Biosensors and Bioelectronics 47 (2013) 106–112

Contents lists available at SciVerse ScienceDirect

Biosensors and Bioelectronics

0956-56http://d

n CorrE-m

journal homepage: www.elsevier.com/locate/bios

Hybridization-induced isothermal cycling signal amplificationfor sensitive electronic detection of nucleic acid

Libing Fu, Dianping Tang n, Junyang Zhuang, Wenqiang Lai, Xiaohua Que, Guonan Chen n

Key Laboratory of Analysis and Detection for Food Safety (Ministry of Education & Fujian Province), Department of Chemistry, Fuzhou University,Fuzhou 350108, PR China

a r t i c l e i n f o

Article history:Received 16 February 2013Received in revised form11 March 2013Accepted 12 March 2013Available online 21 March 2013

Keywords:Electrochemical sensorIsothermal cyclic signal amplificationNucleic acidDNA hybridization

63/$ - see front matter & 2013 Elsevier B.V. Ax.doi.org/10.1016/j.bios.2013.03.008

esponding authors. Tel.: þ86 591 2286 6125;ail address: dianping.tang@fzu.edu.cn (D. Tang

a b s t r a c t

This works reports a new signal-on amplification strategy for sensitive electronic detection of nucleicacid based on the isothermal circular strand-displacement polymerization (ICSDP) reaction. The assaymainly involves a hybridization of ferrocene-labeled hairpin DNA with blocker DNA, a strand-displacement process with target DNA, and an ICSDP-based polymerization reaction. The signal isamplified by the labeled ferrocene on the hairpin probe with target recycling. Upon addition of targetanalyte, the blocker DNA is initially displaced by target DNA from the hairpin/blocker DNA duplex owingto the difference of the folding free energy, then the newly formed target/blocker DNA duplex causes theICSDP reaction with the aid of the primer and polymerase, and then the released target DNA retriggersthe strand-displacement for target recycling. Numerous ferrocene molecules are close to the electrodesurface due to the reformation of hairpin DNA, each of which produces an electronic signal within theapplied potentials, thereby resulting in the amplification of electrochemical signal. Under the optimalconditions, the ICSDP-based amplification method displays good electrochemical responses for detectionof target DNA at a concentration as low as 0.03 pM.

& 2013 Elsevier B.V. All rights reserved.

1. Introduction

An ultrasensitive and feasible method for detecting and quan-tifying sequence-specific nucleic acids is very important in biolo-gical studies, clinical diagnostics and biodefense applications (Luet al., 2012; Tang et al., 2012a,2012b; Palecek and Bartosik, 2012).Typically, the analysis of specific nucleotide sequences is oftenhampered by the presence of extraneous materials or by theextremely small amounts available for examination (Saiki et al.,1998; Mineki et al., 2012). Owing to the inherent backgroundsignals of various instrumental analytical technologies and thelimitation of the classical analytical methodologies, improving thesensitivities via traditional physical methods or simple chemicaland biocatalytic processes is far from meeting the practicaldemands (Ju, 2012; Zhu et al., 2012). Hence, developing highlysensitive analytical methods coupling with the specificity ofbiological recognition events is in urgent need.

Nowadays, the DNA-based amplification methods mainly consistof polymerase chain reaction (PCR) or ligase chain reaction (LCR)-based thermal cycling amplification, and strand-displacement poly-merase-based isothermal processing (Narayanan et al., 2012; Wanget al., 2012; Marshall et al., 2012; Zhao and Dong, 2012; Das et al.,2012). PCR amplification is the most widely used as a thermal cycling

ll rights reserved.

fax: þ86 591 2286 6135.).

protocol for enzymatic amplification of specific DNA sequences withsmall quantity in this category. Usually, PCR amplification involvestwo oligonucleotide primers that flank the DNA segment to beamplified and repeated cycles of heat denaturation of the DNA,annealing of the primers to their complementary sequences, andextension of the annealed primers with DNA polymerase (Dirks andPierce, 2004; Mason et al., 2006). The increase in the product amountis achieved by repeated thermal cycling in an exponential way.Therefore, the PCR-based thermal cycling amplification methods aretime-consuming, sometimes, nonspecific and limited to a thermo-stable enzyme and a laboratory setting (Huang et al., 2011a; Zhanget al., 2012a,2012b). In contrast, the strand-displacement polymer-ase-based isothermal amplification driven by the free energy of basepair formation without enzyme is a straightforward method for thecontinuous replication of one strand of a DNA duplex (Manosas et al.,2012; Dong et al., 2012; Xuan et al., 2012a). The Willner grouputilized rolling circle amplification (RCA) strategy for self-assembly ofDNA nanotubes with controllable diameters (Wilner et al., 2011). ThePugh group explored the impact of Phi29 multiple-strand-displacement amplification on detection of large-scale copy numbervariants using oligonucleotide arrays (Pugh et al., 2008). Unfortu-nately, RCA often depends on inefficient enzymes, and the stepsrequired to prepare circular oligomer templates are time-consumingand costly. Favorably, the rapidly emerging research field of strand-displacement polymerization-based isothermal circular amplificationprovides excitingly possibilities for advanced development of newanalytical tools and instrumentation for bioanalytical application

