighdoost, Ph.D., Mehdi Jalali, Ph.D., Mohammad Reza Nikravesh, Ph.D. .............................. 1

Melatonin Impact on In Vitro Development of Mouse Preantral Follicles and OocyteMaturationMohammad Nabiuni, Ph.D., Roya Ganji M.Sc., Mohammadhadi Bahadori Ph.D. ........................................ 7

The Effects of Pentoxifylline on the Wound Healing Process in a Rat ExperimentalPressure Sore ModelAbdollah Amini, M.Sc., Kobra Velaei, M.Sc., Mohammad Bayat, Ph.D., Masoomeh Dadpay, M.D.,Mohsen Nourozian, Ph.D, Elhameh Jahanbakhsh Asl, M.Sc. ........................................................................ 15

Study of the Effect of Hypothyroidism on the Apoptotic Index in Rat Ovarian Follicles,Using the TUNEL TechniqueMahmoud Moghaddam-Dorafshani, M.Sc., Medi Jalali, Ph.D., Mohammad Reza Nikravesh, Ph.D.,Ali Reza Ebrahimzadeh, Ph.D. ....................................................................................................................... 25

The Role of Wnt Signaling Pathway on the Expression of TGFβ 1 and TGFβ 2 inCultured Rat Cortical AstrocytesSina Bozorgmehr, M.Sc., Azita Parvaneh Tafreshi, Ph.D., Shahsanam Abbasi, M.Sc.,Bahman Zeynali, Ph.D. ..................................................................................................................................................37

Anthropometric Characteristics of Craniums in Residents of Qazvin, Iran and DeraGhazi Khan, Pakistan: A Comparative StudyGholamreza Hassanzadeh, Ph.D., Makan Sadr, M.D., Ph.D. Student, Noushin Alaghbandha, M.D.,Ali Dehbashipour, M.D., Mohammad Abrar Abbas, M.D., Omran Heydar Zeidi, M.D. ............................... 43

The Cephalometric Neurocranial Index of One-day-old Male Newborns inKermanshah by AnthropometrySara Eivazi, M.Sc., Reza Mastery Farahani, Ph.D. ........................................................................................ 51

A Study of the Anatomic Variations in Extrahepatic Bile Ducts in 50 AdultsReferred to Kerman Forensic Medicine OrganizationSeyed Hassan Eftekhar-Vaghefi, Ph.D., Ali Shams-Ara, Ph.D., Mahdiye Jamalizade, M.D. ....................... 57

Instructions to Authors

Aims and Scope: The “Anatomical Sciences Journal“ is the official scientific quarterly publication of theIranian Society of Anatomical Sciences.The Purpose of Anatomical Sciences Journal is going to increase knowledge of the anatomists. We alsoare going to publish the recent researches of Anatomy (Macro anatomy, Microanatomy, Growth, Cell),Medical Strategies in Anatomy, Anatomy Education, and other related subjects.

Submission: Papers should be submitted electronically to [email protected] in MS-WORD2003 orXP file format, via on-line submission at http://www.anatomyjournal.hbi.ir only with a cover letter from thecorresponding author.

Article Admission: This journal publishes Original Articles, Review Articles, Case Report and Shortcommunication articles, all related to the journal goals.1- Original articles: These are the article resulted in new findings.2- Review articles: These are the article by well experienced authors and those who have excellencies in the

related fields.3- Case reports: Particularly articles containing instructive and research values4- Short communication: can be in form of research article, systematic review or ongoing research which reports

its interesting findings. The parts in this type of articles are like those of original one but they are smaller andprepared in maximum 2000 words.

The manuscript should include: Title page; the Abstract; Introduction; Materials and Methods; Results;Discussion; Acknowledgement, References, and attachments (tables, figures, graphs).The title page should include the complete title of the manuscript, the name of all authors with their highestqualification, scientific degree, the department or institution, the school and university to which they areaffiliated, city and country, address for correspondence with telephone numbers, e-mail, and fax number.The abstract should contain structural frame including title, Introduction, Methods, Results, Conclusion, allprepared up to 250 words and 3 to 5 keywords at the end. Keywords will assist the indexers in cross indexingthe articles as they are published with abstract. Use terms from the Medical Subject Headings (MeSH) list ofIndex Medicus (http://www.nlm.nih.gov/mesh/MBrowser.html). Authors need to be careful that the abstractreflects the content of the article accurately.Introduction should summarize the purpose and the rationale behind the study. It should neither review thesubject extensively nor should it have results or conclusions of the study.Materials and Methods employed must be precisely stated so that the others could repeatedly do theexperiment.Results must be presented in the form of text, tables and illustrations. The contents of the tables should not beall repeated in the text. Instead, a reference to the table number may be given. Graphs and images should havegood quality and be prepared on separate pages including numbers and topics.Number of graphs, tables and figures should be appropriate with the length of the article (one for 500 to 700 words).Discussion should emphasize the present findings and the variations or similarities with other works done inthe field by other workers. The detailed data should not be repeated in the discussion again. Emphasize thenew and important aspects of the study and the conclusions that follow from them.Acknowledgement: All contributors who do not meet the criteria for authorship should be covered in theacknowledgement section. It should include persons who provided scientific, writing assistance, etc. and thoseorganizations which provided finance and materials.Tables: In limited numbers (one for 500 to 700 words) should be submitted with the captions placed above.Do not submit tables as photograph. Place explanatory matters in footnotes, not in the heading.Figures: Should be in limited numbers (one for 500 to 700 words), with high quality art work and mountedon separate pages. The captions should be placed below. The same data should not be presented in tables, fig-ures and text, simultaneously.

References: All manuscripts should have related articles and to minimize errors in this field, authors shouldverify references against the original documents. All references should be numbered in caroche in the text andbe brought at the end according to their order of appearance in the main text. Follow the examples:

Book3. Bancroft JD, Gamble M. Theory and practice of histological technique. 5th ed. Churchil Livingston, London,2002, 556-7.Chapter in book4. Hassid WZ, Abrahams S. Chemical procedure for analysis of polysaccharides. In: Methods in enzymology. Editedby Colowick SP, Kaplan NO. 2nd ed. New York, Academy press CO, 1966, 34-7.Article5. Yeon Lim J, Jeun SS, Lee KJ, Oh JH, Kim SM, Park SI, et al. Multiple stem cell traits of expanded rat bonemarrow stromal cells. Exp Neurol 2006; 199: 416-26.

A finalized electronic version is sent to the corresponding author for proof reading before publication inorder to avoid any mistakes. Corrections should be marked clearly and sent immediately to the Journaloffice.

Use only standard abbreviations and symbols. Avoid using them in the title and abstract. The full termfor which an abbreviation stands for should precede its first use in the text unless it is a standard unit ofmeasurement.

The corresponding author will be supplied with 2 free issues. Authors should not send their articles to other journals at the same time before the final result is sent to

them by Anatomical Sciences Journal. Anatomical Sciences Journal does not publish translated articles. All articles should meet necessary ethical criteria. Ethical considerations should come in methods

section. One copy of approval letter from Medical Ethics Committee (human subjects and laboratoryanimals) of the institute should be included with the manuscript.

Informed consent must be obtained from all human participants. The anonymity of patient(s) andconfidentiality of medical records must be considered by the author(s) of papers. The eyes and any otherremark(s) of patient(s) helping to recognize them must be covered if necessary.

Anatomical Sciences Journal is entitled to edit the received manuscripts. Authors are responsible for their article’s content. Publishing the articles which have been already presented in a seminar is accepted. Conflicts of interest: Authors must acknowledge and declare any sources of funding and potential

conflicting interest, such as receiving funds or fees by, or holding stocks and shares in, an organizationthat may profit or lose through publication of your paper.

The authors should pay the charge of their accepted manuscript editing. The entire contents of the Anatomical Sciences Journal are protected under international copyright. This

journal is for your personal noncommercial use. You may not modify copy, distribute, transmit, display,or publish any materials contained on the journal without the prior written permission of it or theappropriate copyright owner.

All manuscripts are considered to be confidential. They are peer-reviewed by at least 3 anonymousreviewers selected by Editorial Board. The corresponding author is notified as soon as possible of thedecision to accept, reject, or require modifications. If the manuscript is completely acceptable andaccording to the criteria set forth in these instructions, it is scheduled for the next available issues.

Address: P.O.Box: 15875-6349, Tehran, Iran Phone & Fax: +982188622689

Website: http://anatomyjournal.hbi.ir E-mail: [email protected]

Copyright©2013, Iranian society of anatomical sciences. All rights reserved.

Anatomical Sciences Journal 2013, Vol 10, No 1, Pages 1-6

Original Article

Evalauation of Laminin Expression during MouseLens Development

Houshang Rafighdoost, Ph.D.1, Mehdi Jalali, Ph.D.2,Mohammad Reza Nikravesh, Ph.D.2*

1.Department of Anatomy, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran2.Department of Anatomy and Cell Biology, School of Medicine, Mashhad University of Medical Sciences,Mashhad, Iran*Corresponding author, E-mail address: [email protected]

Received: December 2011 Accepted: March 2012

Professor Mohammad Reza Nikravesh is a Professor of Anatomy in the Department ofAnatomy and Cell Biology, Mashhad University of Medical Sciences, Mashhad, Iran.Dr. Nikravesh has over thirty years of experience as an educator of anatomicalsciences, supervisor of research, and researcher in basic medical sciences. Hisresearch focuses on collagen type IV, laminin and fibronectin, key proteins withimportant functions in the basement membrane and extracellular matrix.

AbstractIntroduction: Among the components of the extracellular matrix (ECM) and basement membrane (BM), laminitisheterotrimeric glycoprotein (laminin) and collagen type IV are the most important. In a previous study we haveexamined the role of collagen type IV in the developing lens capsule. The present study aims to determine theappearance and distribution of laminin in the BM and ECM of lenses during visual system morphogenesis.Materials and Methods: Pregnant Balb/C mice were randomly selected and maintained under normalconditions. The presence of a vaginal plug was assumed as day zero of pregnancy. From embryonic days 11to 20, pregnant animals were sacrificed and their fetuses were collected for histotechnical prossessing.Results: Our data revealed that laminin appeared during the early stage of gestation (day 12) in the BM ofthe anterior epithelial lens cells. The amount of laminin gradually increased in the ECM and posterior lenscapsule epithelial cells until days 14-18. After this period, a strongly positive laminin reaction was notobserved in any part of the lens structure.Conclusion: These findings establish the importance of the laminin molecule in the developing optic cup(OC) and lens differentiation. It could be assumed that any changes in the presence of laminin during thecritical period of eye development may result in visual system defects such as cataracts or congenital eyeabnormalities.Keywords: Laminin, Mice, Lenses, Growth and development

To cite this paper: Rafighdoost H, Jalali M, Nikravesh MR. Evalauation of laminin expression during mouse lensdevelopment. Anat Sci J 2013; 10(1): 1-6.

2 H.Rafighdoost , et al

Anat Sci J 2013, Vol 10, No 1

IntroductionLaminitis heterotrimeric glycoprotein (laminin)is one of the major components of the basementmembrane (BM) and extracellular matrix (ECM)in most animal tissues [1]. Laminin is one of thelarger proteins that play an important role in eyelens and optic cup (OC) morphogenesis [2,3]. Ourrecent investigations have shown that otherECM components such as collagen type IV arealso important during lens morphogenesis [4,5].The lens is a transparent, flexible component ofthe optic system which develops along with theother parts of the eyeball [6,7].

Researches have shown that defects in lamininexpression can cause congenital defects of thenerves and OC in animal models [8,9]. Theabsence of laminin subunits (alpha, beta, andgamma precursors) causes not only lensdeformation but also fragility and rupture of thecapsule [10]. A mutation in any of the lamininsubunits can result in defects in laminin synthesisand bring about a change in components of theeye's structures [5].

Laminin synthesis is one of the mostimportant processes related to the developmentand shape of the eye lens during morphogenesis[11]. Based on different studies, various typesof proteins have been shown to comprise thestructure of the lens capsule such as collagentype IV, entactin/nidogen, heparin sulfate andsome glycoproteins [5]. Although, we shouldnot ignore the structural role of lens proteins.Laminin is one of the most abundant moleculesin the eyeball and plays a critical role in lensdevelopment [11]. In the present study weinvestigate the appearance and distribution oflaminin in the BM and ECM of mice lensesduring visual system morphogenesis.

Materials and Methods20 pregnant balb/c mice, were obtained from

the animal house of Mashhad University ofMedical Sciences. Two pregnant mice at ratherembryonic days E11 to E20 were anesthetizedand perfused transcardially with formaldehyde(10%). The heads of the fetuses were removedand post-fixed for 24 h at room temperature inthe same fixative. The fetal heads wereroutinely processed, embedded in paraffin, thenserially sectioned into 8 µm sagittal sections.Sections were either stained with cresyl violet orincubated with monoclonal antibody againstlaminin α5.

All study procedures were approved by theMedical Ethics Committee Mashhad Universityof Medical Sciences, Mashhad, Iran.

We used the avidin-biotin-peroxidase immuno-histochemical procedure for analysis of theserial sections. These sections were deparaffinized,rehydrated and washed twice for 5 min in 0.05Tris buffer that contained 1.5% NaCl (pH 7.4).For blocking any nonspecific antibody, sectionswere preincubated in 0.3% Triton X-100 in Trisbuffer NaCl (TB-NaCl) followed by 5% goatserum for 2-3 h. Then, sections were allowed toreact for 12-24 h at 4°C with primary antibody(anti-laminin 2413, Dako Co., USA) diluted1:250 in TB-NaCl with 0.3% Triton X-100 and2% serum. Tissues were washed three timeswith TB-NaCl, for 10 min each time and thenincubated for 2 h in biotinylated goat anti-rabbitIgG (1:400 in TB-NaCl). After three additionalrinses, each for 1 h, endogenous peroxidaseactivity was blocked by incubation in 0.03%H2O2 in methanol for 30 min. Tissues were thenincubated for 2 h in a 1:100 avidin-biotinylatedhorseradish peroxidase complex, washed threetimes (30 min each wash) in TB-NaCl andallowed to react with a 0.03% solution of 3,3-diaminobenzidine tetra- hydrochloride thatcontained 0.03% H2O2 for 10-15 min. Tissueswere washed and lightly counterstained with

Laminin expression and mouse lens development 3


hematoxylin. Subsequently, tissues were washed,air-dried, dehydrated, and then mounted in PBSglycerol. Photographs were taken by a BX52Olympus light microscope was appointed tocamera. wichs.

The laminin reaction in the lens componentsfor each of the embryonic days was evaluatedaccording to the method by Firth and Read.Grading was scored according to the severity ofthe reaction, as follows: negative (-), weak (+),moderate (++), strong (+++), and highly strong(++++). The intensity of staining was graded bytwo individuals, separately, according to theabove method [12,13].

Statistical analysisData were analyzed by SPSS software (Version19), using the Kruskal-Wallis and Mann-Whitneytests. P<0.05 were considered statistically signi-ficant.

ResultsOur findings showed that the primary stage of

OC development on day 10 of gestation (Fig. 1a)and the primary lens (PL) was primary cellularmass in the anterior pole of the OC (Fig. 1b).On day 11 the PL cellular mass acquired alenticular shape (L). In this stage, although theepithelium of the lens was formed, howeverthere was no laminin reaction in the BM (Fig.1c). On day 12, the lens structure changed to acortical region. In addition we observed a weaklaminin reaction in the nuclear region of thelens (Fig. 1d). Based on our findings, lamininclearly appeared by embryonic day 14 (Fig. 1e) inthe lens matrix (LM) and BM of the epithelialcells (arrows). There was a population ofprimordial cells (head arrows) in the LM on day15, however a cellular degeneration processoccurred with replacement by laminin fibers inthe lens nucleus, particularly in the lens cortexon day 16 (Fig. 1g and 1h), respectively. Overdays 17 and 18 the BM of epithelial cells(Figure 1i) and posterior lens capsule (Fig. 1j)showed very strong reactions with antibodyagainst laminin (Table 1), however there was aconspicuous population of the remnants ofprimordial cells in these areas.

Table 1. Laminin reaction in the lens components during mouse embryonic development.Embryonic days Basement membrane (BM) Extracellular matrix (ECM)

Anterior epithelial cells Nucleus Cortex Posterior capsule

10 - - - -

11 - - - -

12

13

+

++

+

+

-

+

-

+

14 +++ ++ +++ ++

15 +++ ++ ++++ ++

16

17

++++

++++

++

++

++++

++++

+++

+++

18 ++++ +++ ++++ ++++

Scored according to the extent of the laminin reaction,as follows: negative (-), weak (+), moderate (++), strong (+++), and verystrong (++++)Values that are (-), (+) and (++) are not significant+++ values: p<0.005++++ values: p<0.0005


J Anat Sci 2013, Vol 10, No 1

Figure 1. Images a-j showing sections through the eyeball through days 10-18 of gestation respectivelywhich are incubated with monoclonal antibody against laminin. a and b: on day 10th of gestation, optic cup (OP) andprimary lens (PL). c: on day 11th of gestation, the lens matrix (L) d: day 12, weakly reaction in basement membrane of anteriorepithelium (arrows) and nuclear region (c: cortex and n: nucleus) e: section through lens on day 14 of gestation. Anterior epitheliumbasement membrane (arrows) and lens matrix (LM) with remarkable reaction. f: middle part of lens on day 15 of gestation with highermagnification which clearly showed laminin reaction in lens nucleus and many primordial cells reminded (head arrows). On day 16th ofgestation (g and h), g: section through lens nucleus (n) with weak laminin reaction and h: cortical lens region (c) with severe lamininreaction (arrows). On day 18th of gestation (i and j), i: through lens epithelium basement membrane (arrows) j: posterior capsule(bifurcated arrows) with severe laminin reaction and remains of primordial cells (asterisks) in both figures (scale bar =µm, Hematoxylincounterstained).

DiscussionOur previous studies have shown that BM andECM molecules play an important role in tissuedevelopment and promotion of cell adhesion,migration, growth and differentiation [5,14,15].Among these molecules, laminin is a largeglycoprotein which is one of the major componentsof BM.

According to the results of our immuno-histochemical studies, there was no reaction oflaminin until gestational day 12. In anotherinvestigation, the initial laminin expression inthe Cat Fraser mouse was detected in the lenscapsule as early as embryonic day 10 [16]. Theabove mentioned investigation has also shownthat, at this stage, other important BM proteins

such as collagen type IV had a similardistribution as laminin and fibronectin. In ourprevious immunohistochemical studies therewas no collagen type IV reaction until day 12 ofgestation in the lens structure [5].

The appearance of the first signals of lamininexpression in the BM of the anterior capsulepossibly represented the important role of thismolecule in lens development. Investigationshave shown that the anterior capsule consists ofspecialized BM to which epithelial cells bind[17]. As the structural compositions of the lensbecome completed, the specific role of lamininis distinguished in this part of the visual system.Since the marginal zone of the capsule binds to

Laminin expression and mouse lens development 5


connective bundles (zonules) which connectsthe capsule to the ciliary body by using stable,thin fibers the strength force diffuses to the lenssurface [18]. Thus compositions such as collagen,fibronectin and laminin are required to providestability and flexibility [19,20]. Subunits of thesemolecules can bind to cell-surface and intra-cellular receptors, affecting compositions of theLM [21].

Analysis of the emergence of laminin at latergestational days, especially day 14 of gestation,showed that its density significantly increasedfrom the anterior to the LM. This densitypeaked on day 18 of gestation when the capsuleas well as structural composition of the lensbecame full of laminin. However laminin waspoorly reactive in the nuclear region of the lens.Here, the distribution pattern did not show adistinguished change over the following days.

Therefore, in order to have a better understandingof the formation, development and role of lamininin accommodation, it is necessary to obtaininformation on the appearance and distribution ofprivate molecules such as laminin, fibronectin,and collagen type IV and their alterations [5,22].As our data indicated, the appearance of laminin

at gestational day 12 and its increase untilembryonic day 18 might be an index ofdevelopmental changes in the optic lens. At thecompletion of lens development, laminin synthesisceases. During these stages, the cell mass, whichis known as the lens precursor, graduallydisappears and is replaced with macromoleculessuch as collagen IV, laminin and fibronectin [23].Similar immunohistochemical studies on theabnormal appearance of laminin in the pre- andpostnatal stages of transgenic mice have shownthat laminin forms on day 10 of gestation where itexpands until after birth [6,7]. These findingsestablish the importance of laminin during thecritical period of lens development. This study hasshown the presence of elevated levels of lamininat the BM of anterior epithelial cells, the posteriorcapsule, and cortical region during early lensdevelopment during growth of the anteriorepithelial cell BM and posterior capsule.

AcknowledgmentThe authors would like to thank Mrs. Motejaddedfor her excellent technical assistance.

References1. Ekblom P, Lonai P, Talts JF. Expression and biological

role of laminin-1. Matrix Biol 2003; 22: 35-47.2. Hallmann R, Horn N, Selg M, Wendler O, Pausch F,

Sorokin LM. Expression and function of laminins inthe embryonic and mature vasculature. Physiol Rev2005; 85: 979-1000.

3.Parmigiani CM, Mcavoy JW. The roles of laminin andfibronectin in the development of the lens capsule.Curr Eye Res 1991; 10: 501-11.

4. Saika S, Miyamoto T, Ishida I, Barbour WK, OhnishiY, Ooshima A. Accumulation of thrombospondin-1 inpost-operative capsular fibrosis and its down-regulation in lens cells during lens fiber formation.Exp Eye Res 2004; 79:147-56.

5. Nikravesh MR, Jalali M, Moein AA, Karimfar MH,Saeidinezhat Sh. The Role of Type IV Collagen inDeveloping Lens in Mouse Fetuses. Iran J Basic Med

Sci 2009; 12: 158-62.6. Parmigiani C, Mcavoy J. Localisation of laminin and

fibronectin during rat lens morphogenesis.Differentiation 1984; 28: 53-61.

