Identification of Differentially Expressed Genes in Cardiac Hypertrophy by Analysis of Expressed Sequence Tags

0Pcp

Genomics 66, 1–14 (2000)doi:10.1006/geno.2000.6171, available online at http://www.idealibrary.com on

Identification of Differentially Expressed Genes in CardiacHypertrophy by Analysis of Expressed Sequence Tags

David M. Hwang, Adam A. Dempsey, Cheuk-Yu Lee,* and Choong-Chin Liew1

The Cardiac Gene Unit, Department of Laboratory Medicine and Pathobiology, The Centre for Cardiovascular Research,The Toronto Hospital, University of Toronto, Toronto, Ontario M5G 1L5, Canada; and *Department of Biochemistry,

The Chinese University of Hong Kong, Shatin, Hong Kong

Received September 22, 1999; accepted February 7, 2000

tssscS1tlprdd

cqdssatdc

atmc

l

Cardiac hypertrophy is an adaptive response tochronic hemodynamic overload. We employed a whole-genome approach using expressed sequence tags (ESTs)to characterize gene transcription and identify newgenes overexpressed in cardiac hypertrophy. Analysis ofgeneral transcription patterns revealed a proportionalincrease in transcripts related to cell/organism defenseand a decrease in transcripts related to cell structureand motility in hypertrophic hearts compared to normalhearts. Detailed comparison of individual gene expres-sion identified 64 genes potentially overexpressed in hy-pertrophy, of 232 candidate genes derived from a set of77,692 cardiac ESTs, including 47,856 ESTs generated inour laboratory. Of these, 29 were good candidates (P <.0002) and 35 were weaker candidates (P < 0.005). RT-CR of a number of these candidate genes demonstratedorrespondence of EST-based predictions of gene ex-ression with in vitro levels. Consistent with an organ

under various stresses, up to one-half of the good candi-dates predicted to exhibit differential expression weregenes potentially involved in stress response. Analysesof general transcription patterns and of single-gene ex-pression levels were also suggestive of increased proteinsynthesis in the hypertrophic myocardium. Overall,these results depict a scenario compatible with currentunderstanding of cardiac hypertrophy. However, theidentification of several genes not previously known toexhibit increased expression in cardiac hypertrophy(e.g., prostaglandin D synthases; CD59 antigen) also sug-gests a number of new avenues for further investigation.These data demonstrate the utility of genome-based re-sources for investigating questions of cardiovascular bi-ology and medicine. © 2000 Academic Press

1 To whom correspondence should be addressed at Department ofLaboratory Medicine and Pathobiology, Banting Institute, Univer-sity of Toronto, 100 College Street, Toronto, Ontario M5G 1L5,Canada. Telephone: (416) 978-8758. Fax: (416) 978-5650. E-mail:

[email protected].

1

INTRODUCTION

Cardiac hypertrophy is an adaptive response thatattempts to maintain normal function in the face ofchronic hemodynamic overload. Although it is a funda-mental process in the normal growth and developmentof the mammalian heart, cardiac hypertrophy can alsobe a predictor of increased cardiovascular morbidityand mortality (Levy et al., 1990) and an early step inhe progression to heart failure. Recent years haveeen advances in delineating molecular pathways re-ponsible for transducing mechanical and humoraltimuli into changes in gene expression during pro-esses of hypertrophy and failure (Chien et al., 1997;adoshima and Izumo, 1997; Schwartz and Mercadier,996). Few of these studies, however, have endeavoredo characterize gene expression on a genome-wideevel. Such broader-based studies would be of value inroviding a more global framework for integrating cur-ent knowledge and for gaining a more complete un-erstanding of the molecular processes underlying car-iac hypertrophy (Pashmforoush and Chien, 1997).High-throughput sequencing of randomly selected

lones from cDNA libraries to generate expressed se-uence tags (ESTs) has proven a powerful means ofiscovering novel genes and of examining their expres-ion in a wide variety of tissues (see Table 1). Randomampling and sequencing of cDNA libraries by the ESTpproach generate gene expression profiles that are inheory useful for detailed genetic-level comparisons ofifferent developmental and pathologic states of theells and tissues of interest (Adams et al., 1993a,b,

1995; Hwang et al., 1997; Vasmatzis et al., 1998). Whilelmost three million ESTs are currently availablehrough dbEST, however, strategies to use this infor-ation to study disease processes have been less forth-

oming.Previously, we documented the establishment of a

arge-scale cDNA sequencing project to investigate
uestions of cardiovascular biology (Hwang et al.,
0888-7543/00 $35.00Copyright © 2000 by Academic Press

All rights of reproduction in any form reserved.

aptcn

C

2 HWANG ET AL.

1994, 1995, 1997; Liew et al., 1994) and character-ized gene expression in cardiac development throughcomparative analysis of over 6000 ESTs from adult(Liew, 1993; Liew et al., 1994) and fetal (Hwang et

l., 1994, 1995) heart cDNA libraries. Recently, weroposed a novel strategy for identifying genes po-entially involved in cardiovascular disease throughomputer-based comparisons of EST frequencies inormal and diseased tissue (Hwang et al., 1997).

TAB

Expressed Sequence Tags fr

Tissue References

omplete body Adams et al. (1995)

Adipose Maeda et al. (1997)

Brain Adams et al. (1991)Adams et al. (1992)Adams et al. (1993a)Adams et al. (1993b)Hillier et al. (1996)Khan et al. (1992)Soares et al. (1994)

Breast Hillier et al. (1996)Ji et al. (1997)Watson and Fleming (1994)

Cochlea Hillier et al. (1996)Skvorak et al. (1999)

Colon Frigerio et al. (1995)Okubo et al. (1994)

Cornea Nishida et al. (1996)

Embryo Jay et al. (1997)Morozov et al. (1998)

Fovea Bernstein et al. (1996)

Granulocytoid cells Itoh et al. (1998)Murakawa et al. (1994)Okubo et al. (1995)

Heart Hwang et al. (1994)Hwang et al. (1995)Hwang et al. (1997)Liew (1993)Liew et al. (1994)Tanaka et al. (1996)

Hematopoietic cells Claudio et al. (1998)Gubin et al. (1999)Mao et al. (1998)

Keratinocyte Kita et al. (1996)Konishi et al. (1994)

Liver Choi et al. (1995)Hillier et al. (1996)Kawamoto et al. (1996)Okubo et al. (1992)

Applying this model to a preliminary analysis of

cardiac hypertrophy, we demonstrated that evensmall EST data sets were able to identify a signifi-cant number of genes overexpressed in hypertrophy.However, the small number of ESTs used restrictedthe analysis to more abundantly expressed genes(i.e., genes expressed at frequencies of greater than 1in 800 transcripts) with increased sensitivity to lessabundant transcripts requiring larger numbers ofESTs. Furthermore, no in vitro evidence was ob-

1

Different Human Tissues

Tissue References

ng Hillier et al. (1996)Itoh et al. (1994)Schraml et al. (1994)Sudo et al. (1994)

elanocyte Hillier et al. (1996)

esangial cells Yasuda et al. (1998)

ultiple sclerosis lesions Becker et al. (1997)Hillier et al. (1996)

euroblastoma Yokoyama et al. (1996)

lfactory epithelium Hillier et al. (1996)

vary Hillier et al. (1996)

ncreas Ferrer et al. (1997)Gress et al. (1996)Takeda et al. (1993)

neal gland Hillier et al. (1996)

acenta Hillier et al. (1996)

ostate Huang et al. (1999)Krizman et al. (1996)Nelson et al. (1998)

tina Agarwal et al. (1995)Gieser and Swaroop (1992)Hillier et al. (1996)Shimizu-Matsumoto et al. (1997)

eletal muscle Houlgatte et al. (1995)Lanfranchi et al. (1996)Pallavicini et al. (1997)

leen Hillier et al. (1996)

cell, CD341 Yang et al. (1996)

stis Affara et al. (1994)Pawlak et al. (1995)

ymus Hwang et al. (1999)Lamerdin et al. (1995)

LE

om

Lu

M

M

M

N

O

O

Pa

Pi

Pl

Pr

Re

Sk

Sp

T-

Te

Th

tained to determine whether changes in expression

UsCap

cn1dfGkH1a(

vwvipbpptgnura

od

3GENE EXPRESSION ANALYSIS IN CARDIAC HYPERTROPHY

predicted by this method were actually reflective oftranscript abundance at the RNA level.

In this report, we extend this strategy to identify64 genes potentially overexpressed in cardiac hyper-trophy, from a set of 77,692 cardiac ESTs (47,856ESTs generated in our laboratory), including 4511ESTs from hypertrophic heart cDNA libraries. Wefurther demonstrate the correspondence of comput-er-based predictions to in vitro assessment of genetranscription, and we discuss several potential im-plications of our approach and findings to heart fail-ure research.

MATERIALS AND METHODS

RNA isolation and cDNA library construction and sequencing.Isolation of mRNA from pooled human heart samples was performedas previously described (Hwang et al., 1997) using the method ofChomczynski and Sacchi (1987), followed by enrichment of thepoly(A)1 fraction by oligo(dT) cellulose chromatography (Pharmacia,

ppsala, Sweden). Hypertrophic heart cDNA libraries were con-tructed in the Lambda ZAP Express vector (Stratagene, La Jolla,A) according to the manufacturer’s instructions. ESTs were gener-ted using a well-established PCR and cycle-sequencing-based ap-roach (Liew, 1993; Hwang et al., 1997).

Data acquisition and analysis. EST data from other human heartDNA libraries were retrieved from the National Center for Biotech-ology Information (NCBI) as previously described (Hwang et al.,997). Sequence similarity searching of all ESTs against the nonre-undant GenBank/EMBL/DDBJ and dbEST databases was per-ormed in-house using the BLAST algorithm (Altschul et al., 1990;ish and States, 1993), and functional assignments of ESTs withnown gene matches were made according to categories described inwang et al. (1997). Sequences were deposited with dbEST (Boguski,993) using standard flat file format. Further clone information isvailable through NCBI or at The Cardiac Gene Unit WWW siteURL: http://www.tcgu.med.utoronto.ca).

