Hardcastle Et Al-2014-Veterinary and Comparative Oncology

Original Article DOI: 10.1111/vco.12105

Expression of fibroblast growth factor 23by canine soft tissue sarcomas

M. R. Hardcastle and K. E. DittmerInstitute of Veterinary, Animal and Biomedical Sciences, College of Sciences, Massey University, PalmerstonNorth, New Zealand

AbstractTumour-induced osteomalacia (TIO) is a rare paraneoplastic syndrome of humans. Some

mesenchymal tumours (often resembling haemangiopericytomas) express molecules that normally

regulate phosphorus metabolism; most frequently, fibroblast growth factor 23. Patients develop

renal phosphate wasting and inappropriately low serum concentrations of 1, 25 (OH)2 vitamin D3,

leading to osteomalacia. Surgical removal of the tumour is curative. The authors examined

expression of canine fibroblast growth factor 23 in 49 soft tissue sarcomas, and control tissues from

normal adult dogs. RNA extracted from bone or formalin-fixed, paraffin-embedded tissues was

analysed by end point and quantitative reverse transcriptase-polymerase chain reaction. Fibroblast

growth factor 23 expression was detected in bone, lung, kidney, lymph node and thymus. Fifteen of

49 sarcomas (31%) expressed fibroblast growth factor 23, three of these had high relative expression

and some features resembling phosphatonin-expressing mesenchymal tumours of humans. Further

work is required to determine whether TIO may occur in dogs.

Keywordscanine, fibroblast growthfactor 23, phosphatonin,polymerase chain reaction,soft tissue sarcoma,oncogenic osteomalacia

Introduction

Rickets and osteomalacia are uncommon metabolicbone diseases affecting humans and animals. Fail-ure of normal mineralization in physeal or articu-lar cartilage of growing children or animals leadsto rickets; the same process in the remodellingbone of adults leads to osteomalacia.1 Rickets ismost common due to vitamin D or phosphorusdeficiency.1 Rare cases of inherited metabolic dis-orders and paraneoplastic syndromes are reportedto cause rickets or osteomalacia in humans. Thesehave been variably linked to well-described defectsof either vitamin D3 or phosphorus metabolism.1 Asmall number of well-substantiated cases of canineinherited rickets have been reported2; however,these diseases appear to be very rare in the caninepopulation.

Tumour-induced osteomalacia (TIO) is a rareparaneoplastic syndrome of humans with patientsshowing reduced renal phosphate reabsorption,inappropriately low levels of active vitamin D3

and osteomalacia.3 The responsible tumours areusually small and located in obscure areas such asthe paranasal sinuses4 or within bone3,5,6 althoughthey are occasionally located subcutaneously.7,8

They are often difficult to diagnose and to resectcompletely.3 Advanced imaging (such as scintig-raphy, magnetic resonance imaging or positronemission tomography/computed tomographyscan) has been required to identify sites of osteo-malacia and locate the causative tumour,6,9–11

which can nevertheless defy identification in someaffected patients despite such measures.12 Earlyinvestigators noted that removal of the causativetumour led to the resolution of osteomalacia.3,5,13,14

The majority of tumours causing TIO are desig-nated phosphaturic mesenchymal tumour-mixedconnective tissue variant (PMT-MCT), and havea consistent morphologic appearance similar tohaemangiopericytomas.5,15 Generally speaking,PMT-MCT are composed of large numbers ofloosely to densely packed spindle to stellate-shaped

Correspondence address:M. R. HardcastleGribbles VeterinaryPathologyP.O. Box 12049Penrose, Auckland 1642,New Zealande-mail:[email protected]

© 2014 John Wiley & Sons Ltd 1

2 M. R. Hardcastle and K. E. Dittmer

cells embedded within a highly vascular myxoid tochondroid stroma, which is frequently described as‘grungy’15 due to diffuse mineralization. Immuno-histochemical profiling of PMT-MCTs shows scantstaining for smooth muscle-specific actin, andnegative staining for S-100, CD34, desmin andcytokeratin.15

Predominantly expressed by bone but foundin other organs,16–18 fibroblast growth factor 23(FGF23) has a physiological and pathological rolein phosphate homeostasis, causing decreased renalphosphate reabsorption and reduced activation ofvitamin D3.19 FGF23 exerts these effects throughreducing 25 (OH) vitamin D3 1-𝛼-hydroxylaseexpression, and reducing the numbers of renalepithelial cell membrane sodium-phosphateco-transporters. This has led to its appellationas a ‘phosphatonin’.20 When transplanted intonude mice, Chinese hamster ovary cells express-ing human FGF23 caused hypophosphatemia,phosphaturia, high-serum alkaline phosphatase,low 1,25 (OH)2 vitamin D3, bone deformity andrickets.21

FGF23 is the most important phosphatonin inTIO patients.22 In situ hybridization, immunohis-tochemistry, polymerase chain reaction, westernblot and northern blot analysis21,23,24 have shownFGF23 protein and mRNA to be present and over-expressed in the tumour cells of TIO patients; inaddition, elevated serum concentrations of FGF23are often detected in TIO patients by enzyme-linkedimmunosorbent assay (ELISA), and these quicklyreturn to normal after the causative tumours areremoved.25 Parallel research has revealed thatFGF23 also plays a key role in most inheriteddisorders of phosphorus metabolism.19,26–28

Although murine models of disordered FGF23metabolism are well established,29,30 its physiol-ogy and naturally occurring disorders in animalsare little explored. FGF23 manipulation has beenconsidered as a means of improving phosphorusutilization efficiency in production animals,31,32

and has been evaluated in cats with chronickidney disease and/or hyperthyroidism.33–36

To the author’s knowledge, TIO has not beenreported in dogs, or any other animal species;furthermore, the phosphatonin system is com-pletely unexplored in dogs. Here, we describe our

investigation into FGF23 expression by caninesoft tissue sarcomas and a range of other tis-sues.