7. Parmigiani CM, Mcavoy JW. The roles of laminin andfibronectin in the development of the lens capsule.Curr Eye Res 1991; 10: 501-11.

8. Zwaan J, Webster EH Jr. Histochemical analysis ofextracellular matrix material during embryonic mouselens morphogenesis in an aphakic strain of mice. DevBiol 1984; 104: 380-89.

9. Rossi M, Morita H, Sormunen R, Airenne S, Kreivi M,Wang L, et al. Heparan sulfate chains of perlecan areindispensable in the lens capsule but not in thekidney. EMBO J 2003; 22: 236-45.

10. Dong LJ, Chung AE. The expression of the genes forentactin, laminin A, laminin B1 and laminin B2 in



murine lens morphogenesis and eye development.Differentiation 1991; 48: 157-72.

11. Wederell ED, Brown H, O'connor M, Chamberlain,CG, Mcavoy JW, De Iongh RU. Laminin-bindingintegrins in rat lens morphogenesis and theirregulation during fibre differentiation. Exp Eye Res2005; 81(3):326-39.

12. Rafighdoust H, Nikravesh MR, Jalali M.. Pattern oflaminin expression during kidney morphogenesis inBalb/c mice. Pakistan J Biol Sci 2010, 13(19): 961-65.

13. Firth NA, Reade PC. The prognosis of oral mucosalsquamous cell carcinomas: a comparison of clinicaland histopathological grading and of laminin and typeIV collagen staining. Aust Dent J 1996; 41: 83-6.

14. Nikravesh MR, Jalali M, Moein AA, Karimfar MH,Mohammadi Sh, Rafighdoost H. Study of BasementMembrane Type IV Collagen Appearance in the BrainChoroids Plexus of Mouse Fetuses. Scientific JHamadan Univ Med Sci Health Serv 2009; 16: 5-9.

15. Jalali M, Nikravesh MR, Moeen AA, Karimfar MH,Saidinejat S, Mohammadi S, et al. Inductive role ofcollagen type IV during nephrogenesis in mice. Urol J2009; 6: 289-94.

16. Haloui Z, Jeanny JC, Jonet L, Courtois Y, Laurent M.Immunochemical analysis of extracellular matrix

during embryonic lens development of the Cat Frasermouse. Exp Eye Res 1988; 46: 463-74.

17. Johnson MC, Beebe DC. Growth, synthesis andregional specialization of the embryonic chicken lenscapsule. Exp Eye Res 1984; 38: 579-92.

18. Pazour GJ, Bloodgood RA. Targeting proteins to theciliary membrane. Curr Top Dev Biol 2008; 85: 115-49.

19. Inoue S, Leblond CP. Three-dimensional network ofcords: the main component of basement membranes.Am J Anat 1988; 181: 341-58.

20. De Jong-Hesse Y, Kampmeier J, Lang GK, Lang GE.Effect of extracellular matrix on proliferation anddifferentiation of porcine lens epithelial cells. GraefesArch Clin Exp Ophthalmol 2005; 243: 695-700.

21. Greiling TM, Houck SA, Clark JI. The zebrafish lensproteome during development and aging. Mol Vis2009; 15: 2313-25.

22. Olivero DK, Furcht LT. Type IV collagen, laminin,and fibronectin promote the adhesion and migrationof rabbit lens epithelial cells in vitro. InvestOphthalmol Vis Sci 1993; 34: 2825-34.

23. Taliana L, Evans MD, Ang S, Mcavoy JW..Vitronectin is present in epithelial cells of the intactlens and promotes epithelial mesenchymal transitionin lens epithelial explants. Mol Vis 2006; 12: 1233-42.



Original Article

Melatonin Impact on In Vitro Development of MousePreantral Follicles and Oocyte Maturation

Mohammad Nabiuni, Ph.D.¹, Roya Ganji, M.Sc.¹,Mohammadhadi Bahadori, Ph.D.2*

1 Department of Cell and Molecular Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, Iran2. Cellular and Molecular Research Center, Faculty of Medicine, Guilan University of Medical Science, Rasht, Iran*Corresponding author, E-mail address: [email protected]

Received: May 2012 Accepted: July 2012

Mohammad Hadi Bahadori, Ph.D. is an Associate Professor in the Department ofAnatomy at Guilan University of Medical Sciences, Rasht, Iran. He specializes in thetreatment of male and female infertility, including IVF and single spermmicroinjection, at the Center of Reproductive Medicine in Alzahra Hospital, Rasht,Iran.

AbstractIntroduction: Melatonin acts as an indirect antioxidant and is a powerful direct free radical scavenger anddirect responses to melatonin in the gonads are detected. This study aims to investigate the influence ofdifferent doses of melatonin on preantral follicle development and oogenesis of in vitro cultured mouseovarian follicles.Materials and Methods: Preantral follicles with diameters of 150–175 µm were mechanically isolated fromNMRI mouse ovaries. Follicles were cultured in droplets of α-minimal essential medium (α-MEM)supplemented with 5% FBS, 100 mIU/ml rhFSH, 1% ITS, 100 IU/ml penicillin and 100 μg/ml streptomycinin conjunction with varying doses of melatonin (0, 1, 10, 100 nM and 100, 500 pM) for six days. On day six,in vitro ovulation was induced by the addition of hCG/rEGF to the culture medium and after 16-20 h thematuration state of the oocytes was assessed.Results: There was a significant (P<0.05) decrease in the number of surviving follicles in the groups thatreceived 10, 100 nM and 500 pM melatonin compared to the other groups. After induction of in vitroovulation, follicles in groups that received 1, 10, and 100 nM melatonin had higher ovulation rates (P<0.05)compared with the other groups. Oocyte maturation capacity was adversely influenced by five concentrationsof melatonin and GV arrest was significantly higher compared to the control group (P< 0.01).Conclusions: Our data indicates that a dose of 100 pM melatonin has no toxic effects on folliculardevelopment and can be used to reduce oxidative stress in follicle culture systems.Keywords: Ovarian follicle, Melatonin, Ovulation, Oocytes

To cite this paper: Nabiuni M, Ganji R, Bahadori MH. Melatonin impact on in vitro development of mousepreantral follicles and oocyte maturation. Anat Sci J 2013; 10(1): 7-14

8 M. Nabiuni, et al


IntroductionAlthough mammalian ovaries contain numerousfollicles only a very limited number of themundergo maturation in vivo. In vitro culture offollicles that promotes follicular developmentaccelerates the maturation of large numbers ofhealthy oocytes. Follicle culture and in vitromaturation (IVM) are tentative techniques topreserve oocytes in patients with prematureovarian failure and is a way to avoid the sideeffects of hormonal stimulation protocols in somepatients who undergo assisted reproductiontechniques [1]. The quality of oocytes developedin vitro remains lower compared with in vivomatured oocytes [2-4]. Lower quality of in vitromatured oocytes has been related to theinadequacy of the in vitro environment [5]. Animportant factor that affects the IVM process inmammals is the culture medium used for oocytematuration. Composition of the IVM mediuminfluences the developmental capacity of oocytesand embryos [6]. The in vitro environmentexposes oocytes and embryos to an excess ofreactive oxygen species (ROS) that are notnormally produced during in vivo processes.Although ROS are required for variousphysiological pathways necessary for reproduction,in vivo levels of these molecules are controlled byantioxidants that scavenge and neutralize freeradicals to maintain an optimal physiologicoxygen tension in the reproductive system [7].

Melatonin or 5-methoxy-acetyl-tryptamine hasan important role in the regulation of electrontransfer and detoxification of free radicalintermediates [8]. This molecule selectivelydetoxifies ROS in vitro [9] and is a potent, broadspectrum antioxidant [10-12]. Melatonin is anendogenous hormone produced by the pinealgland, as well as the gut and bone marrow cells orthe enterochromaffin cells of the gastrointestinaltract [13,14]. It is also produced in numeroustissues such as the ovaries, testes, vascularsystem, intestines, and smooth muscles. In

addition, some immune cells possess membraneand nuclear melatonin receptors [15,16].According to research, a direct effect of melatoninon oocytes has been observed [17]. This moleculeeasily crosses all cellular membranes and entersthe cytosol, mitochondria and nuclei [18,19].Some actions of melatonin are mediated throughspecific membrane receptors, whereas otherfunctions seem to rely on nuclear binding sites[20]. Although the physiological roles of melatoninin follicular fluid have not been understood, it ispossible that melatonin is the most effectiveantioxidant in the follicle [21].

In the present study we investigate the effect ofdifferent doses of melatonin on the development ofmouse preantral follicles and their oocytes in vitro.

Materials and MethodsAnimalsFemale NMRI mice used in this study werehoused in a room with a controlled temperature(23-25ºC) and 12 h light:12 h dark cycle. Micewere fed with pellet food and water ad libitum.All study procedures were approved by theMedical Ethics Committee Guilan Universityof Medical Sciences, Rasht, Iran.

Isolation of preantral folliclesImmature female mice (18–22 day-old) werekilled by cervical dislocation. The ovaries wereremoved and placed in droplets of α-minimalessential medium ( α-MEM; Gibco, Invitrogen)supplemented with 10% FBS (Sigma, Germany),100 IU/ml penicillin and 100 μg/ml streptomycin(Sigma, Germany). Preantral follicles weremechanically dissected using 26-G needlesattached to a 1 ml syringe under a stereo micros-cope (Olympus). Follicles with diameters of 150-175 μm and normal appearance (central andspherical oocyte, high density of granulosa cellsand an intact basal lamina) were selected (Fig. 1A).

Melatonin impact on in vitro development 9


Figure 1. Preantral follicle at the start of the culture time (200x) (A): Preantral follicle with antral-like cavity at day six(40x) (B): Degenerated preantral follicle (40x) (C): Control group.

Follicular diameters were measured under aninverted microscope using a calibrated digitalcamera.

Culture of preantral folliclesFollicles were individually cultured for sixdays in 20 μl droplets of α-MEM mediumsupplemented with 5% FBS, 100 mIU/mlrhFSH (Gonal-f, Merck Serono, Switzerland),1% ITS (Gibco, Invitrogen), 100 IU/ml penicillinand 100 μg/ml streptomycin covered with mineraloil at 37ºC in a humidified atmosphere of 5%CO2.

In vitro ovulation inductionOn day six of culture, 5 ng/ml rEGF (Sigma,Germany) and 1.5 IU/ml hCG (Choriomon,Switzerland) were added to the culturemedium of the surviving follicles to induce invitro ovulation. After 16–20 h of incubation,we checked the follicles for ovulation. Ovulatedoocytes were denuded by gentle pipettingfrom the cumulus cells. A stereo microscope(Olympus) was used to grade the state of theoocytes' nuclear maturation.

Experimental groups

To evaluate the effect of melatonin onfollicular development and oocyte maturation,

we cultured the follicles in groups of thefollowing melatonin concentrations: 100 pM,500 pM, 1 nM, 10 nM, and 100 nM.

Evaluation parametersOn day six of culture, we assessed the number ofsurviving follicles. After 16–20 h, the survivingfollicles that had been induced to ovulate werechecked for ovulation. The diameters of theoocytes and zona pellucida (ZP) were measured at200x magnification by a precalibrated digitalcamera under an inverted microscope.

Statistical analysisWe used the chi-square test to analyzesurvival and ovulation rate of the follicles, andthe nuclear maturation of the oocytes. Oocyteand ZP diameters were analyzed by one-wayANOVA. Data analysis was performed usingSPSS 16 software.

ResultsFollicle survivalFigure 2 shows the effects of five concen-trations of melatonin on follicle survival duringthe culture period. On day six there was asignificant decrease in the number of survivingfollicles in those groups treated with 10 nM,100 nM and 500 pM compared to the controlgroup (P<0.05). There was no significant

10 M. Nabiuni, et al


difference between the control, 1 nM and 100pM groups (Figs. 1B and C).

Figure 2. Percentage of surviving follicles in experi-mental groups at the end of the culture period.

.P<0.05 according to the chi-square test ٭

Figure 3. Ovulated COC (100x) (A): Metaphase II oocyte

(200x) (B): Control group

In vitro ovulation and cumulus expansionAfter induction of in vitro ovulation, the survivingfollicles released mucified cumulus-oocytecomplexes (COCs; Fig. 3A). When comparedwith the control group, the 1, 10 nM and 100 nMgroups showed a significant increase in thenumber of COCs (P<0.05). There was no signi-ficant difference between the other groups and thecontrol group (Fig. 4).

Maturation stage of oocytesWe observed the highest number of matureoocytes in the 100 pM group (Fig. 3B),

however this number was significantly lesswhen compared with the control group(P< 0.01; Fig. 5).

Figure 4. Percentage of COCs in the experimentalgroups.

P<0.05 according to the chi-square test ٭

Figure 5. Effect of melatonin on oocyte maturation.M II: Metaphase II oocyte, GVBD: Germinal vesiclebreak down. GV: Germinal vesicle

P<0.05 according to the chi-square test ٭

Oocyte and zona pellucida (ZP) diameterThe mean diameter of oocytes in the controlgroup was 70 μm. This diameter decreased withexposure to different concentrations of melatonin(P<0.05). Oocytes in the 10 nM group had thelowest diameters, whereas the highest diameter



observed for the ZP was in the 1 nM group,which was significant (Table 1).

Table 1. Mean diameters ± S.E. of oocytes andzona pellucida (ZP) in the experimental groups.

Melatoninconcentrations

Mean diameter(µm) of oocytes

Mean diameter(µm) of zona

pellucida (ZP)

100 nM 66.52±0.8ᵃ 8.42±0.210 nM 63.18±0.5ᵃ 7.33±0.11 nM 67.21±0.7ᵃ 9.85±0.2ᵃ

500 pM 63.03±0.5ᵃ 7.06±0.1ᵃ100 pM 66.91±0.5ᵃ 7.76±0.1Control 70.19±0.7 8.07±0.2

a P<0.05 according to ANOVA

DiscussionOxidative stress can alter cellular moleculessuch as lipids, proteins and nucleic acids.Oocytes and embryos produced in vivo can beprotected against free radicals by antioxidantsthat exist within the follicular and oviductfluid [22]. Melatonin plays a key role in avariety of important physiological functions.Some effects of melatonin are mediated bymembrane receptors but many of them exertdirect free radical scavenging properties, aprocess that requires no receptor [21].Physiological melatonin concentrations inhuman blood seems to be in the range of 100pM to 1 nM; in follicular fluid, it is threetimes higher than in serum at the same time[23-25].

It has been demonstrated that the efficacy ofexogenous melatonin in modifying particularreproductive functions varies among speciesaccording to age and timing of itsadministration [26].

The results of our study showed that highconcentrations of melatonin reduced thenumber of surviving follicles. Morphologicalobservations of degenerated follicles showed ahigh reduction in the number of granulosa

cells. The effect of melatonin has been shownby Adriaens et al., where follicle survivaldecreased when 2 mM of melatonin was addedto the culture medium [27]. Inpinealectomized female Syrian hamsters,melatonin administration has been shown toinhibit in vivo follicular development [28].

Melatonin’s inhibition of cell proliferationhas been reported in numerous cellular models[29]. It has been shown that in culturedChinese hamster ovarian cells, high doses ofmelatonin caused decreased cell numbers [30].

High levels of ROS can damagespermatozoa, oocytes and embryos [31]. Thepresence of melatonin in follicular fluid andits receptors in granulosa cells indicate theimportant role of melatonin in reproduction[24,32]. It has been demonstrated that amelatonin concentration of 10‾6 M significantlyincreased the maturation rate of sheep oocytes,however a 10‾5 M concentration of melatonin inculture medium did not significantly influencematuration, fertilization, or cleavage [33].Kang et al. reported that supplementation ofculture medium with 10 ng/ml melatoninduring IVM of porcine oocytes compared withthe control group increased the proportion ofoocytes that extruded polar bodies [32].

Our study showed a significant decrease inoocyte maturation rate in all doses ofmelatonin that was associated with a reductionin oocyte diameter. Wang et al. demonstratedthat melatonin in cultured COCs inhibited theformation of the first polar body, but had noeffect on germinal vesicle break down. Inaddition, melatonin inhibited the effects ofFSH on resumption of meiosis [34]. In anotherstudy supplementation of bovine COC culturemedium with 10‾9 M melatonin, alone or incombination with gonadotropins, did notaffect nuclear maturation, nor did it affect thecleavage and blastocyst rates [35]. In addition



it has been shown that melatonin in the culturemedium did not improve cumulus cell expansionand nuclear maturation of bovine oocytes [36].Although melatonin toxicity is reported to beextremely low, oocyte maturation in femalemice was significantly impaired by melatoninconcentrations of 10‾ 3 M or higher [33].

In this study the reduction of oocytes diametercorrelated with the oocyte maturation state. Itwas demonstrated that bovine oocytes with aninside-zona diameter less than 95 μm wereunable to resume meiosis in vitro [37]. Theability of bovine oocytes of different sizes tomature in vitro was also investigated by Fair etal. [38]. Hyttel et al. and Sirard et al. have alsoshown that oocytes gradually acquire competenceto undergo meiotic maturation and sustainembryonic development after reaching a dia-

meter between 110 and 120 μm [39].ROS in nontoxic levels act as signaling

molecules. They play a role in the balancebetween cell growth and death [40]. In manycell lines such as MCF7 and hepatomaAH130, physiological levels of melatonindelay cell progression from the G1 to the S-phase, prolonging the total duration of the cellcycle [23]. It is possible that melatonininfluences all cell cycle phases by modifyingseveral cell events, given the fact that cellshave not only stopped in the G0/G1 phase, butsome also stopped in the G2 gap [30]. Inconclusion this study has demonstrated thatsupplementing of culture medium with 100 pMmelatonin decreases oxidative stress in mousefollicles. High doses of melatonin have toxiceffects on the follicles.

References1. Cortvrindt R, Smitz J, Van Steirteghem AC. In-vitro

maturation,fertilization and embryo development ofimmature oocytes from early preantral follicles fromprepuberal mice in a simplifiedculture system. HumReprod 1996; 11: 2656-66.

2. Eppig JJ, O’Brien MJ. Development in vitro of mouseoocytes from primordial follicles. Biol Reprod 1996;54: 197-207.

3. Trounson A, Anderiesz C, Jones G. Maturation ofhuman oocytes in vitro and their developmentalcompetence. Reproduction 2001; 121: 51-75.

4. Anckaert E, Adriaenssens T, Romero S, Dremier S,Smitz J. Unaltered imprinting establishment of keyimprinted genes in mouse oocytes after in vitrofollicle culture under variable follicle-stimulatinghormone exposure. Int J Dev Biol 2009; 53: 541-8.

5. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P.Consequences of bovine oocyte maturation,fertilization or early embryo development in vitroversus in vivo: implications for blastocyst yield andblastocyst quality. Mol Reprod Dev 2002; 61: 234-48.

6. Knijn HM, Gjorret JO, Vos PL, Hendriksen PJ, Van derWeijden BC, Maddox-Hyttel P, et al. Consequences ofin vivo development and subsequent culture onapoptosis, cell number, and blastocyst formation in

bovine embryos. Biol Reprod 2003; 69: 1371-8.7. Gupta S, Sekhon L, KimY, Agarwal A. The role of

Oxidative Stress and Antioxidant in AssistedReproduction. Current Women's Health Reviews 2010; 6:227-38.

8. Poeggeler B, Reiter RJ, Tan DX, Chen LD,Manchester LC. Melatonin, hydroxyl radical-mediated oxidative damage, and aging: A hypothesis.J Pineal Res 1993; 14: 151-68.

9. Poeggeler B, Saarela S, Reiter RJ, Tan DX, Chen LD,Manchester LC, et al. Melatonin-A highly potentendogenous radical scavenger and electron donor: Newaspects of the oxidation chemistry of this indole accessedin vitro. Ann N Y Acad Sci 1994; 738: 419-20.

10. Bonnefont-Rousselot D, Collin F, Jore D, Gardès-Albert M. Reaction mechanism of melatoninoxidation by reactive oxygen species in vitro. J PinealRes 2011; 50: 328-35.

11. Galano A, Tan DX, Reiter RJ. Melatonin as a naturalally against oxidative stress: a physicochemicalexamination. J Pineal Res 2011; 51: 1-16

12. Huether G. The contribution of extrapineal site ofmelatonin synthesis to circulating melatonin levels inhigher vertebrates. Experientia 1993; 49: 665-70.

13. Vijayalaxmi, Thomas Jr CR, Reiter RJ, Herman TS.



Melatonin: from basic research to cancer treatmentclinics. J Clin Oncol 2002; 20: 2575-601.

14. Chen LD, Manchester LC, Poeggeler B, Tan DX,Reiter RJ. Melatonin: a potent, endogenous hydroxylradical scavenger. Endocr J 1993; 1: 57-60.

15. Simonneaux V, Ribelayga C. Generation of themelatonin endocrine message in mammals: a reviewof the complex regulation of melatonin synthesis bynorepinephrine, peptides, and other pineal transmitters.Pharmacol Rev 2003; 55: 325-95.

16. Drew JE, Barrett P, Mercer JG, Moar KM, Canet E,Delagrange P, et al.Localization of the melatonin-related receptor in the rodent brain and peripheraltissues. J Neuroendocrinol 2001; 13: 453-8.

17. de Atenor MS, de Romero IR, Brauckmann E, Pisano A,Legname AH. Effects of the pineal gland and melatoninon the metabolism of oocytes in vitro and on ovulation inBufo arenarum. J Exp Zool 1994; 268: 436-41.

18. Mayo JC, Sainz RM, Antoli I, Herrera F, Martin V,Rodriguez C. Melatonin regulation of antioxidantenzyme gene expression. Cell Mol Life Sci 2002; 59:1706-13.

19. Paradies G, Petrosillo G, Paradies V, Reiter RJ,Ruggiero FM. Melatonin, cardiolipin andmitochondrial bioenergetics in health and disease. JPineal Res 2010; 48: 297-310.

