FY18 USWBSI McLaughlin Final - scabusa.org · FY18 USWBSI Individual Project Proposal FY18 USWBSI INDIVDIUAL PROJECT PROPOSAL(S) NOTE: This document will be retained in the USWBSI’s

FY18 USWBSI Individual Project Proposal

FY18 USWBSI INDIVDIUAL PROJECT PROPOSAL(S) NOTE: This document will be retained in the USWBSI’s NFO

COVER PAGE

Instructions: Update any contact information that is not correct and sign cover page before submitting full Individual Project Proposal(s).

USWBSI Consolidated Funding Title:

Suppression of FHB by Green Leaf Volatiles (GLVs).

Principal Investigator (PI): John McLaughlin PI’s Institution: Rutgers University

PI’s Address: Department of Plant Biology 59 Dudley Rd. New Brunswick, NJ 8901

PI’s E-mail: [email protected] PI’s Phone: 848-932-6359

Fiscal Year (FY): 2018 Award Period: 7/1/18 - 6/30/19

ARS Agreement Number: New Institution’s Indirect Cost Rate

for the USWBSI for FY18: 5% DC

USWBSI’s FY18 Total Recommended Amount:

$ 40,000

USDA-ARS FY18 Total Award Amount:

$ 38,760

USWBSI Project ID

USWBSI Research Category USWBSI Project Title

PI Requested Amount

USWBSI‘s Recommended

Amount

ARS Award

Amount

FY18-MC-014 GDER Suppression of FHB by Green Leaf Volatiles (GLVs).

$ 45,375 $ 40,000 $ 38,760

FY18 USWBSI’s Total Recommended/ARS Award Amount $ 40,000 $ 38,760

FY18 USWBSI INDIVIDUAL PROJECT PROPOSAL


PROJECT SUMMARY PAGE Principal and Co- Investigator(s):

Principal Investigator: John McLaughlin Institution: Rutgers University

Co-Investigator #1: Institution:



Project Title 1: Suppression of FHB by Green Leaf Volatiles (GLVs).

PROJECT SUMMARY

Plant-derived volatile organic compounds (VOCs) are produced when plants are under both abiotic and biotic stress. They play important roles in plant growth regulation, plant-plant communications, plant-microbe interactions and defense. However, it is not clear how specific VOCs impact plant pathogenesis. In preliminary studies we have shown that that a green leaf volatile (GLV), (E)-2-hexenal, completely inhibits the growth of F. graminearum and retards the development of disease symptoms on detached wheat leaves. It is not known if VOC concentration correlates with resistance to Fusarium head blight (FHB) and whether increasing their production in wheat would protect against FHB. The main objective of this study is to determine if VOCs affect susceptibility of wheat to FHB and whether production of these volatiles in wheat would enhance resistance. Our specific objectives are: 1) Determine the effect of volatile treatment on susceptibility of wheat to F. graminearum. 2) Determine if the volatile treatment induces expression of the defense genes in wheat. 3) Determine if FHB resistance can be improved by increasing the production of volatiles in wheat. We will determine the effect of volatile treatment on the enhancement of wheat resistance to F. graminearum and DON accumulation. We will identify concentrations of VOCs which induce expression of plant defense genes and determine if FHB resistant wheat lines produce higher levels of volatiles than susceptible lines both before and after treatment with F. graminearum. Lastly, we will overexpress fatty acid hydroperoxide lyase (HPL) gene in wheat to measure its impact on volatile production and FHB resistance. This project addresses the following FY18-19 priorities of GDER: 1) Identify wheat or barley gene variants that improve FHB resistance and/or reduce DON accumulation; 3) Develop effective FHB resistance and/or reduced DON accumulation through transgenic strategies. Harnessing VOCs from plants for control of FHB will open up an exciting field of research. Stakeholders will benefit from this research by the identification of new genes and new mechanisms of FHB resistance that can be introduced into wheat and barley.