Identification of differentially expressed genes. To identify indi-idual genes differentially expressed in cardiac hypertrophy, ESTsere generated from three independent human hypertrophic heartentricle cDNA libraries. Known genes represented by EST matchesn at least two of the three library samples were identified. Poissonrobabilities for simultaneously detecting at least the observed num-er of ESTs in each hypertrophic heart library were calculated, usingooled EST data from all cardiac cDNA libraries to determine ex-ected frequencies (excluding normalized libraries, since normaliza-ion in principle alters relative gene frequencies). In cases whereene expression frequencies differed significantly (P , 0.01) betweenormal adult and fetal hearts, Poisson probabilities were calculatedsing expected frequencies based on adult heart data alone. Genesepresented by ESTs in all three hypertrophic heart cDNA librariesnd which exhibited P , 0.0002 (i.e., Bonferoni value, P , 0.05/n;

n 5 232) were considered to be strong candidates for differentialexpression. Genes with P , 0.0002 but which were represented innly two of three libraries were designated good candidates forifferential expression, while genes with 0.0002 , P , 0.005 were

designated weak candidates.

Reverse transcriptase–polymerase chain reaction (RT-PCR). RT-PCR was performed using the Titan One-tube RT-PCR kit (Boehr-inger Mannheim), according to the manufacturer’s protocols. Reac-tions were performed in a final volume of 25 ml, in the presence of 0.2mM each dNTP, 5 mM DTT, 1.5 mM MgCl2, 0.1 mg of pooled totalRNA for each stage and 20 pmol each of forward and reverse primers
(Table 2), and each sample was tested at least in triplicate. Reverse
transcription was performed at 60°C (30 min) in a DNA ThermalCycler (Perkin–Elmer). After reverse transcription, reactions wereheated to 94°C (2 min) and then cycled [(94°C for 2 min; 60°C for 2min; 72°C for 2 min; 10 cycles) followed by (94°C for 2 min; 60°C for2 min; between 14 and 30 cycles, as optimized for each gene)],followed by a final extension at 72°C for 5 min. PCR products wereelectrophoresed on 1% agarose gels containing ethidium bromide,and semiquantitation was performed using a Gel DocumentationSystem (Bio-Rad). In all cases, glyceraldehyde-3-phosphate dehydro-genase primers (Table 2) were used as internal controls for RNAintegrity and equal loading. Differences between stages were ana-

TABLE 2

RT-PCR Primers for Genes PotentiallyOverexpressed in Failing Heart

Gene Primer

a-B-Crystallin F TGGTTTGACACTGGACTCTCR GCTTCAGCACTAGTCACAAG

a-Skeletal-actin F TGGAAAAGAGCTACGAGCTGR AGATTCGTCGTCCTGAGAAG

Brain natriuretic peptide F GCTCCTGCTCTTCTTGCATCR CACCGTGGAAATTTTGTGCTC

Calcyclin F GTGGCCATCTTCCACAAGTACR CCACCACTGGATTTGACTCAG

CD59 antigen F ACACTCTACTACATGTGACTGR TGCAAAAGTCAGCCTATGCC

Connexin 43 F TCAATGTGGACATGCACTTGR CTGGTCCACAATGGCTAGTG

Decorin F AAGTGACTTCTGCCCACCTGR TTTGCAGCTGCCTACGTTAG

Desmin F GATGATGGAATACCGACACCR TAGAGCACTTCATGCTGCTG

Glutathione peroxidase F TCAGCAACGTCAAGATGGACR GTCTCAAGCCAGTGGACCAG

Heat shock protein 70B F TTGATGCTAATGGCATCCTGR CCCTGACAGTCACAGCTGAC

Lipoprotein lipase F GCAGTGCTTGTAAACCATCGR TTCATTCCAAGCCTGATGATG

Long-chain acyl-CoA F CTACATGCGAAGTGAGCCTGsynthase R AGATTCTCCAGCCAGGACAG

Metallothionein II F GCAACCTGTCCCGACTCTAGR GTCACGGTCAGGGTTGTACA

Myoglobin F AGTTTGACAAGTTCAAGCACCR GCAGACACTCAGAAGCAAAC

Myosin light chain 1, F AGGAAGCCTTCATGCTGTTCventricular R TCACAGGTAAGCACAGCCTG

Myosin regulatory light F TACTTGAGAGAGCTGCTGACchain R CGAGCCGAACTAACTTTCTC

Plasma gelsolin F CATCAGGATTCAAGCACGTGR AGGACCGAGACCTGAGTCTG

Plasminogen activator F TGCCATCACTCTTGTACTGCinhibitor R GACTTCCTGAGATACGGTGA

Prostaglandin D synthase F GAATGGCTACTCATCACACGR CCTATTGTTCCGTCATGCAC

Prostaglandin D2 F GTTGTCCATGTGCAAGTCTGsynthase R AGGAACAGAGCAGAGACATC

Pyruvate dehydrogenase F TTTATATGGCGATGGTGCTGa-subunit R CTTGATCCACTGATTGGCAC

Troponin I, cardiac F GCAGATTGCAAAGCAAGAGCR TTCCACTCAGTGCATCGATG

Glyceraldehyde-3 F TGGGTGTGAACCATGAGAAGphosphatedehydrogenase

R GTGTCGCTGTTGAAGTCAGA

lyzed using paired t tests, with a significance cut-off of P 5 0.05.

4 HWANG ET AL.

RESULTS

cDNA Sequencing and EST AcquisitionA total of 47,856 ESTs were generated in our labo-

ratories from seven human heart cDNA libraries rep-resenting several developmental stages and diseasestates. These include 4511 ESTs from three hypertro-phic heart cDNA libraries (Table 3). An additional29,836 ESTs from four cardiac cDNA libraries wereobtained through dbEST, for a total of 77,692 ESTsrepresenting over 22 million nucleotides of raw cDNAsequence. Of these, 55% had significant similarity to

TAB

Summary of EST Data—

Human cardiac cDNA library

A. Toronto and Hon

Hypertrophic A (Toronto)Hypertrophic B (Toronto)Hypertrophic, familial (Hong Kong)Adult (Clontech)Fetal, 10–12 weeksFetal, 8–10 weeksFetal, 20–25 weeks (Clontech)

Total

B. d

Adult, atrium (Genethon)Adult (Stratagene, Genethon)Adult normalized (Tanaka, University of Tokyo)Fetal, 19 weeks normalized (Soares, Washington University)SubtotalCardiac libraries (Toronto and Hong Kong)

Total

known sequences in the nonredundant GenBank/

* P (adult vs hypertrophic) , 0.001 (x2 df 5 1).

EMBL/DDBJ nucleotide databases, representing asmany as 5000 unique known genes. Another 32%matched other ESTs in dbEST, but not any knowngene sequences, while the remaining 13% were noveltranscripts, exhibiting no similarity to any known se-quences. While these proportions varied widely be-tween individual cDNA libraries, the proportion ofESTs matching known genes was consistently higherin all three hypertrophic heart cDNA libraries (approx-imately 70 to 75%; Table 3) than in any other library,due primarily to the prevalence of mitochondrial ge-

3

ardiac cDNA Libraries

talTs

Matched toknown genes

Matched toother ESTs

Unmatchednovel

ong data libraries

,069 754 (71%) 250 (23%) 65 (6%),353 1,640 (70%) 447 (19%) 266 (11%),089 820 (75%) 184 (17%) 85 (8%),749 3,282 (49%) 1,751(26%) 1,716 (25%),975 1,554 (52%) 820 (28%) 601 (20%),579 19,109 (57%) 8,168 (24%) 6,302 (19%)

42 23 (55%) 7 (17%) 12 (28%),856 27,182 (57%) 11,627 (24%) 9,047 (19%)

ST

651 255 (39%) 277 (43%) 119 (18%)382 161 (42%) 131 (34%) 90 (24%),040 2,114 (70%) 836 (27%) 90 (3%),763 12,748 (49%) 11,725 (46%) 1,290 (5%),836 15,278 (51%) 12,969 (44%) 1,589 (5%),856 27,182 (57%) 11,627 (24%) 9,047 (19%),692 42,460 (55%) 24,596 (32%) 10,636 (13%)

LE

C

ToES

g K

12162

33

47

bE

325294777

nome transcripts observed in the hypertrophic librar-

TABLE 4

Relative Levels of Gene Expression in the Heart

Human heart cDNA library

Functional category

Cell divisionCell signaling/

communicationCell structure/

motilityCell/organism

defenseGene/proteinexpression Metabolism Unclassified

A. All known transcripts

Fetal 3.35% 8.92% 14.62% 5.13% 32.87% 27.91% 7.21%Adult 3.09% 7.88% 22.34% 5.54% 17.27% 34.86% 9.03%Hypertrophic 1.34% 8.26% 15.88%* 7.16%* 16.60% 43.43%* 7.32%

B. Mitochondrial transcripts excluded

Fetal 4.00% 10.66% 17.47% 6.13% 39.29% 13.85% 8.61%Adult 4.01% 10.20% 28.92% 7.17% 22.36% 15.65% 11.69%Hypertrophic 1.99%* 12.22% 23.51%* 10.60%* 24.57% 16.29% 10.83%

Note. Relative expression levels were calculated by dividing the total number of ESTs for each category by the total number of ESTs, with(A) or without mitochondrial transcripts (B), for each stage (fetal, adult, hypertrophic). Normalized libraries were excluded from calculations.

sot


ies compared with other cardiac libraries (average 23%vs 5%, respectively; data not shown).

Analysis of Known Gene Expression in CardiacGrowth and Hypertrophy

Functional categorization. ESTs matching knowngenes were classified by putative function into sevencategories (cell division, cell signaling/cell communi-cation, cell structure/motility, cell/organism defense,gene/protein expression, metabolism, unclassified).For each cDNA library, the proportion of gene ex-pression represented in each category was estimatedby calculating the proportion of ESTs with knowngene matches in each category (Table 4A), allowingfor comparisons of gene expression patterns betweennormal and hypertrophic hearts. Over 40% of knowntranscripts in the hypertrophic heart were dedicatedto metabolic functions. This proportion far exceededthat seen in either fetal (28%) or adult normal (35%)heart (P , 0.001). However, these differences dis-appeared when mitochondrial transcripts, whichconstituted 32% of known transcripts in hypertro-phic heart (compared with 16% in fetal and 22% inadult normal hearts; data not shown), were excludedfrom calculations (Table 4B). In concordance withprevious findings (Hwang et al., 1997), the hypertro-phic heart exhibited decreased abundance of tran-scripts related to cell structure and motility relativeto the adult heart (16% vs 22%; P , 0.001) (Table4A), although part of this decrease was due to theoverrepresentation of mitochondrial transcripts inhypertrophic heart libraries. Nevertheless, this de-crease persisted (24% vs 29% in hypertrophic vs non-hypertrophic hearts; P , 0.001) even after levels ofnuclear gene expression alone were determined byexcluding mitochondrial transcripts from calcula-tions (Table 4B). This decrease was not due to de-creased expression of contractile proteins as asubcategory, which in aggregate constituted approx-imately 13% of known nuclear transcripts in bothhypertrophic and nonhypertrophic hearts (data notshown). Also decreased in the hypertrophic heartwere transcripts related to cell division (2% vs 4% infetal and adult normal hearts; P , 0.001).