20. Tamura H, Nakamura Y, Korkmaz A, ManchesterLC, Tan DX, Sugino N, et al. Melatonin and theovary: physiological and pathophysiologicalimplications. Fertil Steril 2009; 92: 328-43

21. Tamura H, Takasaki A, Taketani T, Tanabe M,Kizuka F, Lee L, et al. The role of melatonin as anantioxidant in the Follicle. J Ovarian Res 2012; 5: 1-9.

22. Gupta S, Sekhon L, Kim Y, Agarwal A. The Role ofOxidative Stress and Antioxidants in AssistedReproduction. Curr Women’s Health Rev 2010; 6:227-38.

23. Cos S, Sanchez-Barcelo EJ. Melatonin and mammarypathological growth. Front Neuroendocrinol 2000; 21:133-70.

24. Brzezinski A, Seibel MM, Lynch HJ, Deng MH,Wurtman RJ. Melatonin in human preovulatoryfollicular fluid. J Clin Endocrinol Metab 1987; 64:865-7.

25. Ronnberg L, Kauppila A, Leppaluoto J, Martikainen H,Vakkuri O. Circadian and seasonal variation in humanpreovulatory follicular fluid melatonin concentration. JClin Endocrinol Metab 1990; 71: 492-6.

26. Brzezinski A. Melatonin in humans. N Engl J Med

1997; 336: 186-95.27. Adriaens I, Jacquet P, Cortvrindt R, Janssen K, Smitz

J. Melatonin has dose-dependent effects onfolliculogenesis, oocyte maturation capacity andsteroidogenesis. Toxicology 2006; 228: 333-43.

28. Karakaş A, Kaya A, Gündüz B. The effect ofpinealectomy, melatonin and leptin hormones onovarian follicular development in female Syrianhamsters (Mesocricetus auratus). Acta Biol Hung2010; 61: 380-90.

29. Blask DE, Sauer LA, Dauchy RT. Melatonin as achronobiotic/ anticancer agent: cellular, biochemical,and molecular mechanisms of action and theirimplications for circadian-based cancer therapy. CurrTop Med Chem 2002; 2: 113-32.

30. Sainz RM, Mayo JC, Tan D, Lopez-Burillo S,Natarajan M, Reiter RJ. Antioxidant activity ofmelatonin in Chinese hamster ovarian cells: changesin cellular proliferation and differentiation BiochemBiophys Res Commun 2003; 302: 625-34.

31. Agarwal A, Saleh RA, Bedaiwy MA. Role of reactiveoxygen species in the pathophysiology of humanreproduction. Fertil Steril 2003; 79: 829-43.

32. Kang JT, Koo OJ, Kwon DK, Park HJ, Jang G, KongSK, et al. Effects of melatonin on in vitro maturationof porcine oocyte and expression of melatoninreceptor RNA in cumulus and granulosa cells. JPineal Res 2009; 46: 22-8.

33. Casao A, Abecia JA, Cebrián-Pérez JA, Muiño-Blanco T,Vázquez M I, Forcada F. The effects of melatonin on invitro oocyte competence and embryo development insheep. Span J Agric Res 2010; 8:35- 41.

34. Wang JH, Bu SM, Xia GL, Wang SB, Tao Y, Lei L,et al. The suppression of melatonin on mouse oocytein vitro maturation of mouse. Zhongguo Ying YongSheng Li Xue Za Zhi 2004; 20: 197-200.

35. Takada L , Martins Junior A, Mingoti GZ, CarvalhoBalieiro JC, Cipolla-Neto J, Coelho LA. Melatonin inmaturation media fails to improve oocyte maturation,embryo development rates and DNA damage ofbovine embryos. Sci Agric 2010; 67: 393-98.

36. Farahavar A, Zare Shahne A, Kohram H, Vahedi V.Effect of melatonin on in vitro maturation of bovineoocytes. Afr J Biotechnol 2010; 9: 2579-83.

37. Blanco MR, Demyda S, Moreno Millán M, Genero E.Developmental competence of in vivo and in vitromatured oocytes: A review. Biotechnol Mol Biol Rev2011; 6: 155-65.

38. Hyttel P, Fair T, Callensen H, Greve T. Oocyte



growth capacitation and final maturation in cattle.Theriogenology 1997; 47: 23-32.

39. Sirard MA, Richard F, Mayes M. Controlling meioticresumption in bovine oocytes: Review. Theriogenology

1998; 49: 483-97.40. Suzuki YJ, Forman HJ, Sevanian A. Oxidants as

stimulators of signal transduction. Free Radic BiolMed 1997; 22: 269-85.



Original Article

The Effects of Pentoxifylline on the Wound HealingProcess in a Rat Experimental Pressure Sore Model

Abdollah Amini, M.Sc.1, Kobra Velaei, M.Sc1, Mohammad Bayat, Ph.D.1*,Masoomeh Dadpay, M.D.2 , Mohsen Nourozian, Ph.D.1,Elhameh Jahanbakhsh Asl, M.Sc. 1

1. Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences,Tehran, Iran2. Department of Pathology, Faculty of Medicine, Army University of Medical Sciences, Tehran, Iran*Corresponding author, E-mail address: [email protected]

Received: January 2012 Accepted: September 2012

Abdollah Amini obtained his B.Sc. in Biology (2000) and his M.Sc. degree in AnatomicalSciences from Tehran University of medical Sciences, Tehran, Iran. He is currently aPhD student in Anatomical Sciences and Biology Department at the Shahid BeheshtiUniversity of Medical Sciences, Tehran, Iran.

AbstractIntroduction: The present study used a histological evaluation method to examine the effects ofpentoxifylline (PTX) on healing an experimentally-induced pressure sore in a rat model.Materials and Methods: There were 36 adult male rats used in this study. Under general anesthesia andsterile conditions, we used forceps to create one pressure sore on each rat. A double layer of folded skin fromthe dorsal region was held with the highest forceps pressure grade for two hours, followed by 30 minutes ofrelaxation. This was repeated 12 times over three consecutive working days, and created a pressure sore afterseven days. Next, rats were randomly divided into three control and three experimental groups. Theexperimental groups received intraperitoneal injections of PTX (50 mg/kg) for 14, 21, and 28 days after thepressure sore was created. Control groups received a similar volume of saline solution. Rats were euthanized,after which samples were extracted from the wound area and prepared for light microscopy examination. Wecalculated the number of neutrophils, macrophages, fibroblasts, blood vessel sections, and thicknesses of thenewly formed epidermis and dermis.Results: Although the values of some studied parameters were higher in the experimental group, there wereno significant differences noted between the experimental and control groups.Conclusion: In this study PTX did not increase any histological parameters. Thus, the effects of PTX on thepressure sore model seem to result from different mechanisms.Keywords: Pentoxifylline, Histology, Rats

To cite this paper: Amini A, Velaei K, Bayat M, Dadpay M, Nourozian M, Jahanbakhsh Asl E. The effects ofpentoxifylline on the wound healing process in a rat experimental pressure sore model. Anat Sci J 2013; 10(1): 15-24

16 A. Amini, et al


IntroductionThe ability of a wound to heal is a topic ofconcern in medicine, such that the tissuehealing process and medications used areimportant areas for medical research. Materialsand medications that can lead to healing or atleast accelerate wound healing have beenreviewed by various studies [1-3]. One medicationthat has been used experimentally to acceleratethe wound healing process is pentoxifylline(PTX).

PTX is a xanthine derivative. As with othermethylated xanthine derivatives, PTX is acompetitive nonselective phosphodiesteraseinhibitor [4] that raises intracellular cyclic AMP(c AMP), activates protein kinase A (PKA),inhibits tumor necrosis factor-alpha [5,6] andleukotriene synthesis [7], and reduces inflamm-ation and innates immunity [7]. In addition,PTX improves red blood cell deformability,reduces blood viscosity and decreases thepotential for platelet aggregation and thrombusformation [8]. PTX increases blood flowthrough peripheral blood vessels and thereforeimproves blood circulation in the arms and legs(intermittent claudication), and in the brain(vascular dementia) [3]. A large volume ofstudies have identified the positive effects ofPTX administration on healing skin flaps [9-11], venous ulcers [12-15], cutneous wounds inhealthy and diabetic mice [16], colitis, stomachulcers, and small and large bowel anastomosesunder experimentally created ischemic conditions[17-20].

According to the literature, administration ofPTX has been shown to positively impact thewound healing process, including those thatarise from pressure sores. The pressure sore is amajor health problem that currently affectsapproximately 3 million adults [21].

Research on pressure sores in humans isdifficult due to variations in both internal

(fever, anemia, infection, ischemia, hypoxia,malnutrition, low body mass, neurologic disease)and external factors (shear forces, friction andimmobility). Due to a lack of knowledge andwide variety of influencing factors, thus the useof several animal models is necessary to increaseour knowledge of the role of PTX in woundhealing. Any method generated to study thepressure ulcer, by itself, cannot show all thefeatures of the pathology of chronic wounds.Only certain types of pressure sore models canmimic certain aspects of wound evolution [22-25].

Pressure sores mostly occur in immobilepatients or those who are unable to change theirbody position. Under these circumstances thepatient’s dermal tissues are at increased risk fornecrosis of the skin, subcutaneous tissue, andmuscles. Pressure sores are defined as areas ofskin discoloration or damage that persist afterthe removal of pressure and which are likely tobe due to the effects of pressure on the tissues[3,26].

Pressure sores have also been described asdecubitus ulcers and bed sores [26]. Scientistshave attempted to use these terms to identifyand describe the pathophysiology of woundscaused by physical stress. However, this termcould not justify the existence of pressure soresthat result from other reasons, such as the soresthat occur in wheelchair patients. Currently, theterm pressure sore is the best description forthese lesions, since they are multifactorial andmay occur anywhere on the body [3].

Stress, time, spasticity, infection, edema,nerve transaction, and poor nutrition areconsidered main factors that can lead to theformation of pressure sores or play a role intheir development. Over 60% of pressure soresoccur in hospitalized patients [21,27-29]. Apossible explanation for this increase in pressure

Pentoxifylline on pressure sore 17


sores prevalence is due to the increasing olderpopulation who need hospital services. Approxi-mately one third to one half of the elderlypopulation have limited mobility. Health careproviders and hospital administrators are legallyobligated to prevent patients from acquiring bedsores and physical weakness [3]. In order toprevent pressure sores, intensive preventativemeasures should be undertaken [30,31].

As mentioned earlier, the primary cause ofpressure sores is based on the exerted pressureand permanent forces on the patient’s dermaltissues, whereby the supply of oxygen is reducedor cut-off, thereby causing tissue necrosis [32,33].Pressure sores remain a major challenge in themedical world [3,33].

Pressure sores result from the ischemia-reperfusion cycle. An important issue in ischemia-reperfusion cycles is cellular impairment.Reperfusion controversially accelerates celldamage in the tissue, which is followed by morecell damage and tissue destruction. Ischemia-reperfusion ulcers are such as the pressure soresthat caused by the same pathomechanical andpathophysiological conditions [23,25,34].

Pressure sores are clinically divided asfollows: i) grade I (similar to intact skin with apale pink or red appearance); ii) grade II(presence of an injured epidermis); iii) grade III(damage develops in the dermis layer of theskin); and grade IV (the whole skin andunderlying muscle to the bone's surface aredamaged) [23,29].

Due to an increase in the elderly populationand prevalence of pressure sores, it seemsnecessary to research the pathophysiological,prevention and treatment of pressure sores inboth basic science and the clinic setting [3,9].

The prevalence rate of pressure sores amongadult patients in hospitals in the UK rangedfrom 6.9% to 9.11%. The incidence rate amongthose who underwent surgery was 12%,

whereas for the elderly it was 22%. Statisticstaken from the entire British populationindicated a prevalence rate of 4.4% for adultsand 6.8% in children.

According to research, worldwide, the pre-valence and incidence of pressure sores variesaccording to environment conditions. For example,in the acute care setting the prevalence rangesfrom 4.7% to 29.7% [1, 3]. A similar study inEuropean hospitals has shown a prevalence of18.1% [2-4]. According to reports by theConsultation Secretariat of the National Asso-ciation of Pressure Ulcers, the range of pre-valence in the US is 10% to 18% in general acutecare units [34,35].

It is known that ischemia and reperfusion arethe most important factors in the pathogenesisof pressure sore development[36,37]. Numerousrecent studies have shown the positive effects ofPTX in cases of ischemic conditions and woundhealing [3,10,], however studies pertaining tothe influence of PTX on pressure sores arelacking. The present study aims to use ahistomorphometrical evaluating method toinvestigate the effects of PTX administration onthe wound healing process in a grade IIIexperimental pressure sore in rats.

Materials and MethodsWe obtained 36 adult male Wistar rats (meanages: twelve weeks) from Pasteur Institute ofIran. Rats were individually housed in cleancages in an animal house on a light-darkcycle (12 hours light: 12 hours dark) withaccess to water and food ad libitum. All studyprocedures were approved by the Medical EthicsCommittee of Shahid Beheshti University ofMedical Sciences, Tehran, Iran.

Generation of pressure soresTo create a grade III pressure sore [38] weanesthetized the rats by administering intra-

18 A. Amini, et al


muscular injections of ketamine (50 mg/kg) anddiazepam (5 mg/kg) on day 0. Next, the hairsof the dorsal region were shaved and the skincleaned with 70% alcohol and povidone iodine.Under sterile conditions the skin was raised,folded at midline and maintained under thehighest pressure grade with a no.25 Halstedmosquito forceps for a period of 2 hours(Fig.1), after which the skin was released andallowed to relax for 30 minutes.

Figure 1. A) Creation of experimental pressure sore in the rat'sskin using no. 25 Halsted mosquito forceps. B) H&E-stained slideshowing the location of the wound. : Degenerated epidermis. **:Degenerated dermis. Magnification: 100×.

A thin sheet of aluminum (3×5mm) was placedbetween each of the external (epidermal) skinsections and forceps clamps in order to provide an

equal pressure distribution for all areas of theclamped skin. The courses of ischemia (2 hours)and perfusion (thirty minutes) were applied for 12times over three consecutive working days (fourperiods per day). During the process of creatingthe pressure sore, the rats were given 1/2 doseinjections of the anesthetic drugs from the onset ofpressure sore induction (the first day) until day 4,when the pressure exertion was completed.Histological examination on day seven confirmedthat the pressure sores were created [3] (Fig. 1).

Pentoxifylline (PTX) administrationWe randomly divided the rats into three controland three experimental groups. The experimentalgroups received intraperitoneal injections ofPTX (50 mg/kg) for 14, 21, and 28 days afterthe pressure sore was created on day 7 . Controlgroups received a similar volume of salinesolution (without PTX).

Histomorphometrical examinationThe rats were sacrificed by inhalation ofchloroform at the end of the designated studyperiods and skin samples were taken from thewound and surrounding normal, undamagedskin. Samples were fixed in 10% formalin-saline, after which they were prepared for tissueprocessing by dehydration, clearing, andparaffin molding. Tissues were sectioned into5µm thicknesses. From the serial sections, weexamined one from each of the five sections.Totally, we examined five sections which hadbeen stained by hematoxylin and eosin (H&E).In each section, ten microscopic fields at amagnification of 400× were morphometricallyevaluated and analyzed by a calibrated lightmicroscopy. The total number of cells thatincluded macrophages, neutrophils, fibroblasts,and blood vessel sections (Fig.2) were examinedin each 0.06 mm2 field from the ten fields. Wereported the mean number from five sections of



each of the rat specimens from each of thecontrol and experimental groups. The eyepieceof the microscope contained 20×20 grids of 2×2mm2 dimensions. We used the same eyepiece tocalculate the thicknesses of the newly formedepidermis and dermis.

Statistical analysisData were analyzed by the student's t-test forindependent samples and presented as mean±SD.P<0.05 was considered statistically significant.

ResultsHistological examination of the experimentally-

induced pressure sores showed an inflammatoryreaction that included numerous neutrophils andsome macrophages in the wound bed. All ratsremained alive after induction of pressure sorewith no secretions or symptoms of infection inboth control and experimental groups during theinvestigation. Figures 3-5 show the histologicalanalyses of the rat's skin in the process of healingon days 14, 21, and 28 after induction of thepressure sore in the control and experimentalgroups. Tables 1-3 show the results of thehistomorphometrical examination.

Figure 3. Photomicrograph of repaired rat skin tissue on day 14 after induction of experimental pressure sore.A) Control group. B) Experimental group،. NE: New epidermis; S: Scab; GT: Granulation tissue; PC: Panniculus carnosus . (H&E stain.Magnification: 100 ×)

Figure 2. High resolution photomicro-graphs of the cells and a blood vesselfrom the repaired skin tissue in anexperimentally-induced pressure sore atday 14 post-injury. A) N: Neutrophil; B) M:Macrophage; C) F: Fibroblast; D) V: Vessel. .(H&E stain. Magnification: 1000 ×)

20 A. Amini, et al


Figure 4. Photomicrograph of repaired rat skin tissue on day 21 after induction of an experimental pressure sore.A) Control group; B) Experimental group. NE: New epidermis; S: Scab; GT: Granulation tissue; BV: Blood vessels. (H&E stain.Magnification: 400 ×)

Figure 5. Photomicrograph of repaired rat skin tissue on day 28 after induction of the experimental pressuresore. A) Control group. B) Experimental group. ,NE: New epidermis, SR: Scar. (H&E stain. Magnification: 400 ×)

Table 1. Day 14 histological parameters (mean±SD) for control and experimental groupsFibroblasts

(n)Macrophages

(n)Neutrophils

(n)Blood vessels

(n)Thickness of the

new epidermis(mm)

Thickness of thenew dermis

(mm)

Parameters

Groups

17.17±7.0816.67±3.2055.00±35.1617.33±7.390.012.5±0.01252.167±0 75C*

20.50±11.6416.33±6.0556.33±27.4733.83±38.220.012.5±0.01251.600±0.63E**0.56240.90750.94310.32371.00000.1884P-value

*C: Control; **E: Experimental




(n)Macrophages

(n)Neutrophils

(n)Blood vessels

(n)Thickness of the

new epidermis(mm)


(mm)

Parameters

Groups

14.83±6.3011.50±3.9313.50±14.0611.67±4.300.07287±0.01751.167±0.4C*13.00±6.8712.50±11.029.000±5.7911.17±8.380.052±0.0151.167±0.4E**

0.64050.83840.48540.89920.39101.00P-value



(n)Macrophages

(n)Neutrophils

(n)Blood vessels

(n)Thickness of the

new epidermis(mm)


(mm)

Parameters

Groups

10.4±1.1019.6±4.724.80±3.344.800±2.770.0475±0.0251.083±0.54C*

11.6±1.148.00±4.853.40±2.303.0±1.220.04±0.03751.33±0.447E**

0.1460.87330.46310.22110.19500.2959P-value


Despite the increased numbers of fibroblasts inthe experimental groups compared with theirrelative controls, there were no significantdifferences noted.

The mean numbers of macrophages, neutro-phils, and blood vessels in the wound sites and themean thicknesses of the demis and epidermis inthe experimental groups (14, 21 and 28 daygroups) were almost equal or slightly less or morecompared with their relative control groups, whichwas not statistically significant.

DiscussionIn a previously published study of our research,we have shown that PTX significantly increasedthe parameters of biomechanical tests thatincluded maximal stress and work up to maximumforce in rats with pressure sores, compared withthe control groups [3]. These results indicated thatadministration of PTX accelerated the healingprocess of pressure sores. In the present study wedecided to study the role of PTX on histologicalparameters in rats with pressure sores compared totheir control groups. We observed higher numbers

of the some histological parameters, in theexperimental groups compared to their relativecontrols, however these results were notstatistically significant. PTX did not increase thehistological parameters, thus its mechanism ofaction on healing pressure sores appeared to be theresult of a different mechanism.

In our previous study, we found that adminis-tration of PTX positively affected the strength andmaturity of the repairing tissue [3], however thiswas not verified by increased numbers ofhistological findings of current study. Similarresults were obtained by Karasoy et al. and Tireliet al. who researched skin and intestinal sores [16,19]. Karasoy et al. observed that administration ofPTX significantly increased the tensile strength ofskin wounds in healthy compared to control mice,however there were no significant differences inhistological parameters between the control andexperimental mice. Their justification forincreasing the tensile strength of wounds treatedby PTX was that tissue perfusion increased inthese wounds [16].

Tireli et al. showed that administration of PTX

22 A. Amini, et al


during the healing process of intestinal grafts, leadto increased numbers of fibroblast cells, increasedtensile strength and the amount of the amino acid,proline, under conditions such as ischemia andreperfusion wounds [19].

Our former study [3] in addition to studies byKarasoy et al. [16] and Tireli et al. [19] haveshown significantly increased tensile strength inwounds in the experimental groups whichindicated that fibroblasts might be more active incollagen synthesis. However, the findings by Dansand Isseroff differ, of which the difference mightpossibly be related to the culture mediumconditions in their studies [39].

Isaac and colleagues investigated the effects ofPTX on human fibroblasts derived fromhypertrophied scars after burning, where theyreported decreased synthesis of type III collagenfibers in these cells [40].Dans and Isserofinvestigated the combined effects of PTX andinterferon on fibroblasts and wound contraction invitro. They have concluded that PTX might delaywound contraction under in vivo conditions andcause decreased production of scar tissue in soresassociated with severe scar tissue [39,40].However, it seems that additional cellular andmolecular research is warranted for clarification.

Tireli and colleagues have investigated thepositive effects of PTX on healing a smallintestine anastomosis after induction of ischemia.They reported that the dose of PTX (50 mg/kg)used in their study [19] caused significant healingin the experimental group. This dose was chosensince it was an effective dose for the reduction oftissue neutrophils. Neutrophils affect tissue bysecreting proteolytic enzymes and free radicals inthe wound bed of pressure sores during healingprocess [19,41]. In our pilot study we observed apositive effect of PTX (50 mg/kg) on the pressuresore. Thus in the current study, we used 50 mg/kgPTX for the experimental groups.