Materials and methods

Case selection and control samples

Fifty-one formalin-fixed paraffin-embeddedtumours were selected from the databases ofNew Zealand Veterinary Pathology (PalmerstonNorth, New Zealand) and the Necropsy service,Pathobiology Department (Institute of Veterinary,Animal and Biomedical Sciences, Massey Uni-versity, Palmerston North, New Zealand). Thetumours selected were mesenchymal tumours vari-ously diagnosed on haematoxylin and eosin (H&E)morphology as spindle cell tumour (5), haeman-giopericytoma (6), soft tissue sarcoma (2), spindlecell tumour/haemangiopericytoma (5), spindle celltumour/soft tissue sarcoma/haemangiopericytoma(17), fibrosarcoma (4), dermatofibroma (1), periph-eral nerve sheath tumour/schwannoma (5), mixedsarcoma (1), sarcoma (3) or poorly differentiatedsarcoma (2). Particular attention in case selectionwas given to any historical or clinical featuressuggestive of TIO-causing tumours (e.g. locationwithin a muscle). None was associated with adiagnosis of osteomalacia.

To establish the normal tissue distribution ofFGF23 expression in dogs, control soft tissueswere taken from three clinically healthy approxi-mately 6-month-old female cross-bred dogs. Thesedogs (designated as A, B and C) were humanelyeuthanized with intravenous pentobarbitone andnecropsied immediately. No gross abnormalitieswere identified. Samples of skin, skeletal muscle,fat and fascia from the distal limbs, cardiac muscle,arteries and veins, peripheral nerve, liver, spleen,kidney and lung were taken from each dog within60 min of death; in addition, tendon was taken fromdogs B and C, and mesenteric lymph node, thymus,ovary, pylorus and small intestine from dog C.These tissues were immediately fixed in neutralbuffered 10% formalin, and then trimmed into tis-sue cassettes after 24 h of fixation. The tissues weredehydrated in graded alcohols, and embedded inparaffin wax. Sections cut at 3 μm were stained withH&E and examined for adequacy of fixation, tissue

© 2014 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12105

Expression of FGF23 by canine soft tissue sarcomas 3

preservation and microscopic lesions. Samples oflung contained small scattered foci of interstitialeosinophilic or granulomatous inflammationconsistent with migration of Toxocara canis larvae.

Samples of bone were taken from the proxi-mal humerus and femur of a healthy 6-month-oldmale dog that had been humanely euthanized withintravenous pentobarbitone and necropsied imme-diately (bone 1), and dog C (bone 2), snap-frozenin liquid nitrogen and then either immediately sub-jected to the RNA extraction or stored at −80 ∘Cuntil processed.

RNA extraction

Total RNA was extracted from paraffin-embeddedsoft tissue samples using the Roche High PureFFPE RNA Micro Kit (Version December 2008,Cat. No. 04-823-125-001, Roche Applied Science,Mannheim, Germany) according to the manu-facturer’s instructions, with a few modifications(DNAse solution was formulated before additionto the column, and one extra application of DNAseand wash buffer rinse were used). Samples wereimmediately stored at −80 ∘C for later analysis,excepting a 2-μL aliquot which was tested for RNAquantity with a Nanodrop 1000 Spectrophotometer(Thermo Scientific, Wilmington, DE, USA).

RNA was extracted from control bones usingthe following protocol. Snap-frozen bone wasmaintained in liquid nitrogen while pulverizedto a fine powder using a mortar and pestle. Thefrozen powder was transferred to a 15-mL tubecontaining stainless steel ball bearings and TRIreagent (Sigma, St. Louis, MO, USA) at a ratioof 2 mL per 100 mg tissue. The tubes were thenvortexed for 4–15 min. The homogenate wastransferred to a 15-mL tube and centrifuged at12 000 g for 5–10 min. The clear (RNA-containing)supernatant was transferred to a fresh 15- mL tubeand then allowed to stand for 5 min at room tem-perature. Total RNA was then extracted accordingto the manufacturer’s instructions. The resultingpellet was air dried for 5–10 min and then resus-pended in 50–200 μL of diethylpyrocarbonate(DEPC)-treated water (Invitrogen, Carlsbad, CA,USA). Samples were immediately stored at −80 ∘Cfor later analysis, excepting a 2-μL aliquot which

was tested for RNA quantity with a NanodropND-1000 Spectrophotometer (Thermo Scientific).

Reverse transcriptase-polymerase chainreaction

Primers (Table 1) were designed using thenucleotide Basic Local Alignment Search Tool[BLASTn, National Centre for Biotechnology Infor-mation (NCBI), Bethesda, MD, USA; http://blast.ncbi.nlm.nih.gov/Blast.cgi] to match referencecanine RNA sequences for FGF23 (XM_849487.1),secreted frizzled-related protein 4 (SFRP4)(XM_851504.1) and glyceraldehyde 3-phosphatedehydrogenase (GAPDH) (XM_534639.2) and tocross exon–exon boundaries. Potential unwantedhomology to extraneous targets was also examined.

A protocol for detecting the expression of FGF23,SFRP4 and GAPDH mRNA was validated in controlbone samples (as FGF23 expression is reported tobe highest in bone of other species17), with purifi-cation and sequencing of amplicons confirmingtheir 100% identity to reference sequences (datanot shown). GAPDH and SFRP4 were selected foramplification as ‘house-keeping’ genes to confirmthe presence of detectable RNA of a similar orlonger amplicon length to the FGF23 target.