PROJECT DESCRIPTION

Title. Suppression of Fusarium head blight by green leaf volatiles Introduction. Plants respond to stress by releasing numerous volatile organic chemicals (VOCs) which are now recognized for playing important roles in plant growth regulation, plant-plant communications, and plant-microorganism interactions and defense. Oxylipins derived from the oxidation of unsaturated fatty acids that easily vaporize and exist in the gaseous state at room temperature, are classified as VOCs. Several six-carbon oxylipins are compounds released by plants after tissue damage are collectively called “green leaf volatiles (GLVs).” GLVs comprise an important group within the VOCs. They have a distinctive odor and are well known as having the familiar smell of freshly cut grass. They can repel or attract herbivores and can induce plant defenses against herbivores and pathogens. GLVs such as (E)-2-hexenal, (Z)-3-hexenal, and n-hexanal are six-carbon (C6) aldehydes, which are produced after wounding or pathogen attack in higher plants. They are formed from linolenic and linoleic acid through formation of 13-hydroperoxides by lipoxygenase (LOX) and subsequent cleavage reaction by fatty acid hydroperoxide lyase (HPL) [1]. GLVs are formed during the hypersensitive response (HR), after insect damage, or upon treatment with jasmonic acid (JA) [2]. Several GLVs are biologically active against fungal pathogens and several have antibacterial activity. (E)-2-hexenal (structure shown in Fig. 1) and 1-hexanol have antifungal activity and have been used in controlling postharvest fungal pathogens. Our collaborator, Dr. Joan Bennett has shown that (E)-2-hexenal and 1-hexanol inhibit the germination and growth of Aspergillus niger, Penicillium chrysogenum and impact the morphogenesis of Drosophila melanogaster [3]. (E)-2-hexenal and (Z)-3-hexenal have been shown to protect Arabidopsis thaliana against the necrotrophic fungus, Botrytis cinerea [4]. (E)-2-hexenol enhanced resistance against another necrotrophic fungal pathogen, Alternaria alternata [5]. Resistance was observed with (E)-2-hexenol, but not (Z)-3-hexenol [5]. (E)-2-hexenal is produced by different wheat cultivars and inhibits growth of Fusarium graminearum even at low doses [6]. In contrast, 1-hexanol did not inhibit Fusarium growth at low doses [6]. These results suggest that the antifungal activity is dependent on the structure of the VOC. Several studies indicated that VOCs play a role in the control of plant defense gene expression [7]. Genes induced by mechanical wounding or JA such as chalcone synthase (CHS), glutathione-S-transferase (GST1) and lipoxygenase 2 (LOX2) were induced after treatment of Arabidopsis with (E)-2-hexenal or (Z)-3-hexenal, while a salicylic acid (SA) responsive gene, pathogenesis-related protein 2 (PR2) was not induced [4]. Lignification of plant tissues and accumulation of antifungal substances, such as camalexin was observed after treatment of Arabidopsis with (E)-2-hexenal to a greater extent than (Z)-3-hexenal [8]. The VOC, Z-3-hexenyl acetate (Z-3-HAC) was found to decrease SA-regulated defenses of wheat to F. graminearum during the biotrophic phase of initial infection, but later enhance JA-dependent defense during the necrotrophic stage of infection [9]. Moreover, volatiles, such as 1-decene have been shown to positively impact plant growth while having fungistatic activity [10, 11]. These findings suggest that VOCs function as a signal to induce defense responses. However, there is much more to be learned in understanding how specific VOCs impact plant pathogenesis. We developed an agar I-plate assay to identify the concentration of (E)-2-hexenal that inhibits growth of F. graminearum. Agar plugs containing the fungus were placed on an agar I-plate containing potato dextrose agar (PDA) on one half of the plate (Fig. 2). A glass slide was spotted with (E)-2-hexenal to give a calculated concentration of 0 to 15 ppm (accounting for the head space of the plate). The plates were wrapped with three layers of Parafilm, enclosed in a glass jar with screw top, incubated for 7 days, and photographed. The area of fungal growth was compared to the zero volatile (ethanol) control. Approximately 26% and 51% of the fungal growth was inhibited relative to the ethanol control for the 1 and 5 ppm treatments, respectively (Table 1). At 15 ppm the fungal growth was completely inhibited (Fig. 2). Furthermore, the fungus failed to recover



after the volatile was removed indicating the treatment was cytotoxic to the fungus (data not shown). These results showed that (E)-2-hexenal can completely inhibit the growth of F. graminearum. We used a wheat detached leaf bioassay [12] to determine if (E)-2-hexenal would affect susceptibility of wheat to F. graminearum. Severe F. graminearum disease symptoms were observed on wheat (Bobwhite) leaves after inoculation with F. graminearum (104 spores) in the absence of (E)-2-hexenal (Fig. 3A). In contrast after treatment with 10 ppm (E)-2-hexenal smaller lesions were observed on infected leaves (Fig. 3B). Digital analysis of the lesion areas indicated that (E)-2-hexenal treatment reduced fungal growth on wheat leaves by 75% relative to the ethanol control (Table 1). These results indicated that (E)-2-hexenal substantially reduces fungal growth on wheat. It is not known if VOC concentration correlates with resistance to F. graminearum and whether increasing their production would protect against FHB. The main objective of this study is to determine if VOCs improve resistance of wheat to FHB and whether production of these volatiles in wheat would enhance resistance to FHB. Our specific objectives are: 1) Determine the effect of volatile treatment on susceptibility of wheat to F. graminearum. 2) Determine if the volatile treatment induces expression of the defense genes in wheat. 3) Determine if FHB resistance can be improved by increasing the production of volatiles in wheat. Rationale and Significance. Our preliminary results showed that (E)-2-hexenal completely inhibits the growth of F. graminearum and volatile treatment retards the development of disease symptoms on detached wheat leaves. A meta-analysis of GLV production during biotic stress responses revealed an interaction between GLV production and pathogens [7]. Pathogens induced more GLVs than insects or wounding and fungal infection caused the highest induction of GLV production. It is not clear if this is a strategy by the pathogen to promote virulence or if GLV production is a byproduct of oxidative damage. Fusarium graminearum may produce GLVs by causing cellular damage, which may result in increased GLV production. Trichothecenes cause oxidative stress, leading to membrane damage resulting in fatty acids hydrolyzed from membrane lipids, which are substrates for GLV synthesis. F. graminearum could interfere with primary plant defenses by influencing GLV biosynthesis and the subsequent free fatty acid release. Despite the progress made in recent years regarding GLV perception and signaling, many questions remain unanswered. It is not known if their accumulation in wheat correlates with resistance to trichothecenes and FHB and whether increasing their production would protect wheat against FHB. Identifying the role of GLVs in FHB resistance would lead to identification of new genes and their products that have the potential to improve resistance of wheat and barley to FHB. Genetic modification of GLV biosynthesis could be a unique approach for improving resistance to FHB. This project meets the following research priorities of GDER: 1) Identify wheat or barley gene variants that improve FHB resistance and/or reduce DON accumulation; 3) Develop effective FHB resistance and/or reduced DON accumulation through transgenic strategies. Research Materials and Methods. Objective 1. Determine the effect of volatile treatment on susceptibility of wheat to F. graminearum. We will determine if treatment of whole (undissected) wheat plants with (E)-2-hexenal or (Z)-3-hexenal will reduce the development of disease symptoms by F. graminearum. The carrier, ethanol will be used as a control. An additional control of 1-hexanol will be used as this C6 volatile was shown to have a greatly reduced impact on F. graminearum [6]. Wheat leaves will be treated for 24 h with each volatile, the volatile will then be removed and F. graminearum spores will be inoculated onto wheat leaves and head tissue. We will use a concentration series to identify the concentration of each volatile that protects wheat leaf and spike tissue from F. graminearum infection. A GFP-labeled F. graminearum strain (Fig. 4) will be used to determine if the volatile limits fungal growth within the tissue by confocal microscopy and a RT-qPCR