Numerous studies have used PTX in experi-mental models of skin flaps [9-11]. In those

studies PTX was injected for a defined period oftime into the animals, and skin flaps were createdfollowed by administration of PTX for a longerduration. In studies by Bayat et al. and Pratt et al.[10,11], PTX was administered seven days beforesurgery in the first stage, but did not lead to anysignificant increase in flap survival. Thus in thesecond series, PTX was administered 14 daysbefore flap surgery which lead to a significantincrease in skin flap survival. According to theseresults administration of PTX prior to surgery wasnecessary in order to achieve positive results.However, in that research the flap model was usedunder ischemia conditions, which differed fromthe pressure sore model. In the present study, weadministered PTX after the pressure sores werecreated, and observed a positive effect.

In those studies [9-11] the dose of PTX was 20mg/kg, which was lower than the dose used in thepresent study. Possibly, if higher doses of PTXwere used in those studies a positive effect of PTXon flap survival could have been observed withoutthe preoperative administration of PTX. Additionalresearch is necessary to confirm this comment. Inother studies The researchers have suggested thatPTX should not be routinely used in cases of acuteischemic stroke [42].

The present study has shown that administrationof PTX at a dose of 50 mg/kg to an experimentalmodel of pressure sores in rats did not signi-ficantly affect the histological parameters such asnumbers of cells, blood vessels and thicknesses ofthe repaired tissue compared with the controlgroups. As the histological parameters in thecurrent study did not increase, thus there seems tobe another mechanism of action for PTX onpressure sores.

AcknowledgmentWe express our appreciation to the ViceChancellor of Research at Shahid BeheshtiUniversity of Medical Sciences, Tehran, Iran forfinancial support.



References1. Papanikolaou P, lyne P, Anthony D. Risk assessment

scales for pressure ulcers: a methodological review.Int J Nurs Stud 2007; 44: 285-96.

2. Shahin ES, Dassen T, Halfens RJ. Pressure ulcerprevalence and incidence in intensive care patients: aliterature review. Nurs Crit Care 2008; 13: 71-9.

3. Velaei K, Bayat M, Torkman G, Rezaie F, Amini A,Noruzian M, et al. Evaluating the effects ofpentoxifylline administration on experimentalpressure sores in rats by biomechanical examinations.Lab Anim Res 2012; 28: 209-15.

4. Vanderwee K, Clark M, Dealey C, Gunningberg L,Defloor T. Pressure ulcer prevalence in Europe: Apilot study. J Eval Clin Pract 2007; 13: 227-35.

5. Deree J, Martins JO, Melbostad H, Loomis WH,Coimbra R. Insights into the regulation of TNF-αproduction in human mononuclear cells: The effectsof non-specific phosphodiesterase inhibition. Clinics(Sao Paulo) 2008; 63: 321-8.

6. Marques LJ, Zheng L, Poulakis N, Guzman J, CostabelU "Pentoxifylline inhibits TNF-alpha productionfrom human alveolar macrophages". Am J RespirCrit Care Med 1999; 159: 508-11.

7. Peters-Golden M, Canetti C, Mancuso P, Coffey MJ..Leukotrienes: underappreciated mediators of innateimmune responses. J Immunol 2005; 174: 589-94.

8. Ward A, Clissold SP. Pentoxifylline. A review of itspharmacodynamic and pharmacokinetic properties,and its therapeutic efficacy. Drugs 1987; 34: 50-97.

9. Yessenow RS, Maves MD. The effect of pentoxifyllineon random skin flap. Arch Otolaryngol Head NeckSurg 1989; 115: 179-81.

10. Pratt MF. Evaluation of random skin flap survival in aporcine model. Laryngoscope 1996; 106:700-12.

11. Bayat M, Chelcheraghi F, Piryaei A, Rakhshan M,Mohseniefar Z, Rezaie F, et al. The effect of 30-daypretreatment with pentoxifylline on the survival of arandom skin flap in the rat: an ultrastructural andbiomechanical evaluation. Med Sci Monit 2006; 12:

201-7.12. Falanga V, Fujitani RM, Diaz C, Hunter G, Jorizzo J,

Lawrence PF. Systemic treatment of venous legulcers with high doses of pentoxifylline; efficacy in arandomized. placebo controlled trial. Wound RepReg 1999, 7: 208-13.

13. Dale JJ, Ruckley CV, Harper DR, Gibson B, Nelson EAand Prescott RJ. Randomized double blind placebocontrolled trail of pentoxifylline in the treatment ofvenous leg ulcers. BMJ 1999; 319: 875-8.

14. Jull A, Waters J, Arroll B. Pentoxyfylline fortreatment of venous leg ulcers: a systemic review.Lancet 2002; 395: 1550-4.

15. De Sancits MT, Belcaro G, Cesarone MR. Treatment ofvenous ulcers with pentoxifylline : a 12 month, doble-blind, placebo controlled study. microcirculation andhealing. Angiology 2002; 53: 49-51.

16. Karasoy A, Kuran I, Turan T, Hacikerim S, Bas L,Sungan A. The effect of pentoxifylline on the healingof full -thickness skin defect on diabetic and normalrat. Eur J Plast Surg 2002; 25:253-7.

17. Peterson TC and Davey K. Effect of acutepentoxifylline treatment in an experimental model ofcolitis. Aliment Pharmacol Ther 1997; 11: 575-80.

18. Shimizu N, Watanabe T, Arakawa T, Fujiwara Y,Higuchi K, Kourok T. Pentoxifylline accelerategastric ulcer healing, Digestion. 2000; 61: 157-64.

19. Tireli GA, Salman T, Ozbey H, Abbasoglu L, TokerG, Celik A. The effect of pentoxifylline on intestinalanastomotic healing after ischemia. Podiatr Surg Int2003; 19: 88-90

20. Parra-Membrives P, Ruiz-Luque V, Escudero-Serevin C, Agullar-Luque J, Mendaz-Garcia V.Effect of pentoxifylline on the healing of ischemiccolorectal anastomoses. Dis Colon Rectum 2007; 50:369-75.

21. Lyder C H. Pressure Ulcer: Prevention andManagement. JAMA 2003;289: 223-6.

22. Bosboom EM, Bouten CV, Oomens CW, van Straaten

24 A. Amini, et al


HW, Baaijens FP, Kuipers H. Quantification andlocalisation of damage in rat muscles after controlledloading; a new approach to study the aetiology ofpressure sores. Med Eng Phys 2001; 23: 195-200

23. Nguyen P ,Smith, Reynolds KJ. A literature review ofdifferent pressure ulcer models from 1942-2005 andthe development of an ideal animal model. AstralasianPhys Eng Sci Med 2008; 31: 223-5.

24. Salcido R, Popescu A, Ahn C. Animal models inpressure ulcer research. J Spinal Cord Med 2007; 30:107-16.

25. Tweed C. The role of pressure in pressure ulceraetiology: a review of the literature. PrimaryIntention 2003; 11: 28-36.

26. Grey JE, Harding KG, Enoch S. Pressure ulcers. BMJ2006; 332: 472-5.

27. Berlowitz DR, Brienza DM. Are all pressure ulcersthe result of deep tissue injury? A review of theliterature. Ostomy Wound Manage 2007; 53: 34-8.

28. Gefen A. Risk factors for a pressure-related deeptissue injury: a theoretical model. Med Bio EngComput 2007; 45: 563-73.

29. Ruschkewitz Y, Gefen A. Cell-level temperaturedistributions in skeletal muscle post spinal cordinjury as related to deep tissue injury. Med Biol EngComput 2010; 48:113-22.

30. Isken T, Serdaroglu I, Ozgentas E. The effects of thepentoxifylline on survival of the skin flaps instreptozotocin-diabetic rats. Ann Plast Surg 2009; 64:446-50.

31. Bass MJ, Phillips LG. Pressure sores. Curr Probl Surg2007; 44: 101-43.

32. Deelfoor T. The risk of pressure sores: a conceptualscheme. J Clin Nurs 1998; 8: 206-16.

33. Meijer JH, Germs PH, Schneider H, Ribbe MW.Susceptibility to decubitus ulcer formation. ArchPhys Med Rehabil 1994; 75: 318-23.

34. Cuddigan J, Ayello EA, Sussman C, Baranoski S, eds.Pressure ulcers in America: Prevalence, incidence, andimplications for the future. Reston, VA: NationalPressure Ulcer Advisory Panel, 2001.

35. Clark M, Bours G, Delfoor T, Summery report on theprevalence of pressure ulcers. EPUAP 2002; 4: 49-57.

36. Reid RR, Sull AC, Mogford JE, Roy N, Mustoe TA.A novel murine model of cyclical cutaneous ischemia-reperfusion injury. Journal of Surgical Research. JSurg Res 2004; 116: 172-80.

37. Kosiak M. Etiology and pathology of ischemic ulcer.Arch Phys Med Rehabil 1959; 40: 62-9.

38. Dorland's Illustrated Medical Dictionary, DeluxeEdition, 32nd ed, Philadelphia, Saunders, 2011.

39. Dans MJ, Isseroff R. Inhibition of collegen latticecontraction by pentoxifylline and interferon-alfa, -beta and gamma. J Invest Dermatol 1994; 102: 118-21.

40. Isaac C, Mathor MB, Bariani G, Paggiaro AO, HersonMR, Goldenstein-Schainberg C, et al. Pentoxifyllinemodifies three-dimensional collagen lattice modelcontraction and expression of collagen types I and IIIby human fibroblasts derived from post-burnhypertrophic scars and from normal skin. Burns2009; 35:701-6.

41. Tsutakawa S, Kobayashi D, Kusama M, Moriya T,Nakahata N. Nicotine enhances skin necrosis andexpression of inflammatory mediators in a rat pressureulcer model. Br J Dermatol 2009; 161: 1020-7.

42. Bath PM, Bath-Hextall FJ. Pentoxifylline,propentofylline and pentifylline for acute ischaemicstroke. Cochrane Database Syst Rev 2004; CD000162.



Original Article

Study of the Effect of Hypothyroidism on the ApoptoticIndex in Rat Ovarian Follicles, Using the TUNEL Technique

Mahmoud Moghaddam-Dorafshani , M.Sc.1, Medi Jalali, Ph.D.1 *,Mohammad Reza Nikravesh, Ph.D.1, Ali Reza Ebrahimzadeh , Ph.D.1

1. Anatomy and Cell Biology Department, Medical Faculty, Mashhad University of Medical sciences, Mashhad, Iran*Corresponding author, E-mail address: [email protected]

Received: August 2012 Accepted: October 2012

Professor Mehdi Jalali has 26 years of experience as an educator, supervisor, andresearch scientist in gross anatomy, embryology and histology at Mashhad Universityof Medical Sciences, Mashhad, Iran. Dr. Jalali conducts research in developmentalbiology with specific emphasis on developmental immunohistochemistry.

AbstractIntroduction: Among the endocrine diseases, hypothyroidism is the commonest after diabetes.Thyroidhormones (T3,T4) are essential for genital organs function. Apoptosis process in ovarian cells plays asignificant role of development in ovarian follicles. The aim of the present study was determine the apoptoticindex induced by hypothyroidism in rat ovarian follicles.Materials and Methods: In the present study, twenty female mature wistar rats were used with age of 2.5months and weight of 200-250 (g). Rats were divided into test and control groups. In test group chemicalhypothyroidism induced by propylthiouracil (PTU;500 mg/L) in drinking water. The control group onlyreceived normal drinking water. After three weeks the rats were killed and their ovaries removed and werefixed for tissue preparation. TUNEL technique were used for determine of apoptosis. Cells count done bystereological method. Data were analyzed by t-test and one-way ANOVA followed by Tukey test.Significance was accepted at P<0.05.Results: The findings showed that the apoptotic index had a significant decrease in late antral and graffianfollicles (P=0.000) and no significant decrease in preantral and early antral follicles (P>0.05) in hypothyroidgroup. All granulosa cells were TUNEL-positive in primary follicles but no cell was seen in primordialfollicles in groups.Conclusion: The results of the present study showed that the hypothyroidism may be vigorous decreased ofapoptotic index in antral and graffian follicles. Hypothyroidism increased the number of luteal bodies anddecreased the number of graffian follicles in ovarian tissue.Keywords: Hypothyroidism, Apoptosis, Ovarian Follicle, Thyroid Gland, Rats

To cite this paper: Moghaddam-Dorafshani M, Jalali M, Nikravesh MR, Ebrahimzadeh AR. Study of theeffect of hypothyroidism on the apoptotic index in rat ovarian follicles, using the TUNEL technique. AnatSci J 2013; 10(1): 25-35.

26 M. Moghaddam, et al


IntroductionAfter diabetes, hypothyroidism is the mostcommon endocrine disease whose incidenceincreases with age. This disease is mainlycaused by disorders in thyroid gland that lead todecreases in triiodothyronine (T3) and thyroxin(T4) production and secretion, resulting inprimary hypothyroidism [1-3]. Levothyroxine isa thyroid hormone prescribed when the thyroidgland does not produce an adequate amount ofhormones [4,5].

Female fertility is dependent upon the precisedevelopment of ovarian tissue, special regulationof oocytes, and the maturity, multiplication anddiscrimination of somatic cells during folliculo-genesis. This process is regulated by intra-gonadal and extragonadal factors. The intra-gonadal factors begin follicular growth andorganize oocyte development, granulosa cellsand theca cells ingredients in follicles. Fourmain types of follicles are present in the ovary:primordial, primary, secondary and graffian[6-8].

Mattheij et al. researched the ovary-pituitaryaxis following reduction in thyroid hormones inmature female rats by iodine-131 radioidectomy.According to the results, hypothyroid rats hadirregular, long menstrual cycles, increasedplasma progesterone and decreased ovulation [9].

Apotosis is the planned cell death that occursnaturally during different stages of morphogenesis,both in fetal tissues and during adulthood. Therate of apoptosis increases in cells under certainpathologic conditions such as genetic changes(BCL2, ligand Fas, P53), heat, exposure toionizing rays, toxic substances, hormonal andgrowth factor depri-vations, and genetic mutations.The cell that undergoes apoptosis morpho-logically becomes round and wrinkled in shapeand its nuclear chromatin becomes compressedand marginal. When DNA is analyzed, the cellnucleus will be broken into several blocks or

chromatin bodies, called apototic bodies whichare finally eliminated by phagocytizing cells[10,11].

The necessity of apotosis is widely acceptedin multicellular organisms. According to studies,the process of apoptosis in ovarian tissue cellsplays a significant role in the development ofovarian follicles. This process occurs withinthree stages during ovarian development:oogonium before birth, follicular atresia andlutealysis [12,13]. This study aims to determinethe apoptotic index that results from reductionsin the thyroid hormones, T3 and T4, in ovarianfollicles.

Materials and MethodsAll study procedures were approved by theMedical Ethics Committee Mashhad Universityof Medical Sciences Mashhad,Iran. The presentresearch is an experimental and interventionalstudy.The number of female mature wistar ratswere selected in 2.5 months of the age and bodyweight of 200-250 (g). Animals were maintainedin standard animal house conditions (12 hrlight:12 hr dark) with adequate water and food,at a temperature of 24±1°C. The experimentalgroup (n=10) was given a solution ofpropylthiouracil 500 (mg/L) (PTU; Iran HormoneCompany, Iran) in drinking water. Their hypo-thyroidism was confirmed by radioimmuno-assay (RIA). PTU causes rapid decline inthyroid hormones under hypothyroid conditions[4,15] Controls (n=10) received ordinarydrinking water.

Radioimmunoassay (RIA)In order to ensure hypothyroidism , the level ofthyroid hormones in the rats' blood plasma ismeasured in RIA method. Three weeks afterReception of the drug, were venesected fromtheir angular eye vein to 1-2 mL. After centri-

Ovarian follicles apoptosis after hypothyroidism 27


fuging the blood's serum was determined usingkit (Iran,IRMA co.) in RIA method. At the endof the period, the ovaries all of the groups weredissected and transferred to fixation solution.

Histological analysisTissue samples were fixed in paraformaldehyde(4%) that was solved in phosphate buffersaline(100 mL) (PBS) for 14 to 16 h,dehydrated in ascending grades (20%-100%) ofalcohol for 45 min to 1 h, then cleared inalcohol-xylene (50:50) and xylene (three times).Tissues were then fixed in paraffin, sampleswere cut in 5 µm sections with a microtome andplaced on poly L-lysine slides. Slides weredeparaffinized and hydrated in descendinggrades of alcohol. Tissues were analyzed by theTUNEL technique and viewed with an opticalmicroscope.

TUNEL immunohistochemical techniqueApotosis in tissue was done by TUNELproxidase kit (In situ cell death detection Kit-POD,Roch,Germany). The Sections weredeparaffinized, hydrated and then incubated for15 minutes in room humid temperature with 20(g/mL) K protein kinase. The slides were thenincubated with reactive TUNEL mixtureconsisting terminal deoxynucleotidyl transferase(Enzyme Solution 450μL, Lable Solution 50μL)for sixty minutes in temperature of 37 °C.ThendUTP(Deoxyuridine Triphosphate) conjugatedby dioxygen proxidase was added and the slideswere covered with a lid. Afterwards Dioxygenand Hydrogen Peroxide (Converter-POD) wasadded to the samples. The slides were incubatedfor 30 minutes and DAB(Diaminobenzidine)was added (DAB powder 6mg , PBS 10mL ,H2O2 3% 10μL).The slides were stained byhematoxylin. Apoptotic cells will appear inbrown [16-20].

Morphological evaluation of ovarian folliclesThe ovarian follicles were classified to followinggroups:[21-24].1) Primordial Follicle, the oocytes is surroundedby a layer of squamous follicular cells.2) Intermediate Follicle, the oocytes is surroundedby squamous and cuboid cells.3) primary follicles ,the oocytes is surroundedby cuboid cells.4) Preantral follicle,the spaces are seen betweencells sporadically. Antral follicle, the space isextending between the cells finally taking one -third of the follicle's volume. This follicle itselfincludes two stages.5) In primary stages called Early antral6) In final stages called late antral7)Tertiary (Graffian) the selected follicle with aspace bigger than two-third of follicle's volume.

Stereology techniqueApoptotic index were calculated in stereologicalmethod [25-31]. (Table1).

Statistical analysisThe data were analysed by Life science , Imagej, Image Tools3 and SPSS 16 softwares. T-test,ANOVA and Tukey tests were done and theresults that valued P<0.05 were regarded assignificant.

ResultsRadioimmunoassay Test and ovarian tissuesweightStatistical analysis on the data showed asignificant decrease in the rate of thyroidhormones in hypothyroid group (P<0.001),(Table 2).

In macroscopic study ,the ovarian tissues wereweighted whit digital scale in control andhypothyroid groups. Statistical analysis showed asignificant decrease in hypothyroid group(P<0.001),(Table 2; Fig. 1).



Table 1. Method for determining apoptotic indexEquation Description

numerical density in volume unit (mm-3), total counted marked nucleicross-section, total frames related to the desired structure, area of eachframe considering the magnification (mm2) and dissector depth (mm).

reference volume (mm3), distance of two sections (cross-section thickness)(mm), area related to spot (mm2), number of cross-sections andtotal spots hit with the desired structure.

volume fraction or volume density, total spots hit with follicle andreference volume (mm3) .

follicle volume (mm3), volume fraction or volume density and referencevolume (mm3).N total number of marked nuclei in the follicle, numerical density in unitvolume (mm-3) and follicle volume (mm3).

apoptotic index, number of follicles with dying cells ,number of dying cells in each follicle , total number of follicles and

total number of cells in each follicle.

Table 2. T3 and T4 hormone serum levels andweight of ovaries in control and hypothyroid groups.

Group Mean(%) SD

Control 85.90 14.47T3**Hypothyroid 54.30* 9.79

Control 4.60 0.45T4**Hypothyroid 3.22* 0.68

Ovary weight Control 0.07 0.00(g) Hypothyroid 0.04* 0.01

*Significant values compared with control group, P<0.05.**Results according to RIA analysis.

Apoptotic index in ovarian folliclesThe results are expressed as follow:The studies on primordial follicles showedzero apoptotic index and no TUNEL-positivecells in control and hypothyroid groups (Figs.3,4-B).

The apoptotic index was equal 100% incontrol and hypothyroid groups. This meansthat all of the cells were TUNEL- positive inPrimary follicles. The standard deviation (SD)between data averages was zero in both groups(P>0.05), (Figs. 3,4-C).

The results of the apoptotic index showed no

significant difference between groups inpreantral and early antral follicles (P>0.05).TUNEL–positive cells were seen in theca layercells(Table3, Figs.3,4-D,E).

The results of the apoptotic index showed asignificant decrease in hypothyroid comparedto control groups in late antral and graffianfollicles (P=0.000). TUNEL-positive cells wereseen in antrum margin clearly (Table3, Figs.3-F,G,H,I and 4-F,G,H,I).

Figure 1. Ovarian tissues weight (g) in control andhypothyroid groups.*Significant values compared with control group, P<0.05, (Control(C), Hypothyroid (H) rats)



Figure 3. Photomicrograph of rat ovarian follicles in control group after TUNEL immunohistochemicaltechnique. TUNEL-positive nuclei are seen in brown. A) General image of ovarian tissue, spots in brown indicateTUNEL-positive cells in ovarian tissue. B) Primordial follicle (arrow), absence of TUNEL-positive cells in squamous cellsof follicle. C) Primary follicle (arrow), granulosa cuboid TUNEL-positive cells are clearly visible. D) Preantral follicle,granulosa TUNEL-positive cell nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip), TUNEL-positive cells areseen in theca layer (t). E) Early antral follicle with small antrum, granulosa TUNEL-positive nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip). F) Late antral follicle with two-thirds antrum of the follicle volume(a). G) Same as (F) image,but at higher than magnification, Granulosa TUNEL-positive cell nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip).H) Graffian follicle with very large antrum that is over two-thirds of the follicle volume (a),I) Same as (H) image but athigher than magnification, granulosa TUNEL-positive cell nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip),TUNEL-positive cells are clearly visible along the antrum (asterisk). magnification: x4 (A); x100 (B-D and I); x40 (E andG); x20 (F); x10 (H).

