Genetics

Biology I

Chromosomes

Chromatid

Chromatid

Centromere↓

database of genes that are on each chromosome (hax1, fuca1)

Karyotype – spread of human chromosomes to look for chromosomal abnormalities

OROR

Chromosome Terminology Homologous Chromosomes – paired

chromosomes – same size, same banding pattern, same type of genes but not necessarily the exact same forms of each gene Example – gene on one chromosome for

brown eyes and gene on its homologue for blue eyes

GGGTCAGTCATTTTAAGAGATC

GGGAAAGTCATTTTAAGAGATC

Remember – Sister Chromatids are two halves of the same double chromosome and are exact copies of one another

Real Karyotype

Down’s Syndrome Karyotype

Cell Types and Chromosome Types Diploid – cell with the normal # of

chromosomes (2n) Haploid – cell with ½ the normal number

of chromosomes (n) Somatic cell – normal body cell Sex Cell, gamete – sperm and egg –

haploid cells Germ cell – 2n cell that is the precursor

to the gametes Autosomes – chromosomes 1-22 Sex chromosomes – X and Y, necessary

to determine sex, but code for many proteins not related to sex and found in all cells

Meiosis – cell division process that produces the sperm and egg (n)

Purpose of Meiosis To make haploid sex cells so that

when they come together, the zygote has the normal amount of DNA (2n)

EggEgg

nn

SpermSperm

nn

ZygoteZygote

2n2n

FertilizationFertilization

→→MitosisMitosis

EmbryoEmbryo

Steps of Meiosis

Chromosomes form and homologous pairs come together

Germ Cell (2n) in G1 (46 single chromosomes)

S-Phase – copy all DNA so after have 46 double chromosomes

When Chromosomes form in meiosis I – 46 doubles

Crossing over in Prophase I

Homologous Pairs line up down center

Still 46 doubles or

23 double pairs

Each daughter cell has 23 double chromosomes – no longer have pairs – just one of each pair

Meiosis I is the reduction division because the cell went from 46 chromosomes or 23 pairs to just 23 chromosomes

The daughter cells are now haploid but they don’t yet have ½ of the DNA of the orginial germ cell, they must undergo meiosis II

Chromosomes reform in the two daughter cells

Each individual chromosome lines up down the center and sister chromatids split

Now that sister chromatids split – we have 23 single chromosomes – ½ the DNA of a normal cell – this is the finished sex cell

Summary

Meiosis happens only in ovaries and testes to make sperm and egg

Sperm and egg have only 1 of each pair of chromosomes and are haploid

Sex cells come together to make a zygote that contains a pair of each chromosomes again and is diploid

Meiosis Animation

Mitosis vs. Meiosis

Egg vs. Sperm

Each germ cell forms 4 sperm of equal size

Sperm form everyday throughout life in a male

Each germ cell forms 1 large egg (cytoplasm divides unequally and small cells disintegrate)

Females are born with all of the eggs they will ever have

Sexual Reproduction Brings about Variation by: Crossing Over Independent Assortment

Amount of variation due to IA – 2n

In humans = 2 23 = 8 million Random Fertilization

8 million x 8 million = 64 TRILLION combinations

Crossing Over makes this almost infinite

Chromosomal Abnormalities Trisomy or Monosomy due to

non-disjunction during meiosis Chromosomal deletions (a

piece of a chromosome breaks off)

Chromosomal Translocations (whole or parts of chromosomes)

Chromosomal Inversions

Non-disjunction causes trisomy’s, monosomy’s, and

aneuploidy

Chromosomal Abnormalities

Translocation of chromosome 13 and 14 – normal phenotype

Translocation Abnormality Philadelphia Chromosome

A piece of chromosome 22 is translocated to chromosome 9 causing Chronic Myelogenous Leukemia

Chromosomal Deletions

Each chromosome 22 on the right of each pair is missing a piece

Cri-du-chat – have a deletion from chromosome #5 and the babies sound like a cat crying – mental retardation and heart disease

Mendel

Mendelian Principles Alleles – different forms of the

same gene Dominant – gene that is seen Recessive – only seen if with

another recessive allele Homozygous – having 2 like alleles Heterozygous – having 2 different

alleles Genotypes – actual gene make-up

for a particular locus or trait Phenotypes – visible trait

Mendelian Laws

Law of SegregationLaw of Segregation - When the gametes form – each gamete receives only 1 of each pair of alleles.