bioassay that measures the total fungal DNA relative to the total leaf DNA [13]. Primers for the fungal/plant biomass RT-qPCR bioassay are listed in Table 2. We will determine DON accumulation in wheat in the presence of volatiles using a DON ELISA (RIDASCREEN®FAST DON, R-Biopharm AG, Darmstadt, Germany). Objective 2. Determine if the volatile treatment induces expression of the defense genes in wheat. If resistance to F. graminearum is observed after volatile treatment, resistance may either be due to direct fungicidal effect of the volatiles or their signaling ability to induce defense genes or both could be responsible to modulate the susceptibility of wheat to F. graminearum. Activation of expression of defense genes such as chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) may result in formation of fungicidal secondary metabolites, while activation of lipoxygenase genes may lead to formation of antifungal volatiles. Previous results indicated that (E)-2-hexenal induces the expression of some defense genes in Arabidopsis thaliana and protects Arabidopsis plants from infection by Botrytis cinerea [4]. We will determine if treatment with (E)-2-hexenal or (Z)-3-hexenal will induce defense gene expression in wheat. The carrier, ethanol will be used as a control in addition to 1-hexanol. Expression of CHS, PAL, a select group of the lipoxygenase (LOX) genes [14], members of the systemic acquired resistance (SAR) genes [15], and WRKY genes known to be associated with (E)-2-hexenal perception in plants [16] will be examined by qRT-PCR after treatment of wheat by different volatiles as outlined in Objective 1. To understand the dynamics of expression of these genes, the levels will be examined at 4, 12, 24 and 36 h after treatment with the volatiles using qRT-PCR. Untreated plants will be used as controls. Objective 3. Determine if FHB resistance can be improved by increasing the production of volatiles in wheat. GLVs are synthesized by the hydroperoxide lyase (HPL) branch of the oxylipin pathway after cleavage of 13-hydroperoxides by HPL [1]. HPL expression is upregulated after mechanical wounding or insect attack [17]. Infection by Alternaria alternata induced expression of HPL, suggesting that HPL is a defense-related gene induced by biotic attacks. Upregulation of HPL expression leads to accumulation of higher amounts of GLVs in Arabidopsis [4], suggesting that GLVs that accumulate after pathogen infection can exert their toxic effects on the pathogen. They could also be signaling molecules that induce defense responses. To determine if GLVs accumulate in wheat after F. graminearum infection, we will examine expression of HPL before and after F. graminearum infection. Wheat tissues will be treated with F. graminearum and at different times after treatment the tissues will be sampled, RNA will be extracted and analyzed by qRT-PCR to determine if HPL gene expression correlates with the development of fungal lesions. If we observe upregulation of HPL, we will determine if GLVs, such as (E)-2-hexenal, (Z)-3-hexenal and 1-hexanol accumulate in wheat tissues after infection by F. graminearum. The levels of volatiles will be analyzed by GC-MS as previously described [6]. We will determine if the concentration of GLVs that accumulate after pathogen attack are sufficient to exert fungicidal effects and whether they are effective against the fungus in a concentration dependent manner. These studies will address if GLVs are formed after infection of wheat by F. graminearum and if they accumulate at the infection sites and whether higher concentration of GLVs at the infection sites will have a direct effect on the protection of wheat against F. graminearum infection. To determine if resistance of wheat cultivars correlates with accumulation of GLVs, we will examine GLV levels in FHB resistant and susceptible wheat cultivars by GC-MS [6]. The susceptible variety will be represented by Bobwhite and Wheaton. The resistant varieties will be represented by Rollag, Rb07, and Forefront. Rollag [18] has been shown to have good resistance to F. graminearum and low DON kernel contents while Rb07 [19] and Forefront [20] have moderate resistance for both infection levels and DON kernel contents compared to sensitive varieties like Bobwhite. Transgenic manipulation of GLV biosynthesis in Arabidopsis has been shown to improve resistance to B. cinerea infection [21]. The Arabidopsis hydroperoxide lyase1 (HPL1) has recently been identified



(AT4G15440) [22]. To determine if overexpression of AtHPL1 in transgenic wheat will affect susceptibility to FHB, we will introduce AtHPL1 into the wheat expression vector (B712p7o2x35s-UbiZmF-LGFP). AtHPL1 controls arabidopside accumulation after tissue damage [22]. Arabidopsides are lipids that accumulate following abiotic and biotic stresses and expression of AtHPL1is negatively correlated with arabidopside accumulation. Overexpression of the gene in wheat can be expected to increase the generation of GLVs and likely impact resistance to FHB. Our collaborator Harold Trick will transform Bobwhite, Rb07, and Forefront lines with this overexpression vector. Expression analysis using GFP detection via confocal microscopy and Western blot analysis will be performed to identify transformants expressing AtHPL1. Anticipated results and possible pitfalls. Green leaf volatiles such as (E)-2-hexenal have been shown to be both cytostatic and cytotoxic (Fig. 2 and Table 1) to F. graminearum with little or no negative effect on wheat [6]. Understanding this dynamic in terms of the effect on the initial fungus infection (Type I resistance) and growth (Type II resistance) would enhance our understanding of the wheat-FHB pathosystem. Currently little information is available on the impact of VOCs on FHB. Testing VOCs from both susceptible and resistant wheat lines would allow us to determine if VOC emission correlates with FHB sensitivity. Additionally, understanding the downstream events in the plant upon VOC exposure would help reveal novel defense strategies of the plant against FHB. Possible pitfalls include the possibility of VOC exposure decreasing FHB disease level but increasing DON. This possibility could be addressed by modifying VOC levels to find a concentration that decreases DON. Another pitfall would be that the natural variation within wheat to produce VOCs that inhibit FHB could be narrow. Additional wheat genotypes with measured FHB resistance (low, moderate, and high) could be tested to address this. Major QTLs that control volatile production in tomato have recently been identified [23]. Thus, it is likely that varietal differences in wheat may also be discovered. Lastly, alteration of HPL-derived metabolites in wheat lines overexpressing HPL may impact the sensitivity to other pathogens. Changing the flux in biosynthesis of oxylipins can alter the substrate pool for jasmonate production, potentially impacting JA signaling. Nonetheless, the finding that F. graminearum can be inhibited (or even killed) by low doses of a GLV opens up an exciting research field. The experiments outlined in this proposal will obtain answers to critical questions regarding the role volatiles play in FHB resistance, a largely overlooked area of research.