In contrast, an increase in the abundance oftranscripts involved in cell/organism defense wasobserved in hypertrophic heart (average 11%) rela-tive to both fetal (average 6%) and adult (average7%) hearts (P , 0.001) (Table 4B). Transcripts ofgenes involved in gene and protein expression werealso marginally elevated in hypertrophic heart (av-erage 25%) compared to the normal adult heart (av-erage 22%), although this was not statistically sig-nificant.

Identification of genes differentially expressed in car-diac hypertrophy. Analysis of approximately 5000
unique known genes represented by cardiac ESTs was
undertaken to identify genes highly expressed in hy-pertrophic heart cDNA libraries (Table 5). To minimizethe impact of random events that might tend to biasrelative gene frequencies in individual cDNA libraries,only genes represented by ESTs in at least two of thethree hypertrophic heart libraries were selected forfurther analysis. A total of 232 unique genes were thusidentified (Table 5). Of these, 22 were identified asstrong candidates for overexpression in cardiac hyper-trophy (with mitochondrial genome transcriptscounted as a single entity) (Table 5A). Another 7 wereconsidered good candidates (Table 5B), while 35 wereidentified as weak candidates for differential expres-sion (Table 5C). The remaining 168 genes exhibited acombined P . 0.005 and were therefore not identifiedas being differentially expressed (Table 5D).

Approximately one-quarter (54 in total) of the 232genes identified in this screen exhibited significantlydifferent expression frequencies between adult and fe-tal hearts (indicated by asterisks in Table 5). The largemajority of these were either genes related to proteintranslation (e.g., ribosomal proteins, elongation fac-tors) or contractile proteins (e.g., a-cardiac actin)—notsurprising given the previous finding that the relativeproportions of these classes of genes differ betweenadult and fetal hearts (Hwang et al., 1995, 1997) (seealso Table 4A). Recalculation of P values for compari-on of hypertrophic heart data with adult heart datanly did not substantially alter the results in most ofhese cases, with the notable exception of b-myosin

heavy chain (Table 5D), which would have been astrong candidate for differential expression (P 5 3.7 31025) had fetal expression data been included. More-over, a number of ribosomal proteins exhibited trendstoward increased expression levels (P , 0.05) in hyper-trophic hearts when compared to adult hearts alone,though these were not considered statistically signifi-cant given the level of significance required for thenumber of different genes considered.

A sample of 10 strong candidates (Fig. 1) and 12weaker candidates (Fig. 2) for differential expressionidentified using this approach were selected for confir-matory RT-PCR, including several previously known tobe differentially expressed. Nine of 10 strong candi-dates (all except troponin I) exhibited visible differ-ences in intensity of RT-PCR products between adultnormal and hypertrophic hearts (Fig. 1). On semiquan-titation, 7 of these (a-B-crystallin, brain natriureticpeptide, CD59 antigen, desmin, myoglobin, myosinregulatory light chain, and plasminogen activator in-hibitor) exhibited statistically significant increases(P , 0.05) of expression in adult hypertrophic com-pared to adult normal hearts (data not shown). An-other 2 tended toward, but did not achieve, statisticalsignificance at the threshold selected (lipoproteinlipase, P 5 0.07; a-skeletal actin, P 5 0.06). Troponin I
did not exhibit significant differences in expression

TABLE 5

Identification of Genes Potentially Overexpressed in Cardiac Hypertrophy

Gene Accession No. Function Fetal AdultHyper-trophic P

A. Strong candidates for differential expressionMitochondrial genome (consensus sequence) X62996 M 7.85% 8.13% 22.99% ,1.0 3 10230

Myoglobin X00373 C/OD 0.02% 0.01% 0.82% 6.6 3 10225

Brain natriuretic peptide precursor M25296 CS/C 0.01% 0.00% 0.67% 4.3 3 10221

Actin, a-skeletal J00068 CS/M 0.00% 0.03% 0.53% 8.1 3 10216

Troponin I, cardiac M64247 CS/M 0.01% 0.04% 0.40% 8.6 3 10213

Crystallin, a-B S45630 CS/M 0.05% 0.04% 0.53% 8.7 3 10212

Myosin regulatory light chain X54304 CS/M 0.05% 0.03% 0.33% 4.0 3 1029

Skeletal muscle LIM-protein SLIM1 U60115 U 0.00% 0.00% 0.20% 1.6 3 1028

Tropomyosin, a skeletal muscle M19715 CS/M 0.32% 0.27% 0.80% 7.9 3 1028

Atrial natriuretic factor* M30262 CS/C 0.50% 0.27% 0.78% 1.3 3 1027

Myosin light chain-2* S69022 CS/M 0.08% 0.19% 0.98% 3.8 3 1027

CD59 antigen M34671 U 0.00% 0.00% 0.18% 9.8 3 1027

Lipoprotein lipase M15856 M 0.00% 0.01% 0.18% 2.2 3 1026

Heat shock protein 70 (hsp70 protein 1) M59830 C/OD 0.01% 0.04% 0.16% 1.1 3 1025

Plasminogen activator inhibitor-1 X04429 G/PE 0.00% 0.00% 0.11% 1.2 3 1025

Creatine kinase (MtCK), sarcomeric mitochondrial J05401 C/OD 0.01% 0.03% 0.18% 1.4 3 1025

Desmin* U59167 CS/M 0.02% 0.09% 0.60% 1.8 3 1025

Ferritin L chain M11147 C/OD 0.04% 0.00% 0.20% 4.3 3 1025

ATP/ADP translocator, heart/skeletal muscle (ANT1) J04982 M 0.03% 0.00% 0.16% 9.1 3 1025

Troponin T, cardiac isoform L40162 CS/M 0.25% 0.23% 0.55% 9.5 3 1025

Ubiquitin M26880 G/PE 0.04% 0.04% 0.20% 0.00011Troponin C, slow-twitch skeletal muscle* X07897 CS/M 0.21% 0.03% 0.29% 0.00015

B. Good candidates for differential expressionMetallothionein II V00594 C/OD 0.00% 0.00% 0.16% 1.25 3 1027

Decorin L01131 CS/M 0.05% 0.00% 0.27% 5.78 3 1027

Ribosomal protein S11* X06617 G/PE 0.14% 0.00% 0.22% 2.14 3 1026

HHCPA78, brain-expressed homologue S73591 U 0.01% 0.01% 0.16% 2.77 3 1023

Heat shock protein 70B X51758 C/OD 0.00% 0.00% 0.09% 3.07 3 1025

Calcyclin J02763 CS/C 0.00% 0.00% 0.09% 0.00010Glutathione peroxidase, plasma X58295 C/OD 0.00% 0.01% 0.11% 0.00016

C. Weak candidates for differential expressionMetallothionein Ie M10942 C/OD 0.00% 0.00% 0.07% 0.00025Myosin light chain 1, ventricular X07373 CS/M 0.17% 0.12% 0.40% 0.00026Prostaglandin D synthase M61900 M 0.00% 0.00% 0.09% 0.00028Ribosomal protein L39 D79205 G/PE 0.00% 0.00% 0.09% 0.00028Superoxide dismutase (SOD-2) (manganese) X65965 C/OD 0.01% 0.01% 0.11% 0.00030Enoyl-CoA hydratase-like protein, peroxisomal (HPXEL) U16660 M 0.00% 0.01% 0.09% 0.00030Gelsolin, plasma X04412 CS/C 0.00% 0.00% 0.09% 0.00030ATPase, calcium (HK2) M23115 M 0.04% 0.05% 0.13% 0.00031Ferritin heavy chain* M97164 C/OD 0.09% 0.01% 0.18% 0.00033P21 mouse homologue* X64899 CD 0.19% 0.06% 0.33% 0.00040Cytochrome c oxidase subunit VIIc* X16560 M 0.10% 0.00% 0.13% 0.00061CLP (LIM domain protein)* U20324 G/PE 0.14% 0.03% 0.18% 0.00061Ribosomal protein S8* X67247 G/PE 0.13% 0.03% 0.16% 0.00066Cell surface protein TAPA-1, 26 kDa M33680 U 0.01% 0.01% 0.11% 0.00069Ribosomal RNA, 28S M11167 G/PE 0.19% 0.30% 0.42% 0.00071Ribosomal protein S18* X69150 G/PE 0.15% 0.01% 0.22% 0.00092Cytochrome c, somatic M22877 M 0.03% 0.01% 0.13% 0.00095Prothymosin a M14483 CD 0.05% 0.03% 0.13% 0.00098Ribosomal protein S12 X53505 G/PE 0.05% 0.01% 0.16% 0.0009926S proteasome subunit p31 D38047 G/PE 0.00% 0.00% 0.07% 0.0010Matrix Gla protein X53331 CS/M 0.02% 0.01% 0.11% 0.0012Ribosomal protein L9* U09953 G/PE 0.17% 0.00% 0.16% 0.0012Pyruvate dehydrogenase a-subunit M24848 M 0.02% 0.01% 0.09% 0.0014Microglobulin, b-2* M17987 C/OD 0.06% 0.00% 0.16% 0.0017Prostaglandin D2 synthase M98537 M 0.00% 0.01% 0.07% 0.0023Ribosomal protein L26* X69392 G/PE 0.15% 0.00% 0.09% 0.0024Ribosomal protein L21* U14967 G/PE 0.12% 0.00% 0.13% 0.0026DS-1 X81788 U 0.00% 0.00% 0.04% 0.0028Long-chain acyl-CoA synthetase D10040 M 0.00% 0.00% 0.04% 0.0028Heterogeneous nuclear ribonucleoprotein E1 X78137 G/PE 0.01% 0.00% 0.09% 0.0032Glycogenin U31525 M 0.02% 0.01% 0.09% 0.0033RanBP2 (Ran-binding protein 2) D42063 CS/C 0.01% 0.00% 0.07% 0.0037Ribosomal protein L41* S64030 G/PE 0.05% 0.00% 0.13% 0.0044
Ribosomal protein L27a* U14968 G/PE 0.12% 0.00% 0.13% 0.0044