Figure 2. Apoptotic index of ovarian follicles incontrol and hypothyroid groups.*Significant values compared with control group, P=0.000.

Analysis of the apoptotic index

Studying the apoptotic index of ovarian folliclesin control and hypothyroid groups showed themost degree in primary follicle and the least ingraffian follicle. Apototic index of graffian follicleshowed a significant decrease in hypothyroidcompared to control groups. The trend of apoptoticindex decrease of primary to graffian follicle incontrol group.

ANOVA statistical analysis and Tukey testshowed a significant difference of apoptotic



index between primary follicle and other typesof the follicles in control group (P=0.000),While the difference was not significant in othertypes of ovarian follicles. Also a significantdifference was seen between primary follicleand other types of the follicles in hypothyroidgroup. The results of other ovarian follicles inhypothyroid group were as follows: apoptoticindex of preantral follicle showed a significantdifference in late antral and Graffian follicles,while the difference was not significant in Earlyantral follicle. Apoptotic index of Late antralfollicle showed no significant difference ofGraffian follicle , while it showed a significantdifference the other types of follicles. Theapoptotic index of Graffian follicle showed asignificance difference of primary follicle incontrol group. But it showed a significantdifference of preantral and early antral follicles inhypothyroid group (Table4; Fig. 2).

Table 3. Apoptotic index of ovarian follicles in controland hypothyroid groups.

Type of follicle Group Mean(%) SD

Control 79.85 6.87PreantralHypothyroid 78.30 0.80

Control 77.57 3.90Early antralHypothyroid 76.69 6.27

Late antral Control 77.28 6.83

Hypothyroid 56.68* 1.64

Graffian Control 77.11 5.76


*Significant values compared with control group, P<0.05.

Numbers of graffian follicles and lutealbodies

According to our results, there was a significantdecrease in the number of graffian follicles in thehypothyroid group (P=0.000). There was asignificant increase in the number of luteal bodiesin the hypothyroid group compared to the controlgroup (P=0.000), (Table 5; Figs. 3, 4-A).

Table 4. Significant levels of apoptotic index of ovarian follicles in control and hypothyroid groups

GraffianLate antralEarly antralPreantralPrimaryPrimordial

Hyp

othy

roid

Con

trol

Hyp

othy

roid

Con

trol

Hyp

othy

roid

Con

trol

Hyp

othy

roid

Con

trol

Hyp

othy

roid

Con

trol

Hyp

othy

roid

Con

trol

++++++++++Primordial

++++++++++Primary

+-+---++++Preantral

+-+---++++Early antral

--+-+-++++Late antral

--+-+-++++Graffian

+: Significant difference; -: No significant difference



Figure 4. Photomicrograph of rat ovarian follicles in hypothyroid group after TUNEL immunohistochemicaltechnique. TUNEL-positive nuclei are seen in brown. A) General image of ovarian tissue. B) Primordial follicle (arrow),absence of TUNEL-positive cells in squamous cells of follicle. C) Primary follicle (arrow), granulosa cuboid TUNEL-positive cells are clearly visible. D) Preantral follicle, granulosa TUNEL-positive cell nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip), TUNEL-positive cells are seen in theca layer (t), oocyte nucleus (asterisk) is clearlyvisible. E) Early antral follicle with sporadic small holes between granulosa cells, granulosa TUNEL-positive nucleus(arrow) and TUNEL-negative (arrow tip). F) Late antral follicle with two-thirds antrum of the follicle volume(a), granulosaTUNEL-positive nucleus (arrow) and TUNEL- negative (arrow tip). G) Graffian follicle with large antrum more than two-thirds of the follicle volume. H) Same as (G) image, but at higher than magnification with large antrum (a), granulosaTUNEL-positive cell nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip). I) Same as (H) image but at higherthan magnification, granulosa TUNEL-positive cell nucleus (arrow) and TUNEL-negative cell nucleus (arrow tip), TUNEL-positive cells are clearly visible along antrum (a) (asterisk). magnification: x4 (A); x100 (B-D and I); x40 (E and H); x20(F); x10 (G).

Table 5. Number of graffian follicles and luteal bodiesin control and hypothyroid groups.

GroupMean(%)

SD

Control 5.00 0.81Graffian follicles (n)


Control 2.50 0.85Luteal bodies (n)


*Significant values compared with control group, P=0.000

DiscussionThe most common cause of hypothyroidismworld wide is attributed to iodine deficiency. In

regions that have adequate iodine, autoimmunediseases such as Hashimoto's thyroiditis isamong the most common cause of hypothyroidism[1-3]. The ovary regulates the evolution ofmature oocytes as well as the release andproduction of hormones such as estrogen,progesterone and inhibin which are vital forevolution during maturity, preparation of theuterus for pregnancy, and during implantationand the primary stages of pregnancy. This isindicative of the crucial role of oogonia informing primordial follicles [32,33]. Experiencehas shown that normal sexual behavior andrelated physiological aspects are subject to the



presence of a balanced level of thyroidhormones [34,35].

Armada et al. conducted a study to determinewhether infertility due to hypothyroidism wasthe result of changes to function of the pituitarygland or resulted from the ovary. Their findingsshowed a decrease in numbers and thickness ofthe luteal body in hypothyroid rats. In addition,there was a significant decrease in the numberof graffian follicles in the hypothyroid rats. Theresearchers have determined that morphologicalchanges could be the outcome of excessproduction of prolactin (PRL) in the pituitarygland which prevents secretion and function ofgonadotropin hormone (GnH) [36]. Various vitalfunction mechanisms, including reproductivefunctions have a neural-hormonal nature [37].The hypothalamic-pituitary axis and its impactin increasing gonadotropins can influencereproductive activities [38].

Hosoda et al. have shown that infertility instudied rats resulted from a thyroid functiondeficiency. Sufficient thyroid secretion (T3) washighly important for natural function ofreproduction in female rats. Their results haveshown that the thyroid hormone is not the requisitefor mating and delivery. The thyroid hormonesplay a crucial role in evolution and function ofreproductive organs during maturity [39].

According to research, the hypothalamic–pituitary axis begins to form from weeks 4 and5 of embryonic development and completesformation by weeks 30 to 35 of pregnancy [40].The hypothalamic–pituitary axis establishes arelationship with gonads, and assists withfeedback and control related to hormonalsecretion and balance [41]. Existing evidenceindicates that iodine deficiency and ensuingreduction in thyroid hormones can be manifestedas reductions in fertility, miscarriage, and fataldefects that include defects in the evolution andfunction of this system [42,43].

Apoptosis plays a crucial role in regulatingfollicular growth and causes atresia in follicles.Kiess et al. have researched apoptosis hormonecontrol by studying the effect of differenthormones, including steroids and growth factorson the prostate, ovaries, testes, and mammaryglands. The findings showed that steroidhormones played a crucial role in regulatingapoptosis in organs and some endocrine glandscaused apoptosis adjustment. Growth factorsand estrogens cause ovarian follicles to survive,whereas androgens and gonadotropins induceapoptosis in follicles [44]. According to theliterature, thyroid hormones play a crucial rolein apoptosis of ovarian follicular cells.

In the present study, the apoptotic index waszero in the primordial follicles from both groups.Thus, according to this result apoptosis in ovarianfollicular cells begins with the onset of primaryfollicular formation. The absence of apoptoticcells in primordial follicles has proven thehypothesis that about 99% of the follicle supplydegenerated during the early stages of primaryfollicle formation [8]. According to the apoptoticindex, there was a reducing trend of primary tograffian follicles in both groups. This shortage wasclearly evident in the late antral and graffianfollicles of the hypothyroid group.

The results have proven that GnH are animportant controlling factor in the apoptosisprocess in ovarian follicles. These hormonesregulate caspase-3, which has a basic role inapoptosis induction in granulosa cells [44].There is an increase in PRL hormone productionand reduced secretion of gonadotropins inhypothyroidism [36]. It has been stated thatthere is more iodine uptake in ovarian follicularfluid than any other organs except for thethyroid gland and increase by estrogens andhypothyroid state [45]. The results of thepresent study showed decreased apoptotic indexin follicles with large antrum (late antral and



graffian) which supported the results ofprevious studies. Although the apoptotic indexof the graffian follicle selected for ovulationdecreased at a normal level in the control group,there was a significant decrease due to deficiencyof GnH in the hypothyroid group. In particular,the apoptotic index of selected graffian folliclesshowed a significant decrease compared tocontrol group, considering large antrum containingfollicular fluid for preserving and stability offollicle.

According to the results we have presumedthat a reduction of thyroid hormones can lead tosignificant decreases in the apoptotic index inonly follicles with large antrum. In the currentstudy, hormone reduction has caused a significantdecrease in the apoptotic index in some types offollicles compared to the control group.

Since most primary follicles had an apoptoticindex of 100% in both groups, it might beconcluded that they were unaffected byhypothyroidism. Within the subgroups of theprimary follicle, the preantral follicle had thehighest apoptotic index followed by the earlyantral follicle. Although hypothyroidism causesdisorders in the reproductive process, it waspossible that adjustments occurred in a way thatthe selected follicle could enter the ovulationstage. Microscopic images of the ovarian tissueshowed a increase in antral follicles in thecontrol group, as well as the corpus luteumwere clearly observed in the hypothyroid group.

It can be presumed that the developing trend

toward graffian follicles in the hypothyroidgroup occurred at a faster rate compared to thecontrol group. Studies have proven the presenceof thyroid hormones, particularly T3 infollicular fluid and the existence of theirreceptors in granulosa cells. The our findingsprove of the hypothesis proposed in thisresearch [45]. Experimental studies should beundertaken to evaluate the contents of follicularfluid, both molecularly and biochemically toclearly determine the factors that create theseeffects.The results of present study propose ahypothesis that decreases in thyroid hormonesmay cause extensive hormonal changes. In turn,these changes cause the factors present infollicular fluid, particularly in antral follicleswith large antrum, to undergo changes andmake the process of follicular growth passquickly. Therefore the follicle will enter thenext stage without making required potentialityand ovules are produced of healthy ormorphologically defective. Increase in lutealbodies can also be an outcome of these events.

AcknowledgementThis study was sponsored by the MashhadUniversity of Medical Science and the Histo-chemical Laboratory of the Anatomy Departmentat the School of Medicine, for whom we expressour appreciation. We also are grateful to allcolleagues and friends who helped us duringthis study.

References1. Bharaktya S, Griffing GT. Hypothyroidism. 2010 Mar

31; [cited 2011 May12]:[about 16 p.].Avalable from:http//www. emedicine. medccape. com/ article/.

2. Harrison G, Ebrahimpoor M. Haririson‘s principles ofinternal medicine. 17th ed. Tehran, Nore danesh, 2008,101-37.(Persian).

3. Guyton AC, Sepehri H, editor. Textbook of medicalphysiology. 12th ed. Tehran. Andishe rafi, 2011, 1158-

71.(Persian).4. Imberti R, Ferrari M, Albertini R, Rizzo V, Tinelli C.

Increased levothyroxine requirements in critically illpatients with hypothyroidism. Minerva Anestesiol2010, 76, 500-3.

5. Radaeli Rde F, Diehl LA. Increased levothyroxinerequirement in a woman with previously well-controlled hypothyroidism and intestinal giardiasis.



Arq Bras Endocrinol Metabol 2011; 55: 81-4.6. Ruoss C, Tadros A, O’Shea T, McFarlane J, Almahbobi

G. Ovarian follicle development in Booroola sheepexhibiting impaired bone morpho-genetic proteinsignalling pathway. Reproduction 2009; 138: 689-96.

7. Elvin JA, Matzuk MM. Mouse models of ovarianfailure. Rev Reprod 1998; 3: 183-95.

8. Codon SM, Estecondo SG , Galindez EJ , CasanaveEB. Ultrastructure and morphometry of ovarianfollicles in armadillo Chaetophractus villosus (Mammalia, Dasypodidae). Braz J Biol 2001; 61: 485-96.

9. Mattheij JA, Swarts JJ, Lokerse P, Van kampen JT,Van der Heide D. Effect of hypothyroidism on thepituitary-gonadal axis in the adult female rat. JEndocrinol 1995; 146: 87-94.

10. Sjostrom J, Bergh J. How apoptosis is regulated, andwhat goes wrong in cancer. BMJ 2001; 322: 1538-9.

11. Saraste A. Morphologic criteria and detection ofapoptosis. Herz 1999; 24: 189-95.

12. Tingen CM, Bristol-Gould S K, Kiesewetter S E,Wellington J T, L. Shea, Woodruff T K. PrepubertalPrimordial Follicle Loss in Mice Is Not Due toClassical Apoptotic Pathways. Biol Reprod 2009; 81:16-25.

13. Tilly JL. Apoptosis and ovarian function. Rev Reprod1996; 1: 162-72 .

14. Behnam-Rassoli M, Herbert LC, Howard V, PhavoahPO, Stanisstreet M. Effect of propyl thiouraciltreatment during prenatal and early postnataldevelopment on the neocortex of rat pups. Neuro-endocrinology 1991; 53: 321-7.

15. Gottesfeld Z, Butler IJ, Findly WE. Prenatal andpostnatal hypothyroidism abolishes lesion-inducednoradrenergic sprouting in the adult rat. J NeurosciRes 1984; 14: 61-9.

16. Gavrieli Y, Sherman Y, Ben-Sasson SA. Identifi-cation of programmed cell death in situ via specificlabeling of nuclear DNA fragmentation. J Cell Biol1992; 119: 493-501.

17. Charriaut-Marlangue C, Ben-Ari Y. A cautionary noteon the use of the TUNEL stain to determineapoptosis. Neuroreport 1995; 7: 61-4.

18. Ichimura E, Fukuda T, Oyama T, Kashiwabara K,Sakurai S, Sano T, et al .Formalin fixation by boiling:is it suitable for the TUNEL staining? Pathol Int 1995;45: 971-2.

19. Clarke RG, Lund EK, Johnson IT, Pinder AC.Apoptosis can be using annexin V binding, but not byTUNEL assay or sub-Go DNA content. Cytometry2000; 40(3): 252-7.

20. Grasl-Kraupp B, Ruttkay-Nedecky B, Koudelka H,Bukowska K, Bursch W, Schulte-Hermann R. In situdetection of fragmented DNA (TUNEL assay) fails todiscriminate among apoptosis, necrosis, and autolyticcell death: a cautionary note. Hepatology 1995; 21:1465-8.

21. Picut CA, Swanson CL, Scully KL, Roseman VC,Parker RF, Remick AK. Ovarian follicle counts usingproliferating cell nuclear antigen (PCNA) and semi-automated image analysis in rats. Toxicol Pathol2008; 36: 674-9.

22. Peters H, Byskov AG, Grinsted J. Follicular growth infetal and prepubertal ovaries of humans and otherprimates. Clin Endocrinol Metab 1978; 7(3):469-85.

23. Hirshfield AN, Midgley AR Jr. Morphometricanalysis of follicular development in the rat. BiolReprod 1978; 19: 597-605.

24. Pedersen T. Follicle kinetics in the ovary of the cyclicmouse. Acta Endocrinol 1970; 64: 304-23.

25. Rassouli M, Nikravesh MR, Mahdavi SV, TehranipourM. Post operative time effects after sciatic nerve crushon the number of alpha motoneurons, using a stereo-logical counting method (Disector). Iran Biomed J2000; 4: 45-9.

26. Gundersen HJ, Bendtsen TF, Korbo L, Marcussen N,Møller A, Nielsen K, et al. Some new, simple andefficient stereological methods and their use inpathological research and diagnosis. APMIS 1988;96: 379-94.

27. Gundersen HJ, Jensen EBV, Kieu K, Nielsen J. Theefficiency ofsystematic sampling in stereology-reconsidered. J Microsc 1999; 193: 199-211.

28. Gundersen HJ, Bagger P, Bendtsen TF, Evans SM,Korbo L, Marcussen N, et al. The new stereologicaltools: disector,fractionator, nucleator and pointsampled intercepts and their use inpathologicalresearch and diagnosis. APMIS 1988; 96: 857-81.

29. West MJ, Slomianka L and Gundersen HJ.Unbiasedstereological estimation of the total numberof neuronsin the subdivisions of the rathippocampus using theoptical fractionator. Anat Rec 1991; 231: 482-97.

30. Melo SR, de Souza RR, Mandarim-de-Lacerda CA.Stereologic study of the sinoatrial node of rats– agerelated changes. Biogerontology 2002; 3: 383-90.

31. Charleston LB, Thyer AC, Klein NA, Soules MR,Charleston JS. An improved methodfor the productionof slides from oversized samples ofglycol methacrylate-embedded tissues: Applicationfor optical disectorbased stereology. J Histotechnol 2003; 26: 49-52.

32. Bloom W, Fawcett DW. Textbook of Histology.



Philadelphia: WB Saunders, 1975, 858-906.33. Takagi K, Yamada T, Miki Y, Umegaki T, Nishimura

M, Sasaki J. Histological observation of the develop-ment of follicles and follicular atresia in immature ratovaries. Acta Med Okayama 2007; 61: 283-98.

34. Bourget C, Femino A, Franz C, Hastings S, LongcopeC. The effect of L-thyroxine and dexamethasone onsteroid dynamics in male cynomolgous monkeys. JSteroid Biochem 1987; 28: 575-9.

35. Jannini EA, Ulisse S, D’ Armiento M. Thyroidhormone and male gonadal function. Endocr Rev1995; 16: 443-59 .

36. Armada-Dias L, Carvalho JJ, Breitenbach MM,Franci CR, Moura EG. Is the infertility in hypothyro-idism mainly due to ovarian or pituitary functionalchanges? Braz J Med Biol Res 2001; 34: 1209-15.

37. Saita E, Tohei A, Jin WZ, Takahashi S, Suzuki AK,Watanabe G, et al . Effects of hypothyroidism ongonadal function after transition of short dayphotoperiod in male golden hamsters. J Reprod Dev2005; 51: 221-8.

38. Krassas GE, Pontikides N. Male reproductivefunction in relation with thyroid alterations. BestPract Res Clin Endocrinol Metab 2004; 18: 183-95.

39. Hosoda Y, Sasaki N, Agui T. Female infertility in grt

mice is caused by thyroid hormone deficiency, not byinsufficient TPST2 activity in the reproductiveorgans. J Vet Med Sci 2008; 70: 1043-9.

40. Jannini EA, Ulisse S, D Armiento M. Thyroidhormone and male gonadal function. Endocr Rev1995; 16: 443-59.

41. Krassas GE, Perros P. Thyroid disease and malereproductive function. J Endocrinol Invest 2003; 26:372-80.

42. Calikoglu AS, Gutierrez-Ospina G, D'Ercole AJ.Congenital hypothyroidism delays the formation andretard the growth of the mouse primary somaticsensory cortex (S1). Neurosci Lett 1996; 213: 132-6.

43. Porterfield SP, Hendrick CH. The role of thyroidhormone in prenatal and neonatal neurologicaldevelopment current perspectives. Endocr Rev 1993;14: 94-106.

44. Kiess W, Gallaher B. Hormonal control ofprogrammed cell death/apoptosis. Eur J Endocrinol1998; 138: 482-91.

45. Slebodziński AB. Ovarian iodide uptake andtriiodothyronine generation in follicular fluid theenigma of the thyroid ovary interaction. DomestAnim Endocrinol 2005; 29: 97-103 .



Original Article

The Role of Wnt Signaling Pathway on theExpression of TGFβ 1 and TGFβ 2 in Cultured RatCortical Astrocytes

Sina Bozorgmehr, M.Sc.1, Azita Parvaneh Tafreshi, Ph.D.1*,Shahsanam Abbasi, M.Sc.1, Bahman Zeynali, Ph.D.2

1. Department of Basic Sciences in Biotechnology, National Research Institute of Genetic Engineering andBiotechnology, Tehran, Iran2. Department of Developmental Biology, Faculty of Biology, Tehran University, Tehran, Iran*Corresponding author, E-mail address: [email protected]

Received: September 2011 Accepted: November 2012

Assistant Professor Dr. Azita Parvaneh Tafreshi has been the academic member of theDept. Basic Sciences at the National Research Institute of Genetic Engineering and

focus on neurodegenerative diseases such as multiple sclerosis and on discovering themechanism of neuroprotection by glial cells.