L. Fu et al. / Biosensors and Bioelectronics 47 (2013) 106–112 107

(Jiao et al., 2012; Wichham et al., 2012; Lie et al., 2012; Xing et al.,2011; Krishnan and Simmel, 2011; Xuan et al., 2012b).

Isothermal circular strand-displacement polymerization(ICSDP) is a biochemical technique based on repeated triggeringtoward a polymerization reaction on a linear DNA sequencetemplate (Qiu et al., 2011; Qian et al., 2012, Guo et al., 2009).During the polymerization, the former products can be displacedby the polymerases to promote the generation of the latter ones,thus resulting in the repeating sequences for in turn amplificationof target analyte-recognition binding event (Feng et al., 2012;Huang et al., 2011b). Qiu's group utilized circular nucleic acidstrand-displacement polymerization method to construct abifunctional signaling probe for the parallel analysis of diseasemarkers (Qiu et al., 2011). He and Liu developed a sequentialstrand-displacement strategy for multistep DNA-templated synth-esis and used it to mediate an efficient six-step DTS that proceededin 35% overall yield (He and Liu, 2011). Ding and her colleagueemployed a hairpin probe and two primers for fluorescencedetection of telomerase activity by using the ICSDP method(Ding et al., 2010). In these methods, most strategies were basedon the displacement of nucleic acid strands. Despite manyadvances in this field, there is still the quest to find some newschemes and strategies for improving the detectable sensitivityand specificity.

Recently, target recycling-based signal amplification hasattracted greatest attention since a target molecule could bereacted with multiple nucleic acid-based signaling probes(Miranda-Castro et al., 2012; Zhang et al., 2012a,2012b, Tanget al., 2012a,2012b). The Plaxco group developed a sensitive andselective amplified fluorescence DNA detection based on exonu-clease III-aided target recycling without any significant restriction

Scheme 1. Schematic illustration of variously assayed protocols for electrochemicaldetection of nucleic acids: (A) hybridization reaction between hairpin DNA andblocker DNA, (B) 1: 1 hybridization strategy, and (C) the ICSDP-based amplificationstrategy.

in the choice of target sequences (Zuo et al., 2010). Hsing and hiscoworker designed a ultrasensitive solution-phase electrochemicalmolecuar beacon-based DNA detection protocol with signal ampli-fication by exonuclease III-assisted target recycling (Xuan et al.,2012a,2012b). Typically, DNAzymes, nicking enzymes and exonu-cleases were utilized for target recycling-based signal amplifica-tion (Kong et al., 2011a; Chen et al., 2011; Zuo et al., 2010; Konget al., 2011b). To the best of our knowledge, there is no reportfocusing on target-induced cycling signal amplification couplingwith the ICSDP reaction and a hairpin switch for electrochemicaldetection of nucleic acids.

Herein we report the proof-of-concept of a novel and powerfulelectrochemical sensing strategy for ultrasensitive detection oftarget DNA by coupling with target-induced ICSDP-signal ampli-fication technique and a DNA-based hairpin switch (Scheme 1).Initially, the ferrocene-labeled hairpin DNA hybridizes with thedesigned blocker DNA to form the double-stranded DNA forpreparation of DNA sensor on a gold electrode. Target DNA strandsdisplace the hairpin from the hairpin/blocker duplex, resulting inthe formation of hairpin DNA on the electrode and a target/blockerduplex in solution. Hairpin formation on the electrode bringsferrocene close to the electrode surface. Primers are allowed toanneal to accessible complementary sequences of the blocker andthe ICSDP reaction is started with the help of a polymerase,leading to the release of target DNA and thus allowing a newcycle to start. As a result, a large number of ferrocene moleculesare close to the electrode surface during the reformation of hairpinDNA, thereby producing a strong electrochemical signal.