TABLE 5—Continued


Phospholamban* M63603 CS/C 0.13% 0.01% 0.11% 0.0047D. Other genes expressed in two or more hypertrophic heart

cDNA librariesTropomyosin, b skeletal X06825 CS/M 0.01% 0.03% 0.09% 0.005361-8U gene from interferon-inducible gene family X57352 U 0.02% 0.00% 0.09% 0.00544High endothelial venule protein X82157 CS/M 0.02% 0.00% 0.09% 0.00544PTB-associated splicing factor X70944 G/PE 0.02% 0.00% 0.07% 0.00553a4 protein Y08915 U 0.00% 0.00% 0.04% 0.0059COX17 L77701 M 0.00% 0.00% 0.04% 0.0059Dynein light chain A X79088 CS/M 0.00% 0.00% 0.04% 0.0059Lipid-binding protein, adipocyte J02874 M 0.00% 0.00% 0.04% 0.0059MHC class II HLA-DR-a M60334 C/OD 0.00% 0.00% 0.04% 0.0059Protein kinase inhibitor p58 U28424 CS/C 0.00% 0.00% 0.04% 0.0059TGF-b-type II receptor M85079 CS/C 0.00% 0.00% 0.04% 0.0059Tyrosine phosphatase PYST1 X93920 CS/C 0.00% 0.00% 0.04% 0.0059Eotaxin D49372 CS/C 0.00% 0.00% 0.04% 0.00601Hypothetical protein (KIAA0062) D31887 U 0.00% 0.00% 0.04% 0.00601Hypothetical protein (KIAA0217) D86971 U 0.00% 0.00% 0.04% 0.00601Milk fat globule protein S56151 U 0.00% 0.00% 0.04% 0.00601S100 calcium-binding protein A13 X99920 CS/C 0.00% 0.00% 0.04% 0.00601Ribosomal protein S20* L06498 G/PE 0.12% 0.01% 0.09% 0.00611Thrombin inhibitor Z22658 G/PE 0.00% 0.00% 0.04% 0.00618Thrombospondin 4 Z19585 CS/C 0.00% 0.00% 0.04% 0.00618Nucleophosmin B23* X16934 G/PE 0.07% 0.00% 0.07% 0.00669Thymosin b-4* M17733 CS/C 0.07% 0.00% 0.07% 0.00681Ubiquinol-cytochrome C reductase subunit VI requiring protein P27635 M 0.29% 0.10% 0.16% 0.0075Ribosomal protein S5* U14970 G/PE 0.08% 0.00% 0.09% 0.00782Ribosomal protein S6* M20020 G/PE 0.20% 0.04% 0.18% 0.00793Enolase, b muscle specific X16504 M 0.05% 0.01% 0.09% 0.0088Skeletal muscle 165-kDa protein X69089 CS/M 0.02% 0.04% 0.09% 0.00891Tissue inhibitor of metalloproteinases-3 U14394 G/PE 0.02% 0.03% 0.09% 0.00942Ribosomal protein S3a* M77234 G/PE 0.23% 0.03% 0.16% 0.00982Aldose reductase J04795 M 0.01% 0.00% 0.04% 0.01069Coatomer protein (hepcop) U24105 C/OD 0.01% 0.00% 0.04% 0.01069Gem GTPase (gem) U10550 M 0.01% 0.00% 0.04% 0.01069NADH dehydrogenase subunit ND2, mitochondrial S73804 M 0.01% 0.00% 0.04% 0.01069Protein kinase C inhibitor-I U27143 CS/C 0.01% 0.00% 0.04% 0.01069Syntrophin, a 1 S81737 CS/M 0.01% 0.04% 0.07% 0.01081Transglutaminase M98479 G/PE 0.03% 0.08% 0.11% 0.01126Anion exchanger 3 brain isoform U05596 M 0.00% 0.04% 0.07% 0.01138Actin, b X63432 CS/M 0.07% 0.09% 0.16% 0.01151Lipocortin II* M14043 CS/C 0.06% 0.00% 0.07% 0.01252Ribosomal protein S15a* X84407 G/PE 0.07% 0.00% 0.07% 0.01252Ribosomal protein L12* L06505 G/PE 0.11% 0.00% 0.07% 0.01252Ribosomal protein S24* M31520 G/PE 0.17% 0.00% 0.07% 0.01252Acidic ribosomal phosphoprotein P2 M17887 G/PE 0.04% 0.01% 0.09% 0.01259CCAAT-box binding factor (cbf) M37197 G/PE 0.00% 0.00% 0.04% 0.01273Eukaryotic/translation initiation factor-2 (eif-2) a-subunit J02645 G/PE 0.00% 0.00% 0.04% 0.01273HSP75, mitochondrial L15189 C/OD 0.00% 0.00% 0.04% 0.01273Hypothetical protein (GS3955) D87119 CS/C 0.00% 0.00% 0.04% 0.01273Nonintegrin laminin-binding protein M36682 CS/C 0.00% 0.00% 0.04% 0.01273Tissue inhibitor of metalloproteinases (TIMP) X03124 G/PE 0.00% 0.00% 0.04% 0.01273Cytochrome c oxidase subunit VIII J04823 M 0.00% 0.00% 0.04% 0.01296Ubiquinol cytochrome c reductase core I protein L16842 M 0.00% 0.00% 0.04% 0.01296Heat shock cognate protein hsc70, 71 kDa Y00371 C/OD 0.12% 0.08% 0.20% 0.01382Fatty acid-binding protein, heart S67314 M 0.01% 0.01% 0.07% 0.01456Integrin b-1D subunit cytoplasmic domain* U28252 CS/C 0.08% 0.01% 0.07% 0.01462Ribosomal protein S16* M60854 G/PE 0.10% 0.00% 0.09% 0.01568Cerebroside sulfate activator protein M60257 M 0.01% 0.04% 0.07% 0.01614Protein kinase C-binding protein Enigma U48247 C/OD 0.01% 0.01% 0.04% 0.01626Ribosomal protein S28 U58682 G/PE 0.01% 0.00% 0.04% 0.01626U1 small nuclear RNP-specific C protein X12517 G/PE 0.01% 0.01% 0.04% 0.01626Creatine kinase M M14780 C/OD 0.04% 0.10% 0.13% 0.01627Ryanodine receptor 2 X98330 CS/C 0.03% 0.05% 0.07% 0.01818Ras-related GTP-binding protein rad U46165 CS/C 0.00% 0.01% 0.04% 0.0217NADH-ubiquinone oxidoreductase CI-AGGG X63216 M 0.02% 0.00% 0.07% 0.02184Ubiquitin U49869 G/PE 0.07% 0.04% 0.13% 0.02209
Gravin M96322 U 0.01% 0.00% 0.04% 0.02209

TABLE 5—Continued


ZAKI-4 D83407 U 0.01% 0.00% 0.04% 0.02209ATP-synthase subunit 9, mitochondrial U09813 M 0.04% 0.03% 0.09% 0.02213Hypothetical protein (KIAA0262) D87451 U 0.00% 0.04% 0.04% 0.0228Laminin-binding protein J03799 CS/M 0.08% 0.04% 0.11% 0.02293Cytokine inducible nuclear protein X83703 U 0.04% 0.03% 0.09% 0.02501Cytochrome c oxidase subunit VIIb Z14244 M 0.05% 0.00% 0.07% 0.02554Proteasome subunit HC5 D00761 G/PE 0.03% 0.00% 0.07% 0.02556Glyceraldehyde-3-phosphate dehydrogenase M33197 M 0.37% 0.27% 0.40% 0.02566Ribosomal protein S9* U14971 G/PE 0.06% 0.00% 0.04% 0.02592Ribosomal protein S23* D14530 G/PE 0.11% 0.00% 0.04% 0.02592Ribosomal protein S27* U57847 G/PE 0.05% 0.00% 0.07% 0.02649Ribosomal protein L5* U14966 G/PE 0.10% 0.03% 0.09% 0.02727Electron transfer flavoprotein a-subunit J04058 M 0.02% 0.00% 0.04% 0.03022Actin depolymerizing factor S65738 CS/M 0.03% 0.00% 0.07% 0.03228ATP-synthase subunit c (P1 form) D13118 M 0.01% 0.00% 0.04% 0.03253Endothelial differentiation protein (edg-1) M31210 CS/C 0.01% 0.00% 0.04% 0.03253U22 snoRNA host gene (UHG) U40580 G/PE 0.01% 0.00% 0.04% 0.03253Cathepsin B L22569 G/PE 0.01% 0.00% 0.04% 0.03309Cytochrome C oxidase subunit Va M22760 M 0.01% 0.00% 0.04% 0.03309Eukaryotic/translation initiation factor-3 (eIF-3) p110 subunit U46025 G/PE 0.01% 0.01% 0.04% 0.03309Myosin heavy chain, a cardiac Z20656 CS/M 0.04% 0.09% 0.09% 0.03488Lectin, 14 kDa (galectin-1) J04456 CS/C 0.03% 0.01% 0.07% 0.03604Cytochrome c oxidase subunit IV X54802 M 0.05% 0.01% 0.09% 0.03613Ribosomal protein L30 X79238 G/PE 0.03% 0.00% 0.07% 0.03662Eukaryotic/translation initiation factor-5 (eIF5) U49436 G/PE 0.02% 0.00% 0.04% 0.03844Ornithine decarboxylase antizyme (Oaz) U09202 M 0.03% 0.01% 0.07% 0.03977Myosin heavy chain, b* M58018 CS/M 0.20% 1.22% 1.09% 0.04034Acidic ribosomal phosphoprotein P1* M17886 G/PE 0.13% 0.03% 0.09% 0.04453Proteasome inhibitor hPI31 subunit D88378 G/PE 0.01% 0.03% 0.04% 0.04494Ribosomal protein L13a P40429 G/PE 0.12% 0.03% 0.09% 0.04516Rapamycin-binding protein M96256 G/PE 0.01% 0.01% 0.04% 0.04572Small nuclear ribonucleoprotein particle N (SNRPN) U41303 G/PE 0.01% 0.01% 0.04% 0.04572ATPase coupling factor 6 subunit, mitochondrial (ATP5A) M37104 M 0.03% 0.00% 0.04% 0.0474Titin X90569 CS/M 0.34% 0.28% 0.29% 0.04773Acidic ribosomal phosphoprotein P0* M17885 G/PE 0.39% 0.09% 0.13% 0.05139tra1 human homologue of murine tumor rejection antigen