Reverse transcriptase-polymerase chain reac-tion (RT-PCR) testing was performed using theSuperScript One-Step RT-PCR with Platinum TaqKit (Invitrogen) according to the manufacturer’sinstructions. A PCR mix containing 1× reactionmix, 0.2 μM of each primer, 1 μL of RT/PlatinumTaq mix, RNA template (19.4–518.99 ng RNA)and PCR-grade water was added to thin-walled0.2-mL PCR tubes to a final volume of 25 μL. Inall reactions a negative control was included totest for the presence of contaminants. Sampleswere gently mixed and subjected to the follow-ing PCR conditions: 55 ∘C for 30 min, 94 ∘C for2 min, 40 cycles of 95 ∘C for 30 s, 58 ∘C for 30s, 72 ∘C for 1 min and finally 72 ∘C for 10 min.PCR products were analysed on an ethidiumbromide-labelled 1.33% (w/v) UltraPure agarosegel (Invitrogen) and visualized under transillumi-nator UV light. Selected products were purified,sequenced and analysed to confirm successfuldemonstration of gene expression. Positive samples



Table 1. Primer sets for RT-PCR (all from Invitrogen Custom Primers, except FGF23 (Biosearch Technologies, Novato, CA,USA)

Target Forward (5′ –3′) primer Reverse (5′ –3′) primer Product (bp) Tm (1 M Na+) For./Rev

FGF23 CGGTCAGAGGATGCCGGCTTT TCCGGGCTGAAGAGGTGTGAT 107 75/73GAPDH GGCGTGAACCATGAGAAGTATGA CCCTCCACGATGCCAAGT 119 72/69SFRP4 CGCCATGTACGCGCCCATCT CATGAGCGGCTCGCAGTCGT 163 74/74

Tm, melting temperature; For., forward; Rev., reverse.

were retested up to five times to ensure that pos-itive results were repeatable. In several cases (e.g.tumour 5) fresh samples were re-extracted fromformalin-fixed paraffin-embedded tissues beforerepeat PCR.

The RNA sample concentration at the lower limitof detection for the FGF23 PCR assay was deter-mined to be 15 ng μL−1. Tissues of sufficient con-centration to amplify FGF23 mRNA, but negative,were tested using the one-step protocol for expres-sion of GAPDH or SFRP4 as previously describedfor FGF23, save for the use of 63 ∘C as the annealingtemperature. A fibrosarcoma and a haemangioperi-cytoma were negative for GAPDH or SFRP4 expres-sion; these were excluded from further study.

Real-time quantitative polymerase chainreaction

Tumours that were positive for FGF23 expres-sion using conventional RT-PCR, and controldog tissues were analysed using real-time quan-titative polymerase chain reaction (qPCR). Thereference genes selected were ribosomal proteinL13a (RPL13A) and hydroxymethylbilane synthase(HMBS). RPL13A in particular has been shown tohave stable expression in canine skin, connectivetissues and bone,37,38 while HMBS has relativelystable expression in a number of canine tissues.39

The primer sequences for RPL13A have previouslybeen reported.38 HMBS and new FGF23 primerswere devised specifically for real-time PCR usingnucleotide BLASTn (NCBI) to match referencecanine RNA sequences for FGF23 (XM_849487.1)and HMBS (XM_546491.3). The primers weredesigned for a product less than 120 bp in size,to span an exon–exon boundary and to lackcomplementarity to extraneous targets. Primersequences for qPCR are reported in Table 2.

The RNA previously extracted (see earlier) wasconverted to cDNA using the Roche Transcrip-tor cDNA synthesis Kit (Roche Applied Science)as per the manufacturer’s instructions. RNA to beused in real-time PCR had the concentration deter-mined using a Qubit 2.0 fluorometer (Life Tech-nologies, Carlsbard, CA, USA) as this has recentlybeen shown to be more accurate than a spectropho-tometer for determining RNA concentration fromFFPE sections. 40 A mix of 2.5 μM oligo(dT), 60 μMrandom hexamers, 1 mM each dNTP, 20 U RNaseInhibitor, 10 U RT, 5× reaction buffer, 4 μL RNA(25–300 ng RNA) and water, up to a final volumeof 20 μL, was added to each tube. Samples were gen-tly mixed and incubated at 25 ∘C for 10 min, 55 ∘Cfor 30 min and 85 ∘C for 5 min. For qPCR, 2 μLof cDNA product was used in a reaction mix with5 μL of FastSYBR master mix (Applied Biosystems,Life Technologies, Foster City, CA, USA), variableforward and reverse primer concentrations (as perTable 2) and water, up to a final volume of 10 μL.Real-time qPCR was performed using the StepOnePlus real-time PCR machine (Applied Biosystems,Life Technologies) and the qPCR conditions wereas follows: 95 ∘C for 20 s, followed by 40 cyclesof 95 ∘C for 3 s and 60 ∘C for 30 s. A melt curvewas performed at the end of each qPCR run tocheck for non-specific amplification. Negative con-trols of water, and reaction mix without RT wereincluded in every qPCR run. All samples were runin duplicate. Five-point standard curves were pro-duced for each target using bone 2 and sample5 to determine the accuracy (R2) and efficiency(%) of the real-time PCR reactions (Table 2). Thereal-time data were analysed using the compara-tive 2−Δ ΔC

T method and the arithmetic mean ofthe reference genes by the StepOne plus software(Applied Biosystems, Life Technologies) to producerelative expression ratios. Selected amplicons for



Table 2. Primer sets for real-time qPCR (Biosearch Technologies)

Target Forward (5′ –3′) primer Reverse (5′ –3′) primerFor.

(nM)Rev.(nM)

Product(bp) R2 E (%)

FGF23 TGGATGGCACACCTCATCAGACCA ACACCTGTTATCACCACAAAGCCG 250 250 82 1.00 103.3HMBS AGACTCTGCTTCGCTGCATT CAGTCAGGTACAGTTGCCCA 300 100 114 0.97 98.8RPL13A CTGCCCCACAAGACCAAG GGGATCCCATCAAACACCT 100 500 65 1.00 95.0

For., forward primer concentration; Rev., reverse primer concentration; R2, coefficient of correlation; E, efficiency.

each target were sent for sequencing as describedearlier.

