Click here to load reader

Genetic Engineering. Genetic Engineering: Genetic Engineering: process of altering biological systems by the purposeful manipulation of DNA Applications:

  • View
    214

  • Download
    0

Embed Size (px)

Text of Genetic Engineering. Genetic Engineering: Genetic Engineering: process of altering biological...

Genetic Engineering

Genetic EngineeringGenetic Engineering:Genetic Engineering: process of altering biological systems by the purposeful manipulation of DNAApplications:Production of proteins (insulin, hormones, vaccine)Agriculture: plants can be more suitable for growth and resistant to insects and bacteriaMedicine: diagnosis, medication, gene replacement therapyMethods:Breeding Investigation (Genetic testing for disease, test paternity, investigating crime scenes)Cloning (genes of interest, plants/animals)

BreedingBreeding Methods: are used to get desirable traitsSelective breeding: choosing an organism with desirable traitsInbreeding: mating closely related organisms that have desired traitsDecreases variationHybridization: mating organisms that are not closely related for a mixture of both genesHybrids usually are sterile!

Test Cross ActivityTest cross is one way to determine genotypeHH or Hh? Cross it with a hh and observe offspringIf any express the recessive trait hh then the parent was HhPg:347Read Critical Thinking #1-5

Gene CloningWhy? Some people lack the essential proteins like insulin, thyroxine, etcCreate organisms that have characteristics of other organism

How to clone genes?Identify gene of interestCut it out using a restriction enzymeRestriction enzyme recognizes a specific DNA nucleotide sequence and cuts at that siteCut a vector (usually a plasmid (circular DNA) of a bacteria)Insert cut gene of interest into vector using sticky ends (called splicing)Insert the plasmid back into the host (bacteria)This technique is called Recombinant DNA to create a transgenic organism (organism that contains foreign genes)

Diagram of CleavageGAATTCCTTAAGGAATTCCTTAAGG AATTCCTTAA GDiagram of Recombinant DNA

Activity in Text BookMini Lab 13-1 on pg 351Follow all steps in procedure Answer analysis question #3

Gel ElectrophoresisGel Electrophoresis: separates molecules based on their rate of movement through a gel under the influence of an electric field, based on the size and charge of the moleculesHow does Gel Electrophoresis work?DNA fragments are made using restriction enzymesA mixture of fragments is placed in one end of the gelAn electric voltage is applied to the gelDNA (which is negative) would move to the positive Since there are tiny holes in the gel, the small pieces move farther in the gelThis creates a unique DNA fingerprint

What can this be used for?Since each person has a unique sequence of DNA, the restriction enzyme creates different size pieces for each persons DNA called a DNA fingerprintRelated people have similar DNA and therefore their DNA will be cut into similar size piecesIt can be used to determine paternity and help identify unknown DNA samplesGel Electrophoresis

Activity in the textbookActivity 13-3 Questions 1-3Pg 361

PCR

Is the technique that allows us to make many copies of genes.First lets review some concepts.How does DNA replicate in cells? Steps?DNA unwinds and unzipsFree nucleotides attach to their complementary basesDNA polymerase attaches them togetherSteps in PCR: Machine assisted DNA replicationPCR stands for polymerase chain reactionDNA of interest is placed in machineDNA is heated Heat will break the weak hydrogen bond btw the strandsFree nucleotides are addedDNA polymerase is added creating the new complementary strandsSteps are repeated to create a large amount of DNADoes your DNA polymerase work at high temperatures? The DNA polymerase used is called taq polymerase. From bacteria that live in hot springs..Cloning an organism OH DOLLY!Steps:Donor cell is taken from a sheepAn egg cell from a different sheep is takenThe nucleus is extractedThe empty egg is fused with the donor cellThe cell is implanted into a female sheepWill eventually become a clone of the donorCloning an organism

Challenge questionWould a clone have more mutations than a normal offspring?Would a clone have the same survival rate as a normal offspring?What are some dangers of this new technology?Should the government put restrictions on human cloning?HWQuestions 1-20Pg 365-366WRITE QUESTION AND ANSWER..

Search related