2. Experimental

2.1. Chemicals

Oligonucleotides designed in this study were synthesized andpurified through HPLC by Sangon Biotechn. Co., Ltd. (Shanghai,China), and their sequences are listed in Table 1. The polymeraseKlenow fragment exo- and deoxynucleotide mixture (dNTP) werepurchased from Sangon Biotechnol. Co., Ltd. (Shanghai, China).Mercaptohexanol (MCH) was purchased from Tokyo ChemicalIndustry Co., Ltd. (Japan). N-(3-Dimethylaminopropyl)-N′- ethyl-carbodiimide hydrochloride (EDC) was obtained from Alfa Aesar(Beijing, China). All other reagents were of analytical grade andwere used without further purification. Ultrapure water obtainedfrom a Millipore water purification system (18 MΩ, Milli-Q, Milli-pore) was used in all runs. Tris–HCl buffer (0.3 M, pH 7.4), 10�NEBbuffer 2 (1�NEB buffer 2: 50 mM NaCl, 10 mM Tris–HCl, 10 mMMgCl2, 1.0 mM dithiothreitol, pH 7.9), HEPES buffer (25 mM, pH7.4) and phosphate-buffered saline (PBS) were the products ofSigma-Aldrich.

2.2. Hybridization and labeling of hairpin DNA and blocker DNA

5 μL of 100 μM hairpin DNA and 5 μL of 100 μM blocker DNAwere initially mixed into 90 μL HEPES buffer (25 mM, pH 7.4)containing 20 mM KCl, 200 mM NaCl, 0.05 wt% Triton X-100 and1.0 wt% dimethyl sulfoxide. And then, the resulting mixture wasdenatured for 4 min at 94 1C, annealed for 5 min at 50 1C, andfinally cooled to room temperature (RT). During this process, theadded blocker DNA opened the hairpin DNA to form a hairpin/blocker DNA double-stranded structure with a concentration of0.5 mM.

Next, the as-prepared hairpin/blocker DNA duplex was used forthe labeling of ferrocene by chemically bonding ferrocenecar-boxylic acid to the aminated hairpin DNA according to theliterature (Wang et al., 2008). Briefly, 20 mg of imidazole was

Table 1Oligonucleotide sequence.

Hairpin DNA 5'–HS-TTT GATAC CTACG GGAGA CGAAG TAATG TCAGA AAGGT ATC-NH2-3'Blocker DNA 5'–TAATG CGTTT GTAAT AACTA AGTCC ATTAC TTCGT CTCCC GT-Phos-3'Ureagene target DNA 5'–GAAGT AATGG ACTTA GTTAT TACAA ACGCA TTAAT TCTTG ACTA-3'Primer DNA 5'–ACG GGA GAC-3'

Blocker DNA: The 3' end was modified with phosphate group.The underlined sequence of hairpin DNA at 5' end represents the stem portion of hairpin DNA.The bold letters of the blocker DNA are complementary to the bold letters of corresponding hairpin DNA.The italic letters of blocker DNA are the sequence complementary to target DNA.The bold underlined letters at 3' end of blocker DNA are the primer binding site.

L. Fu et al. / Biosensors and Bioelectronics 47 (2013) 106–112108

initially added into 200 μL of 1.0 mM ferrocenecarboxylic acid, andthen the mixture was adjusted to pH 7.0 by 1.0 M HCl. Followingthat, 15 mg of EDC was added into the mixture to activate thecarboxylic group of ferrocenecarboxylic acid. After gentle stirringfor 30 min, the prepared-above hairpin/blocker DNA duplex(100 mL, 0.5 mM) was injected into the suspension, and stirred for12 h at RT. Subsequently, the reaction was stopped by adding100 μL of 3.0 M sodium acetate and 1.0 mL of ethanol. The solutionwas refrigerated for 8 h and filtered. Finally, the obtained sediment(i.e. ferrocene-labeled hairpin/blocker DNA duplex) was washedwith 70% cold ethanol, centrifuged, redispersed into 100 μL 10 mMPBS containing 100 mM LiClO4 (pH 7.4), and stored at 4 1C whennot in use.

2.3. Fabrication of DNA sensor

A gold electrode (2 mM in diameter) was polished repeatedlywith 0.3 and 0.05 μm alumina slurry, followed by successivesonication in the distilled water and ethanol for 5 min and driedin air. Before modification, the gold electrode was cleaned with hotpiranha solution (a 3:1 mixture of H2SO4 and H2O2. Cautions!) for10 min, and then continuously scanned within the potential rangeof −0.3 to 1.5 V in freshly prepared deoxygenated 0.5 M H2SO4

until a voltammogram characteristic of the clean gold electrodewas established. After thorough rinsing with distilled water andabsolute ethanol, 8.0 μL of ferrocene-labeled hairpin/blocker DNAduplex (0.5 μM) was dropped on the cleaned gold electrode, andincubated for 12 h at RT. During this process, the ferrocene-labeledhairpin/blocker DNA duplex was conjugated onto the gold elec-trode via the Au–S bond. After rinsing with distilled water,the modified gold electrode was incubated with 1.0 mM6-mercaptohexanol in 10 mM Tris–HCl buffer, pH 7.4, for 60 min.Finally, the as-prepared DNA sensor was suspended over pH7.4 PBS at 4 1C for further use.