Figures:

Figure 1. Structure of (E)-2-hexenal, also known as leaf aldehyde or trans-2-hexenal.

Figure 2. Potato dextrose agar I-plates F. graminearum (isolate Ph1) exposed to 0 ppm (A) and 15 ppm trans-2-hexenal (B) for 7 days. Agar plugs containing the fungus were placed on an agar I-plate containing potato dextrose agar (PDA) on one half of the plate. A glass slide spotted with (E)-2-hexenal was placed on the other half. The plates were wrapped with parafilm and placed into a sealed jar. The area of fungal growth was compared to the ethanol control after 7 days. Following the 7-day incubation period the plates were removed from the jar, the parafilm was removed, and the plates were photographed.



(E)-2-hexenal (ppm)

Mean F. graminearum

inhibition

SE

0 0 11.5 1 25.8 14.7 5 51.2 5.7

15 100 0 Table 1. F. graminearum growth inhibition assay using the PDA I-plates with F. graminearum (isolate Ph1) using four different concentrations of (E)-2-hexenal (0, 1, 5, and 15 ppm). Growth of F. graminearum exposed to (E)-2-hexenal was expressed as a percentage of the area of F. graminearum growth exposed to ethanol carrier at 7 days post inoculation. The standard error for the mean F. graminearum growth inhibition at 15 ppm was zero because no fungal growth was recorded at this concentration. Removal of the volatile after 7 days and further incubation of the plate permitted additional fungal growth in all treatments except the 15 ppm treatment indicating this concentration was 100% cytotoxic.

Primer Name

Target Sequence

3090 (PR1 F) T. aestivum

CGTCTTCATCACCTGCAACTA

3091 (PR1 R)

T. aestivum

CAAACATAAACACACGCACGTA

2192 (Tri6) F. graminearum

TAACCACATCGTCGGGACTG

2193 (Tri6)

F. graminearum

GCCGACTTCTTGCAGGTCTT

Table 2. Primers to quantify fungal biomass relative to wheat tissue.

Figure 3. (E)-2-hexenal reduces F. graminearum growth on wheat leaves. A detached leaf bioassay was performed by inoculating F. graminearum (104 spores) onto Bobwhite leaves with A. Ethanol control and B. (E)-2-hexenal (10 ppm). Plates were wrapped in three layers of parafilm, placed in a sealed jar, incubated for 4 days, and then photographed. Digital analysis of the lesion areas indicated that the 10 ppm treatment reduced fungal growth by ~75% relative to the ethanol control.



Figure 4. Wheat inoculation with F. graminearum strain expressing GFP (Fg-GFP). Confocal microscopy reveals growth of the GFP-tagged fungus in the mesophyll layer of the wheat leaf. Majority of the growth appears intercellular and in the apoplast.



References 1. Scala, A., et al., Green Leaf Volatiles: A Plant's multifunctional weapon against herbivores and

pathogens. Int. J. Mol. Sci., 2013. 14(9): p. 17781-17811. 2. Avdiushko, S., et al., Effect of volatile methyl jasmonate on the oxylipin pathway in tobacco, cucumber,

and arabidopsis. Plant Physiol, 1995. 109(4): p. 1227-30. 3. Yin, G., et al., Effects of three volatile oxylipins on colony development in two species of fungi and on

drosophila larval metamorphosis. Curr Microbiol, 2015. 71(3): p. 347-56. 4. Kishimoto, K., et al., Direct fungicidal activities of C6-aldehydes are important constituents for defense

responses in Arabidopsis against Botrytis cinerea. Phytochemistry, 2008. 69(11): p. 2127-32. 5. Gomi, K., et al., Characterization of a hydroperoxide lyase gene and effect of C6-volatiles on expression

of genes of the oxylipin metabolism in Citrus. J Plant Physiol, 2003. 160(10): p. 1219-31. 6. Cruz, A.F., et al., Phytochemicals to suppress Fusarium head blight in wheat-chickpea rotation.

Phytochemistry, 2012. 78: p. 72-80. 7. Ameye, M., et al., Green leaf volatile production by plants: a meta-analysis. New Phytol, 2017. 8. Kishimoto, K., et al., ETR1-, JAR1- and PAD2-dependent signaling pathways are involved in C6-

aldehyde-induced defense responses of Arabidopsis. Plant Sci, 2006. 171(3): p. 415-23. 9. Ameye, M., et al., Priming of wheat with the green leaf volatile Z-3-hexenyl acetate enhances defense

against Fusarium graminearum but boosts deoxynivalenol production. Plant Physiol, 2015. 167(4): p. 1671-84.

10. Zou, C.-S., et al., Possible contributions of volatile-producing bacteria to soil fungistasis. Soil Biol Biochem, 2007. 39(9): p. 2371-2379.

11. Lee, S.Y.J., Analysis of volatile organic compounds emitted by filamentous fungi and volatile-mediated plant growth. 2015, Rutgers University-Graduate School-New Brunswick.

