Flagellin from Marinobacter algicola and Vibrio vulnificus activates the innate immune response of gilthead seabream

  • Published on
    03-Feb-2017

  • View
    213

  • Download
    0

Embed Size (px)

Transcript

<ul><li><p>Developmental and Comparative Immunology 47 (2014) 160167Contents lists available at ScienceDirect</p><p>Developmental and Comparative Immunology</p><p>journal homepage: www.elsevier .com/locate /dc iFlagellin from Marinobacter algicola and Vibrio vulnificus activates theinnate immune response of gilthead seabreamhttp://dx.doi.org/10.1016/j.dci.2014.07.0030145-305X/ 2014 Elsevier Ltd. All rights reserved.</p><p>Abbreviations: FCS, fetal calf serum; IL, interleukin; iNOS, inducible NOsynthase; MA, Marinobacter algicola; MACS, magnetic-activated cell sorting; PAMP,pathogen-associated molecular pattern; PBS, phosphate-buffered saline; ROS,reactive oxygen species; STF, Salmonella enterica serovar Typhimurium (SalmonellaTyphimurium); TLR, Toll-like receptors; TNF, tumor necrosis factor; Vvul, Vibriovulnificus. Corresponding author. Address: Department of Cell Biology and Histology,</p><p>Faculty of Biology, University of Murcia, Campus Universitario de Espinardo, 30100Murcia, Spain. Tel.: +34 868887581; fax: +34 868883963.</p><p>E-mail address: vmulero@um.es (V. Mulero).Jana Montero a, Eduardo Gmez-Casado b, Alicia Garca-Alczar c, Jos Meseguer a, Victoriano Mulero a,aDepartment of Cell Biology and Histology, Faculty of Biology, University of Murcia and IMIB-Arrixaca, Murcia, SpainbDepartment of Biotechnology, Instituto Nacional de Investigacin y Tecnologa Agraria y Alimentaria (INIA), Madrid, SpaincOceanographic Centre of Murcia, Spanish Oceanographic Institute (IEO), Puerto de Mazarrn, Murcia, Spain</p><p>a r t i c l e i n f oArticle history:Received 23 May 2014Revised 4 July 2014Accepted 6 July 2014Available online 11 July 2014</p><p>Keywords:FlagellinAdjuvantImmunostimulantsSeabreamTeleostsFisha b s t r a c t</p><p>Adjuvants have emerged as the best tools to enhance the efficacy of vaccination. However, the traditionaladjuvants used in aquaculture may cause adverse alterations in fish making necessary the developmentof new adjuvants able to stimulate the immune system and offer strong protection against infectiouspathogens with minimal undesirable effects. In this respect, flagellin seems an attractive candidate dueto its ability to strongly stimulate the immune response of fish. In the present study, we have evaluatedthe ability of recombinant flagellin from Marinobacter algicola (MA) and Vibrio vulnificus (Vvul), a non-pathogenic and a pathogenic bacteria, respectively, to stimulate the innate immune system of giltheadseabream (Sparus aurata L.) and compare the effect with that of the classical flagellin from Salmonella ent-erica serovar Typhimurium (Salmonella Typhimurium, STF). Intraperitoneal injection of MA and Vvulresulted in a strong inflammatory response characterized by increased reactive oxygen species produc-tion and the infiltration of acidophilic granulocytes at the injection site. Interestingly, however, onlyflagellin from MA consistently induced the expression of the gene encoding pro-inflammatory interleu-kin-1b. These effects were further confirmed in vitro, where a dose-dependent activation of macrophagesand acidophilic granulocytes by MA and Vvul flagellins was observed. In contrast, STF flagellin was foundto be less potent in both in vivo and in vitro experiments. Our results suggest the potential use of MA andVvul flagellins as immunostimulants and adjuvants for fish vaccination.