AbstractIntroduction: Astrocytes, the most abundant glia in the central nervous system, modulate neuronal survivaland function. Astrocytic functions are mediated by synthesis and secretion of wide ranges of polypeptidesthrough mechanism (s) poorly understood. Among these, TGFβs are synthesized and released by theastrocytes. In this study, the involvement of Wnt signaling pathway on the synthesis of TGFβs by theastrocyte was investigated.Materials and Methods: Cultured rat astrocytes were therefore treated either with Wnt3a (20 ng/ml) alone for24 hours or in combination with sFRP-1 (400 ng/ml) for a further 24 hours. Cells were then harvested andexamined for the expression of TGFβs and the Wnt target gene, cyclin D1.Results: In this study, we were able to show that 1) treatment Wnt3a alone for 24 hours induced theexpressions of TGFβs and cyclin D1; 2) The effect of Wnt was inhibited by pre-treatment with sFRP-1, thatis, sFRP-1 pre-treatment significantly blocked the Wnt-induced expressions of TGFβs and cyclin D1.Conclusion: This study therefore provides the first evidence for the involvement of Wnt signaling pathway inthe synthesis of TGFβ proteins by cortical rat astrocytes.Keywords: Astrocytes, Wnt3a Protein, Transforming Growth Factor beta (TGF beta), Secreted frizzledrelated protein-1 (sFRP-1), Cyclin D1

To cite this paper: Bozorgmehr S, Parvaneh Tafreshi A, Abbasi Sh, Zeynali B. The role of Wnt signalingpathway on the expression of TGFβ 1 and TGFβ 2 in cultured rat cortical astrocytes. Anat Sci J 2013; 10(1):37-42

38 S. Bozorgmehr, et al


IntroductionGlial cells comprised of the astrocytes, oligo-dendrocytes and microglial cells are the largestcell populations in the central nervous system(CNS). Astrocytes support neurons by regulatingtheir activity and synaptic transmission [1-2].These functions are mediated by release ofvarious amino acids and polypeptides. Amongthese peptides, the family of transforminggrowth factor beta (TGFβ ) are known to beproduced and released by astrocytes [3], mediatingastrocyte-induced neuroprotection. TGFβ is amember of the TGFβ super family consisting of3 isoforms in mammals (TGFβ 1, 2, and 3),each encoded by different genes. Astrocyticsecretion of TGFβ is known to be regulated byseveral important signaling pathways includingphosphatidylinositol 3-kinase (PI3K/Akt) [4].Wnt proteins (Wnt1 and Wnt 3) signal througha receptor complex composed of members ofthe Frizzled (Fz) and low-density lipoproteinreceptor-related protein (LRP) families, andactivate a number of intracellular signalingpathways including the β-catenin/TCF pathway(known as the canonical Wnt pathway) [5-6].The present study aimed at if the synthesis ofTGFβs 1 and 2 and cyclin D1 as a target gene inthe Wnt pathway are affected by Wnt3a or itsinhibitor, secreted frizzled related protein (sFRP-1).

Materials and MethodsAstrocyte culture and treatmentsAll study procedures were approved by thethe Ministry of health animal care EthicsCommittee, Tehran, Iran. Brains from 1-4days old Wistar rat pups (Pasteur institute ofIran) were used for the astrocyte culture.Astrocytes were separated from neural and non-neural cells according to McCarthy and colleagues,

and prepared for the treatments [7]. Briefly,following removal of meninges, cortices weredissected, washed in DMEM media, cut intosmall pieces and homogenized in completeDMEM by triturating. Complete culture mediumcontained DMEM (Gibco, Germany) supple-mented with 20% fetal bovine serum (FBS; SPLlife sciences, Korea) and antibiotics (penicillinand streptomycin; Gibco, Germany). The brainhomogenate was then placed in a humidifiedcell culture incubator under an atmosphere of5% CO2 at 37ºC. After a couple of days, flasksbecame confluent (filled with cells by 70%), thecells were trypsinized and transferred to newflasks 25 cm2 flasks (Nunc, Germany) at 5x105

cells containing medium with 10% FBS. Sinceastrocytes are the quickest among the glials andalso compared with neurons to attach, they wereisolated from the other glials by changing theculture medium after a few hours. This led tothe removal free floating neurons, oligodendro-cytes and microglial cells. The purity of theastrocytes was assessed by immunostainingwith glial fibrillary acidic protein (astrocytespecific marker; GFAP; Roche, Germany) thatconfirmed a purity of 95% (Fig. 1). After 10days, a point at which cultures became confluent,cells were cultured in new flasks, treated withWnt3a (20 ng/ml; R& D systems, Canada)and sFRP-1 (400 ng/ml; Peprotech, Canada).Wnt was applied either alone for 24 hours orin sFRP-1 pre-treated astrocytes. For allexperiments, the viability was assessedbefore and after the treatments using trypanblue and typically over 90% of the cellsexcluded the dye. The used doses of sFRP-1and Wnt did not induce toxicity and did notchange cell viability.

Wnt regulates TGF beta in astrocytes 39


Figure 1. GFAP immunostaining in cultured adult rat astrocytes. (A-C) Detection of GFP immunoreactivityusing DAB chromogen. D) using FITC fluorochrome, Scale bar: 250 m.

Immunocytochemistry20,000 cells of a second passage were plated perwell/12-well plate. For GFAP immunostaining,cells were fixed by cold methanol andpermeabilized using Triton-X100 (0.25%; Merck,Germany). They were then blocked by 3% BSA(Merck, Germany), followed by overnightincubation with anti-GFAP (1:200; Sigma,Germany), 2 hours in biotinylated secondaryantibody (Eskanteb, DAKO, Netherlands) and 1hour in FITC-streptavidin (Eskanteb, DAKO,Netherlands) for detection under the fluorescencemicroscope.

Real-time PCRTotal RNAs were extracted by using easy blue

RNA extraction kit (iNtRON, Korea). cDNAswere synthesized by Fermentas kit (Nedayefan,Iran). Using Roche Light Cycler, real time PCRwas performed for quantification of the levelsof β-actin, TGFβs and cyclin D1 mRNAs. Thesequences of the primers (Roobinteb gostar,metabion, Germany) for beta actin were:5ÀAGGCCAACCGTGAAAAGAT 3` and5’ACCAGAGGCATACAGGGACA3 ,̀ for TGFβ1F: 5`CCTGGAAAGGGCTCAACAC 3`R: 5`CAGTTCTTCTCTGTGGAGCTGA 3`, forTGF β2 F: 5ÀGTGGGCAGCTTTTGCTC 3`

R: 5`GTAGAAAGTGGGCGGGATG 3` andthose for cyclin D1 were forward:5`GCCACCTGGATGCTAGAGG3ànd reverse:



5`CAGGCGGCTCTTCTTCAG3`. Real timePCR for TGFβs, beta actin and cyclin D1 wasperformed according to the following program:(95 ºC: 5 min, cycles of 95 ºC: 10 sec, 60 ºC: 30sec). Product specificity was confirmed bymelting curve analysis and visualization of asingle band of the appropriate product size on a2% agarose gel. (Fanavariteb, Invitrogen,Germany). Expression levels were quantified bya standard curve using cDNA dilutions, andgene levels were normalized to the housekeeping gene beta actin and compared withthose in the controls. According to the methodof Pfaffl and colleagues data were expressed asthe fold changes compared with vehicle-treatedcultures, using three per group and triplicatesfor verification of results [8].

Statistical analysesEach experiment was performed in triplicatesand the data obtained were analysed by SPSSStatistics software (version 19). One wayANOVA and the post-hoc test LSDs were usedto determine the significance of variations. TheP values < 0.05 considered as significant.

ResultsWnt 3a induces the expression of TGFβsand cyclin D1 in the cortical astrocytesReal time PCR analysis of the treated astrocytesshowed that in cells treated with Wnt 3a (20ng/ml) for 24 hours the levels of TGFβ1mRNA,TGFβ2mRNA and cyclin D1mRNA were increased by0.68±0.05, 0.95±0.07 and 0.67±0.02 times respec-tively (Fig. 2), indicating that Wnt ligand activatesthe Wnt signaling pathway and induces theexpression of TGFβs in the astrocytes.

The expression of TGFβs and cyclin D1 issuppressed by Wnt antagonist, sFRP1.Treatment of the astrocytes with specificantagonist for canonical Wnt pathway, sFRP-1

for 24 hours followed by Wnt-3a for another 24hours, the levels of TGFβ1mRNA, TGFβ2mRNA

and cyclin D1mRNA reduced significantly by0.26±0.03, 0.47±0.04 and 0.24±0.08 timesrespectively (Fig. 2), indicating that thesynthesis of TGFβs is specifically inhibited byWnt antagonist in the astrocytes.

Figure 2. Real time PCR analysis of TGFβ1mRNA,TGFβ2mRNA and cyclin D1mRNA in the cortical astrocytestreated with sFRP-1 for 24 hours followed by Wnt-3afor another 24 hours. While Wnt 3a induced theexpression of the candidate genes significantly, co-treatment with sFRP-1 decreased their expression.

DiscussionAstrocytes produce large ranges of soluble andmembrane associated signals which affect theirneighbors and influence the development of thecentral nervous system [9]. Among the solublefactors released by the astrocytes, the family ofTGFβ [10], are known to regulate the astrocytephysiology. So far, very few data is available onthe mechanism (s) involved in the synthesis ofneuroprotective factors released by the astrocytes.Considering that Wnt and its receptor/Co-receptor are expressed in the astrocytes [11-12],one proper candidate could be Wnt signalingpathway. To investigate this, we have appliedWnt ligand (Wnt3a) and a Wnt antagonist(sFRP-1) in cultured astrocytes and measured the

Wnt regulates TGF beta in astrocytes 41


expression levels of TGF betas. Wnt antagonistscould block the Wnt pathway upstreamly eitherby binding directly to the Wnt ligand or indirectlyto its receptor/co receptor (Frizzled/LRP5/6).There are also downstream blockers of Wntpathway, e.g. through blocking GSK-3 (glycogensynthase kinase) a rate limiting enzyme. We havepreviously shown that treatment of culturedastrocytes with a specific inhibitor of GSK-3(BIO), enhances the expression of TGF betas[13]. However, since GSK-3 is a common keyelement of other signaling pathways such asPI3K/Akt pathway [14], in this study we soughtto activate/blockade the Wnt pathway at upstreamto clarify the specificity of the Wnt involvement.Indeed, the synthesis of TGF betas in theastrocyte treated with Wnt ligand (Wnt3a) wasincreased, whereas in those combined with Wntantagonist (sFRP-1) was decreased. Also, wefurther examined the downstream key element ofthe Wnt pathway, cyclin D1 and showed that itwas increased by Wnt3a and decreased followingthe sFRP-1 pre-treatment. Altogether, our resultsindicate for the first time that upstream anddownstream activations of the Wnt pathway in theastrocytes both lead into one direction, that is, theinduction of TGF beta synthesis. L'Episcopo andcolleagues have also provided an indirectevidence for the involvement of Wnt inneuroprotection by astrocytes [15]. They havesuggested the existence of an autoprotective loopbetween the astrocyte-dopaminergic neurons. Co-culturing dopaminergic neurons with midbrainastrocytes, phenocopies Wnt1 and inducesneuroprotective effects, whereas RNA inter-ference- mediated knockdown of Wnt1 inmidbrain astrocytes markedly reduces astrocyte-induced TH+ neuroprotection [15]. Lie andcolleagues have also shown that factors derived

from the hippocampal astrocytes activateWnt/beta catenin pathway and induce thedifferentiation of hippocampal neural stem cells[11]. Kornyei and colleagues have shown thatinteraction of Wnt with other secreted factorsfrom glia affects neural cell fate [16]. Altogether,there is a possibility of autocrine activity of theWnt3a, secreted by the astrocytes, to protectneurons. The expression of frizzled receptors onthe astrocytes would also mediate this autocrineactivity [12]. Wnt could also affect on develop-ment of astrocyte progenitors. Liu & Nathanshave shown that in Fz5-/- mutant mice, there is anexcess of astrocyte precursors and matureastrocytes, indicating that Wnt inhibits thedifferentiation of the astrocytes [17]. Feigensonand colleagues have also shown a Wnt inhibitoryeffect on oligodendrocyte differentiation [18].Although one could never rule out the interactionof Wnt with other signaling pathways such asPI3K/Akt pathway which have commondownstream key element (s) such as GSK-3,resulting in similar effects. As pointed out byDhandapani and colleagues, blocking PI3K/Aktpathway in the astrocyte, inhibits the synthesisand secretion of TGFβs by beta estradiol [4]. Inconclusion, Wnt signaling pathway is an effectiveroute for neuroprotective actions of the astrocyteswhich may interact with other signaling pathwayssuch as PI3K/Akt pathway to regulate thephysiology of neuron-glia. Future studies wouldbe required to elucidate the redundancy orcomplementary actions of these pathways.

AcknowledgementThis work was supported by a grant from theNational Research Institute of Genetic Engineeringand Biotechnology.

References1. Parpura V, Heneka MT, Montana V, Oliet SH, Schousboe A, Haydon PG, et al.Glial cells in (patho)



physiology. J Neurochem 2012; 121: 4-27.2. Bezzi P, Domercq M, Vesce S, Volterra A. Neuron-

astrocyte cross-talk during synaptic transmission:physiological and neuropathological implications.Prog Brain Res 2001; 132: 255-65.

3. Constam DB, Philipp J, Malipiero UV, ten Dijke P,Schachner M, Fontana A.Differential expression oftransforming growth factor-beta 1, -beta 2, and -beta 3by glioblastoma cells, astrocytes, and microglia. JImmunol 1992; 148: 1404-10.

4. Dhandapani KM, Wade FM, Mahesh VB, Brann DW.Astrocyte-derived transforming growth factor-{beta}mediates the neuroprotective effects of 17{beta}-estradiol: involvement of nonclassical genomicsignaling pathways. Endocrinology 2005; 146: 2749-59.

5. Brantjes H, Barker N, van Es J, Clevers H. TCF: LadyJustice casting the final verdict on the outcome ofWnt signalling. Biol Chem 2002; 383: 255-61.

6. Wodarz A, Nusse R. Mechanisms of Wnt signaling indevelopment. Annu Rev Cell Dev Biol 1998; 14: 59-88.

7. McCarthy KD, de Vellis J. Preparation of separateastroglial and oligodendroglial cell cultures from ratcerebral tissue. J Cell Biol 1980; 85: 890-902.

8. Pfaffl M.W. A new mathematical model for relativequantification in real-time RT-PCR. Nucleic AcidsRes 2001; 29: 2003-7.

9. Lim, DA, Alvarez-Buylla A. Interaction betweenastrocytes and adult subventricular zone precursorsstimulates neurogenesis. Proc Natl Acad Sci U S A1999; 96: 7526-31.

10. Lafon-Cazal M, Adjali O, Galéotti N, Poncet J, JouinP, Homburger V, et al. Proteomic analysis ofastrocytic secretion in the mouse. Comparison withthe cerebrospinal fluid proteome. J Biol Chem 2003;278: 24438-48.

11. Lie DC, Colamarino SA, Song HJ, Désiré L, Mira H,

Consiglio A, et al. Wnt signalling regulates adulthippocampal neurogenesis. Nature 2005; 437: 1370-5.

12. Cahoy JD, Emery B, Kaushal A, Foo LC, ZamanianJL, Christopherson KS, et al. A transcriptomedatabase for astrocytes, neurons, and oligodendro-cytes: a new resource for understanding braindevelopment and function. J Neurosci 2008; 28: 264-78.

13. Bozorgmehr S, Parvaneh Tafreshi A, Abbasi S,Zeynali B. The synthesis of TGFβs 1 and 2 ismediated through Wnt signaling pathway in ratcortical astrocytes. in 8th IBRO world organizationcongress of neuroscience, Italy, 2011.

14. Mercado-Gómez O, Hernández-Fonseca K,Villavicencio-Queijeiro A, Massieu L, Chimal-Monroy J, Arias C. Inhibition of Wnt and PI3Ksignaling modulates GSK-3beta activity and inducesmorphological changes in cortical neurons: role of tauphosphorylation. Neurochem Res 2008; 33: 1599-609.

15. L'episcopo F, Serapide MF, Tirolo C, Testa N,Caniglia S, Morale MC, et al. A Wnt1 regulatedFrizzled-1/β-Catenin signaling pathway as a candidateregulatory circuit controlling mesencephalic dopa-minergic neuron-astrocyte crosstalk: Therapeuticalrelevance for neuron survival and neuroprotection.Mol Neurodegener 2011; 6 :1-29.

16. Környei Z, Gócza E, Rühl R, Orsolits B, Vörös E,Szabó B, et al. Astroglia-derived retinoic acid is a keyfactor in glia-induced neurogenesis. FASEB J 2007;21: 2496-509.

17. Liu C, Nathans J. An essential role for frizzled 5 inmammalian ocular development. Development 2008;135: 3567-76.

18. Feigenson K, Reid M, See J, Crenshaw III EB,Grinspan JB. Canonical Wnt signalling requires theBMP pathway to inhibit oligodendrocyte maturation.ASN Neuro 2011; 3: e00061.



Original Article

Anthropometric Characteristics of Craniums inResidents of Qazvin, Iran and Dera Ghazi Khan,Pakistan: A Comparative Study

Gholamreza Hassanzadeh, Ph.D.1, Makan Sadr, M.D., Ph.D. Student1,2*,Noushin Alaghbandha, M.D.1, Ali Dehbashipour, M.D.1,Mohammad Abrar Abbas, M.D.1 Omran Heydar Zeidi, M.D.1

1. Department of Anatomy, Tehran University of Medical Sciences (TUMS), Tehran, Iran2. Tracheal Diseases Research Center, NRITLD, Shahid Beheshti University of Medical Sciences, Tehran, Iran.*Corresponding author, E-mail address: [email protected]

Received: July 2012 Accepted: October 2012

Makan Sadr, M.D. is obtaining his Ph.D. in Anatomy from Tehran University of MedicalSciences. He has been employed as a researcher in the National Research Institute ofTuberculosis and Lung Diseases the TrachealDiseases Research Center and Lung Transplantation Research Center at ShahidBeheshti University of Medical Sciences. Dr. Sadr has been the Executive Director ofTanaffos (Respiration), a peer-reviewed journal since 2001. Molecular medicine ofrespiratory diseases, such as COPD and asthma, are among his major interests.

AbstractIntroduction: The purpose of present study is to compare anthropometric characteristics of the adult craniumbetween Iranian and Pakistani residents in two specific areas where people have special characteristics in thefeatures of their heads and faces.Materials and Methods: This cross-sectional investigation was performed on 300 adult inhabitants of Qazvin,Iran and 356 residents of Dera Ghazi Khan, Pakistan. Participants were selected randomly and did not haveany physical deformities or any previous history of trauma. Measurements were performed in an anatomicalposition on the cephalic length, cephalic breadth, and auricular height.Results: Cephalic length, cephalic breadth and auricular height in females from Qazvin were significantlyhigher than those of DG Khan (p<0.05). According to the findings, 82% of males and 58% of females fromQazvin were megacephalic while 25% of males and only 1% of females of DG Khan were megacephalic.The prominent cranium form in males from DG Khan was mesocephaly (41%), whereas it was microcephaly(85%) in females from DG Khan. The mean cephalic index was as follows: Qazvin males (88.19±5.78) andfemales (86.54±3.23); DG Khan males (84.11±3.7) and females (85.27±6.09). For DG Khan residents, thecranial capacity was 1348.4±122 cm3 for males and 1189.3±180.5 cm3 for females. At the same time, thebrain weight was 1395.5±126.2 g in males and 1230.9±186.8 g in females.Conclusion: This study shows the existence of differences in cranium dimensions between residents ofQazvin, Iran and DG Khan, Pakistan as well as in different regions of each country.Keywords: Skull, Anthropometry, Iran, PakistanTo cite this paper: Hassanzadeh Gh, Sadr M, Alaghbandha N, Dehbashipour A, Abbas MA, Heydar Zeidi O.Anthropometric characteristics of craniums in residents of Qazvin, Iran and Dera Ghazi Khan, Pakistan: Acomparative study. Anat Sci J 2013; 10(1): 43-9.

44 Gh. Hassanzadeh, et al


IntroductionThe physical differences among humans can beevaluated by measuring different indices [1]. Thedimensions of the human body have been shownto be affected by geographical, racial, gender andage factors [2,3]. Craniofacial measurements areused in anthropology, plastic surgery, forensicmedicine, oral surgery, pediatrics, and fordiagnostic information between patients and thenormal population [4-6]. Cephalometry is animportant component of anthropometry formeasuring the dimensions of the head and face.The cephalic index is useful for differentiation ofracial and gender differences [1,7-9]. Cranialcapacity is an important measurement thatevaluates racial differences and in clinical practicedetermines abnormalities of the cranial diameterand shape [10]. According to some researchersthere is a close correlation between cranialcapacity and brain weight; it is an indirectapproach to evaluate the brain's size [10-12].

Numerous studies with various methods suchas autopsies and investigation on living subjectshave been conducted regarding the sizes of thehead's compartments [13].

With the invention of modern neuroimagingtechniques, human brain morphometry hasadvanced dramatically. Evaluation of slices fromdifferent living body parts provides a possibilityfor quantitative assessment [14]. In addition, thevolume of organs can be obtained using theCavalieri principle of stereologic approaches [15].

Cotter et al., in a comparison of stereologic andplanimetry methods on fixed brain tissues usingMRI have estimated the brain's volume. Instereologic point-counting according to theCavalieri method, the volume of the respectiveregion is divided into parallel sections with equalthicknesses and the area is evaluated throughpoint-counting. These researchers have concludedthat if similar results can be obtained by bothtechniques, the stereology method would be

preferable since it is faster and more efficient [16].Acer and colleagues have compared stereologic,

planimetric and anthropometric methods forestimation of total intracranial volume (TIV)and reported a similar close correlation betweenthe three techniques. The anthropometric techniquewas less expensive and applicable for TIVmeasurement [17].

Iran and Pakistan are two neighboring countriesthat have different local races. Unfortunately thereis scant information about anthropometric indicesin Iran and Pakistan. Considering the importanceof achieving information on cephalic index,cranial capacity and brain weight, this study isdesigned to compare the anthropometriccharacters of the cranium among normal adultsfrom Iran and Pakistan in two specific areas wherethe residents have special characteristics, such asfeatures of the head and face. We use the lineardimensions of the heads as measured by theclassic cephalometry technique.

Materials and MethodsThis cross-sectional investigation was performedon 300 (160 males and 140 females) adultinhabitants of Qazvin (Iran) and 356 (181 malesand 175 females) dwellers of Dera Ghazi Khan(DG Khan, Southern Punjab, Pakistan). Under-study subjects were selected using randomsampling method. The age range of participantswas 18 to 50 years. There were no physicaldeformities or any previous history of trauma. Theselected populations have resided for more thanone century in these regions. This study wasapproved by the ethics committee of QazvinUniversity of Medical Sciences.