12. Perochon, A. and F.M. Doohan, Assessment of wheat resistance to Fusarium graminearum by automated image analysis of detached leaves assay. Bio-protocol, 2016. 6(24): p. 1-7.

13. Vaughan, M.M., et al., Effects of elevated [CO2 ] on maize defence against mycotoxigenic Fusarium verticillioides. Plant Cell Environ, 2014. 37(12): p. 2691-706.

14. Maschietto, V., et al., Resistance to Fusarium verticillioides and fumonisin accumulation in maize inbred lines involves an earlier and enhanced expression of lipoxygenase (LOX) genes. J Plant Physiol, 2015. 188: p. 9-18.

15. Scala, A., et al., Green leaf volatiles: a plant's multifunctional weapon against herbivores and pathogens. Int J Mol Sci, 2013. 14(9): p. 17781-811.

16. Mirabella, R., et al., WRKY40 and WRKY6 act downstream of the green leaf volatile E-2-hexenal in Arabidopsis. Plant J, 2015. 83(6): p. 1082-96.

17. Matsui, K., Green leaf volatiles: hydroperoxide lyase pathway of oxylipin metabolism. Curr Opin Plant Biol, 2006. 9(3): p. 274-80.

18. Anderson, J.A., et al., Registration of 'Rollag' Spring Wheat. J Plant Regist, 2015. 9(2): p. 201-207. 19. Anderson, J.A., et al., Registration of 'RB07' Wheat. J Plant Regist, 2009. 3(2): p. 175-180. 20. Glover, K.D., et al., Registration of 'Forefront' Wheat. J Plant Regist, 2013. 7(2): p. 184-190. 21. Shiojiri, K., et al., Changing green leaf volatile biosynthesis in plants: an approach for improving plant

resistance against both herbivores and pathogens. Proc Natl Acad Sci U S A, 2006. 103(45): p. 16672-6. 22. Nilsson, A.K., et al., The activity of HYDROPEROXIDE LYASE 1 regulates accumulation of

galactolipids containing 12-oxo-phytodienoic acid in Arabidopsis. J. Exp. Bot., 2016. 67(17): p. 5133-5144.

23. Bauchet, G., et al., Identification of major loci and genomic regions controlling acid and volatile content in tomato fruit: implications for flavor improvement. New Phytol., 2017. 215(2): p. 624-641.



FACILITIES- Drs. John McLaughlin and Nilgun E. Tumer Laboratory: Dr. Tumer’s laboratory covers approximately 2400 sq. ft. of space. An office is provided adjacent to the laboratory. The Postdocs and students have their own desk space adjacent to the lab. Major equipment needs of a molecular biology/biochemistry laboratory have been fulfilled by the core funding supplied by Biotech Center and by grants from NIH, NSF and Rutgers University. Major equipment items in Dr. Tumer’s lab include a Zeiss LSM 710 confocal microscope, GE Healthcare Biacore T200, GE Healthcare Isothermal Calorimeter (ITC200), GE Healthcare Typhoon FLA9500 imager, GE Healthcare DeCyder 2D-DIGE software, LI-COR Odyssey CLx Infrared Imaging System, Perkin Elmer MicroBeta2 liquid scintillation and luminescence counter, Perkin Elmer MICROBETA FILTERMAT-96 Cell Harvester, SGA Robotics RoTor HDA high throughput screening robot, an Accuri C6 Flow Cytometer System, a BioTek Synergy 4 Multi-Detection Microplate Reader, an ABI StepOne Plus Real Time PCR system, Olympus BX41 Flourescence Microscope, Olympus SZX16 Stereomicroscope, Nikon Optiphot-2 microscope equipped for fluorescence, GE Healthcare AKTA Purifier high resolution FPLC, HiGro incubator/shaker, BRANDEL Gradient Fractionation System, ABI Prism 7000 Real Time thermocycler, Biometra personal PCR machine, Beckman Optima XE-90-IVD ultracentrifuge and SW 40 Ti, SW 28, SW 50.1, 70 Ti rotors, Beckman AVANTI J-E HPC refrigerated centrifuge and JA-14 and JA-17 Rotors, Beckman Optima TLX Tabletop Ultracentrifuge, Beckman Allegra 25R Centrufuge, two Tabletop centrifuges (eppendorf centrifuge 5415R, and DENVILLE 260D), two laminar flow cabinets, LS 5000 TD standard rack system, DU-64 spectrophotometer, New Brunswick shaker incubators, Fisher - 20oC freezer, Fisher - 80oC freezer, Fisher 4oC cold box, Percival plant growth chamber, Fisher Biostar microscope, Coy tempcyclor microtube incubator, Fisher gyrotory shaker, power supplies, Dynatech Microplate reader, Hoefer DNA fluorimeter, Savant Speedvac, and a Bio-rad Gene Pulser. Research at the School of Environmental and Biological Sciences (SEBS) at Rutgers University is multidisciplinary and is focused on plant animal and microbial systems. There are state-of-the-art core facilities described at: http://sebs.rutgers.edu/core-facility/, which will contribute to the success of the project. Computer: Four HP PC terminals are connected to the laser writer, a color printer and to the BioVax and national terminal servers and databases. In addition, Biotech Center has a high throughput screening laboratory that includes a robotics station for sample preparation and reformatting, an Affymetrix 417 Arrayer and 418 Array Scanner along with the Affymetrix MicroDB software package for managing a GATC-compliant database and the Affymetrix Microarray Suite and Data Mining Tool for analysis of microarray data. Biotech Center Common Resources (http://biotech.rutgers.edu): GE Healthcare Biacore 3000 ABI StepOne PlusRT-PCR system GWC Technologies, SPR Imager II Horiba Scientific SPRi plex Bio-Rad Chemi Doc XRS System with ECL Capabilities BioTek Synergy2 Multi-Detection Microplate Reader Agilent 2100 Bioanalyzer Molecular Devices Axon 4200AL Microarray Scanner GE Healthcare Storm Phosphoimager HPLC/FPLC apparatus