</p><p> 2014 Elsevier Ltd. All rights reserved.1. Introduction</p><p>Vaccination is generally accepted as the most effectiveapproach to preventing infectious diseases. However, most of thevaccines used in aquaculture are not able to confer effectiveprotection by themselves. A good way to enhance the immune-stimulant effects of vaccines is the co-administration of adjuvants,which favors the presentation of the antigen to the immune sys-tem. Commercial vaccines include mineral oil-based adjuvants thatcan cause undesirable alterations in fish (Afonso et al., 2005;Mutoloki et al., 2008) and, despite their success against bacterialpathogens, their ability to combat viral diseases is low (Tafallaet al., 2013). But before beginning a search for new vaccines, it isnecessary to understand the fish immune mechanism in a vaccina-tion context to elucidate optimal targets that will trigger highimmunogenicity with minimal negative effects.</p><p>The innate immune system recognizes conserved pathogen-associated molecular patterns (PAMPS) by Toll-like receptors(TLRs) (Medzhitov, 2007). TLRs comprise a large family of receptorswhose stimulation leads to the activation of the transcription fac-tor NF-jB and the subsequent expression of pro-inflammatorycytokines and co-stimulatory molecules that finally activate theadaptive immune system (Gewirtz et al., 2001; Kawai and Akira,2007; Means et al., 2003; Rebl et al., 2010; Tsujita et al., 2004).Although they present similar key characteristics in mammalsand fish, the functional characterization of fish receptors pointsto differences in the signaling pathway and ligands (Phelan et al.,2005; Sepulcre et al., 2009), for example the presence of a</p><p>http://crossmark.crossref.org/dialog/?doi=10.1016/j.dci.2014.07.003&amp;domain=pdfhttp://dx.doi.org/10.1016/j.dci.2014.07.003mailto:vmulero@um.eshttp://dx.doi.org/10.1016/j.dci.2014.07.003http://www.sciencedirect.com/science/journal/0145305Xhttp://www.elsevier.com/locate/dci</p></li><li><p>J. Montero et al. / Developmental and Comparative Immunology 47 (2014) 160167 161fish-specific soluble TLR5 (TLR5S). This receptor has been identifiedin a variety of fish species, including puffer fish, rainbow trout, cat-fish and seabream, but not in mammals (Baoprasertkul et al., 2007;Bilodeau and Waldbieser, 2005; Munoz et al., 2013; Oshiumi et al.,2003; Tsujita et al., 2004). The soluble form has lost the typicalstructure of TLR and only preserves the extracellular leucin-richrepeats domain. Flagellin is the ligand of TLR5, and both forms ofthe receptor are able to recognize it (Hayashi et al., 2001;Oshiumi et al., 2003; Tsujita et al., 2004). Their tissue expressionpatterns differ and, while many works on the subject hypothesizethat a TLR5M/TLR5S interaction modulates the flagellin-mediatedimmune response, the exact role of TLR5S in fish is controversialand remains unclear (Hwang et al., 2010; Munoz et al., 2013;Sepulcre et al., 2007a).</p><p>Flagellin is the main structural component of the flagella ingram positive and negative bacteria, where it appears as a filamen-tous appendage on the bacterial surface and it is involved in theirmotility, attachment and chemotaxis. Flagellin is one of the mostpowerful PAMP described so far (Hayashi et al., 2001; Tafallaet al., 2013) because its D1 domain binds to and activates theTLR5 (Beatson et al., 2006; Eaves-Pyles et al., 2001b; Smith et al.,2003; Takeda et al., 2003; Yonekura et al., 2003; Yoon et al.,2012). Several studies have demonstrated the potent adjuvant abil-ity of flagellin against diverse pathogens in mammals (Bargieriet al., 2011; Bates et al., 2009; Camacho et al., 2011; Cuadroset al., 2004; Honko et al., 2006; Huleatt et al., 2007; Lee et al.,2006; Leng et al., 2011; Liu et al., 2011; McDonald et al., 2007;McNeilly et al., 2008; Munoz et al., 2010; Newton et al., 1989;Saha et al., 2006; Skountzou et al., 2010; Strindelius et al., 2004;Turley et al., 2011; Weimer et al., 2009a,b). This characteristic isthe result of its capacity to activate many processes that are criticalfor the development of cellular and humoral immune responses(Mizel and Bates, 2010; Verma et al., 1995; Zheng et al., 2012).However, the use of flagellin for vaccines or immunostimulantshas not been widely studied in fish.