2.4. Electrochemical measurement

Scheme 1 represents the target-induced cycling signal ampli-fication strategy for electrochemical detection of nucleic acids bycoupling with an isothermal circular strand-displacement poly-merization reaction for target recycling. Before measurement, anincubation solution containing 2.0 mL Ureagene target DNA stan-dards with various concentrations, 1.0 mL primer DNA (2 OD), 1.0 mLpolymerase Klenow fragment exo- (0.4 units), 2.0 mL dNTPs(0.2 mM), 9.0 mL distilled water and 2.0 mL NEB buffer 2 (10� )was prepared. Following that, the ICSDP-based cycling reactionwas carried out via dipping the as-prepared DNA sensor into theincubation solution for 60 min at 37 1C. Afterward, square wavevoltammetric (SWV) measurement of the resulting DNA sensorwas monitored in Tris–HCl buffer (pH 7.4) containing 1.0 M NaClO4

on a CHI 620D Electrochemical Workstation (Chenhua, Shanghai,China) with a conventional three-electrode system comprising aPt-wire counter electrode, an Ag/AgCl reference electrode, and amodified gold working electrode (amplitude: 25 mV; frequency:

15 Hz; increase E: 4 mV). A baseline correction of the resultingvoltammogram was performed with CHI 620D software. The peakcurrent was collected and registered as the sensor signal relativeto target DNA concentration. All measurements were performed atroom temperature (2571.0 1C). Analyses were always made intriplicate.

After each run, the DNA sensor was regenerated by immersingit into a 100 μL solution containing 50 mM NaCl, 12.5 mM MgCl2,0.1 mM dithiothreitol, 50 mM Tris–HCl (pH 7.9) and 0.5 μM blockerDNA. During this process, the hairpin DNA was opened again bythe added blocker DNA. For comparison, target DNA standardswith various concentrations were also assayed in the absence ofpolymerase/dNTP/primer DNA using the same protocol.

2.5. Gel electrophoresis

The product solution mixed with 1� loading buffer was sub-jected to electrophoresis analysis on a 20% non-denaturing PAGE.The analysis was carried out in 1� TBE (pH 8.3) at a 150 V constantvoltage for about 120 min. After ethidium bromide staining, gelswere scanned using a UV trans-illuminator.

3. Results and discussion

3.1. Principle of target-induced cycling signal amplification strategy

In this work, the detectable electronic signal mainly derivesfrom the labeled ferrocene redox tag at the 3' end of hairpin DNA.Normally, the redox tags are far away from the electrode surfacewhen the hairpin/blocker DNA duplex is immobilized on theelectrode, thus the detection circuit is switched off. After finishingthe strand-displacement and the polymerization reaction, thedisplaced hairpin DNA forms a hairpin structure on the electrodesurface, thereby activating the electrical contact between theredox tags and the base electrode, which causes the sensor circuitto switch on. Just as the strand-displacement, the hairpin DNAswitch is easily tuned by the added target DNA. Logically, apuzzling question to be produced herein is whether the strand-displacement reaction can successfully carry out. To clarify thisissue theoretically, we used RNA folding prediction software tosimulate the designed DNA structure for the formation of hairpinDNA (Software: RNA structure, version 5.3, University of RochesterMedical Center, Mathews Lab, http://rna.urmc.rochester.edu/software.html). Computational results indicated that the folding free energyof hairpin/blocker DNA duplex was approximate −23.6 kcal mol−1,while that of blocker/target DNA duplex was about −38.2 kcal mol−1.The simulation results revealed that the blocker/target DNA structurewas more stable than that of hairpin/blocker DNA. Therefore, thestrand-displacement might be executed.