The linear dimensions of the head weremeasured in the anatomical position for cephaliclength, cephalic breadth, and auricular height bystandard anthropometric instruments (anthro-

Anthropometric characteristics of craniums 45


pometer, spreading caliper, and sliding caliper).Measurements were in centimeters, to thenearest millimeter and defined as follows.Maximum head length (L) or head length isthe distance between the glabella and inion.The maximum head breadth (B) or head widthis the maximum transverse diameter betweentwo parietal eminences. Auricular height (H)is defined as the distance between the externalacoustic meatus and highest point of thevertex.

Each measurement was taken at least threetimes and the average of the three wasconsidered for computation with an accuracy of1 mm. We calculated the cephalic index by thefollowing formula:Cephalic index = Maximal head breadth/Maximal headlength × 100.

Cranial capacity was calculated in the living subjectsusing the Lee-Pearson formula:

Males: 0.000337 (L-11) (B-11) (H-11) + 406.01

Females: 0.000400 (L-11) (B-11) (H-11) + 206.60

Brain weight in grams was determined by the followingformula:

Brain weight = Cranial capacity × 1.035

where 1.035 is the mass density of the brain [18-20].

We recorded the data in a special form. Datawere analyzed by SPSS software version 16. Thestudent's t-test (=0.05) was used to compare themeans of anthropometric measurements.

Based on these indices, head types wereclassified by the following anthropologicalclassifications (Table 1):

Table 1. Anthropological classification of head typesHead shape Cephalic index (CI) range (%)Dolicocephalic CI<74.9Mesocephalic 75<CI<79.9Brachycephalic 80<CI<84.9Hyperbrachycephalic CI>85Head type Cranial capacity (CC) range

(cm3)Microcephalic CC<1300Mesocephalic 1300<CC<1450Megacephalic CC>1450

ResultsThe means and standard deviations (SD) of thecephalic length, cephalic breadth and auricularheight of male and female residents of Qazvinand DG Khan are shown in Table 2.

Table 2. Means±SD of various parameters formales and females of Qazvin and DG Khan

Qazvin DG KhanParameters

Males Females Males Females

Cephalic length 18.3±0.82 17.97±0.58 18.55±0.7 17.74±0.99

Cephalic breadth 16.14±0.73 15.55±0.37 15.59±0.66 15.09±0.22

Auricular height 14.17±1.01 13.37±1.02 12.13±1.15 10.75±1.5

According to the results, the cephalic length inmales fròm DG Khan was higher than Qazvinresidents; however the cephalic breadth washigher among males from Qazvin. Cephaliclength, cephalic breadth and auricular height infemales of Qazvin were significantly higher thanthose of DG Khan (P<0.05). Cranial capacity was1505.4±120 cm3 (males) and 1403±143.5 cm3

(females) for residents of Qazvin. Brain weightwas 1558.1±124.2 g for male and 1452.1±148.5 gfor female residents of Qazvin (Table 3).

Table 3. Cranial capacity and brain weight of the study subjectsQazvin DG Khan

Cranial capacity (cm3)Males Females Males Females

Mean± SD 1505.4±120 1403±143.5 1348.4±122 1189.3±180.5Minimum 1286.2 1144.4 1167.6 1005.2Maximum 1635.7 1572.3 1520 1449.8Brain weight (g) 1558.1±124.2 1452.1±148.5 1395.5±126.2 1230.9±186.8



Among DG Khan residents, the cranialcapacity was 1348.4±122 cm3 (males) and1189.3±180.5 cm3 (females). Brain weight was1395.5±126.2 g for males and 1230.9±186.8 gfor females (Table 3).

According to the findings, in Qazvin, 82% ofmales and 58% of females were megacephalic,whereas 25% of males and only 1% of femalesfrom DG Khan were megacephalic. The prominentform of cranium in males of DG Khan wasmesocephaly (41%) and for females it wasmicrocephaly (85%). Cranial capacity in malesand females of Qazvin was significantly higherthan DG Khan (P<0.05). There were significantdifferences between males and females of bothregions (P<0.05).

Table 4 shows the results of the cephalicindices in males and females from both regions.

Table 4: Cephalic indices of the study subjectsQazvin DG KhanCephalic

index Males Females Males FemalesMean±SD 88.19±5.78 86.54±3.23 84.11±3.7 85.27±6.09Minimum 76.78 80.31 76.11 72.64Maximum 98.2 93.06 93.85 98.5

A significant difference existed betweenmales of both regions; however this differencewas not significant among females from bothregions. The difference between males andfemales of each region was significant (P<0.05).

Morphological classification based on thecephalic index is shown in Table 5.

Table 5: Head types according to cephalic indexQazvin DG KhanMorphological

Classification Males(%)

Females (%)

Males(%)

Females(%)

Hyperbrachycephaly > 85 117 (73.1) 98 (70) 96 (53) 86 (49.1)

Brachycephaly80-84.9 37 (23.1) 42 (30) 54(29.8) 54 (30.9)

Mesocephaly75-79.9 6 (3.8) - 31(17.2) 30 (17.1)

Dolicocephaly<74.9 - - - 5 (2.9%)

In both regions, hyperbrachycephaly was thedominant head type. There were no meso-cephalic or doliococephalic head types amongfemales from Qazvin. There were no dolico-cephalic head types observed in males fromQazvin and DG Khan, however approximately3% of DG Khan females had dolicocephalicheads.

DiscussionIn the present study, the mean±SD cephaliclength for males of DG Khan (18.55±0.7 cm)was higher than those of Qazvin (18.3±0.82 cm).Golalipour reported the cephalic lengths ofmales in Turkman and groups in Northern Iran,where he observed a higher cephalic headlength in males of Turkman compared withthose of Qazvin and DG Khan. However thismeasurement in males from Fars was lowerthan males from Qazvin [21]. Previous studieshave shown that the mean cephalic length inmales from India and Nepal approximate thosefrom Qazvin when compared to males of DGKhan [1,7].

In comparison with males of DG Khan, themales of Qazvin were characterized by highercephalic breadth and auricular height. The meanvalue of cephalic breadth in males of Qazvinwas higher than those observed in India, Nepal,African-Americans, North American Caucasiansand those from Northern Iran [1,7,21,22].

Cephalic length, cephalic breadth and auricularheight in females of Qazvin were higher thanthose of DG Khan. The mean value of cephaliclength in females of the Turkman group,Northern Iran was higher than females fromIndia and Nepal [1,7,21]. In addition, thecephalic breadth and auricular height in femalesof Qazvin were higher than those of India,Nepal, Northern Iran, African-Americans andNorth American Caucasians [1,7,21,22]. In ourinvestigation, the mean±SD cranial capacity for



males and females of Qazvin was 1505.4±120cm3 (males) and 1403±143.5 cm3 (females),whereas for DG Khan it was 1348.4±122 cm3

(males) and 1189±180.5 cm3 (females). Themean cranial capacity for males and females ofQazvin was higher than noted for DG Khan,Korea, India and Northern Iran, whereas thismeasurement in males from DG Khan waslower than Korean males. The mean cranialcapacity for female residents of DG Khan washigher than females in India [10] and lower thanthe cranial capacity in Korean and Iranianfemales [12,21,23].

In 1977, Dekaban [24] reported the cranialcapacity as 1548 cm3 in males and 1425 cm3 infemales, both of which were higher than theIranian cranial capacity based on the values weobtained in our stury.

In a comparison of the results of this studywith other surveys, it was noted that the cranialcapacity differed among diverse racial groups[21,24].

Beals et al. have performed an extensive studyon more than 20000 skulls worldwide andfound the following average cranial volumes:East Asians (1415 cm3), Europeans (1362 cm3),and Africans (1268 cm3) [25].

Cephalic index is useful in discrimination ofracial and gender indicated characters [1].Comparisons of cephalic indices among differentethnic groups can give some new informationabout local races [2].

In the present study, the mean cephalic indexfor Qazvin was 88.19±5.78 (males) and86.54±3.23 (females), whereas for DG Khan itwas 84.11±3.7 (males) and 85.27±6.09 (females).Cephalic index classification of heads showedthat both Qazvin and DG Khan residents hadhyperbrachycephalic features. There were nomesocephalic and dolicocephalic heads notedamong female residents of Qazvin, howeverapproximately 3% of DG Khan females had

dolicocephalic heads.In 1999, Kondo showed evidence of brachy-

cephalization in the Japanese population [26].Similar studies have been conducted amongdifferent Indian groups where variations in thecephalic index were observed. According to onereport, both mesocephalic and brachycephalichead types were observed among various Indiangroups [7].

A previous study highlighted the differencesin craniofacial morphology between groups thathave different genetic backgrounds since theyhave been subjected to significantly differentenvironmental factors [27]. Therefore, twofactors can affect craniofacial parameters: [1]genetic racial/ethnic characteristics and [2]environmental factors. Anthropometric parameterssuch as cranial capacity have been shown to bedependent on gene expression [28]. In addition,different racial and ethnic groups may exhibitdifferent patterns of gene expression [3].

Hooton has reported that racial characteristicswere best defined in the skull [29]. Addition-ally, environmental factors and varying ecologicalconditions may cause changes in head dimensionssuch as cranial capacity and head shape [30].

This study has determined the possible effects ofracial factors on head shape diversity and diameter.To obtain a more valid estimation of craniofacialcharacters which is a true representative of theIranian and Pakistani populations, further studieswith a larger sample size covering a widergeographical area are necessary.

AcknowledgementThe authors would like to express their gratitude tothe Research Deputy of Tehran and QazvinUniversities of Medical Sciences for supportingthis study. The authors declare no conflict ofinterest.



References1. Lobo SW, Chandrasekhar TS, Kumar S. Cephalic

index of Gurung community of Nepal-Ananthropometric study. Katmandu Univ Med J2005; 3: 263-5.

2. Golalipour MJ, Jahanshahi M, Haidari K. TheVariation of head and face shapes in femalenewborns in the South-East of the Caspian Sea(Iran-Gorgan). Eur J Anat 2005; 9: 95-8.

3. Golalipour MJ, Heydari K. Effect of the Ethnicfactor on cranial capacity and brain weight ofmale newborns in Northern Iran. NeuroembryolAging 2004; 5: 146- 8.

4. Golalipour MJ, Hosseinpour KR. Estimation ofthe cranial capacity and brain weight of Iranianfemale newborns. Eur J Anat 2006; 10: 49- 52.

5. Farkas LG, Katic MJ, Forrest CR. Surfaceanatomy of the face in Down's syndrome: anthro-pometric proportion indices in the craniofacialregions. J Craniofac Surg 2001; 12: 519-24.

6. Gale CR, Walton S, Martyn CN. Fetal andpostnatal head growth and risk of cognitivedecline in old age. Brain 2003; 126: 2273-8.

7. Shah GV, Jadhav HR. The study of cephalicindex in students of Gujarat. J Anat Soc India2004; 53: 25-6.

8. Grau V, Alcaniz M, Juan MC, Monserrat C,Knoll C. Automatic localization of cephalometriclandmark s. J Biomed Inform 2001; 34: 146-56.

9. EL-Feghi I, SID-Ahmad MA, Ahmadi M.Automatic localization of craniofacial landmarksfor assisted cephalometry. Pattern Recogni 2004;37:609-21.

10.Manjunath KY. Estimation of cranial Volume-an overview of Methodologies. J Anat Soc India2002; 51: 85-91.

11. Epstein HT, Epstein EB. The relationship betweenbrain weight and head circumference from birth toage 18 years. Am J Phys Anthropol 1978; 48:471- 3.

12.Hwang YI, Lee KH, Choi BY, Lee KS, Lee HY,Sir WS, et al. Study on the Korean adult cranialcapacity. J Korean Med Sci 1995; 10: 239- 42.

13.Nooranipour M, Masteri Farahani R. Estimationof cranial capacity and brain weight in 18-22-

year-old Iranian adults. Clin Neurol Neurosurg2008; 110: 997-1002.

14. Elfaki A, Osman T, Elsheikh A, Hamdoun A,Şahin B. Evaluation of the intra-rater variation forthe estimation of volume of cerebral structuresusing the cavalieri principle on magnetic resonanceimages. J Exp Clin Med 2011; 28: 22-5.

15.Roberts N, Cruz-Orive LM, Reid NM, BrodieDA, Bourne M, Edwards RH. Unbiased estimationof human body composition by the Cavalierimethod using magnetic resonance imaging. JMicrosc 1993; 171: 239-53.

16.Cotter D, Miszkiel K, Al-Sarraj S, WilkinsonID, Paley M, Harrison MJ, et al. The assessmentof postmortem brain volume; a comparison ofstereological and planimetric methodologies.Neuroradiology 1999; 41: 493-6.

17.Acer N, Sahin B, Bas O, Ertekin T, Usanmaz M.Comparison of three methods for the estimationof total intracranial volume: stereologic, plani-metric, and anthropometric approaches. AnnPlast Surg 2007; 58: 48-53.

18.Courchesne E, Chisum HJ, Townsend J, CowlesA, Covington J, Egaas B, et al. Normal braindevelopment and aging: quantitative analysis atin vivo MR imaging in healthy volunteers.Radiology 2000; 216: 672-82.

19. Frontera JG. Evaluation of the immediate effectsof some fixatives upon the measurements of thebrains of macaques. J Comp Neurol 1958; 109:417-38.

20.Golalipour MJ, Hosseinpour KR. Estimation ofthe cranial capacity and brain weight of Iranianfemale newborns. Eur J Anat 2006; 10: 49-52.

21.Golalipour MJ, Jahanshaei M, Haidari K.Estimation of cranial capacity in 17-20 years oldin South East of Caspian sea border (North ofIran). Int J Morphol 2005; 23: 301-4.

22. Farkas LG, Katic MJ, Forrest CR, Alt KW, BagicI, Baltadjiev G, et al. Comparison of craniofacialmeasurements of young adult African-Americanand North American white males and females.Ann Plast Surg 2007; 59: 692- 8.

23.Manjunath KY. Estimation of cranial Volume in



dissecting room cadavers. J Anat Soc India2002; 51: 168-72.

24.Dekaban AS. Tables of cranial and orbitalmeasurements, cranial volume, and derived indexesin males and females from 7 days to 20 years ofage. Ann Neurol 1977; 2: 485-91.

25.Beals KL, Smith CL, Dodd SM. Brain size,cranial morphology, climate, and time machines.Curr Anthropol 1984; 25: 301-30.

26.Kondo S, Wakatsuki E, Shibagaki H. A somato-metric study of the head and face in Japaneseadolescents. Okajimas Folia Anat Jpn 1999; 76:179-85.

27.Kasai K, Richards LC, Brown T. Comparativestudy of craniofacial morphology in Japaneseand Australian aboriginal populations. Hum Biol1993; 65: 821-34.

28.Okupe RF, Coker OO, Gbajumo SA. Assessmentof fetal biparietal diameter during normalpregnancy by ultrasound in Nigerian women. BrJ Obstet Gynaecol 1984; 91: 629-32.

29.Hooton EA. Methods of Racial Analysis. Science1926; 63: 75-81.

30.Nakashima T. Brachycephalization in the headform of school girls in North Kyushu. J UOEH1986; 8: 411-4.



Original Article

The Cephalometric Neurocranial Index of One-day-old Male Newborns in Kermanshah byAnthropometry

Sara Eivazi, M.Sc.1*, Reza Mastery Farahani, Ph.D.1

1. Anatomy and Biology Department, Shahid Beheshti University of Medical Sciences, Tehran, Iran*Corresponding author, E-mail address: [email protected]

Received: August 2012 Accepted: November 2012

Sara Eivazi is an M.Sc. student of Anatomy at Shahid Beheshti University in Tehran,Iran. Her special interests are anthropometry, macro-anatomy and forensic science.

AbstractIntroduction: The findings of cephalometry studies are widely applied in medical and engineering fields.Cephalometry measurements are affected by genetics‚ age‚ gender‚ and social‚ economic and geographicfactors.This study assesses cephalometry of the neurocranium in male newborns in Kermanshah,Iran by ananthropometry method to confirm or reject the theory of brachycephalization (i.e., a spread in the width ofthe average head).Materials and Methods: This was a cross–sectional, descriptive study conducted on 103 healthy malenewbornsborn by natural childbirth in Kermanshah during 2012. The newborns’ heights were measured by astadiometer and their weight was obtained by using a newborn's scale.The neurocranium circumference wasdetermined by a millimeter scaled tape. and the length and breadth of the neurocranium by Martin Salercephalometry.Data were analyzed by SPSS. cephalic index and neurocranium classification were determinedby the classical cephalometry method.Results: The mean and standard deviation of the newborns’ anthropometry and cephalometry measurementswere: 506±20 cm (height), 3219±35 g (weight), 352±12 cm (head circumference), 115±4 mm (neurocraniumlength), 94±3 mm (neurocranium breadth), and 81±3 (cephalic index). A total of 49% of the newborns werebrachycephalic and 3% were dolichocephalic.Conclusion: the results shows that the cephalic index of Kermanshahi male newborns are larger than those ofTurkman Qazvin, Native Fars and Tehran.whereas thay are less than observed in Sistan and Baluchistan.Thestudy confirms that anthropometry factors (i.e. age, genetic, etc.)impact these newborns. The cephalizationtheories in these newborns are also confirmed.Keywords: Cephalometry, Male, Newborn, Iran

To cite this paper: Eivazi S, Mastery Farahani R. The cephalometric neurocranial index of one-day-old malenewborns in kermanshah by anthropometry. Anat Sci J 2013; 10 (1): 51-5.

52 S. Eivazi & R. Mastery Farahani


IntroductionResults of anthropology studies are applicablein areas such as medicine, industries, forensics,in addition to civil and non-civil engineeringfields [1,2]. Anthropology is a key process thatevaluates the status of infant and adult nutrition[3]. Normally anthropometry is used as anindicator of infants' growth [4]. Experts activein the area of social health unanimously believethat anthropometry indices play the mostsignificant role in evaluating newborns' health[5]. For this reason relevant studies are regardedas Iran's second research priority [6]. Additionally,such studies are also one of the most importantresearch priorities in the US and comprises amajor part of their annual research budget [7].

The most important part of anthropometry iscephalometry [8,9] which examines the dimen-sions and contours of the cephalic and prosopicindices and its morphology [9,10]. These indicesdistinguishes between heads and faces andthose defects such as microcephaly and hydro-cephalus. It is a marker for assessing the health,development and growth of the community. Inthe World Health Organization (WHO) it isregarded as an index for confirming thenormality of an individual's skull and brain.

Anthropological evidences show that prehistorichumans had a dolichocephalic skull until thepaleontological eras. Some brachy-cephalic skullsthat date back to paleontological eras have beenfound in Europe. According to the neurocraniumbrachycephalization theory which is defined asa spread in the width of the average head, theneurocranium brachycephalic skull type hasbecome the dominant skull type in differentcommunities [11,12].

Cephalometric dimensions are affected bygenetics, age and sex, in addition to geographic,climatic, social, and economic factors. Thereforecephalometric studies should be performed withregards to the aforementioned factors in order to

confirm their validity [12,13]. In Iran thesefactors exist; additionally, cephalometric studieshave not been conducted on newborns born inKermanshah. Thus, the aim of this study is todetermine the anthropometry of cephalic index inkermanshahi male newborns. This study alsointends to confirm or deny the theory ofbrachycephalization.

Materials and MethodsIn doing this study, Ethics Committee ofBeheshti University gave consent to the authorsand the entire newborns' parents signed thestudy consent form.

This was a cross-sectional, descriptive studyconducted on 103 Kermanshah healthy.

one-day-old male newborns born in 2012 toparents who were also native-born Kermanshahian.Newborns were delivered via natural childbirthin Mo'etazdei (a hospital in Kermanshah) andImam Reza Hospitals. The study was undertakenfollowing the coordination of Shahid BeheshtiUniversity of Medical Sciences andKermanshah University of Medical Sciences, inaddition to the cooperation of the above-mentioned hospitals' officials.

Of 114 newborns, 103 were diagnosed healthyby a pediatrician and entered into the project.Excluded were 11 newborns who were non-natives or afflicted with musculoskeletal andendocrine diseases, hydrocephalus, microcephaly,and diseases which affected anthropometry.Demographic profiles of newborns that enteredthe study were recorded in prepared forms. In atime interval between 5 to 10 hours followingbirth, the weight of the newborn was measuredby a newborns' scale that had a 100 g accuracy;height was measured by a stadiometer that hadan accuracy of 0.5 mm.

The dimensions and anthropometric sizes of

The anthropometry of cephalic index 53


each neonate's neurocranium was measured inmillimeters by using a calibrated Martin Salercephalometer from cephalometric referencepoints according to international anthropometricprotocols [8]. Relevant data was entered in thedata collection form and subsequently analyzedby SPSS version 20 software. Neurocraniumsizes of the newborns were measured andrecorded as mean±standard deviation. Datawere extracted in the form of tables.

Measurement parameters included the lengthof the neurocranium (direct distance betweenglabella points to the inion and breadth of theneurocranium (direct distance between twoeuryons in the middle of the protruding pointsof the right and left parietal bones). Thecephalic index is a percentage obtained bydividing the neurocranium breadth by its length(mm) and multiplying by 100. The index rangesfrom approximately 65% to 90%. Based on thecephalic index, cephalic profiles from allsocieties are divided into four types (neuro-cranium classification) [8] and include thefollowing ranges: dolichocephalic (<70% to74.09%), mesocephalic (75% to 79%), brachy-cephalic (80% to 84.09%), and hyperbrachy-cephalic [85% to 89.09% (or more)] [14].

ResultsAs seen in Table 1 the anthropometric indicesof one-day-old males indicates that their meanheight was 506±20 mm and their weight was3219±358 g.

Table 1. Anthropometric data on male newbornsfrom Kermanshah.