Results

Tumour samples – RT-PCR findings

Of the 49 GAPDH and/or SFRP4 positive tumours,15 (31%) were positive for expression of FGF23(example shown in Fig. 1). The positive tumoursvaried in anatomic site, original diagnosis andhistological features (Table 3). Ten were subcuta-neous/dermal, three were intramuscular and oneeach was found within a nerve sheath and thepharyngeal submucosa. Twelve were located on orclose to a limb, one was located over the thorax,one over the abdominal wall and one was foundin the retropharynx. Four had original diagnosesof spindle cell tumour/haemangiopericytoma,one of spindle cell tumour/soft tissue sar-coma/haemangiopericytoma, one of spindle celltumour, two of fibrosarcoma, two of sarcoma, twoof soft tissue sarcoma, and one each of haeman-giopericytoma, poorly differentiated sarcoma andmixed sarcoma (example shown in Fig. 2).

Tumour samples – real-time qPCR findings

All 15 tumours analysed expressed FGF23, HMBSand RPL13A. Expression of FGF23 in soft tissuesarcomas was compared with expression of FGF23in the two bone samples. Thirteen of the tumourshad greater FGF23 expression than bone 1; three ofthese also had greater FGF23 expression than bone2 (Table 3 and Fig. 3).

The assays produced a single melt peak on amelt curve, and amplicons showed 100% identitywith their respective target gene sequence (FGF23,HMBS or RPL13A). Negative controls and negativeRT controls showed no amplification of DNA.

Figure 1. One-step RT-PCR for FGF23 in a tumoursample. No. 5 is a FGF23 positive tumour sample. ‘Neg’denotes negative control (water); ‘Bone’ denotes positivecontrol (bone 2). Ethidium bromide-stained gelelectrophoresis.

Normal dog tissues – real-time qPCR findings

The two samples of bone were positive for FGF23expression. Samples of skin, skeletal muscle, ten-dons, cardiac muscle, fat, fascia, vessels, nerves,ovary, pylorus, small intestine, liver and spleendid not express FGF23. Mesenteric lymph nodeand thymus were tested in dog C and showedpositive FGF23 expression. Both lung and kid-ney expression of FGF23 was variable; dogs Aand B both had FGF23 expression in the kidney,but dog C did not. Dog B had positive FGF23expression in the lung, whereas dogs A and Cdid not.

All samples negative for FGF23 expression testedpositive with HMBS and/or RPL13A.

Relative expression of FGF23 in the control tis-sues was compared to bone 2 (Table 3). Expressionof FGF23 in all of the positive tissues and bone 1 waslower than in bone 2.



Table 3. Characteristics of FGF23 expressing samples

Sample Diagnosis Site Histological featuresExpression/

bone 2

1 Spindle cell tumour/haemangiopericytoma

Right caudalantebrachiumSQ

Densely to loosely packed cells, interweavingbundles and frequent whorls around vessels orcollagen fibres, scant stroma, occasionalmultinucleated cells, large numbers ofinfiltrating inflammatory cells and 1 MF/10 HPF

0.2407

5 Soft tissue sarcoma Right thigh muscle Densely to loosely packed, interwoven bundleswith some areas of whorling, vascular clefts,myxoid stroma, large areas ofthrombosis/necrosis and 4 MF/10 HPF

1.3742

6 Spindle cell tumour/soft tissuesarcoma/haemangiopericytoma

Left thorax SQ Mostly densely packed cells, interweavingbundles and fascicles, occasional whorls aroundvessels, some pseudocysts, small amountcollagenous to myxomatous stroma, somemultinucleated cells with peripheralized nucleiand 2 MF/10 HPF

0.0271

14 Soft tissue sarcoma Left flank/legskin/SQ

Densely packed cells with haphazardarrangement, occasional large peripheralwhorls, sparse collagenous stroma and 3 MF/10HPF

0.0277


Lateral elbowskin/SQ

Mostly densely packed cells, storiform andwhorling arrangement, small amount ofcollagenous stroma, multinucleated cells andmegakaryotic cells seen, pseudocysts, 3 MF/10HPF and some necrosis

0.0004


Right thigh SQ Dense to loosely packed cells, storiform andwhorling arrangement, small amount ofcollagenous/myxomatous stroma and 1–2MF/10 HPF

0.0467


Left shoulder SQ Dense to loosely packed cells, interweavingbundles and whorling cells, occasionalpalisading around vessels, small/moderateamount of collagenous stroma, occasionalmultinucleated cells and pseudocysts and 1–2MF/10 HPF

0.0301

27 Haemangiopericytoma Sciatic nervesheath

Densely packed interweaving bundles and whorlsarranged around blood vessels, well-developedfibrovascular stroma, multifocal eosinophiliccrystalline deposits and 4 MF/10 HPF

0.0015

30 Fibrosarcoma Left scapula SQ Densely packed cells, interweaving bundles,occasional whorls around vessels, fine stroma,small area of necrosis and 12 MF/10 HPF

0.0494

32 Metastatic mixedsarcoma withelements ofmyoepithelialsarcoma,myxosarcoma andchondrosarcoma

Abdominal wall SQ(masses also inlung, brain,heart and kid-ney) – possiblyof mammaryorigin

Loosely packed cells, streaming to whorlingwithin myxomatous to chondroid stroma (insome areas cells arranged in a reticular patternwith sparse stroma), large areas of necrosis and15 MF/10 HPF

2.5052

34 Sarcoma Middle of leftgastrocnemiusmuscle,metastasis tolungs

Loosely packed cells forming interweavingbundles in a herring bone pattern, peripheralwhorling, well-developed fibrovascular stroma,small areas of necrosis and mild lymphocyteinfiltration and 18 MF/10 HPF

0.0428

43 Sarcoma (PossibleMyxosarcoma)

Right axilla SQ Streaming cells loosely packed in myxoid stroma,occasional interweaving, areas of thrombosisand necrosis and 59 MF/10 HPF