For the successful development of such an ICSDP-based signalamplification strategy, design of hairpin DNA and blocker DNA isvery crucial. In this work, hairpin DNA is labeled with the thiolgroup at the 5' end and the amino moiety at the 3' end,

L. Fu et al. / Biosensors and Bioelectronics 47 (2013) 106–112 109

respectively. Each hairpin has a stem of 7 base pairs enclosing a24-nt loop with a 3-nt spacer at the 5' end. Meanwhile, thesequence of 24-nt loop is also the same as partial target DNA. Torealize the target recycling for signal amplification, the strand-displacement reaction is a precondition. First, we used gel electro-phoresis to characterize the displacement process. As seen fromlanes 2 and 3 in Fig. 1A, the base number of hairpin DNA wasalmost the same as that of blocker DNA, which was in accordancewith our design. Moreover, the mixture of 0.5 μM hairpin DNA and0.5 μM blocker DNA caused their self-hybridization reaction (lane4), indicating that blocker DNA could open the hairpin DNA toform the double-stranded DNA structure. When 100 nM targetDNA was added into the hairpin/blocker DNA duplex, inspiringly,partial hairpin DNA molecules were displaced by target DNA (lane5). Relative to lane 4, the sample at lane 5 ran rapidly. The reasonmight be the fact that the molecular mass of hairpin DNA wasmore than that of target DNA, thus the formed blocker/target DNAduplex was lighter in comparison with the hairpin/blocker DNAduplex. Additionally, the lanes of partial free target DNA or hairpinDNA could be achieved at bottom of lane 5. The results revealedthat the strand-displacement was rational and feasible, whichprovided a precondition for the development of ICSDP-basedpolymerization reaction.

3.2. Comparison of different signal amplification strategies

For the conditional assay mode (i.e. without the ICSDP reac-tion), one target DNA can only cause the displacement of onehairpin DNA on the electrode. Hence, the detectable signal islimited. In contrast, introduction of the ICSDP reaction can make

Fig. 1. (A) Gel electrophoresis for the product solution (lane 1: DNA ladder; lane 2: 0.5blocker DNA; lane 5: 0.5 μM hairpin/blocker DNA duplexþ100 nM target DNA). (B-D) SW(b) 100 nM target DNA, (c) 100 nM target DNAþpolymerase/primer/dNTP, and (d) zero

one target DNA use repeatedly in the multiple cycles, thusresulting in the amplification of electronic signal. To investigatethe signal amplification of the ICSDP-based polymerization reac-tion during the electrochemical measurements, the as-preparedDNA sensors were employed for detection of 100 nM target DNA(as an example) based on various signal amplification strategies byusing square wave voltammetry (SWV) (Fig. 1B D). As seen fromcurve ‘b0’ in Fig. 1B, a weak voltammetric peak was observed at theas-prepared DNA sensor. When the DNA sensor was incubatedwith 100 nM target DNA, the SWV peak current was gentlyincreased (curve ‘b’ in Fig. 1B) (Δi¼65.2 nA, curve ‘b’ versus curve‘b0’), which mainly derived from the strand-displacement of targetDNA (Note: The process was designated as ‘the 1: 1 hybridizationstrategy’). More favorably, when the incubation solution simulta-neously contained 100 nM target DNA, primer DNA, polymeraseand dNTPs, the peak current was heavily increased (curve ‘c’ inFig. 1C) (Δi¼361.5 nA, curve ‘c’ versus curve ‘c0’). This is mostlikely a consequence of the fact that the released target DNA by theICSDP reaction could re-trigger the strand-displacement reactionon the DNA sensor, resulting in the formation of numerous hairpinDNA probes on the electrode after ‘n’ cycles (designated as ‘theICSDP-based amplification strategy’). Moreover, the amplified signalby using the ICSDP-based amplification strategy was 554.4721.6%of the 1: 1 hybridization strategy. For comparison, we alsoinvestigated the electrochemical responses of the DNA sensortoward zero analyte. The peak currents were almost not changed(Fig. 1D), suggesting that primer DNA could not be non-specificallyadsorbed onto the DNA sensor and cause the ICSDP polymeriza-tion reaction. Further, the results indicated that the strand-displacement reaction could not be implemented in the absence

μM hairpin DNA; lane 3: 0.5 μM blocker DNA; lane 4: 0.5 μM hairpin DNAþ0.5 μMV curves of the as-prepared DNA sensors (b0,c0,d0) before and after incubation withanalyteþpolymerase/primer/dNTP.

L. Fu et al. / Biosensors and Bioelectronics 47 (2013) 106–112110

of target DNA, even if the primer DNA, polymerase and dNTPswere present. Hence, the ICSDP-based signal amplification strategycould be used for detection of target DNA with high sensitivity.