Collaborative arrangements. Qualifications of the PIs: This project respresents a new collaboration between Dr. John McLaughlin and the new co-PI, Dr. Joan Bennett. Dr. McLaughlin has been working on improving resistance of wheat to FHB since 2008 and has published 4 papers. This project represents a new and an independent area of research for Dr. McLaughlin. Dr. Joan W. Bennett is a Distinguished Professor in the Department of Plant Biology at Rutgers, The State University of New Jersey, USA. She is trained as a fungal geneticist and during much of her career studied the genetics, biosynthesis and molecular biology of aflatoxin production, helping to establish the paradigm that fungal secondary metabolite genes are clustered. In recent years her focus has been on the physiological effects of fungal volatile organic compounds (VOCs) using genetic models. Professor Bennett is a past president of both the Society for Industrial Microbiology and Biotechnology and the American Society for Microbiology, and is a past vice president of the British Mycological Society and the International Union of Microbiological Sciences. Further, she has served as co-editor-in-chief of Advances in Applied Microbiology and editor-in-chief of Mycologia. She was elected to the National Academy of Sciences (USA) in 2005.

Outreach. We have presented our work at the Mycotoxin and Phycotoxin Gordon Conference (June, 2017). We will continue to present our work at the Fusarium Head Blight Forum, Society of Toxicology meeting and at the Mycotoxin and Phycotoxin Gordon Conference. Results will be presented at invited seminars and during internal interdisciplinary meetings, such as the RNA club and the Rutgers Microbiology Symposium. Work will be published in peer-reviewed journals. Research resources developed will be made available to the scientific community after publication. We will also continue supporting research experiences for both high school and undergraduate students in the lab.



BUDGET JUSTIFICATION

Project Title 1: Suppression of FHB by Green Leaf Volatiles (GLVs).

Principal Investigator: John McLaughlin

Total USWBSI Recommended Amount for FY18: $ 40,000

ARS Award Amount for FY18: $ 38,760

Instructions: Complete all applicable sections below where funds are being requested; description (left columns) and requested amount (right column). If budget category is not applicable, leave line item blank. NOTE: All amounts must be rounded to the nearest whole number. A. SENIOR/KEY PERSON: In fields below, add details for salary and fringe benefits associated with the Senior/Key Person (i.e. PI/PD). Details should include PI’s Base Salary ($), the number of Calendar, Academic and/or Summer months/time to be devoted to the research project. Provide subtotals for both ‘Salary’ and ‘Fringe Benefits’ to the right of the descriptive details. The total amount requested for the Senior/Key Person category should be included in the far right column.

TOTAL $ AMT.

REQUESTED FOR

SENIOR/KEY PERSON

Salary: John McLaughlin 4.06 months of effort $21,866 $32,914

Fringe Benefits: applied at 50.53% $11,049

B. OTHER PERSONNEL: For each sub category listed below, add details for salary and fringe benefits associated with that sub category. Details should include the percentage of time (months)/total hours to be devoted to the research project, rate of pay and fringe rate. Include the amounts requested for Salary, Fringe Benefits and number of personnel for each subcategory (Post Doc, Graduate Students, Undergraduate Students, etc.) as well as the total amount. The TOTAL amount requested for ALL ‘Other Personnel’ should be entered in the far right column.

TOTAL $ AMT.

REQUESTED FOR OTHER PERSONNEL

Sub Total $ Amts. Request for Salary and Fringe Benefits

Total $Amt. Requested per

Sub Category(ies)

$0

Post Doctoral Associates $ Salary: $ Fringe Benefits: $

Number of Post Doc Personnel:

Graduate Students. NOTE: Graduate Student Tuition/Fees/Health Insurance should be included in section ‘Participant/Trainee Support Costs’ (E1).

$

Salary: $ Fringe Benefits: $

Number of Graduate Student Personnel:

Undergraduate Students $ Salary: $ Fringe Benefits: $

Number of Undergraduate Student Personnel:

Secretarial/Clerical $ Salary: $ Fringe Benefits: $

Number of Secretarial/Clerical Personnel:

Other – Research Technician $ Salary: $ Fringe Benefits: $

Number of Other – Research Technician Personnel:



B. OTHER PERSONNEL (cont.) Sub Total $

Amts. Request for Salary and Fringe Benefits

Total $Amt. Requested per

Sub Category(ies)

Other – Temporary Labor $ Salary: $ Fringe Benefits: $

Number of Other – Temporary Labor Personnel:

Other $ Salary: $

Fringe Benefits: $

Number of Other Personnel:

C. EQUIPMENT: List below any items whose total dollar amount exceeds $5,000 and has a useful life of one year or more. Justification must include relevance to proposed research and dollar amounts. Include cost per item if more than one item will be purchased AND the total amount requested for this budget category in right column.

TOTAL $ REQUESTED

FOR EQUIPMENT

$0

D. TRAVEL: Travel costs are the projected expenses for transportation, lodging, subsistence, and related items incurred by employees who are in travel status on official business related to the Federal award. This category is only for cooperator staff travel. Provide requested amount for domestic and foreign travel (middle $ column) in addition to the ‘Total $ Requested for Travel’ (left $ column). The travel costs should be supported with the purpose of the travel, the estimated amount of the trip(s) and the destination(s) if known at the time of award. It is not necessary to identify traveler names and travel dates.

TOTAL $ REQUESTED FOR TRAVEL

D.1. Domestic Travel (DT): List below proposed trips individually and describe their purpose in relation to the proposed research. Also provide dates, destination, and number of travelers where known. Include total amount per sub category below next to ‘$’and total amount requested for DT in middle column. Enter the total for Travel (DT and FT) in far right column.

