Hemoglobin Beta-subunit (HBB)

Josh Bram and Wilton Smith

What is Hemoglobin?• Oxygen (and CO2) transporter

for all vertebrates• Tetramer composed of four

protein subunits (two alpha and two beta subunits)

• Four Iron-containing haeme centers carry one oxygen molecule each

• Beta-subunit mutations cause:– Sickle-cell anemia– Beta-thalessemia

• 146 amino acid protein subunit

Hemoglobin - β Mutation Diseases

Sickle Cell Anemia• Mutation causing beta-

globin units to stick together in masses and deform Red Blood Cells

• RBCs take crescent shape and have many consequences

• These include premature death and blocking of small blood vessels

Beta Thalassemia• Either a decrease or

absence of beta-globin production

• Prevents Red Blood Cells from having enough Hemoglobin to supply oxygen to the body

• In mice, leads to sickly and weak individuals, or stillborn offspring

Peromyscus leucopus

Primer Design

• Targeted Intron 2 (~700 base pairs)• Forward Primer (E2E3F):

5’ ctccatgtggatcctgagaac 3’– GC%: 52.38 – 21 base pairs– Melting point: 55° C

• Reverse Primer (E2E3R): 5’ acgatcatattgcccaggag 3’

– GC%: 50.00– 20 base pairs– Melting Point: 55° C

DNA Extraction

• Qiagen DNeasy Blood & Tissue Kit• Two samples of P. leucopus extracted– Sample 1 extracted after 20 minute incubation– Sample 2 extracted after extended incubation

• Both DNA samples yielded amplification results at one time or another; however, sample 2 proved to be a more reliable DNA source

Polymerase Chain Reaction (PCR)

• 6.25 μL Mastermix– Mix composed of parts:

• 50 x 1.25 μL 10x buffer = 62.5 μL• 50 x 1.25 μL dNTP = 62.5 μL• 50 x 0.1 μL Taq Polymerase = 5 μL

• 4.25 μL dH2O• 1.00 μL DNA• 0.50 μL PF• 0.50 μL PR

Initial Identification

• Six sample PCR– Sample DNA 1 at 50˚C,

55˚C, and 60˚C– Sample DNA 2 at 50˚C,

55˚C, and 60˚C

• Successful gene amplification for Sample DNA 2 at 60˚C PCR (well seven)

2 kb1.5 kb

1 kb700 bp500 bp300 bp100 bp

What happened?

• Only Sample DNA 2 used for future PCR reactions

• Gene amplification failed to occur at 60˚C (or any temperature)

• Possible errors in PCR mix setup, PCR machine setup, random error, denatured primers

Successfully Identified

• PCR run at multiple primer concentrations (1X, 1.5X, 2X) for Sample DNA 2

• Successful gene amplification for across all primer concentrations (wells two, three, and four)

1, 1.5, and 2x primer concentrations all show amplification at approx. 700 bp

Initial 50 μL PCR products

• 50 μL PCR reactions for eventual sequencing

• All PCR ingredient volumes multiplied by four for 50 μL PCR

• Wells two and three show the HBB PCR products (1X and 1.5X Primer concentrations)

HBB PCR Prodcuts, approx. 700 bp

PCR Product Cleanup for Analysis

• Used Qiagen PCR Purification Kit• Cleanup up PCR Product to send for

sequencing• Sent 5 μL of each primer, 10 μL of PCR product• Sent to Penn State sequencing facility in

Chandlee building

HBB Sequence

HBB Forward Primer

• Compared to Mus sequence

HBB Reverse Primer

• Compared to Mus sequence

BLAST Results

Population Samples

• Six Population Sample PCR at 60˚C– TK20806– TK20808– TK20809– TK20813– TK20852– TK20857

• All samples showed gene amplification

East

West

5E (806) vs 9W (852)

Conserved vs Unconserved

Site 179

Depending on reading frame: Cys to Tyr, Val to Met, Leu to Leu

Bibliography

• http://www.uniprot.org/uniprot/P68871• http://ghr.nlm.nih.gov/gene/HBB• http://

biotools.umassmed.edu/bioapps/primer3_www.cgi• http://www.ncbi.nlm.nih.gov/genbank/• http://www.megasoftware.net/• http://nucleobytes.com/index.php/4peaks• http://

bioinformatics.picr.man.ac.uk/research/software/tools/sequenceconverter.html