3.3. Kinetic characteristics and optimization of the ICSDP-basedamplification strategy

Usually, the target-induced cycling signal amplification can beenhanced with the increasing incubation time between the DNAsensor and the ICSDP-based incubation solution. To clarify thispoint, the kinetic behaviors of the as-prepared DNA sensor werestudied by monitoring the currents as a function of incubationtime toward 100 nM target DNA (as an example) with and withoutthe ICSDP-based amplification strategy, respectively. The peakcurrents increased with the time aged (Fig. 2a). Compared withthe ICSDP-based amplification strategy (∼60 min), the 1: 1 hybri-dization strategy was relatively fast (∼40 min). The reason mightbe the fact that it took longer time for target recycling to formhairpin DNA on the electrode than that of the 1: 1 hybridizationstrategy. Significantly, the assay by using the ICSDP-based ampli-fication strategy exhibited higher current change than that ofusing the 1: 1 hybridization strategy, which was in agreement

Fig. 2. (a) Comparison of electrochemical responses of the as-prepared DNA sensors afteamplification strategy and the 1: 1 hybridization strategy, respectively. (b) Signal dependDNA duplex (0.5 μM) for preparation of the DNA sensors on 2 mm gold electrode (100

Fig. 3. Calibration plots of the DNA sensor toward Ureagene target DNA with various con1 hybridization strategy, respectively. The insets show the corresponding SWV curves i

with that of Fig. 1B. To ensure the adequate cycling reaction oftarget DNA, 60 min was selected as the incubation time for theICSDP-based polymerization.

Additionally, the detectable signal was also relative to theimmobilized amount of hairpin DNA on the electrode. As shownfrom Fig. 2B, the peak currents increased with the increasing volumeof hairpin/blocker DNA duplex (0.5 μM), and then tended to level offafter 8.0 μL. According to the literatures (Stobiecka et al., 2010; Hepoland Stobiecka, 2010), the amount of hairpin/blocker DNA duplexdeposited on the electrode was evaluated, which was about0.13 nmol cm−2. Typically for hexagonal dense packing, the max-imum coverage for B-type double-stranded DNA is 47.9 pmol cm−2

on the gold substrate, while it is 41.5 pmol cm−2 for square lattice(Stobiecka et al., 2010). Experimentally determined maximum cover-age using quartz crystal nanobalance was 34.1 pmol cm−2 (Stobieckaet al., 2010), which allowed for some extra hydration shell. For alkanethiols, the maximum coverage was only 0.76 nmol cm−2 (Hepol andStobiecka, 2010). Because there was some space needed for hairpinoligonucleotide to self-hybridize in this work, the coverage(0.13 nmol cm−2) was less than that of alkane thiols. In this regard,8.0 μL of 0.5 μM hairpin/blocker DNA duplex was used for thepreparation of DNA sensor on the 2 mm gold electrode.

r incubation with 100 nM target DNA as a function of time by using the ICSDP-basedence of the ICSDP-based assay protocol on the used volume (μL) of hairpin/blockernM target DNA used in this case).

centrations by using (a) the ICSDP-based signal amplification strategy and (b) the 1:n Tris–HCl buffer (pH 7.4) containing 1.0 M NaClO4, respectively.

L. Fu et al. / Biosensors and Bioelectronics 47 (2013) 106–112 111

3.4. Analytical performance of the ICSDP-based sensing strategy

Under optimal conditions, the sensitivity and dynamic range ofthe ICSDP-based electrochemical DNA sensor were evaluatedtoward target DNA in Tris–HCl buffer (pH 7.4) containing 1.0 MNaClO4. Fig. 3a shows the electrochemical responses and dynamicrange of the developed DNA sensors toward target DNA withvarious concentrations. The SWV peak currents increased with theincreasing target DNA. The calibration plots displayed a goodlinear relationship between the peak currents and the logarithmof target DNA concentrations in the range from 0.1 pM to 1.0 μM(inset of Fig. 3a). The detection limit (LOD) calculated from theslope of the calibration graph (Kulys, 1999; Kulys and Tetianec,2005) was 0.03 pM. In contrast, the linear range and LOD were0.05–500 nM and 28 pM target DNA by using the 1: 1 hybridizationstrategy, respectively (Fig. 3b). Although the system has not yetbeen optimized for maximum efficiency, the LOD using the ICSDP-based amplification strategy was about 1000-time lower than thatof the 1: 1 hybridization strategy. More importantly, the slope ofregression equation of using the ICSDP-based amplification strat-egy was largely higher than that of the 1: 1 hybridization strategy.The merit of such a high slope is that it could exactly identify twoclose-concentration target DNA samples.

3.5. Specificity, reproducibility and stability

To test the specificity of the ICSDP-based DNA sensors, we usedvarious oligonucleotides as matched, mismatched, deleted andinserted targets (Fig. 4). Only the matched DNA could cause thestrand-displacement and ICSDP polymerization reaction. Hence,the designed scheme was highly selective for completely comple-mentary DNA. The results also revealed one important merit of themethod: incubation process and cycling signal amplification with-out separation, because the cycling signal amplification wasfollowed closely by the strand-displacement reaction.