Total $ Requested

for Domestic

$0

Research Related (e.g. travel to research plots):

$ $

Non-Research Related (i.e. professional meetings): FHB Forum:

$

Other Conferences/Meetings:

$

D.2. Foreign Travel (FT): List below proposed trips individually and describe their purpose in relation to the proposed research. Also provide dates, destination, and number of travelers where known. Include total amount per sub category below and total amount requested for FT in column on the right.

Total $ Requested for Foreign

Research Related (e.g. travel to research plots): $ $

Non-Research Related (i.e. professional meetings): $



E. PARTICIPANT/TRAINEE SUPPORT COSTS (P/TSC): Participant support costs means direct costs for items such as stipends or subsistence allowances, travel allowances, and registration fees paid to or on behalf of participants or trainees (but not employees) in connection with conferences, or training projects. The cost of training and education provided for employee (i.e. Graduate and Undergraduate Students) development is allowable. Include total amount per sub category below next to ‘$’ and total amount requested for ‘Participant/Trainee Support Costs’ in column on the right (i.e. Total $ Requested).

TOTAL $ REQUESTED FOR P/TSC

1. Tuition/Fees/Health Insurance: $ $0 2. Stipends: $ 3. Travel: $ 4. Subsistence: $ 5. Other: $

F. OTHER DIRECT COSTS (ODC): This section contain multiple sub categories. Totals per sub category are required in addition to the total requested for Other Direct Costs (far right column). If there are additional sub categories under the main sub categories (i.e. Materials and Supplies), provide a total as well. F.1. Materials and Supplies (M/S): In the space below, provide as much detail and specificity as possible for all materials and supplies associated with proposed research. Materials and Supplies should be described in detail e.g., chemical reagents, printer/field paper and supplies, glassware, lumber, etc. under each sub category (Field, Greenhouse, Laboratory and Other). Include total amount per sub category below next to ‘$’ and total amount requested for M/S in the middle column (i.e. Total $ Amt. Requested – M/S)

Total $ Amt. Requested - M/S

TOTAL $ AMT. REQUESTED -

ODC Field: The chemical and laboratory supplies will consist of Taq polymerase enzyme and primers for the fungal biomass quantification experiments and RT-qPCR tests for defense gene modulation by the VOCs and purchase of the VOCs ($250); the RIDASCREEN®FAST DON ELISA kit to quantify DON ($350)

$600 $4,000 $4,000

Greenhouse: greenhouse/growth chamber supplies, space, and pesticide treatment is estimated to cost an additional $500.

$500

Laboratory: RNA-Seq cost through the Waksman Genomics Core Facility at Rutgers to measure the impact of GLV on both wheat and Fusarium ($1,850) (time course experiments), and the remaining funds of $1,050 dedicated for GC-MS analysis of VOCs for testing difference concentration differences between cultivars.

$2,900

Other: $

F.2. Publications and Printing Costs (PPC): Below, provide details for any publication costs for electronic and print media, including distribution, promotion, and general handling, for which funds are being requested. NOTE: Page charges for professional journal publications are allowable provided publications report research that was supported by USDA-ARS.

Total $ Amt. Requested - PPC

$

F.3. Consulting Services (CS): For each consultant, list below the services he/she will perform, total number of days, travel costs, and the total estimated costs. Please include names and organizational affiliations for all consultants, other than those involved in consortium/contractual arrangements.

Total $ Amt. Requested - CS

$



F. OTHER DIRECT COSTS (ODC) (cont.)

F.4. Automatic Data Processing /Computer Services (ADP/CS): This section covers cost of computer services, including computer-based retrieval of scientific, technical, and education information. In the space below, list all ADP/CS and include the established computer service rates, if applicable.

Total $ Amt. Requested -

ADP/CS

$

F.5. Subawards/Consortium/Contractual Costs (SCCC): In the space below, provide details for all costs associated with subawards, consortium and contractual costs. The total requested amount for this sub-category should include both direct and indirect costs for all subaward/consortium organizations. A separate budget for the subaward should be included (i.e. attached to funding application).


SCCC

$

F.6. Equipment/Facility/Land Rental and User Fees (RUF): List the total funds requested for equipment or facility rental/user fees. Justify each rental user fee by providing specific details (e.g. Land Rental Fees – number of acres/cost per acre).

Total $ Amt. Requested –

RUF

$

F.7. Alterations and Renovations (A&R): List the total funds requested for alterations and renovations (A&R). Justify (i.e. required in order to carry out research) the costs of alterations and renovations, including repairs, painting, and removal or installation of partitions, shielding, or air conditioning. Where applicable, provide the square footage and costs.

Total $ Amt. Requested –

AR

$

F.8. Other - Miscellaneous Direct Costs (OMDC): Under each relevant sub category below, enter a brief description, and basis for the estimate (i.e. individual fee rate/price). Include total amount per sub category below next to ‘$’ and total amount requested for ODC in column on the right.


OMDC Laboratory Animal Fees: $ $

U.S. based Winter Nurseries: $

International Nurseries: $

Double Haploids: $

Other Analyses/Services: $

Communication (postage, shipping, fax, long distance phone): $

Photocopying: $

Other MODC (describe):

$



H. INDIRECT COSTS (IDC): Provide below your Institution’s approved Indirect Cost (IDC) rate for USWBSI/USDA-ARS funding agreement. ‘Type’ refers to Total Costs (TC), Direct Costs (DC), Modified Direct Costs (MDC). Rate and Type has been prefilled by NFO based on submitted FY18 Pre-Proposals.

TOTAL $ AMT.