1.0299



Table 3. Continued

Sample Diagnosis Site Histological featuresExpression/

bone 2

44 Poorly differentiatedsarcoma

Left stifle muscle Solid sheets of cells, occasional megakaryoticcells, rare multinucleated cells, fine stroma and42 MF/10 HPF

0.0447

48 Fibrosarcoma Retropharynx Densely packed cells, interweaving bundles andsheets, occasional pseudocysts, small amountof collagenous stroma and 15 MF/10 HPF

0.0200

50 Spindle cell tumour Mass right axilla,SQ

Loose to densely packed spindle cells formingwhorls around blood vessels and interleavingbundles, large area central necrosis, abundantcollagenous stroma, focal lymphocyte infiltrateand 20 MF/10 HPF

0.0194

Dog A Kidney – – 0.0548Dog B Lung – – 0.5653Dog B Kidney – – 0.0968Dog C Thymus – – 0.5813Dog C Mesenteric lymph

node– – 0.2438

Dog Bone 1 – – 0.0128Dog C Bone 2 – – 1.0

SQ, subcutaneous site; MF, mitotic figures; HPF, high power field (×400).

Discussion

In this study, we have demonstrated through RNAextraction followed by end point and qRT-PCR thatcanine soft tissue sarcomas may express FGF23.Importantly, FGF23 expression was not detectedin control tissues sampled from sites typically giv-ing rise to canine soft tissue sarcomas (e.g. skin,skeletal muscle, tendon, fat, fascia, arteries, veinsand nerves). This is significant as it indicates thatany FGF23 expression in these tissues is normallyeither very low/undetectable within the protocolsdescribed, or absent; therefore the discovery ofFGF23 mRNA in canine soft tissue sarcomas couldsuggest an abnormal level of FGF23 expression bythese tumours.

TIO has never been diagnosed in dogs; how-ever, given our findings it is tempting to speculatethat it could occur, particularly given the high fre-quency with which dogs are diagnosed with softtissue sarcomas. Proof of principle lies in the arti-cle published by Aschinberg et al.13 These investi-gators intravenously injected a 6-week-old puppywith a homogenated extract from tumour causingTIO in a human patient, and documented a markedphosphaturia following this injection. Although thecausative factors were not identified at that time, it

Figure 2. A tumour sample with high relative expression ofFGF23 (No. 32). Note the prominent myxoid stroma andloosely packed streams of spindloid cells. H&E.

seems likely that a phosphatonin caused this effect.This suggests that canine kidneys participate in aphosphatonin axis homologous to that found inhumans, although further work would be requiredto establish this.

TIO could be overlooked in some canine softtissue sarcoma patients. In humans, osteomalaciacauses proximal muscle weakness, gait abnormal-ities and bone pain, which may be confused witharthritic pain.41 This confusion seems likely to



Figure 3. A graphical representation of the tumour FGF23expression data from Table 3, where the ‘x’ axis representsthe tumour sample number and the ‘y’ axis indicatesexpression of FGF23 relative to bone 2 in real-time qPCR.

be even more common in dogs, who cannot beinterrogated regarding the source of their pain,and in whom the source of locomotive abnor-malities or pain is often hard to define on clinicalexamination.42,43 If radiographic examination ofpainful sites was performed in a case of canineTIO, the subtle signs of osteomalacia could beoverlooked given the difficulty that human radi-ologists have in diagnosing this disease on surveyradiographs,44 and the low index of suspicionmost practitioners would have for osteomalacia incanines.1 Hypophosphatemia in veterinary patientsis not commonly recognized,45 and is generallyassigned significance only in animals with dramaticclinical syndromes such as diabetic ketoacidosis,re-feeding syndrome or hyperparathyroidism.46 Itcan therefore be speculated that hypophosphatemiawould rarely be considered further in the biochem-ical assessment of a dog with ‘osteoarthritis’ and/ora soft tissue sarcoma. While none of the dogs inthis study were diagnosed with osteomalacia, mostof the FGF23 positive tumours were located ineasily palpable subcutaneous sites; their locationwould have facilitated rapid surgical resection,perhaps allowing insufficient time for osteomalaciato become clinically apparent.

The RT-PCR positive tumours varied consider-ably in their original diagnosis, location, histolog-ical description and expression of FGF23 relativeto bone on real-time qPCR analysis. This contrastswith the typical features of PMT-MCT in humans,which as discussed earlier tend to have similar clin-ical features (e.g. obscure location),3 presumptive

diagnosis (e.g. haemangiopericytoma)15 andhistological features (e.g. ‘grungy’, myxoid to chon-droid stroma).15 It is interesting to note that thethree tumours with the highest relative expressionof FGF23 (tumours 5, 32 and 43) had a more myxoidto chondroid stroma than the other tumours tested;also, tumour 5 was located in an obscure location(muscle). A recent paper using real-time qPCRfound that FGF23 expression in human PMT-MCTwas on an average 10 000 times higher than innon-TIO-associated mesenchymal tumours.47 Theexpression difference between tumours 5, 32, 43and the other FGF23-positive tumours in thisstudy varied up to 5590-fold, suggesting that thesetumours could have been responsible for TIO.

However, because TIO has never been diag-nosed in dogs, it is necessary to consider alternativeexplanations for our experimental findings. Evenif adequately expressed, it is well documented thatmany proteins are never produced or exported bycells. Their mRNA may be degraded or interferedwith preventing translation, and post-translationaldegradation of proteins is also reported. Whiteet al.48 speculated that in normal humans, secretedfull-length FGF23 is rapidly cleaved by a serineprotease (one of the subtilisin-like proprotein con-vertases) resulting in its inactivation; they sug-gested that TIO was only seen when a tumoursecreted enough FGF23 to overcome this natu-ral post-translational processing. It is notable thatanother study comparing real-time qPCR expres-sion of FGF23 in TIO and a range of normalhuman tissues found that expression of FGF23 inTIO-associated tumours was between 62 and 54 087times greater than FGF23 expression in bone.17

Tumours 5, 32 and 43 enter the low end of this rangeif compared to bone 1, while all the canine tumoursin this study fall well outside this range if comparedto bone 2. It is therefore difficult to determine ifthe FGF23 expression in canine soft tissue sarcomaswould exert a clinical effect.