The precision and reproducibility of the ICSDP-based DNAsensor were evaluated by using the variation coefficient (CV) ofthe intra- and inter-assay (CV). The experimental results indicatedthat the CVs of the assays using the DNA sensor with the samebatch were 7.4%, 9.5%, and 8.7% at 1.0 pM, 1.0 nM and 500 nMtarget DNA (n¼3), respectively. And the batch-to-batch reprodu-cibility was monitored, and the CVs were 9.6%, 10.2% and 9.3% at

Fig. 4. Electrochemical responses of the DNA sensors toward a matched targetDNA, mismateched target DNA, a target DNAwith a deleted nucleotide, and a targetDNA with an inserted nucleotide (all 100 nM). Target sequence: GAAGTAATGGACT-TAXTTATTACAAACGCATTAATTCTTGACTA; T (matched): X¼G; T (mismatched):X¼C; T (deleted): no X; T (inserted): X¼GC.

the mentioned-above levels, respectively. Hence, the precision andreproducibility of the ICSDP-based DNA sensor was acceptable.

In addition, the stability of the ICSDP-based DNA sensor wasalso studied over a six-week period. When the ICSDP-based DNAsensor were suspended over pH 7.4 PBS at 4 1C and measuredintermittently (every 3–5 days), they retained 94.1%, 88.6% and83.7% (n¼3) of the initial signal after storing 2, 4 and 6 weeks,respectively. We speculate that the slow decrease of the signalswas mainly attributed to the gradual deactivation of the immobi-lized hairpin/blocker DNA duplex.

4. Conclusions

In summary, we have developed a convenient and feasible DNAsensing strategy with high sensitivity and selectivity by coupling astrand-displacement process and an ICSDP-based cycling amplifi-cation protocol. Compared with the traditional DNA sensingstrategy, the method is sensitive and simple, thereby representinga good isothermal signal amplification scheme. Meanwhile, theamplified process can be implemented in the target analyte withinthe one-step protocol. In addition, the strand-displacement poly-merization can be performed under isothermal condition, thuseliminating the requirement for thermal cycling during the pro-cedure. Importantly, the outstanding sensitivity can make thisapproach a promising scheme for development of next-generationDNA sensing techniques.

Acknowledgments

This work was financially supported the National “973” BasicResearch Program of China (2010CB732403), by the NationalNatural Science Foundation of China (41176079, 21075019), theDoctoral Program of Higher Education of China (20103514120003),the National Science Foundation of Fujian Province (2011J06003),and the Program for Changjiang Scholars and Innovative ResearchTeam in University (IRT1116).

References

Chen, Y., Jiang, B., Xiang, Y., Chai, Y., Yuan, R., 2011. Chemical Communications 47,12798–12800.

Das, J., Cederquist, K., Zaragoza, A., Lee, P., Sargent, E., Kelley, S., 2012. NatureChemistry 4, 642–648.

Ding, C., Li, X., Ge, Y., Zhang, S., 2010. Analytical Chemistry 82, 2850–2855.Dirks, R., Pierce, N., 2004. Proceedings of the National Academy of Sciences 101,

15275–15278.Dong, H., Zhang, J., Ju, H., Lu, H., Wang, S., Jin, S., Hao, K., Du, H., Zhang, X., 2012.

Analytical Chemistry 84, 4587–4593.Feng, X., Luo, X., Hsing, I., 2012. Biosensors and Bioelectronics 35, 230–234.Guo, Q., Yang, X., Wang, K., Tan, W., Li, W., Tang, H., Li, H., 2009. Nucleic Acids

Research 37, e20.He, Y., Liu, D., 2011. Journal of the American Chemical Society 133, 9972–9975.Hepol, M., Stobiecka, M., 2010. Interactions of Herbicide Atrazine with DNA. Nova

Science Publishers, New York.Huang, J., Chen, Y., Yang, L., Zhu, Z., Zhu, G., Yang, X., Wang, K., Tan, W., 2011a.

Biosensors and Bioelectronics 28, 450–453.Huang, J., Wu, Y., Chen, Y., Zhu, Z., Yang, X., Yang, C., Wang, K., Tan, W., 2011b.

Angewandte Chemie International Edition 50, 401–404.Jiao, A., Zheng, J., Hu, Y., Zhu, G., Li, J., Li, H., Yang, R., Tan, W., 2012. Chemical

Communications 48, 5659–5661.Ju, H., 2012. Jounal of Biochips Tissue Chips 2, e114.Krishnan, Y., Simmel, F., 2011. Angewandte Chemie International Edition 50,

3124–3432.Kong, R., Zhang, X., Zhang, L., Huang, Y., Lu, D., Tan, W., Shen, G., Yu, R., 2011a.