gp96*X15187 U 0.06% 0.00% 0.04% 0.05164

Ribosomal protein S21* L04483 G/PE 0.06% 0.00% 0.04% 0.05164Ribosomal protein L7* L16558 G/PE 0.31% 0.05% 0.11% 0.05244Ribosomal protein S25* M64716 G/PE 0.16% 0.01% 0.07% 0.05256Catenin, a D13866 CS/C 0.03% 0.01% 0.04% 0.05701Ribosomal protein S4 (RPS4X) M58458 G/PE 0.14% 0.12% 0.18% 0.057733-oxoacyl-CoA thiolase, mitochondrial D16294 M 0.02% 0.00% 0.04% 0.05872Hypothetical protein (KIAA0058) D31767 U 0.02% 0.00% 0.04% 0.05872Protein involved in DNA double-strand break repair X98294 C/OD 0.02% 0.00% 0.04% 0.05971Selenoprotein P Z11793 M 0.02% 0.00% 0.04% 0.05971Anion channel, voltage-dependent isoform 2 (VDAC) L06328 CS/C 0.03% 0.00% 0.04% 0.06721Ribosomal RNA, 18S X03205 G/PE 0.20% 0.10% 0.18% 0.07119Chaperonin containing tcp-1 d-subunit Z31554 G/PE 0.02% 0.00% 0.04% 0.07364Macroglobulin, a-2 M36501 C/OD 0.01% 0.03% 0.04% 0.07364Ribosomal protein L18a X14181 G/PE 0.02% 0.01% 0.04% 0.07364Ribosomal protein L28 U14969 G/PE 0.02% 0.00% 0.04% 0.07364Cytochrome bc-1 complex core protein II J04973 M 0.05% 0.04% 0.07% 0.07371Inosine-59-monophosphate dehydrogenase J04208 M 0.02% 0.01% 0.04% 0.07487Ubiquitin-like protein D23662 G/PE 0.02% 0.00% 0.04% 0.07487Ribosomal protein L13 P26373 G/PE 0.04% 0.03% 0.07% 0.0768114-3-3 protein, e isoform U20972 CS/C 0.03% 0.01% 0.04% 0.07794Lumican U21128 CS/M 0.04% 0.00% 0.04% 0.07794Myosin alkali light chain, nonmuscle/smooth muscle M22919 CS/M 0.10% 0.05% 0.13% 0.08027Ribosomal protein L37a* L06499 G/PE 0.15% 0.03% 0.04% 0.08766Centractin, a X82206 CS/M 0.01% 0.04% 0.04% 0.08953Guanine nucleotide-binding protein Diff6, H5, CDC10

homologueD28540 CS/C 0.03% 0.00% 0.04% 0.08953

Elongation factor 1-a* X16869 G/PE 1.60% 0.37% 0.44% 0.09036Fau X65923 U 0.03% 0.00% 0.04% 0.091Ubiquitin* X63237 G/PE 0.08% 0.01% 0.04% 0.10032Ribosomal protein L18 L11566 G/PE 0.04% 0.04% 0.07% 0.10034
Ribosomal protein S10* U14972 G/PE 0.08% 0.01% 0.04% 0.10195

ca0ao

u


between fetal, adult normal, or adult hypertrophichearts.

Three of five good candidates for differential expres-sion (decorin, glutathione peroxidase, and heat shock

TABLE 5

Gene

Heat shock protein, 90-kDa aPhosphoglycerate mutase (PGAM-B)Sterol regulatory element-binding protein (cnbp)VinculinCalsequestrinRibosomal protein L19Ribosomal protein L10Elongation factor 2VimentinConnexin 43Elongation factor 1-g*Actinin, a2 skeletal muscleProtein kinase, cAMP-dependent type I-a subunitRibosomal protein L4*Heat shock protein 28 kDa78-kDa glucose-regulated proteinHypothetical protein (KIAA0026)Laminin B1Transcription factor BTF 3Malate dehydrogenase, cytosolicCollagen a-2 type IRibosomal protein S19ATP-synthase (F1-ATPase) a-subunit, mitochondrialRibosomal protein L23aProlyl 4-hydroxylase b-subunit and disulfide isomerase*Ribosomal protein S3ATP-synthetase b-subunitSPARC/osteonectinActin, a-cardiac*Ribosomal protein L29Heat shock protein, 90-kDa bMyosin binding protein-C, cardiac*FibronectinSkeletal muscle 190-kDa protein*Aldolase A*Ribosomal protein L3Tubulin, a

Note. Genes represented by ESTs in at least two of three hypertralculated as described in the text. Percentages indicate relative exps per Table 4. Shading intensities reflect gene frequency and are d.0002 and at least one EST in each of three hypertrophic heart cDNnd at least one EST in two of three hypertrophic heart cDNA librariene EST in two of three hypertrophic heart cDNA libraries. D. Othe

Intensity

.000,0

* Genes for which adult heart gene frequencies differed significantsing adult heart EST data alone as the reference value.

protein 70B) exhibited significant increases of expres-

sion in hypertrophic compared to normal hearts byRT-PCR (P , 0.05; Fig. 2A), while four of seven weakercandidates (connexin 43, long chain acyl-CoA synthetase,prostaglandin D synthetase, and prostaglandin D2 syn-

ontinued

cession No. Function Fetal AdultHyper-trophic P

X15183 C/OD 0.12% 0.15% 0.16% 0.10293J04173 M 0.02% 0.04% 0.04% 0.1062M28372 G/PE 0.02% 0.03% 0.04% 0.1062M33308 CS/M 0.03% 0.00% 0.04% 0.10793X55040 M 0.06% 0.01% 0.07% 0.11078X63527 G/PE 0.07% 0.04% 0.07% 0.1141L25899 G/PE 0.10% 0.04% 0.11% 0.12039M19997 G/PE 0.01% 0.06% 0.04% 0.1255M25246 CS/M 0.18% 0.09% 0.18% 0.1426M65188 CS/C 0.04% 0.00% 0.04% 0.14358Z11531 G/PE 0.22% 0.08% 0.07% 0.15195M86406 CS/M 0.09% 0.12% 0.09% 0.15935M33336 CS/C 0.03% 0.03% 0.04% 0.15957L20868 G/PE 0.22% 0.09% 0.11% 0.17095Z23090 C/OD 0.11% 0.05% 0.11% 0.17556M19645 U 0.03% 0.04% 0.04% 0.17807D14812 U 0.05% 0.00% 0.04% 0.19677M61916 CS/M 0.05% 0.00% 0.04% 0.19677X74070 G/PE 0.05% 0.00% 0.04% 0.19974D55654 M 0.13% 0.05% 0.09% 0.20031J03464 CS/M 0.08% 0.14% 0.09% 0.23872M81757 G/PE 0.09% 0.03% 0.07% 0.24562X59066 M 0.08% 0.04% 0.07% 0.25026U43701 G/PE 0.09% 0.03% 0.04% 0.2717M22806 G/PE 0.00% 0.05% 0.04% 0.28154S42658 G/PE 0.05% 0.05% 0.04% 0.29054X05606 M 0.06% 0.03% 0.04% 0.29461J03040 CS/M 0.08% 0.06% 0.07% 0.29589J00071 CS/M 0.07% 0.44% 0.24% 0.31247U10248 G/PE 0.07% 0.06% 0.04% 0.41929M16660 C/OD 0.08% 0.08% 0.04% 0.45204X84075 CS/M 0.06% 0.14% 0.07% 0.53133K00799 CS/M 0.11% 0.05% 0.04% 0.54901X69090 CS/M 0.02% 0.18% 0.04% 0.5692M21190 M 0.04% 0.22% 0.07% 0.74281M90054 G/PE 0.26% 0.15% 0.04% 0.89068K00557 CS/M 0.27% 0.17% 0.04% 0.89966

ic heart cDNA libraries were identified. Poisson probabilities wereion frequency of genes in pooled libraries. Functional categories areed as follows: A. Strong candidates for differential expression: P ,

libraries. B. Good candidates for differential expression: P , 0.0002. Weak candidates for differential expression: P , 0.005 and at least

enes expressed in two or more hypertrophic heart cDNA libraries.

requency

%–2.49%–0.49%–0.19%5%

rom fetal heart frequencies and for which P values were determined

—C

Ac

ophressefinAs. Cr g

F

2.5.50.20.050.0

ly f

thetase) exhibited significant changes (Fig. 2B).

e

kecsh(uoficc(g11mh

eelt

10 HWANG ET AL.

DISCUSSION

Steady progress in the Human Genome Project has ledto rapid growth in the amount of gene sequence andexpression information available in the public domain.The past 5 years have seen the deposition of over1,700,000 partial human cDNA sequences, or ESTs, intodbEST, approximately 100,000 of which represent se-quences from cardiovascular tissues (C. C. Liew, 2000).While the generation of new EST data from differenttissue and cell types continues to gain momentum, strat-egies for exploiting their vast potential for exploringquestions of basic biology and applied medical researchhave not been as forthcoming.

In this report, we extended a novel approach re-ported by our group previously (Hwang et al., 1997) tocharacterizing gene expression in cardiac hypertrophybased on this wealth of EST data. This approach cou-pled the general comparison of gene transcription pat-terns between hypertrophic and nonhypertrophic myo-cardium (Table 4) to more detailed comparativeanalysis of the expression of 232 candidate knowngenes (Table 5), the former analyzing global trends ingene expression and placing differences in a largerperspective and the latter identifying genes of poten-tial interest. This proved to be a good method of pre-dicting differentially expressed genes of high or inter-mediate frequency (approximately 1 in 1500transcripts; compared to 1 in 800 in Hwang et al.(1997)), as demonstrated by comparison of computer-based predictions (Table 5) to actual mRNA levels ofstrong, good, and weak candidates for differential ex-pression by RT-PCR (Figs. 1 and 2). As expected, thelarger number of ESTs available for the present anal-yses allowed for greater sensitivity than previouslypossible, as evidenced by the identification of moregenes potentially upregulated in hypertrophy (64

FIG. 1. RT-PCR of selected genes strongly predicted to be over-xpressed in failing heart. Ten genes strongly predicted to be over-xpressed in failing heart by comparison of EST profiles were se-ected at random and subjected to RT-PCR to assess generanscription in fetal (F), adult (A), and hypertrophic (H) hearts.