In humans, increased concentrations of FGF23do not always lead to osteomalacia. Increasesin serum FGF23 have been detected in cancerpatients without hypophosphatemia or evidence ofosteomalacia49; in addition, Bahrami et al.50 identi-fied a number of PMT-MCT and non-PMT-MCTthat were positive for FGF23 expression, but were



not associated with TIO. The reasons for these find-ings are unclear, but it may be that inconsequentialFGF23 over-expression is also seen in dogs.

Whatever the explanation, it remains that FGF23expression has been detected in nearly a third of thecanine soft tissue sarcomas included in this study.To delineate which of the hypotheses discussedearlier is correct, further work is required. Immuno-histochemistry of FGF23 positive tumours wouldconfirm the production of FGF23 to protein level,and determine tumour homology to reported caseseries of human PMT-MCTs.15 Confirmation thatFGF23 protein is excessively produced by caninesoft tissue sarcomas could lead to prospective anal-ysis of living patients diagnosed with soft tissue sar-coma on cytology or biopsy.

Canine FGF23 RNA was consistently amplifiedfrom normal dog bone and was also amplifiedfrom the lung, kidney, mesenteric lymph nodeand thymus of normal dogs. FGF23 expressionin these organs has been documented in otherspecies17,21,51,52; expression in the one sample oflung might also be explained by the presence ofinflammation, given recent studies suggestingFGF23 expression in tissues by, or induced bymacrophages.53. In this study, only intact femaledog soft tissue samples were used, so it would bedesirable to test a range of normal tissues frommale and desexed dogs, as there is currently uncer-tainty over the relationship between oestrogen andFGF23.54 Further investigation will be required toallow direct comparison of canine FGF23 tissueexpression to that documented in other species.

In summary, a range of canine soft tissue sarco-mas were tested for expression of canine fibroblastgrowth factor 23. Fifteen of forty-nine were positivefor FGF23, and three of these tumours had highrelative quantitative expression of fibroblast growthfactor 23 with some features similar to humanPMT-MCT, suggesting that TIO could be a hereto-fore unrecognized paraneoplastic complication insome dogs with soft tissue sarcomas.

Acknowledgements

The authors gratefully acknowledge the originaldiagnosis and supply of tumour samples by Adri-enne French of New Zealand Veterinary Pathology,

and the Pathobiology Section of the Institute of Vet-erinary, Animal and Biomedical Sciences, MasseyUniversity. We also acknowledge the advice andsupport provided by Dr Laryssa Howe, and tech-nical assistance from Evelyn Lupton and EugeneNdeki.

This work was generously supported by theIVABS Postgraduate Research Fund and the LewisFitch Research Fund.

Conflict of interest

The authors declare no conflicts of interest.

References1. Dittmer KE and Thompson KG. Vitamin D

metabolism and rickets in domestic animals: areview. Veterinary Pathology 2011; 48: 389–407.

2. LeVine DN, Zhou Y, Ghiloni RJ, Fields EL,Birkenheuer AJ, Gookin JL, Roberston ID, Malloy PJand Feldman D. Hereditary 1,25-dihydroxyvitaminD-resistant rickets in a Pomeranian dog caused by anovel mutation in the vitamin D receptor gene.Journal of Veterinary Internal Medicine 2009; 23:1278–1283.

3. Ryan EA and Reiss E. Oncogenous osteomalacia.Review of the world literature of 42 cases and reportof two new cases. The American Journal of Medicine1984; 77: 501–512.

4. Weiss D, Bar RS, Weidner N, Wener M and Lee F.Oncogenic osteomalacia: strange tumours in strangeplaces. Postgraduate Medical Journal 1985; 61:349–355.

5. Evans DJ and Azzopardi JG. Distinctive tumours ofbone and soft tissue causing acquiredvitamin-D-resistant osteomalacia. Lancet 1972; 1:353–354.

6. Fukumoto S, Takeuchi Y, Nagano A and Fujita T.Diagnostic utility of magnetic resonance imagingskeletal survey in a patient with oncogenicosteomalacia. Bone 1999; 25: 375–377.

7. Dewitt CA, Collins MT and Cowen EW. Diffusepain, hypophosphatemia, and a subcutaneousnodule. Journal of the American Academy ofDermatology 2007; 57: 509–512.

8. Takeuchi Y, Suzuki H, Ogura S, Imai R, Yamazaki Y,Yamashita T, Miyamoto Y, Okazaki H, Nakamura K,Nakahara K, Fukumoto S and Fujita T. Venoussampling for fibroblast growth factor-23 confirmspreoperative diagnosis of tumor-inducedosteomalacia. Journal of Clinical Endocrinology andMetabolism 2004; 89: 3979–3982.



9. de Beur SMJ, Streeten EA, Civelek AC, McCarthyEF, Uribe L, Marx SJ, Onobrakpeya O, Raisz LG,Watts NB, Sharon M and Levine MA. Localisation ofmesenchymal tumours by somatostatin receptorimaging. Lancet 2002; 359: 761–763.

10. Dupond JL, Mahammedi H, Prié D, Collin F, Gil H,Blagosklonov O, Ricbourg B, Meaux-Ruault N andKantelip B. Oncogenic osteomalacia: diagnosticimportance of fibroblast growth factor 23 and F-18fluorodeoxyglucose PET/CT scan for the diagnosisand follow-up in one case. Bone 2005; 36: 375–378.

