Genome mapping Genome sequencing Next Gen sequencing

  • View
    217

  • Download
    4

Embed Size (px)

Text of Genome mapping Genome sequencing Next Gen sequencing

  • Slide 1
  • Genome mapping Genome sequencing Next Gen sequencing
  • Slide 2
  • Genomics = resources genome maps genome sequences genome clones DNA microarrays whole gene collections functional genomics! 1980- 1998 1977- 2003
  • Slide 3
  • DNA mapping Genomics = In the beginning. ~ 1980 - 1998
  • Slide 4
  • http://home.comcast.net/~dmgt350/cytogenetics/images/ktype.gif
  • Slide 5
  • ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGT GTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCT AGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCA TTGTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACAT TGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAGACAGTTGACTGTATCGATTGACTCGGCAGC TCATCATGATAACTCCACAATTCCGTTGGATTTTATGCCCAGGGATGCTCTTCATGGATTTGATTGGTCTGAAGAGGATGACATGTCGGAT GGCTTGCCCTTCCTGAAAACGGACCCCAACAATAATGGGTTCTTTGGCGACGGTTCTCTCTTATGTATTCTTCGATCTATTGGCTTTAAAC CGGAAAATTACACGAACTCTAACGTTAACAGGCTCCCGACCATGATTACGGATAGATACACGTTGGCTTCTAGATCCACAACATCCCGTTT ACTTCAAAGTTATCTCAATAATTTTCACCCCTACTGCCCTATCGTGCACTCACCGACGCTAATGATGTTGTATAATAACCAGATTGAAATC GCGTCGAAGGATCAATGGCAAATCCTTTTTAACTGCATATTAGCCATTGGAGCCTGGTGTATAGAGGGGGAATCTACTGATATAGATGTTT TTTACTATCAAAATGCTAAATCTCATTTGACGAGCAAGGTCTTCGAGTCAGGTTCCATAATTTTGGTGACAGCCCTACATCTTCTGTCGCG ATATACACAGTGGAGGCAGAAAACAAATACTAGCTATAATTTTCACAGCTTTTCCATAAGAATGGCCATATCATTGGGCTTGAATAGGGAC CTCCCCTCGTCCTTCAGTGATAGCAGCATTCTGGAACAAAGACGCCGAATTTGGTGGTCTGTCTACTCTTGGGAGATCCAATTGTCCCTGC TTTATGGTCGATCCATCCAGCTTTCTCAGAATACAATCTCCTTCCCTTCTTCTGTCGACGATGTGCAGCGTACCACAACAGGTCCCACCAT ATATCATGGCATCATTGAAACAGCAAGGCTCTTACAAGTTTTCACAAAAATCTATGAACTAGACAAAACAGTAACTGCAGAAAAAAGTCCT ATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGATATTTCCACCA CCGCTCTAACCAATTTGTTGAAGGAACACCCTTGGCTATCCTTTACAAGATTCGAACTGAAGTGGAAACAGTTGTCTCTTATCATTTATGT ATTAAGAGATTTTTTCACTAATTTTACCCAGAAAAAGTCACAACTAGAACAGGATCAAAATGATCATCAAAGTTATGAAGTTAAACGATGC TCCATCATGTTAAGCGATGCAGCACAAAGAACTGTTATGTCTGTAAGTAGCTATATGGACAATCATAATGTCACCCCATATTTTGCCTGGA ATTGTTCTTATTACTTGTTCAATGCAGTCCTAGTACCCATAAAGACTCTACTCTCAAACTCAAAATCGAATGCTGAGAATAACGAGACCGC ACAATTATTACAACAAATTAACACTGTTCTGATGCTATTAAAAAAACTGGCCACTTTTAAAATCCAGACTTGTGAAAAATACATTCAAGTA CTGGAAGAGGTATGTGCGCCGTTTCTGTTATCACAGTGTGCAATCCCATTACCGCATATCAGTTATAACAATAGTAATGGTAGCGCCATTA AAAATATTGTCGGTTCTGCAACTATCGCCCAATACCCTACTCTTCCGGAGGAAAATGTCAACAATATCAGTGTTAAATATGTTTCTCCTGG CTCAGTAGGGCCTTCACCTGTGCCATTGAAATCAGGAGCAAGTTTCAGTGATCTAGTCAAGCTGTTATCTAACCGTCCACCCTCTCGTAAC TCTCCAGTGACAATACCAAGAAGCACACCTTCGCATCGCTCAGTCACGCCTTTTCTAGGGCAACAGCAACAGCTGCAATCATTAGTGCCAC TGACCCCGTCTGCTTTGTTTGGTGGCGCCAATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAG CAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAAT AATGAAATCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTG GAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAA AATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGATATTTCCACC TTTATGGTCGATCCATCCAGCTTTCTCAGAATACAATCTCCTTCCCTTCTTCTGTCGACGATGTGCAGCGTACCACAACAGGTCCCACCAT ATATCATGGCATCATTGAAACAGCAAGGCTCTTACAAGTTTTCACAAAAATCTATGAACTAGACAAAACAGTAACTGCAGAAAAAAGTCCT ATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGATATTTCCACCA ACTTCAAAGTTATCTCAATAATTTTCACCCCTACTGCCCTATCGTGCACTCACCGACGCTAATGATGTTGTATAATAACCAGATTGAAATC ( [G][A][T][C] ) 3,000,000,000
  • Slide 6
  • Cytogenetic Band 5-10 Mb .TTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCA. 1 bp resolution BACs YACs 100s to 1000s of Kb (0.1-1 Mb) Cosmids Plasmids 10s Of Kb resolution Physical maps
  • Slide 7