Shown are representative results for each gene. BNP, brain natri-uretic peptide; LPL, lipoprotein lipase; MyRLC, myosin regulatorylight chain; PAI1, plasminogen activator inhibitor-1; GAPD, glycer-aldehyde-3-phosphate dehydrogenase.

genes compared to 48 genes in Hwang et al. (1997)),

despite more stringent criteria for identification ofsuch genes (P , 0.005, compared to P , 0.05 in Hwangt al. (1997)).General functional categorization of ESTs with

nown gene matches (Table 4) revealed several differ-nces between hypertrophic and nonhypertrophic myo-ardia. Perhaps most striking was the increase of tran-cripts related to cell/organism defense in hypertrophicearts compared with normal fetal and adult heartsTable 4), likely reflective of an organ responding tonusual stresses. This finding was corroborated by thebservation that over one-third of the 29 genes identi-ed by detailed analysis to be either strong or goodandidates for differential expression in hypertrophyould be classified in this category. Of these, ANPButtrick et al., 1994; Poulos et al., 1996), BNP (Naka-awa et al., 1995), heat shock protein 70 (Izumo et al.,988), and superoxide dismutase (Gupta and Singal.,989; Kirshenbaum et al., 1995) were previously docu-ented as being differentially expressed in cardiac

ypertrophy. Further, while a-B-crystallin, a memberof the Hsp27 family, was not known to be differentiallyexpressed in cardiac hypertrophy, it is known to berapidly induced in skeletal muscle subjected to oxida-tive stress imposed by continuous contractile activity(Neufer and Benjamin, 1996). RT-PCR analysis sup-ported increased transcription of a-B-crystallin in thehypertrophic heart (Fig. 1). This may be of some inter-est, as the Hsp27 locus was found to cosegregate withleft ventricular mass independent of blood pressure ina rat model of hypertension (Hamet et al., 1996).

Although not much change was seen in non-mito-chondria-encoded metabolic transcripts (Table 4B) be-tween the hypertrophic hearts relative to the normaladult hearts, numerous individual gene transcripts in-volved in energy metabolism were observed to be up-regulated. Part of this may be a result of a proportion

FIG. 2. RT-PCR of selected genes predicted to be overexpressedin failing heart. (A) Good candidates for overexpression. (B) Weak orpoor candidates for overexpression. LCACS, long-chain acyl-CoAsynthetase; PGD, prostaglandin D synthetase; PTGDS, prostaglan-din D2 synthetase; MYL3, myosin light chain 1, ventricular; P-
gelsolin, plasma gelsolin; PDHA1, pyruvate dehydrogenase.


of these genes being categorized under cell/organismdefense instead of metabolism. Regardless, examina-tion of the individual gene transcripts reveals somespecific changes in energy metabolism as exemplifiedby the increased transcription of the myoglobin, crea-tine kinase, ATP/ADP translocator, cytochrome C (so-matic), and cytochrome C oxidase subunit VIIc genes(Table 5). Further, mitochondria-encoded transcriptsas a class were found at much higher levels in hyper-trophic hearts than in normal adult or fetal hearts.These observations are perhaps reflective of mitochon-drial biogenesis thought to occur in hypertrophy andsuggest an increased need for energy metabolism andATP generation by the hypertrophic myocardium.

General categorization of known genes by functionalso found a marginal increase in the proportion oftranscripts involved in gene and protein expression inhypertrophic hearts, compared to normal adult hearts(Table 4B). Single-gene analysis suggested that thisincrease was due primarily to an increase in expressionof ribosomal proteins and other genes involved in pro-tein synthesis, at least 10 of which were identified aspotential candidates for differential expression (Tables5A–5C). This is consistent with the generalized needfor increased protein synthesis and ribosome biogene-sis known to occur in cardiac hypertrophy (Hannan etal., 1996).

Overall, the combined EST-based approach to char-acterizing gene expression yields results largely com-patible with current understanding of cardiac hyper-trophy. However, novel findings generated by thisapproach should also open new avenues of investiga-tion. For example, the identification and confirmationof CD59 antigen, a complement-inhibitory cell surfaceantigen, and of plasminogen activator inhibitor-1(PAI1) as being differentially expressed in hypertro-phic myocardium raise the question of whether localelaboration of hematologic factors may play a role inthe progression to heart failure. Consistent with thesefindings, several reports suggest that cardiac PAI1 ex-pression is increased in right and left ventricular hy-pertrophy and failure (Bansal et al., 1997; Bloor et al.,1997). Furthermore, while activation of the comple-ment cascade is not known to be involved in the patho-genesis of heart failure, Yasojima et al. (1998) de-scribed marked local upregulation of complementcomponents in ischemia and reperfusion of the myocar-dium.

Another example is in the finding that prostaglandinD synthases exhibit elevated expression in hypertro-phic heart (Table 5C; Fig. 2). While prostaglandin D2(PGD2) was previously demonstrated to have positiveinotropic effects on rodent hearts (Hattori and Levy,1986; Uemura et al., 1984), it was also found to inducecoronary vasoconstriction in a dose-dependent manner(Hattori and Levy, 1986). Interestingly, Nagoshi et al.(1998) demonstrated that PGD2 inhibits inducible ni-
tric oxide synthase expression in vascular smooth mus-
cle cells, and they suggested that PGD2 regulates ni-tric oxide metabolism in vascular lesions. Furtherinvestigation should clarify the role of prostaglandinssuch as PGD2 and perhaps suggest novel therapeuticstrategies.

Taken together, the findings presented in this reportsuggest that comparison of EST profiles is a goodmethod to enrich for genes potentially involved in dis-ease processes, even with relatively small data sets—the present set averaging 1500 ESTs generated de novofrom each of three hypertrophic heart cDNA libraries.The sensitivity of this screen, however, was limited torelatively large differences in expression of genes ofintermediate frequency (approximately 1/1500 tran-scripts) due to the sample size and the stringency ofcriteria used for identifying potentially overexpressedgenes (i.e., expression in at least two libraries, withP , 0.005). Further increases in sensitivity to studyrare transcripts (1/10,000 or less) or to identify subtlechanges in expression will require larger numbers ofgene tags in both the reference (e.g., normal heart) andthe experimental (e.g., hypertrophic heart) data sets.Emergence of new technologies such as SAGE (serialanalysis of gene expression) (Velculescu et al., 1995),which allows for a 30-fold increase in throughput,should greatly facilitate data collection for such anal-yses.

Although this current study focused on genes in-volved in myocardial hypertrophy, the general ap-proach is easily extended to study virtually any devel-opmental or disease process of interest. Furthermore,while this report primarily examined ESTs withknown gene matches for overexpression in cardiac hy-pertrophy, the approach may be extended to detectunderexpressed genes and to screen the 35,000 ESTswithout known gene matches (Table 3). Integration ofnew strategies for extracting information from thegrowing base of EST resources with more conventionalmethods should facilitate research and provide awealth of new perspectives from which to explore ques-tions of cardiovascular biology.

ACKNOWLEDGMENTS

Many thanks are due to the members of The Cardiac Gene Unitand to our collaborators at the Chinese University of Hong Kong,without whose assistance this work could not have been accom-plished. Special thanks are extended to Eva Cukerman for her tech-nical assistance. This work was supported by The Canadian GenomeAnalysis and Technology Program, The Medical Research Council ofCanada, The Heart and Stroke Foundation of Ontario, SpectralDiagnostics, Inc., and the Hong Kong Research Grants Council.David Hwang is recipient of a Medical Research Council of CanadaStudentship and a Hunt Estate MD/PhD Scholarship. Adam Demp-sey is recipient of a Heart and Stroke Foundation of Canada Stu-dentship.

REFERENCES

Adams, M. D., Dubnick, M., Kerlavage, A. R., Moreno, R., Kelley,
K. T., Utterback, T. R., Nagle, J. W., Fields, C., and Venter, J. C.

12 HWANG ET AL.

(1992). Sequence identification of 2,375 human brain genes. Na-ture 355: 632–634.

Adams, M. D., Kelley, J. M., Gocayne, J. D., Dubnick, M., Polymero-poulos, M. H., Xiao, H., Merril, C. R., Wu, A., Olde, B., Moreno,R. F., Kerlavage, A. R., McCombie, W. R., and Venter, J. C. (1991).Complementary DNA sequencing: Expressed sequence tags andthe Human Genome Project. Science 252: 1651–1656.

Adams, M. D., Kerlavage, A. R., Fields, C., and Venter, J. C. (1993a).3,400 new expressed sequence tags identify a diversity of tran-scripts in human brain. Nat. Genet. 4: 256–267.

Adams, M. D., Kerlavage, A. R., Fleischmann, R. D., Fuldner,R. A., Bult, C. J., Lee, N. H., Kirkness, E. F., Weinstock, K. G.,Gocayne, J. D., White, O., Sutton, G., Blake, J. A., Brandon,R. C., Chiu, M. W., Clayton, R. A., Cline, R. T., Cotton, M. D.,Earle-Hughes, J., Fine, L. D., FitzGerald, L. M., FitzHugh,W. M., Fritchman, J. L., Geoghagen, N. S. M., Glodek, A.,Gnehm, C. L., Hanna, M. C., Hedblom, E., Hinkle, P. S., Jr.,Kelley, J. M., Kilmek, K. M., Kelley, J. C., Liu, L. I., Marmaros,S. M., Merrick, J. M., Moreno-Palanques, R. F., McDonald, L. A.,Nguyen, D. T., Pellegrino, S. M., Phillips, C. A., Ryder, S. E.,Scott, J. L., Saudek, D. M., Shirley, R., Small, K. V., Spriggs,T. A., Utterback, T. R., Weidman, J. F., Li, Y., Barthlow, R.,Bednarik, D. P., Cao, L., Cepeda, M. A., Coleman, T. A., Collins,E. J., Dimke, D., Feng, P., Ferrie, A., Fischer, C., Hastings,G. A., He, W. W., Hu, J. S., Huddleston, K. A., Greene, J. M.,Gruber, J., Hudson, P., Kim, A., Kozak, D. L., Kunsch, C., Ji, H.,Li, H., Meissner, P. S., Olsen, H., Raymond, L., Wei, Y. F., Wing,J., Xu, C., Yu, G. L., Ruben, S. M., Dillon, P. J., Fannon, M. R.,Rosen, C. A., Haseltine, W. A., Fields, C., Fraser, C. M., andVenter, J. C. (1995). Initial assessment of human gene diversityand expression patterns based upon 83 million nucleotides ofcDNA sequence. Nature 377(Suppl.): 3–174.

Adams, M. D., Soares, M. B., Kerlavage, A. R., Fields, C., and Venter,J. C. (1993b). Rapid cDNA sequencing (expressed sequence tags)from a directionally cloned human infant brain cDNA library. Nat.Genet. 4: 373–380.