Analytical Chemistry 83, 14–17.Kong, R., Zhang, X., Chen, Z., Meng, H., Song, Z., Tan, W., Shen, G., Yu, R., 2011b.

Analytical Chemistry 83, 7603–7607.Kulys, J., 1999. Biosensors and Bioelectronics 14, 473–479.Kulys, J., Tetianec, L., 2005. Biosensors and Bioelectronics 21, 152–158.Lie, P., Liu, J., Fang, Z., Dun, B., Zeng, L., 2012. Chemical Communications 48,

236–238.

L. Fu et al. / Biosensors and Bioelectronics 47 (2013) 106–112112

Lu, C., Wang, F., Willner, I., 2012. Journal of the American Chemical Society 134,10651–10658.

Manosas, M., Spiering, M., Ding, F., Bensimon, D., Allemand, J., Benkovic, S.,Croquette, V., 2012. Nucleic Acids Research 40, 6174–6186.

Marshall, L., Wu, L., Babikian, S., Bachman, M., Santiago, J., 2012. AnalyticalChemistry, 9640–9645.

Mason, J., Xu, L., Sheng, Z., O'Leary, T., 2006. Nature Biotechnology 24, 555–557.Mineki, H., Hanasaki, T., Matsumoto, A., Kawasaki, T., Soai, K., 2012. Chemical

Communications 48, 10538–10540.Miranda-Castro, R., Marchal, D., Limoges, B., Mavre, F., 2012. Chemical Commu-

nications 48, 8772–8774.Narayanan, R., Zhu, L., Velmurugu, Y., Roca, J., Kuznetsov, S., Prehna, G., Lapidus, L.,

Ansari, A., 2012. Journal of the American Chemical Society 134, 18952–18963.Palecek, E., Bartosik, M., 2012. Chemical Reviews 112, 3427–3481.Pugh, T., Delarney, A., Farnoud, N., Griffith, S., Li, M., Li, H., Qian, H., Farinha, P.,

Gascoyne, R., Marra, M., 2008. Nucleic Acids Research 36, art. no. e80.Qian, J., Ferguson, T., Shinde, D., Ramirez-Borrero, A., Hintze, A., Adami, C., Niemz,

A., 2012. Nucleic Acids Research 40, e87.Qiu, L., Wu, Z., Shen, G., Yu, R., 2011. Analytical Chemistry 83, 3050–3057.Saiki, R., Gelfand, D., Stoffel, S., Scharf, S., Higchi, R., Horn, G., Mullis, K., Erlich, H.,

1998. Science 239, 487–491.Stobiecka, M., Coopersmith, K., Cutler, S., Hepel, M., 2010. ECS Transactions 28,

1–12.

Tang, H., Xiao, C., Sun, J., Xiong, D., Hu, X., 2012a. Chemical Communications 48,10289–10291.

Tang, J., Tang, D., Zhou, J., Yang, H., Chen, G., 2012b. Chemical Communications 48,2627–2629.

Wang, P., Wu, H., Dai, Z., Zou, X., 2012. Chemical Communications 48, 10754–10756.Wang, X., Yun, W., Dong, P., Zhou, J., He, P., Fang, Z., 2008. Langmuir 24, 2200–2205.Wichham, S., Bath, J., Katsuda, Y., Endo, M., Hidaka, K., Sugiyama, H., Turberfield, A.,

2012. Nature Nanotechnology 7, 169–173.Wilner, O., Orbach, R., Henning, A., Teller, C., Yehezkeli, O., Mertig, M., Harries, D.,

Willner, I., 2011. Nature Communication, 2, art. no. 540.Xing, Y., Yang, Z., Liu, D., 2011. Angewandte Chemie International Edition 50,

11934–11936.Xuan, F., Luo, X., Hsing, I., 2012a. Biosensors and Bioelectronics 35, 230–234.Xuan, F., Luo, X., Hsing, I., 2012b. Analytical Chemistry 84, 5216–5220.Zhang, B., Liu, B., Tang, D., Niessner, R., Chen, G., Knopp, D.., 2012a. Analytical

Chemistry 84, 5392–5399.Zhang, L., Guo, S., Dong, S., Wang, E., 2012b. Analytical Chemistry 84, 3568–3573.Zhao, X., Dong, T., 2012. Analytical Chemistry 84, 8541–8546.Zhu, G., Ye, M., Donovan, M., Song, E., Zhao, Z., Tan, W., 2012. Chemical Commu-

nications 48, 10472–10480.Zuo, X., Xia, F., Xiao, Y., Plaxco, K., 2010. Journal of the American Chemical Society

132, 1816–1818.