Law of Independent AssortmentLaw of Independent Assortment – If genes aren’t on the same chromosome (linked) they will not have to remain together in the gamete

Independent Assortment

Pairs:Red and GreenYellow and BlackBrown and WhiteBrown String and White String

Line up you pairs as in Metaphase IPick a side to be the gamete

Independent Assortment Red = red hair, thin eyebrows, long fingers, and genetic

disease for cystic fibrosis, light skin Green = brown hair, bushy eyebrows, short fingers, normal,

dark skin Yellow = big nose, hairy fingers, can’t taste sour things, tall Black = small nose, no hair on fingers, can taste sour things,

short Brown = slow metabolism, blue eyes, great cholesterol

receptors, 5 fingers on each hand, dark skin White = fast metabolism, brown eyes, slightly misshapen

cholesterol receptrs. 6 fingers on each hand, light skin White String = light skin, unibrow, mishappen clotting

enzyme Brown String = dark skin, separated brows, normal clotting

enzyme

Punett Squares – Mono and Di-Hybrid Crosses

Used to calculate the probability of Used to calculate the probability of having certain traits in offspringhaving certain traits in offspring

Figure out all possible gametes for male and females

Place them on the outside of the square

Cross the gametes to come up with the possible genotypes and phenotypes of the offspring

Story of Mendel and Punnett Squares

Beyond Mendel Incomplete Dominance – the phenotype

in the heterozygous condition is a mix of the two (white and red snapdragons make pink)

Co-dominance – both alleles are expressed in heterozygous condition (A,B blood types, Roan cattle)

This can become a “gray” area in diseases – Tay Sachs – make ½ normal protein and ½ misshapen – do not exhibit disease so recessive but moleculary have both expressed so is it co-dominance or even incomplete if has a slight effect ????

Multiple Alleles

More than two allele choices although always only have 2 alleles at each gene locus

Example: Human Blood TypesAlleles = A, B, & O (also an example of co-dominance)

Paternity Testing?

Blood TypesBlooBloo

d d TypeType

AntigenAntigens on s on

blood blood cellscells

GenotypeGenotype Body will Body will make Ab make Ab againstagainst

Person Person can can

Donate to:Donate to:

Person Person can can

Receive Receive From:From:

AA

BB

ABAB

OO

Sex-Linked

Located on a sex chromosome Usually is X-linked (few known

genes on the Y) X-linked usually show more in

males since only have 1 allele – only need 1 recessive allele to show

Pedigrees Used to figure out genotypes of

family members to see if someone is carrying a disease gene

Used to determine the mode of inheritance

Practice

Higher Genetics Pleiotropy – one gene effects

many traits

Polygenic – one trait determined by many genes – continuous pattern

Multifactorial – may be multiple genes and the environment

Chromosomal Inheritance Aneuploidy – abnormal

chromosome # (ex. Trisomy) Polyploidy – 3n, 4n (non-

disjunction of all chromosomes) More normal than aneuploid –

some plants live fine but can only reproduce with other polyploid plants

2n egg and 1n sperm = 3n

Or Zygote replicates DNA but doesn’t

divide = 4n

Sex Chromosomes and Chromosomal Inheritance

Non-disjuction of sex chromosomes

XXY – Klinefelter’s (small testes, sterile, breasts)

XYY – taller, more aggressive?? Males

XXX – normal female

XO – Turner’s Syndrome (no secondary sex characteristics, sterile, short)