Affara, N. A., Bentley, E., Davey, P., Pelmear, A., and Jones, M. H.(1994). The Identification of novel gene sequences of the humanadult testis. Genomics 22: 205–210.

Agarwal, N., Swaroop, A., Zheng, K., Liou, J. D., O’Rourke, K.,Graves, K. A., Gieser, L., Del Monte, M., and Yang-Feng, T. L.(1995). Expression and chromosomal localization of cDNA clonesfrom an enriched human retinal pigment epithelium (RPE) cellline library: Identification of two RPE-specific genes. Cytogenet.Cell Genet. 69: 71–74.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J.(1990). Basic local alignment search tool. J. Mol. Biol. 215: 403–410.

Bansal, D. D., Klein, R. M., Hausmann, E. H., and MacGregor, R. R.(1997). Secretion of cardiac plasminogen activator during hypoxia-induced right ventricular hypertrophy. J. Mol. Cell. Cardiol. 29:3105–3114.

Becker, K. G., Mattson, D. H., Powers, J. M., Gado, A. M., andBiddison, W. E. (1997). Analysis of a sequenced cDNA library frommultiple sclerosis lesions. J. Neuroimmunol. 77: 27–38.

Bernstein, S. L., Borst, D. E., Neuder, M. E., and Wong, P. (1996).Characterization of a human fovea cDNA library and regionaldifferential gene expression in the human retina. Genomics 32:301–301.

Bloor, C. M., Nimmo, L., McKirnan, M. D., Zhang, Y., and White,F. C. (1997). Increased gene expression of plasminogen activatorsand inhibitors in left ventricular hypertrophy. Mol. Cell. Biochem.176: 265–271.

Boguski, M. (1993). dbEST: A database of expressed sequence tags.Nat. Genet. 4: 332–333.

Buttrick, P. M., Kaplan, M., Leinwand, L. A., and Scheuer, J.
(1994). Alterations in gene expression in the rat heart after
chronic pathological and physiological loads. J. Mol. Cell. Car-diol. 26: 61– 67.

Chien, K. R., Shimizu, M., Hoshijima, M., Minamisawa, S., andGrace, A. A. (1997). Toward molecular strategies for heart dis-ease—Past, present, future. Jpn. Circ. J. 61: 91–118.

Choi, S. S., Yun, J. W., Choi, E. K., Cho, Y. G., Sung, Y. C., and Shin,H. S. (1995). Construction of a gene expression profile of a humanfetal liver by single-pass cDNA sequencing. Mamm. Genome 6:653–657.

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNAisolation by acid guanidinium thiocyanate–phenol–chloroform ex-traction. Anal. Biochem. 162: 156–159.

Claudio, J. O., Liew, C. C., Dempsey, A. A., Cukerman, E., Stewart,A. K., Na, E., Atkins, H. L., Iscove, N. N., and Hawley, R. G. (1998).Identification of sequence-tagged transcripts differentially ex-pressed within the human hematopoietic hierarchy. Genomics 50:44–52.

Ferrer, J., Wasson, J., Schoor, K. D., Mueckler, M., Donis-Keller, H.,and Permutt, M. A. (1997). Mapping novel pancreatic islet genes tohuman chromosomes. Diabetes 46: 386–392.

Frigerio, J. M., Berthezene, P., Garrido, P., Oritz, E., Barthellemy,S., Vasseur, S., Sastre, B., Slelznieff, I., Dagorn, J. C., and Io-vanna, J. L. (1995). Analysis of 2166 clones from a human colorec-tal cDNA library by partial sequencing. Hum. Mol. Genet. 4: 37–43.

Gieser, L., and Swaroop, A. (1992). Expressed sequence tags andchromosomal localization of cDNA clones from a subtracted retinalpigment epithelium library. Genomics 13: 873–876.

Gish, W., and States, D. J. (1993). Identification of protein codingregions by database similarity search. Nat. Genet. 3: 266–272.

Gress, T. M., Muller-Pillasch, F., Geng, M., Zimmerhackl, F., Zehet-ner, G., Friess, H., Buchler, M., Adler, G., and Lehrach, H. (1996).A pancreatic cancer-specific expression profile. Oncogene 13:1819–1830.

Gubin, A. N., Njoroge, J. M., Bouffard, G. G., and Miller, J. L. (1999).Gene expression in proliferating human erythroid cells. Genomics59: 168–177.

Gupta, M., and Singal, P. K. (1989). Higher antioxidative capacityduring a chronic stable heart hypertrophy. Circ. Res. 64: 398–406.

Hamet, P., Kaiser, M. A., Sun, Y., Page, V., Vincent, M., Kren, V.,Pravenec, M., Kunes, J., Tremblay, J., and Samani, N. J. (1996).HSP27 locus cosegregates with left ventricular mass indepen-dently of blood pressure. Hypertension 28: 1112–1117.

Hannan, R. D., Luyken, J., and Rothblum, L. I. (1996). Regulationof ribosomal DNA transcription during contraction-induced hy-pertrophy of neonatal cardiomyocytes. J. Biol. Chem. 271:3213–3220.

Hattori, Y., and Levy, R. (1986). Effect of PGD2 on cardiac contrac-tility: A negative inotropism secondary to coronary vasoconstric-tion conceals a primary positive inotropic action. J. Pharmacol.Exp. Ther. 237: 719–724.

Hillier, L., Lennon, G., Becker, M., Bonaldo, M. F., Chiapelli, B.,Chissoe, S., Dietrich, N., DuBuque, T., Favello, A., Gish, W.,Hawkins, M., Hultman, M., Kucaba, T., Lacy, M., Le, M., Le, N.,Mardis, E., Moore, B., Morris, M., Parsons, J., Prange, C.,Rifkin, L., Rohlfing, T., Scellenberg, K., Soares, M. B., Tna, F.,Thierry-Meg, J., Trevaskis, E., Underwood, K., Wohldman, P.,Waterston, R., Wilson, R., and Marra, M. (1996). Generationand analysis of 280,000 human expressed sequence tags. Ge-nome Res. 6: 807– 828.

Houlgatte, R., Mariage-Samson, R., Duprat, S., Tessier, A., Ben-tolila, S., Lamy, B., and Auffray, C. (1995). The Genexpress Index:A resource for gene discovery and the genic map of the human
genome. Genome Res. 5: 272–304.

H

H

I

I

I

J

J

K

K

K

N

N

N

O

O

O


Huang, G. M., Ng, W. L., Farkas, J., He, L., Liang, H. A., Gordon, D.,Yu, J., and Hood, L. (1999). Prostate cancer expression profiling bycDNA sequencing analysis. Genomics 59: 178–186.

Hwang, D. M., Dempsey, A. A., Wang, R. X., Rezvani, M., Barrans,J. D., Dai, K. S., Wang, H. Y., Ma, H., Cukerman, E., Liu, Y. Q., Gu,J. R., Zhang, J. H., Tsui, S. K. W., Waye, M. M. Y., Fung, K. P., Lee,C. Y., and Liew, C. C. (1997). A genome-based resource for molec-ular cardiovascular medicine: Towards a compendium of cardio-vascular genes. Circulation 96: 4146–4203.

Hwang, D. M., Fung, Y. W., Wang, R. X., Laurenssen, C. M., Ng,S. H., Lam, W. Y., Tsui, K. W., Fung, K. P., Waye, M., Lee, C. Y.,and Liew, C. C. (1995). Analysis of expressed sequence tags from afetal human heart cDNA library. Genomics 30: 293–298.wang, D. M., Hwang, W. S., and Liew, C. C. (1994). Single passsequencing of a unidirectional human fetal heart cDNA library todiscover novel genes of the cardiovascular system. J. Mol. Cell.Cardiol. 36: 1329–1333.wang, M. Y., Kang, Y. J., Kim, Y. H., Scherer, S. W., Tsui, L. C., andSohn, U. (1999). Generation and chromosome mapping of ex-pressed sequence tags (ESTs) from a human infant thymus. Ge-nome 42: 457–464.

toh, K., Okubo, K., Utiyama, H., Hirano, T., Yoshii, J., and Matsu-bara, K. (1998). Expression profile of active genes in granulocytes.Blood 92: 1432–1441.

toh, K., Okubo, K., Yosii, J., Yokouchi, H., and Matsubara, K.(1994). An expression profile of active genes in human lung. DNARes. 1: 279–287.

zumo, S., Nadal-Ginard, B., and Mahdavi, V. (1988). Protooncogeneinduction and reprogramming of cardiac gene expression producedby pressure overload. Proc. Natl. Acad. Sci. USA 85: 339–343.

ay, P., Diriong, S., Taviaux, S., Roeckel, N., Mattei, M. G., Audit,M., Berge-Lefranc, J. L., Fontes, M., and Berta, P. (1997). Isolationand regional mapping of cDNAs expressed during early humandevelopment. Genomics 39: 104–108.

i, H., Liu, Y. E., Jia, T., Wang, M., Liu, J., Xiao, G., Joseph, B. K.,Rosen, C., and Shi, Y. E. (1997). Identification of a breast cancer-specific gene, BCSG1, by direct differential cDNA sequencing.Cancer Res. 57: 759–764.awamoto, S., Matsumoto, Y., Mizuno, K., Okubo, K., and Matsu-bara, K. (1996). Expression profiles of active genes in human andmouse livers. Gene 174: 151–158.han, A. S., Wilcox, A. S., Polymeropoulos, M. H., Hopkins, J. A.,Stevens, T. J., Robinson, M., Orpana, A. K., and Sikela, J. M.(1992). Single pass sequencing and physical and genetic mappingof human brain cDNAs. Nat. Genet. 2: 180–185.irshenbaum, L. A., Hill, M., and Singal, P. K. (1995). Endoge-nous antioxidants in isolated hypertrophied cardiac myocytesand hypoxia–reoxygenation injury. J. Mol. Cell. Cardiol. 27:263–272.

Kita, H., Okubo, K., and Matsubara, K. (1996). An expressionprofile of active genes in cultured human keratinocytes. DNARes. 3: 1–7.

Konishi, K., Morishima, Y., Ueda, E., Kibe, Y., Nonomura, K., Ya-manishi, K., and Yasuno, H. (1994). Cataloguing of the genes inhuman keratinocytes: Analysis of 607 randomly selected cDNAsequences. Biochem. Biophys. Res. Commun. 202: 976–983.