11. Halperin F, Anderson RJ and Mulder JE.Tumor-induced osteomalacia: the importance ofmeasuring serum phosphorus levels. Nature ClinicalPractice Endocrinology & Metabolism 2007; 3:721–725.

12. Imanishi Y, Nakatsuka K, Nakayama T, Okamura T,Kobayashi K, Nakayama K, Ishimura E, Inaba M andNishizawa Y. False-positive magnetic resonanceimaging skeletal survey in a patient with sporadichypophosphatemic osteomalacia. Journal of Boneand Mineral Metabolism 2003; 21: 57–59.

13. Aschinberg LC, Solomon LM, Zeis PM, Justice P andRosenthal IM. Vitamin D-resistant rickets associatedwith epidermal nevus syndrome: demonstration of aphosphaturic substance in the dermal lesions.Journal of Pediatrics 1977; 91: 56–60.

14. Salassa RM, Jowsey J and Arnaud CD.Hypophosphatemic osteomalacia associated with"nonendocrine" tumors. The New England Journal ofMedicine 1970; 283: 65–70.

15. Folpe AL, Fanburg-Smith JC, Billings SD, BiscegliaM, Bertoni F, Cho JY, Econs MJ, Inwards CY, deBeur SMJ, Mentzel T, Montgomery E, Michal M,Miettinen M, Mills SE, Reith JD, O’Connell JX,Rosenberg AE, Rubin BP, Sweet DE, Vinh TN, WoldLE, Wehrli BM, White KE, Zaino RJ and Weiss SW.Most osteomalacia-associated mesenchymal tumorsare a single histopathologic entity: an analysis of 32cases and a comprehensive review of the literature.American Journal of Surgical Pathology 2004; 28:1–30.

16. Larsson T, Marsell R, Schipani E, Ohlsson C,Ljunggren Ö, Tenenhouse HS, Jüppner H andJonsson KB. Transgenic mice expressing fibroblastgrowth factor 23 under the control of the alpha1(I)collagen promoter exhibit growth retardation,osteomalacia, and disturbed phosphate homeostasis.Endocrinology 2004; 145: 3087–3094.

17. Mirams M, Robinson BG, Mason RS and Nelson AE.Bone as a source of FGF23: regulation by phosphate?Bone 2004; 35: 1192–1199.

18. Sitara D, Razzaque MS, St-Arnaud R, Huang W,Taguchi T, Erben RG and Lanske B. Genetic ablation

of vitamin D activation pathway reversesbiochemical and skeletal anomalies in Fgf-23-nullanimals. The American Journal of Pathology 2006;169: 2161–2170.

19. Bergwitz C and Jüppner H. Regulation of phosphatehomeostasis by PTH, vitamin D, and FGF23. AnnualReview of Medicine 2010; 61: 91–104.

20. Berndt T and Kumar R. Phosphatonins and theregulation of phosphate homeostasis. Annual Reviewof Physiology 2007; 69: 341–359.

21. Shimada T, Mizutani S, Muto T, Yoneya T, Hino R,Takeda S, Takeuchi Y, Fujita T, Fukumoto S andYamashita T. Cloning and characterization of FGF23as a causative factor of tumor-induced osteomalacia.Proceedings of the National Academy of Sciences ofthe United States of America 2001; 98: 6500–6505.

22. Chong WH, Molinolo AA, Chen CC and CollinsMT. Tumor-induced osteomalacia.Endocrine-Related Cancer 2011; 18: R53–R77.

23. Larsson T, Zahradnik R, Lavigne J, Ljunggren Ö,Jüppner H and Jonsson KB. Immunohistochemicaldetection of FGF-23 protein in tumors that causeoncogenic osteomalacia. European Journal ofEndocrinology 2003; 148: 269–276.

24. White KE, Jonsson KB, Carn G, Hampson G,Spector TD, Mannstadt M, Lorenz-Depiereux B,Miyauchi A, Yang IM, Ljunggren Ö, Meitinger T,Strom TM, Jüppner H and Econs MJ. The autosomaldominant hypophosphatemic rickets (ADHR) geneis a secreted polypeptide overexpressed by tumorsthat cause phosphate wasting. Journal of ClinicalEndocrinology and Metabolism 2001; 86: 497–500.

25. Jonsson KB, Zahradnik R, Larsson T, White KE,Sugimoto T, Imanishi Y, Yamamoto T, Hampson G,Koshiyama H, Ljunggren Ö, Oba K, Yang IM,Miyauchi A, Econs MJ, Lavigne J and Jüppner H.Fibroblast growth factor 23 in oncogenicosteomalacia and X-linked hypophosphatemia. TheNew England Journal of Medicine 2003; 348:1656–1663.

26. Lorenz-Depiereux B, Schnabel D, Tiosano D,Häusler G and Strom TM. Loss-of-function ENPP1mutations cause both generalized arterialcalcification of infancy and autosomal-recessivehypophosphatemic rickets. The American Journal ofHuman Genetics 2010; 86: 267–272.

27. Riminucci M, Collins MT, Fedarko NS, Cherman N,Corsi A, White KE, Waguespack S, Gupta A,Hannon T, Econs MJ, Bianco P and Gehron RobeyP. FGF-23 in fibrous dysplasia of bone and itsrelationship to renal phosphate wasting. The Journalof Clinical Investigation 2003; 112: 683–692.

28. Rowe PS. Regulation of bone-renal mineral andenergy metabolism: the PHEX, FGF23, DMP1,



MEPE ASARM pathway. Critical Reviews inEukaryotic Gene Expression 2012; 22: 61–86.

29. Vogel P, Hansen GM, Read RW, Vance RB, Thiel M,Liu J, Wronski TJ, Smith DD, Jeter-Jones S andBrommage R. Amelogenesis imperfecta and otherbiomineralization defects in Fam20a and Fam20cnull mice. Veterinary Pathology 2012; 49: 998–1017.