REQUESTED FOR IDC

IDC Rate/Type: 5% DC IDC Base Amount: $36,914

$ 1,846

J. FEE (Small Business Act – SBIR Fee): The SBIR fee is a Congressional mandated fee charged to all USDA-ARS Agreements and is applicable to all non-ARS PIs. The rate for FY18 is 3.2% and will be deducted from the USWBSI’s recommended amount prior to the processing of the award by ARS. The Formula for calculating the fee is below (prefilled by the NFO):

Step 1 – USWBSI’s Total Recommended Amount/1.032 Step 2 - Result from Step 1 should be subtracted from USWBSI Recommended Amount to obtain the SBIR

Fee).

TOTAL $ AMT FOR FEE-SBIR

Step 1: $40,000/1.032 = $38,760 Step 2: $40,000 - $38,760 = $1,240

$ 1,240



PROJECT BUDGET PAGE Instructions: Insert values from corresponding budget justification into this form.

Budget based on OMB Number: 4040-0001

PROJECT 1 TITLE: Suppression of FHB by Green Leaf Volatiles (GLVs).

PROJECT ID: FY18-MC-014

ARS AGREEMENT NO:

New

Totals ($)

PRINCIPAL INVESTIGATOR: John McLaughlin

ORGANIZATION: Rutgers University

A. Senior/Key Persons (i.e. PI/PD) .................................................................................................................................... $32,914 B. Other Personnel (Post-Docs, Graduate Students, Secretarial/Clerical, Research Technician, Temporary Labor, and

Other) ..............................................................................................................................................................................................

Total Number of ‘Other Personnel’: 1

Total Salaries, Wages and Fringe Benefits (A + B) .............................................................................................. $32,914

C. Equipment ............................................................................................................................................................................

D. Travel (Insert total amount for D. Travel to left and totals for subsections (1 and 2) below) ............................... 1. Domestic ..............................................................................................................................................

2. Foreign ..................................................................................................................................................

E. Participant/Trainee Support Costs (Insert total for E to left and totals for sub sections below) ........... 1. Tuition/Fees/Health Insurance .........................................................................................................

2. Stipends ................................................................................................................................................ 3. Travel .................................................................................................................................................... 4. Subsistence .......................................................................................................................................... 5. Other .....................................................................................................................................................

Total Number of Participants/Trainees:

F. Other Direct Costs (Insert total amount for F) .......................................................................................................... $4,000 1. Materials and Supplies ..................................................................................................................... $4,000 2. Publication Costs ............................................................................................................................... 3. Consultant Services........................................................................................................................... 4. ADP/Computer Services .................................................................................................................. 5. Subawards/Consortium/Contractual Costs .................................................................................. 6. Equipment or Facility Rental/User Fees ....................................................................................... 7. Alterations and Renovations ........................................................................................................... 8. Other - Miscellaneous ......................................................................................................................

G. Total Direct Costs (Total Salaries, Wages and Fringe thru F) .............................................................................. $36,914

H. Indirect Costs ...................................................................................................................................................................... Rate and Type: 5% DC Base: 36,914

$1,846

I. Total Direct and Indirect Costs - ARS FY18 Award Amount (G + H) ........................................... $ 38,760

J. FEE - Small Business Act – SBIR Fee (3.2%) ................................................................................................. $ 1,240

K. TOTAL COSTS - USWBSI FY18 Total Recommended Amount (I + J) ................................... $ 40,000

NAME AND TITLE SIGNATURE

(Adobe E-Sign or insert image of signature) DATE Principal Investigator

John McLaughlin 7-11-2018



ADJUSTMENT SUMMARY PAGE

USWBSI Consolidated Funding Title: Suppression of FHB by Green Leaf Volatiles (GLVs).

Principal Investigator: John McLaughlin

Institution: Rutgers University

Fiscal Year: 2018 USWBSI’s FY18 Total Recommended Amount: $ 40,000

ARS Agreement Number: New USDA-ARS FY18 Total Award Amount: $ 38,760

Instructions: Under each of the project titles listed below, please indicate the changes made to the pre-proposal that address the comments given by the Review Panel(s) and/or the Executive Committee (see table in “Letter of Instructions”). Use additional pages if necessary. Project Title 1: Suppression of FHB by Green Leaf Volatiles (GLVs). None


I agree to send copies of any printed materials (e.g. brochures, extension publications, etc.) and/or electronic versions of communication materials or URL links to materials posted on the Web to the Networking & Facilitation Office of the U.S. Wheat & Barley Scab Initiative. _________________________________7-11-2018__ Principal Investigator Date


COMMUNICATION PLAN

USWBSI Consolidated Funding Title: Suppression of FHB by Green Leaf Volatiles (GLVs).

Principal Investigator: John McLaughlin Institution: Rutgers University

Fiscal Year: 2018 USWBSI’s FY18 Total Recommended Amount: $ 40,000

ARS Agreement Number: New USDA-ARS FY18 Total Award Amount: $ 38,760

Instructions: Using the space below, describe in detail how you plan to communicate the results from this research to your stake-holders in the most effective way. Please describe your target audience (i.e. USWBSI Administration/members, industry, private growers, interest groups etc.) and the methods (i.e. written, electronic, oral, etc.) of communication you will use to communicate your results to your audience.

We will continue to present our work at the National Fusarium Head Blight Forums, at the Society of Toxicology meeting, and at the Mycotoxin and Phycotoxin Gordon Conference. We will take advantage of both oral presentations and the poster sessions to communicate our work to the entire USWBSI audience. Results will be presented at invited seminars and during internal interdisciplinary meetings, such as the RNA club and the Rutgers Microbiology Symposium. Work will be published in peer-reviewed journals. Research resources developed will be made available to the scientific community after publication.

Documents

FY18 USWBSI McLaughlin Final - scabusa.org · FY18 USWBSI Individual Project Proposal FY18 USWBSI INDIVDIUAL PROJECT PROPOSAL(S) NOTE: This document will be retained in the USWBSI’s