Krizman, D. B., Chuaqui, R. F., Meltzer, P. S., Trent, J. M., Duray,P. H., Linehan, W. M., Liotta, L. A., and Emmert-Buck, M. R.(1996). Construction of a representative cDNA library from pros-tatic intraepithelial neoplasia. Cancer Res. 56: 5380–5383.

Lamerdin, J. E., Athwal, R. S., Kansara, M. S., Sandhu, A. K.,Patanjali, S. R., Weissman, S. M., and Carrano, A. V. (1995).Chromosomal localization and expressed sequence tag generationof clones from a normalized human adult thymus cDNA library.
Genome Res. 5: 359–367.
Lanfranchi, G., Muraro, T., Caldara, F., Pacchioni, B., Pallavicini, A.,Pandolfo, D., Toppo, S., Trevisan, S., Scarso, S., and Valle, G.(1996). Identification of 4370 expressed sequence tags from a 39-end-specific cDNA library of human skeletal muscle by DNA se-quencing and filter hybridization. Genome Res. 6: 35–42.

Levy, D., Garrison, R. J., Savage, D. D., Kannel, W. B., and Castelli,W. P. (1990). Prognostic implications of echocardiographically de-termined left ventricular mass in the Framingham Heart Study.N. Engl. J. Med. 322: 1561–1566.

Liew, C. C. (1993) A human heart cDNA library—The developmentof an efficient and simple method for automated DNA sequencing.J. Mol. Cell. Cardiol. 25: 891–894.

Liew, C. C., Hwang, D. M., Fung, Y. W., Laurenssen, C., Cukerman,E., Tsui, S., and Lee, C. Y. (1994). A catalogue of genes in thecardiovascular system as identified by expressed sequence tags(ESTs). Proc. Natl. Acad. Sci. USA 91: 10645–10649.

Maeda, K., Okubo, K., Shimomura, I., Mizuno, K., Matsuzawa, Y.,and Matsubara, K. (1997). Analysis of an expression profile ofgenes in the human adipose tissue. Gene 190: 227–235.

Mao, M., Fu, G., Wu, J. S., Zhang, Q. H., Zhou, J., Kan, L. X., Huang,Q. H., He, K. L., Gu, B. W., Han, Z. G., Shen, Y., Gu, J., Yu, Y. P.,Xu, S. H., Wang, Y. X., Chen, S. J., and Chen, Z. (1998). Identifi-cation of genes expressed in human CD34(1) hematopoietic stem/progenitor cells by expressed sequence tags and efficient full-length cDNA cloning. Proc. Natl. Acad. Sci. USA 95: 8175–8180.

Morozov, G., Verlinsky, O., Rechitsky, S., Kukharenko, V., Golts-man, E., Ivakhnenko, V., Gindilis, V., Strom, C., Kuliev, A., andVerlinsky, Y. (1998). Sequence analysis of libraries from individualhuman blastocysts. J. Assist. Reprod. Genet. 15: 338–343.

Murakawa, K., Matsubara, K., Fukushima, A., Yoshii, J., andOkubo, K. (1994). Chromosomal assignment of 39-directed partialcDNA sequences representing novel genes expressed in granulo-cytoid cells. Genomics 23: 379–389.

Nagoshi, H., Uehara, Y., Kanai, F., Maeda, S., Ogura, T., Goto, A.,Toyo-oka, T., Esumi, H., Shimizu, T., and Omata, M. (1998). Pros-taglandin D2 inhibits inducible nitric oxide synthase expression inrat vascular smooth muscle cells. Circ. Res. 82: 204–209.

Nakagawa, O., Ogawa, Y., Itoh, H., Suga, S., Komatsu, Y., Kishi-moto, I., Nishino, K., Yoshimasa, T., and Nakao, K. (1995). Rapidtranscriptional activation and early mRNA turnover of brain na-triuretic peptide in cardiocyte hypertrophy. Evidence for brainnatriuretic peptide as an “emergency” cardiac hormone againstventricular overload. J. Clin. Invest. 96: 1280–1287.elson, P. S., Ng, W. L., Schummer, M., True, L. D., Liu, A. Y.,Bumgarner, R. E., Ferguson, C., Dimak, A., and Hood, L. (1998).An expressed-sequence-tag database of the human prostate: Se-quence analysis of 1168 cDNA clones. Genomics 47: 12–25.eufer, P. D., and Benjamin, I. J. (1996). Differential expression ofB-crystallin and Hsp27 in skeletal muscle during continuous con-tractile activity. Relationship to myogenic regulatory factors.J. Biol. Chem. 271: 24089–24095.ishida, K., Adachi, W., Shimizu-Matsumoto, A., Kinoshita, S., Mi-zuno, K., Matsubara, K., and Okubo, K. (1996). A gene expressionprofile of human corneal epithelium and the isolation of humankeratin 12 cDNA. Invest. Ophthalmol. Vis. Sci. 37: 1800–1809.kubo, K., Hori, N., Matoba, R., Niiyama, T., Fukushima, A.,Kojima, Y., and Matsubara, K. (1992). Large scale cDNA sequenc-ing for analysis of quantitative and qualitative aspects of geneexpression. Nat. Genet. 2: 173–179.kubo, K., Itoh, K., Fukushima, A., Yoshii, J., and Matsubara, K.(1995). Monitoring cell physiology by expression profiles and dis-covering cell type-specific genes by compiled expression profiles.Genomics 30: 178–186.kubo, K., Yoshii, J., Yokouchi, H., Kameyama, M., and Matsubara,K. (1994). An expression profile of active genes in human colonic
mucosa. DNA Res. 1: 37–45.

PT

U

V

V

W

Y

Y

Y

Y

14 HWANG ET AL.

Pallavicini, A., Zimbello, R., Tiso, N., Muraro, T., Rampoldi, L.,Bortoluzzi, S., Valle, G., Lanfranchi, G., and Danieli, G. A. (1997).The preliminary transcript map of a human skeletal muscle. Hum.Mol. Genet. 6: 1445–1450.

ashmforoush, M., and Chien, K. R. (1997). Tangled up in blue:Molecular cardiology in the postmolecular era. Circulation 96:4126–4130.

Pawlak, A., Toussaint, C., Levy, I., Bulle, F., Poyard, M., Barouki, R.,and Guellaen, G. (1995). Characterization of a large population ofmRNAs from human testis. Genomics 26: 151–158.

Poulos, J. E., Gower, W. R., Jr., Sullebarger, J. T., Fontanet, H. L.,and Vesely, D. L. (1996). Congestive heart failure: Increased car-diac and extracardiac atrial natriuretic peptide gene expression.Cardiovasc. Res. 32: 909–919.

Sadoshima, J., and Izumo, S. (1997). The cellular and molecularresponse of cardiac myocytes to mechanical stress. Annu. Rev.Physiol. 59: 551–571.

Schraml, P., Shipman, R., Colombi, M., and Ludwig, C. U. (1994).Identification of genes differentially expressed in normal lung andnon-small cell lung carcinoma tissue. Cancer Res. 54: 5236–5240.

Schwartz, K., and Mercadier, J. J. (1996). Molecular and cellularbiology of heart failure. Curr. Opin. Cardiol. 11: 227–236.

Shimizu-Matsumoto, A., Adachi, W., Mizuno, K., Inazawa, J.,Nishida, K., Kinoshita, S., Matsubara, K., and Okubo, K. (1997).An expression profile of genes in human retina and isolation of acomplementary DNA for a novel rod photoreceptor protein. Invest.Ophthalmol. Vis. Sci. 38: 2576–2585.

Skvorak, A. B., Weng, Z., Yee, A. J., Robertson, N. G., and Morton,C. C. (1999). Human cochlear expressed sequence tags provideinsight into cochlear gene expression and identify candidate genesfor deafness. Hum. Mol. Genet. 8: 439–452.

Soares, M. B., Bonaldo, M. F., Jelene, P., Su, L., Lawton, L., andEfstratiadis, A. (1994). Construction and characterization of a nor-malized cDNA library. Proc. Natl. Acad. Sci. USA 91: 9228–9232.

Sudo, K., Chinen, K., and Nakamura, Y. (1994). 2058 Expressedsequence tags (ESTs) from a human fetal lung cDNA library.
Genomics 24: 276–279.
Takeda, J., Yano, H., Eng, S., Zeng, Y., and Bell, G. I. (1993). Amolecular inventory of human pancreatic islets: Sequence analysisof 1000 cDNA clones. Hum. Mol. Genet. 2: 1793–1798.

anaka, T., Ogiwara, A., Uchiyama, I., Takagi, T., Yazaki, Y., andNakamura, Y. (1996). Construction of a normalized directionallycloned cDNA library from adult heart and analysis of 3040 clonesby partial sequencing. Genomics 35: 231–235.emura, S., Nakanishi, T., Matsuoka, S., Friedman, W. F., andJarmakani, J. M. (1984). Inotropic effects of prostaglandin D2and E1 on the newborn rabbit heart. Pediatr. Res. 18: 1277–1281.asmatzis, G., Essand, M., Brinkmann, U., Lee, B., and Pastan, I.(1998). Discovery of three genes specifically expressed in humanprostate by expressed sequence tag database analysis. Proc. Natl.Acad. Sci. USA 95: 300–304.elculescu, V. E., Zhang, L., Vogelstein, B., and Kinzler, K. W.(1995). Serial analysis of gene expression. Science 270: 484 –487.atson, M. A., and Fleming, T. P. (1994). Isolation of differentiallyexpressed sequence tags from human breast cancer. Cancer Res.54: 4598–4602.

ang, Y., Peterson, K. R., Stamatoyannopoulos, G., and Papayanno-poulou, T. (1996). Human CD341 cell EST database: Single-passsequencing of 402 clones from a directional cDNA library. Exp.Hematol. 24: 605–612.

asojima, K., Kilgore, K. S., Washington, R. A., Lucchesi, B. R., andMcGeer, P. L. (1998). Complement gene expression by rabbitheart: Upregulation by ischemia and reperfusion. Circ. Res. 82:1224–1230.

asuda, Y., Miyata, T., Nangaku, M., Iida, Y., Maeda, K., Kurokawa,K., and Okubo, K. (1998). Functional quantitative analysis of thegenome in cultured human mesangial cells. Kidney Int. 53: 154–158. [Technical note]

okoyama, M., Nishi, Y., Yoshii, J., Okubo, K., and Matsubara, K.(1996). Identification and cloning of neuroblastoma-specific andnerve tissue-specific genes through compiled expression profiles.
DNA Res. 3: 311–320.

Documents

Identification of Differentially Expressed Genes in Cardiac Hypertrophy by Analysis of Expressed Sequence Tags