Variable Mean Standarddeviation Maximum Minimum

Height(mm)

506 20 550 440

Weight(mm)

3219 358 4250 1950

Secondly, the mean neurocranium circumferencewas 352±12 mm, the mean neurocranium lengthwas 115±4 mm, and the mean neurocraniumbreadth was 94±3 mm. The calculated cephalicindex was 81±3% (Table 2).

Table 2. Cephalometric data on male newbornsfrom Kermanshah.

Neurocranium Mean Standarddeviation Maximum Minimum

Circumference(mm)

352 12 380 320

Length (mm) 115 4 128 107

Breadth (mm) 94 3 103 78

Index (%) 81 3 89 67

Neurocranium classificationThe newborns were classified by neurocraniumindexing. The dominant type of neurocraniumobserved was brachycephalic (49.05%) whereasthe least observed was dolichocephalic (3.09%).There were 29.01% mesocephalic and 17.05%hyperbrachycephalic (Table 3).

Table 3. Classification of male newborns accordingto neurocranium indexing.Neurocranium type Number Percent

Dolichocephalic 4 3.9Mesocephalic 30 29.1Brachycephalic 51 49.5Hyperbrachycephalic 18 17.5Total 103 100

DiscussionIn the current study the newborns had a cephalicindex of 81%, which was lower than the results ofa study by Heidari on one-day-old newborns fromZahedan, Sistan and Baluchistan who had acephalic index of 83% and 83% [15]. However thecephalic index in our study was higher than the

54 S. Eivazi & R. Mastery Farahani


results of a study conducted in Gorgan on one-day-old newborns in which the cephalic index ofthose who were native Fars was 77.09% and thosewho were Turkman was 77% [16].

Both the cephalic indices of a study conductedby Imami Meibodi in Qazvin (Northwestern Iran)and in a study of newborns delivered at Shohadai-e-Tajrish Hospital in Tehran were 78%, whichwere lower than the current study [1,17].

In this study, the head phenotype was deter-mined according to the cephalic index. Thedominant type of head shape in our study wasbrachycephalic (49.05%), which was the samefinding observed by [15]. However, in contrastto our study, mesospheric was the dominanttype in native Fars (36.05%) and Turkman(38.01%) newborns' head shapes [16]. In addition,the dominant type of newborns' head shape in aQazvin study was mesocephalic (40%) [1]. Thedominant type of newborns' head shape atTehran Shohadai-e-Tajrish Hospital was meso-cephalic (45%) which was not consistent withour study [17].

The least common head shape amongnewborns in Sistan and Baluchistan [15] wasdolichocephalic, which was the same as our

study. However, the least common observedamong native Fars and Turkman newborns inGorgan was hyperbrachycephalic [16]; inQazvin and Tehran Shohadai-e-Tajrish Hospital,it was brachycephalic, both of these observationswere confirmed by the current study [1,17].

The results obtained from the anthropometricindex of one-day-old Kermanshahian male new-borns confirmed the effect of factors includingage, gender, genetics, etc [18]. Secondly theresults clearly showed the process of brachy-cephalization in communities located in differentareas of Iran and confirmed the presence ofbrachycephalization in male new-borns fromKermanshah.

AcknowledgmentsAppreciation and special thanks are expressedto Dr. Azargashb for his guidance on statisticalissues in addition to the officials at the NeonatalUnits in the Educational and Treatment Centersof Mo'etazedi and Imam Reza Hospitals, inparticular Mrs. Jamshidi and Mrs. Veisi whocontributed to the administrative portion of thisstudy.

References1. Imami Mibodi MA, Farahani MR. Study of normal

range of anatomical dimensions of one-day oldnewborns by cephalometry. J Med Council IslamicRepublic of Iran 1996; 14: 1- 8

2. Abolhasanzadeh A, Farahani MR. Standardedinternational Classification of head shapes of 22 - 24years old in Tehran . J Res Med 2003; 26: 281- 5.

3. de Onis M, Onyango A, Borghi E, Siyam A, Blössner M,Lutter C. Worldwide implementation of the WHO ChildGrowth Standards. Public Health Nutr 2012; 12: 1-8.

4. Shajari H, Marsoosy V, Aslani M, Mahammady MR,Heshmaty P. The effect of maternal age gestationalage and parity on the size of the newborn. Acta Med

Iran 2006; 44: 400-4.5. Ashraf S, Rahman AJ, Abbas K. Anthropometric

Measurments; Newborns in Urban Karachipopulation.Professional Med J 2012; 19: 150-4.

6. Owala P, Eftkhari M, Forozan A, Bahrini F, Farahani M,Ghanei M. Health research priority setting in Iran:Introduction to a bottom up approach . J Res Med Sci2011; 16: 691-8.

7. Molarius A, Seidell J C. Selection of anthropometricindicators for classification of abdominal fatness acritical review. Int J Obes Relate Metab Distorb1998; 22: 719-27.

8. Williams PL, Bannister LH, Berry MM, Collins P,

The anthropometry of cephalic index 55


Dyson M, Dussek JE, Fergusson MWJ. Graysanatomy. 38th Edn. Chuirchill Livingston,Philadelphia, 1995, 607-12.

9. Shamla MC. Anthropologie biologique. Marie-Claude Chamla. NashrGostar,Tehran, 1989; 75.

10. Will MJ, Ester MS, Ramirez SG, Tiner BD, McAnear JT,Epstein L. comparison of cephalometric analysis withethnicity in obstructive sleep apnea syndrome . Sleep1995; 18: 873-5. (Persian)

11. Hassanzadeh Gh. Anthropology, GholamrezaHasanzadeh, Bashir E elm o adab publisher, Tehran,1999, 45-60.

12. Golalipour MJ, Jahanshahi M, Haidari K. Thevariation of head and Face shapes in femalenewborns in the South – East of the Caspian sea (Iran-Gorgan). Eur J Anat 2005; 9: 95-8.

13. Golalipour MJ, Jahanshahi M, Haidari K. MorphologicalEvaluation of Head in Turkman Male in Gorgan- North

of Iran. Int J Morphol 2007; 25: 99-102.14. Mahmoud Najjar El, Mcwillams R. Forensic

Anthropometry Charles C Thomas. PA, USA, 1982,93-9.

15. Heidari Z, Mahmoudzadeh sagheb HR, MohammadiM, Noori Moogehi SMH, Arab A. Cephalic andProsopic indices: comparsion in one-day newbornboys in Zahedan. J Fac Med 2004; 62: 156-65.

16. Golalipour MJ, Hadari K, Jahanshahi M. The shapesof head and face in normal male newborns in South -East of Caspian sea ( Iran-Gorgan ). J Anat Soc India2003; 52: 28-31.

17. Kamali F. study of one-day anthropometric neonatalchildren with classic dial Shohada Hospital[Dissertation]. Shahid Beheshti University of medicalscience, 2007. (persion)

18. Bharati S, Som S, Bharati P, Vasulu TS. Climate andhead form in India. Am J Hum Biol 2001; 13: 626-34.



Case Report

A Study of the Anatomic Variations in ExtrahepaticBile Ducts in 50 Adults Referred to Kerman ForensicMedicine Organization

Seyed Hassan Eftekhar-Vaghefi, Ph.D.¹, Ali Shams-Ara, Ph.D.²*,Mahdiye Jamalizade, M.D.²

1. Neuroscience Research Center, Kerman University of Medical Sciences, Kerman, Iran2. Anatomy Department, Afzalipour School of Medicine, Kerman University of Medical Sciences, Kerman ,Iran*Corresponding author, E-mail address: [email protected]

Received: September 2012 Accepted: December 2012

Ali Shams Ara, Ph.D. is affiliated with the Department of Anatomy, Medical ScienceCollege, Kerman University since 2008. His special interests include anthropology, cellculture, surgical technique in rats, long term potential (LTP), pain evaluating tests(hot plate, formalin, tail flick), and learning and memory tests (Morris water maze,Rotarod test).

AbstractAnatomic variations in forensic extrahepatic bile ducts is common. Knowledge of extrahepatic bile ductvariations is important for surgeons in order to prevent iatrogenic damage during surgery. This study aims todetermine the variations in extrahepatic bile ducts among 150 cadavers located at the Kerman MedicineOrganization.We performed autopsies on 150 cadavers. Bile ducts were exposed and studied to determine their anatomicvariants and diameters.We observed anatomic variants of the biliary tree in 7 cadavers (4.6%). In 3 (2%) cadavers, the right hepaticduct was missing, in 2 (1.33%) the left hepatic duct was missing and 6 (4%) did not have a common hepaticduct. In one case the common bile duct was absent.We may conclude that the Variation of bile duct is different in multiple population.Keywords: Anatomic variation, Bile ducts

To cite this paper: Eftekhar-vaghefi SH, Shams-Ara A, Jamalizade M. A study of the anatomic variations inextrahepatic bile ducts in 50 adults referred to kerman forensic medicine organization. Anat Sci J 2013;10(1): 57-62

58 S.H. Eftekhar-Vaghefi , et al


IntroductionExtrahepatic bile ducts include the right andthe left hepatic duct, the common hepatic duct,the cystic duct, and the common bile duct orductus choledochus. the bile secretion of liverinto small intestine by biliary ducts [1]. Thecommon hepatic duct is formed of the rightand left hepatic ducts. The right hepatic ductusually lies vertically and the left hepatic ducthorizontally [2]. The common hepatic duct is1-4 cm in length and diameter is 4 mm [1].The cystic duct onset than posterior and leftthe neck gallbladder part and joins to thecommon hepatic duct by an acute angle toform the common bile duct or ductuscholedochus [2]. The length of the cystic ductis approximately 3-4 cm and the ductuscholedochus is approximately 7-11 cm. Thediameter of the choledochus is 5-10 mm [3].The upper third (supraduodenal) of thecholedochus lies on the right side of thehepatic artery and anterior to the portal vein,in an unattached margin of the hepatoduodenalligament. The mid-third (retroduodenal) liesposterior to the duodenum and to the right ofthe hepatic artery and portal vein. The lowerthird (pancreatic section) lies in the posteriorgroove of the pancreatic head and forms thevater ampulla by the pancreatic duct and intothe duodenal space. This classic, normal structureof bile ducts is observed in only one-third ofindividuals [4]. The majority of variations thathave been reported in these ducts were relatedto the cystic [5] and right hepatic ducts [6] anddetected during chole-cystectomy.

Anatomical variations in cystic ducts areasymptomatic; this variation is observed in18%-23% of cases [3,6] and varies amongdifferent races [4]. Different anatomical positionsreported for the cystic duct include the

following: absence of the cystic duct, twocystic ducts, the cystic duct tributary of theright hepatic duct, junction of the left side intothe common hepatic duct, or the cystic ductand the common hepatic duct were parallel toone another [7-9].

This is important goal that quickly andviolent diagnoses of malformation because bilepathology likes bile ducts inflammatory,gallstone and bile ducts cancer in bile crudityare very incident [4]. This is possible dissectionor occlusion bile ducts crudity during surgeryoperation and creation imposition as such bileleakage, fistula or narrow [10]. Assessment ofextrahepatic bile duct variations is importantfor surgeons to determine in order to preventiatrogenic damage during surgery. Anatomicalsurvey of biliary ducts is possible by ultra-sonography, cholangiography and MRI [11-13].

Because this issue is important and due to alack of statistics in Kerman Province, we haveattempted to evaluate the variation inextrahepatic bile ducts among in cadavers atKerman Medicine Organization. In this studywe determine the length, diameter and anatomicalvariation of the cadavers' bile ducts.

Materials and MethodsThis study was performed on 150 cadavers thatwere located in the Kerman MedicineOrganization. Ethically, consent was obtainedfrom the cadaver's family and the appearanceof the cadaver was maintained during theautopsy. In this study we assessed the anatomicvariant, length and diameter of the cadavers'bile ducts. All procedures were performed asnoted previously with regards to surgicaltechnique, incision location, and anatomicdescription [1,2].

The anatomic variations in extrahepatic bile ducts 59


Initially, we opened the abdominal wall withan 8-10 cm midline incision inflicted by abistoury knife. Next, we removed the firstduodenum and lesser omentum that werelocated in the right superior abdominal quadrant.We dissected the right and left hepatic ducts,common hepatic duct, cystic duct and chole-dochus (supraduodenal, retroduodenal andinfraduodenal) and noted any anatomic variants,as well as the lengths and diameters of the bileducts. This information was recorded in thecadaver's medical form.

Windows SPSS version 18 was used to performstatistical analyses.

ResultsOf the 150 cadavers studied the anatomicpositions of the bile ducts were normal in 95%.Of these, three did not have a right hepaticduct, two did not have a left hepatic duct, andthere was no common hepatic duct in sixcadavers. In one, the right and left hepatic ductwere joined and the cystic duct in one pointand formation the choledochus, namely in thisplace, the common hepatic duct was absent.The cystic duct was observed in all samplesand joined to the common hepatic duct innormal shape and don’t observed the accessorybile duct. In one case was the choledochus wasabsent; the common hepatic duct and cysticduct were joined to the vater ampulla at onepoint near the duodenum.

We assessed for variations in diameter andlength of the bile ducts in addition to anyanatomic differences. As noted in Tables 1- 2,the lengths of the bile ducts in this study wereshorter than previously reported lengths, whereasthe diameters were greater than diameters of thebile ducts that have been previously reported

[5,10]. The average, standard digression, andminimum and maximum lengths and diameters ofthe extrahepatic bile ducts are shown in Table 3.

Table 1. Frequency of length of biliary ducts inmillimeters.

Ductlengthof theduct

Frequency

Percent

The right hepatic duct

8-1516-2324-43Absent

6859203

45.3339.3313.33

2

The left hepatic duct

6-1415-2224-40Absent

8252142

54.6634.669.331.33

The common hepaticduct

7-1819-2627-44Absent

7747251

51.3331.3316.660.66

The cystic duct

7-1819-2526-35Absent

5075250

33.3350

16.660

Table 2. Frequency of diameter of biliary ducts inmillimeters.

Ductdddddd

Diameterof the duct

Frequency Percent

The righthepatic duct

4-78-11

12-18Absent

39100

83

2666.665.33

2

The lefthepatic duct

3-56- 89-12

Absent

4291152

2860.66

101.33

The commonhepatic duct

5-89-12

13-15Absent

3897141

25.3364.669.330.66

The cysticduct

4-78-11

12-14Absent

3699150

2466100



Table 3. Average, standard deviation and minimum and maximum extrahepatic bile duct sizes in millimeters.

AbsentMaximumMinimumStandarddeviationAverageDuct

3436617.15Length of the right hepatic duct124065.7514.75Length of the left hepatic duct21447719.91Length of the common hepatic duct303575.3320.55Length of the cystic duct4318.841.928.63Diameter of the right hepatic duct521231.586.61Diameter of the left hepatic duct611552.079.75Diameter of the common hepatic duct701441.938.91Diameter of the cystic duct811571.9311.45Diameter of the choledochus9

DiscussionIn support of previously reported variants [3,4],this study has also shown observable variants inthe extrahepatic bile ducts. We additionallyobserved the lack of bile ducts in somecadavers. In this study 95% of cadaversexhibited classic, normal bile duct structurehowever another study observed only 33.3% ofcases that had normal bile ducts [5]. A previousstudy on 186 cholecystectomy cases noted noanomalies, with normal bile ducts [10]. Theirresults approximated the outcome of the currentstudy. According to one study that evaluated300 donor livers, the anatomic bile ducts werenormal in 63% of cases [7].

In 3 (2%) cadavers the right hepatic duct wasmissing. The left hepatic duct joined to thecystic duct and formed the choledochus. Inthese occasion, 3 cadavers the common hepaticduct was also absent. In 2 (1.33%) the lefthepatic duct was missing such that the righthepatic duct joined to the cystic duct andformed a choledochus, therefore the commonhepatic duct was also absent. In 1 (0.66%?)cadaver, the right and left hepatic ducts and thecystic duct joined in a point and formed acholedochus; the common hepatic duct was alsoabsent. There wasnt common hepatic duct

observed in 6 (4%) cadavers. In a studyconducted in London that was performed on2080 cases, the researchers discovered anatomicvariants in 12 cases; the cystic duct was missingin 3 cases, the cystic duct joined to the righthepatic duct in 2 cases and to the left hepaticduct in one case, a double cystic duct in onecase was noted, and there were accessory bileducts in 5 cases [14]. Another study of 500cholecystectomy cases noted cystic variants in52 cases [5].

In the current study the cystic duct waspresent in all cadavers; it joined the commonhepatic duct in classic form and wasnt theaccessory bile duct (Table 1). This wasConsiderable point in our studied that we foundcrudities than any one of other previous study.In other studies the most observed variant wasrelated to the cystic duct [5,14-16] whereas inthe current study the cystic duct had a normalstructure. In a research performed in Canada on170 cases, the cystic duct was located on theleft side of the common hepatic duct in 22(17%) cases and parallel in 31 (25%) cases [17].These results were not in agreement with ourobservations. In all cadavers in the currentstudy the cystic duct was located at the rightside of the common hepatic duct and joined to it

The anatomic variations in extrahepatic bile ducts 61


by an acute angle.Rare cases of bile ducts variants such as

extrahepatic bile ducts [4] or double choledochus[11] have been reported. We did not observe thesein our study according to the number of samplesassessed. In only one cadaver we noted theabsence of choledochus; it joined the commonhepatic duct and the cystic duct in a point to thevater ampulla in the duodenum.

This study also assessed the diameters andlengths of bile ducts despite anatomic variantof bile ducts. [18,19] The size of the bileducts in the present study differed fromprevious reports [1,2]. We observed shorter duct

lengths and larger diameters compared toother sources [1,2], which must be related tothe difference in race in the populationstudied. However, the results of our studyhave not been found in any previous study.Thus these variants are important as they arerare findings. These outcomes can be used toenable surgeons to have more accurate surgeriesand decrease the risk of injury during surgery.

AcknowledgmentsWe wish to thank the staff at the Kerman ForensicMedicine Organization for their assistance.

References1. Charles Brunicadi F, Andersen D, Timothy R, Dunn

D, et al. Schwartz’s principles of surgery. 8th ed. TheMcGraw-Hill Companies Inc, USA, 2005, 1188-90.

2. Kim HJ, Kim MH, Lee SK, Seo DW, Kim YT, Lee DK,et al. Normal structure, variations and anomalies of thepancreaticobiliary ducts of Koreans: a nationwidecooperative prospective study. Gastrointest Endos 2002;55: 889-96.

3. Wu YH, Liu ZS, Mrikhi R, Ai Zh, Sun Q, Bangoura G,et al. Anatomical variations of the cystic duct: Two casereports. World J Gastroenterol 2008; 14: 155-7.

4. Choi E, Byun JH, Lee MG. Duplication of theextrahepatic bile duct with anomalous union of thepancreaticobiliary ductal system revealed by MRcholangiopancreatography. Br J Radiol 2007; 80:150-4.

5. Mortele KJ, Ros PR. Anatomic variants of the biliarytree: MR cholangiographic findings and clinicalapplications. Am J Roentgenol 2001;177: 389-94

6. Koenraad J, Mortelé R. Anatomic Variants of theBiliary Tree: MR Cholangiographic Findings andClinical Applications. Am J Roentgenol 2001; 177:389-94.

7. Daniel V. Kostov, Georgi L. Kobakov. Six Rare

Biliary Tract Anatomic Variations: ImplicationsforLiver Surgery. EAJM 2011; 43: 67-72.

8. Kocaoğlu M, Uğurel S, Bulakbaşı N, Somuncu I. MRcholangiopancreatography of a case with a biliarytract variation and postoperative biliary duct injury.Diagn Interv Radiol 2005; 11: 219-21.

9. Dumitrascu T, Lupescu I, Ionescu M. The Todaniclassification for bile duct cysts: an overview. ActaChir Belg 2012; 112: 340-5.

10. Larobina M, Nottle P. Extrahepatic Biliary AnatomyAt Laparoscopic Cholecystectomy. ANZ J Surg2005; 75: 392-5.

11. Ozden I, Kamiya J, Nagino M, Uesaka K, Sano T,Nimura Y. Clinicoanatomical study on the infraportalbile ducts of segment 3. World J Surg 2002; 26: 1441-5.

12. Kahaleh M, Hernandez AJ, Tokar J, Adams RB,Shami VM, Yeaton P. Interventional EUS-guidedcholangiography: evaluation of a technique inevolution. Gastrointest Endosc 2009; 64: 52-9.

13. Kitami M, Takase K, Murakami G, Ko S, Tsuboi M,Saito H, et al. Types and frequencies of biliary tractvariations associated with a major portal venousanomaly: analysis with multi-detector row CTcholangiography. Radiology 2006; 238: 156-66.



14. Lamah M, Dickson G. Congenital anatomicalabnormalities of the extrahepatic biliary duct. SurgRadiol Anat 2000; 21: 325-7.

15. Brandt CP, Eckhauser ML. Rare bile duct anomalies.A case report and implications for laparoscopiccholecystectomy. Surg Endosc 1994; 8: 329-31.

16. Bong Tae Park, Chooi Yong Moon, sang Lee, Minsang Kim. A rare case of extahepatic bile ductanomaly associated with multiple stones. Korean JGastrointest Endosc 1996; 16: 1023-8.

17. Taourel P, Bret PM, Reinhold C, Barkun AN, Atri M.

Anatomic variants of the biliary tree: diagnosis withMR cholangiopancreatography. Radiology 1996;199: 521-7.

18. Wu CC, Ho YH, Chen CY. Effect of aging oncommon bile duct diameter: a real-time ultra-sonographicstudy. J Clin Ultrasound 1984; 12: 473-8

19. Hassan S, Young AL, Farooq M, Pai D, Gough M.Accessory gallbladder: a new anatomical variationarising from both left and right hepatic ducts. Ann RColl Surg Engl 2012; 94: 204-5.

Documents

In The Name of God - anatomydept.mums.ac.ir · In The Name of God ðvOwned Iranian Society of Anatomical Sciences ðvChairman Manager Joghataei Mohammad Taghi, Ph.D. ðvEditor in