  • Genetic map of the Drosophila X chromosome 1913 Sturtevant, A. H. 1913. The linear arrangement of six sex- linked factors in Drosophila, as shown by their mode of association. Journal of Experimental Zoology, 14: 43-59. www.dnaftb.org/dnaftb/ concept_11/con11bio.html
  • Slide 8
  • Genetic map of the yeast genome, 1960 Hawthorne & Mortimer GENETICS 1960 45: 1085 - 1110
  • Slide 9
  • His - Trp - X a haploid haploid Trp - His - a/ diploid
  • Slide 10
  • His - Trp - His - Trp - two meiotic divisions 100% parental meiosis
  • Slide 11
  • His - Trp - X a haploid haploid Trp - His - a/ diploid
  • Slide 12
  • His - Trp - His - Trp - two meiotic divisions 50% parental 50% recombinant (non-parental) His - Trp -
  • Slide 13
  • His - Trp - His - Trp - two meiotic divisions 100% parental 0% recombinant (non-parental) Trp - His -
  • Slide 14
  • Trp - His - Trp - two meiotic divisions 50% recombinant His - Trp -
  • Slide 15
  • His - Trp - His - Trp - two meiotic divisions 0% recombinant Trp - > His -
  • Slide 16
  • Trp - His - Trp - two meiotic divisions 50% parental 50% recombinant (non-parental) His - Trp - Tetratype
  • Slide 17
  • His - Trp - His - Trp - two meiotic divisions 100% parental Parental ditype
  • Slide 18
  • Mortimer & Hawthorne GENETICS 53: 165-173 1966 50% recombinants 0% recombinants 40% recombinants 16% recombinants T = 49 * 4 = 196 spores/2 = 98r PD = 14 * 4 = 56 spores = 0r NPD = 15 * 4 = 56 spores = 56r 308 spores 154r
  • Slide 19
  • Mortimer & Hawthorne GENETICS 53: 165-173 1966 c 19951966
  • Slide 20
  • Cytogenetic Band 5-10 Mb Genetic Map Cm YACs ~1 Mb BACs ~150 Kb clones ~15 Kb
  • Slide 21
  • Slide 22
  • Slide 23
  • GENETICS 134: 81-150 (1993)
  • Slide 24
  • YAC ClonesCosmid Clones Genome the more pieces in the puzzle, the harder it is to assemble
  • Slide 25
  • Marra et al., 1997 High throughput fingerprint analysis of large-insert clones. Genome Res. 7:1072
  • Slide 26
  • Genome mapping Meyers BC, Scalabrin S, Morgante M (2004) Nature Reviews Genetics 5: 578 finishing
  • Slide 27
  • Marra et al., 1997 High throughput fingerprint analysis of large-insert clones. Genome Res. 7:1072 Finishing
  • Slide 28
  • Genome mapping Meyers BC, Scalabrin S, Morgante M (2004) Nature Reviews Genetics 5: 578 finishing
  • Slide 29
  • Sequence-ready BAC map Green ED Nat Rev Genetics 2001 2:573-83
  • Slide 30
  • Genome maps Meyers BC, Scalabrin S, Morgante M (2004) Nature Reviews Genetics 5: 578
  • Slide 31
  • CTAGTACTGTCG CAGTGCTATTAG 200-500 bp STS: SequenceTagged Sites
  • Slide 32
  • Closely linked STSsSTSs farther apart closely linked markersmarkers farther apart
  • Slide 33
  • T.A. Brown GENOMES 2 BIOS Scientific Publishers Ltd, 2002 Radiation hybrid cell lines
  • Slide 34
  • Cox DR et al. 1990 Radiation hybrid mapping: a somatic cell genetic method for constructing high resolution maps of mammalian chromosomes. Science 250: 245250. PMID: 2218528 Radiation hybrid mapping
  • Slide 35
  • His - Trp - His - Trp - two meiotic divisions 50% recominant >> 0% recombinant Trp -
  • Slide 36
  • Cox DR et al. 1990 Radiation hybrid mapping: a somatic cell genetic method for constructing high resolution maps of mammalian chromosomes. Science 250: 245250. PMID: 2218528 Radiation hybrid mapping CTAGTACTGTCG CAGTGCTATTA G
  • Slide 37
  • Human Molecular Genetics 2, Strachan and Read 1999 Garland Science STS content mapping
  • Slide 38
  • Eric Green, NHGRI
  • Slide 39
  • Cytogenetic Band 5-10 Mb YACs ~1 Mb BACs ~150 Kb STS mapping fingerprint mapping
  • Slide 40
  • RFLPs Donis-Keller H et al. A genetic map of the human genome. Cell. (1987); 51: 319337 PMID: 3664638 Human Genome Genetic Map 1987 10 Mb resolution probe X X 1 2 3 haplotypes
  • Slide 41
  • Human Genome Genetic Map 1996