30. Liu S and Quarles LD. How fibroblast growth factor23 works. Journal of the American Society ofNephrology 2007; 18: 1637–1647.

31. Crenshaw TD, Rortvedt LA and Hassen Z. TriennialGrowth Symposium: a novel pathway for vitaminD-mediated phosphate homeostasis: implications forskeleton growth and mineralization. Journal ofAnimal Science 2011; 89: 1957–1964.

32. Bobeck EA, Burgess KS, Jarmes TR, Piccione MLand Cook ME. Maternally-derived antibody tofibroblast growth factor-23 reduced dietaryphosphate requirements in growing chicks.Biochemical and Biophysical ResearchCommunications 2012; 420: 666–670.

33. Finch NC, Geddes RF, Syme HM and Elliott J.Fibroblast growth factor 23 (FGF-23) concentrationsin cats with early nonazotemic chronic kidneydisease (CKD) and in healthy geriatric cats. Journalof Veterinary Internal Medicine 2013; 27: 227–233.

34. Geddes RF, Finch NC, Syme HM and Elliott J. Therole of phosphorus in the pathophysiology ofchronic kidney disease. Journal of VeterinaryEmergency and Critical Care 2013; 23: 122–133.

35. Geddes RF, Finch NC, Elliott J and Syme HM.Fibroblast growth factor 23 in feline chronic kidneydisease. Journal of Veterinary Internal Medicine 2013;27: 234–241.

36. Williams TL, Elliott J and Syme HM. Calcium andphosphate homeostasis in hyperthyroid cats -associations with development of azotaemia andsurvival time. Journal of Small Animal Practice 2012;53: 561–571.

37. Wood SH, Clements DN, McEwan NA, Nuttall Tand Carter SD. Reference genes for canine skinwhen using quantitative real-time PCR. VeterinaryImmunology and Immunopathology 2008; 126:392–395.

38. Ayers D, Clements DN, Salway F and Day PJR.Expression stability of commonly used referencegenes in canine articular connective tissues. BMCVeterinary Research 2007; 3: 7.

39. Peters IR, Peeters D, Helps CR and Day MJ.Development and application of multiple internalreference (housekeeper) gene assays for accuratenormalisation of canine gene expression studies.Veterinary Immunology and Immunopathology 2007;117: 55–66.

40. Deben C, Zwaenepoel K, Boeckx C, Wouters A,Pauwels P, Peeters M, Lardon F, Baay M andDeschoolmeester V. Expression analysis on archivalmaterial revisited: isolation and quantification ofRNA extracted from FFPE samples. DiagnosticMolecular Pathology: the American Journal ofSurgical Pathology, Part B 2013; 22: 59–64.

41. Thacher TD and Clarke BL. Vitamin D insufficiency.Mayo Clinic Proceedings 2011; 86: 50–60.

42. McKee M. Lameness and weakness in dogs: is itorthopaedic or neurological? In Practice 2007; 29:434–444.

43. Muir P. Physical examination of lame dogs.Compendium on Continuing Education for thePracticing Veterinarian 1997; 19: 1149–1161.

44. Krestan C and Hojreh A. Imaging of insufficiencyfractures. European Journal of Radiology 2009; 71:398–405.

45. Hooft KV, Drobatz KJ and Ward CR.Hypophosphatemia. Compendium on ContinuingEducation for the Practicing Veterinarian 2005; 27:900–911.

46. Schropp DM and Kovacic J. Phosphorus andphosphate metabolism in veterinary patients.Journal of Veterinary Emergency and Critical Care2007; 17: 127–134.

47. Imanishi Y, Hashimoto J, Ando W, Kobayashi K,Ueda T, Nagata Y, Miyauchi A, Koyano HM, Kaji H,Saito T, Oba K, Komatsu Y, Morioka T, Mori K,Miki T and Inaba M. Matrix extracellularphosphoglycoprotein is expressed in causativetumors of oncogenic osteomalacia. Journal of Boneand Mineral Metabolism 2012; 30: 93–99.

48. White KE, Carn G, Lorenz-Depiereux B,Benet-Pages A, Strom TM and Econs MJ.Autosomal-dominant hypophosphatemic rickets(ADHR) mutations stabilize FGF-23. KidneyInternational 2001; 60: 2079–2086.

49. Tebben PJ, Kalli KR, Cliby WA, Hartmann LC,Grande JP, Singh RJ and Kumar R. Elevatedfibroblast growth factor 23 in women withmalignant ovarian tumors. Mayo Clinic Proceedings2005; 80: 745–751.

50. Bahrami A, Weiss SW, Montgomery E, Horvai AE,Jin L, Inwards CY and Folpe AL. RT-PCR analysisfor FGF23 using paraffin sections in the diagnosis ofphosphaturic mesenchymal tumors with andwithout known tumor induced osteomalacia.American Journal of Surgical Pathology 2009; 33:1348–1354.

51. Yoshiko Y, Wang H, Minamizaki T, Ijuin C,Yamamoto R, Suemune S, Kozai K, Tanne K, AubinJE and Maeda N. Mineralized tissue cells are a



principal source of FGF23. Bone 2007; 40:1565–1573.

52. Liu S, Guo R, Simpson LG, Xiao Z-S, Burnham CEand Quarles LD. Regulation of fibroblastic growthfactor 23 expression but not degradation by PHEX.Journal of Biological Chemistry 2003; 278:37419–37426.

53. van Venrooij NA, Pereira RC, Tintut Y, FishbeinMC, Tumber N, Demer LL, Salusky IB and

Wesseling-Perry K. FGF23 protein expression incoronary arteries is associated with impaired kidneyfunction. Nephrology, Dialysis, Transplantation 2014:1–8. January 23. [Epub ahead of print].

54. Wetmore JB. The link between estrogen andfibroblast growth factor 23. American Journal ofKidney Diseases 2011; 58: 695–696.


Documents

Hardcastle Et Al-2014-Veterinary and Comparative Oncology