</p><p>In this context, we evaluate the immunostimulant propertiesin vivo and in vitro of three flagellins of different origins: Marinob-acter algicola (MA), Salmonella enterica serovar Typhimurium (STF)and Vibrio vulnificus (Vvul), in gilthead seabream (Sparus aurata).M. algicola is a Gram-negative and non-pathogenic bacterium,present in marine flora where it is associated with dinoflagellates(Green et al., 2006), while S. Typhimurium and V. vulnificus are alsoGram-negative but pathogenic species.2. Materials and methods</p><p>2.1. Fish</p><p>Healthy specimens of the hermaphroditic protandrous marinefish gilthead seabream (S. aurata L., Perciformes, Sparidae) werebred and maintained at the Centro Oceanogrfico de Murcia, Insti-tuto Espaol de Oceanografa (IEO) (Mazarrn, Murcia). The fish(approximately 40 g mean weight) were kept in running seawatertanks (dissolved oxygen 6 ppm, flow rate 20% aquarium volume/h)with natural temperature and photoperiod, and fed twice a daywith a commercial pellet diet (Skretting, Burgos, Spain) at a feedingrate of 1.5% of fish biomass. All experiments comply with theGuidelines of the European Union Council (86/609/EU), the SpanishRD 53/2013, and the Bioethical Committee of the University ofMurcia and the IEO for the use of laboratory animals.2.2. Recombinant flagellins</p><p>The different recombinant flagellins were generated and testedas previously reported (Terron-Exposito et al., 2012; Lee et al.,2006). Briefly, recombinant pFastbac plasmids were used to gen-erate the recombinant baculovirus. Then, in order to express therecombinant flagellins, Sf21 insect cells were infected with eachspecific baculovirus and the recombinant proteins were purifiedby affinity chromatography on a Co2+ resin (HisPur cobalt resin,Pierce) following the manufacturers recommendations and theirpurity was finally assessed by SDSPAGE and Coomassie bluestaining. The residual LPS content as determined by the ToxinSen-sorTM Chromogenic LAL Endotoxin Assay Kit (GenScript) was90%.</p><p>2.4. In vivo treatments</p><p>Fish were injected intraperitoneally with 100 ll of phosphate-buffered saline (PBS) alone or containing 1 lg of flagellin per fish.Three hours, 1 day, 3 days and 6 days post-treatment, four speci-mens per treatment were anesthetized with clove oil, bled, andthe peritoneal exudate and head kidney were removed. Cell sus-pensions were then obtained for the respiratory burst assays,immunofluorescence staining and RNA extraction (see below).</p><p>2.5. In vitro treatments</p><p>Macrophages and acidophilic granulocytes were maintained inRPMI-1640 culture medium (Life Technologies) adjusted to gilt-head seabream serum osmolarity (353.33 mOs) with 0.35% NaCl,supplemented with 0.1% fetal calf serum (FCS, Life Technologies),100 I.U./ml penicillin,100 lg/ml streptomycin and 1% L-glutamine,before being plated into 25 cm2 flask or 24-well plates, respec-tively. The macrophage monolayers and acidophilic granulocyteswere then exposed for 3 and 18 h, respectively, to different concen-trations of flagellin. After treatment, RNA was extracted from thecells as described below.</p><p>2.6. Respiratory burst assay</p><p>Respiratory burst activity was measured as the luminol-dependent chemiluminescence produced by 0.6 106 cells(Mulero et al., 2001). This was achieved by adding 100 lM luminol(Sigma) and 1 lg/ml phorbol myristate acetate (PMA, SigmaAldrich), while the chemiluminiscence was recorded every 127 sfor 1 h in a FLUOstart luminometer (BGM, LabTechnologies). Thevalues reported are the average of triple readings, expressed as</p></li><li><p>Table 1Primers used for RT-qPCR analysis.</p><p>Gene Acc. number Primer sequence (50 ? 30)</p><p>rps18 AM490061 F: AGGGTGTTGGCAGACGTTACR: CTTCTGCCTGTTGAGGAACC</p><p>il1b AJ277166 F: GGGCTGAACAACAGCACTCTCR: TTAACACTCTCCACCCTCCA</p><p>tnfa AJ413189 F: TCGTTCAGAGTCTCCTGCAGR: CATGGACTCTGAGTAGCGCGA</p><p>il8 AM765841 F: GCCACTCTGAAGAGGACAGGR: TTTGGTTGTCTTTGGTCGAA</p><p>il10 FG261948 F: TGGAGGGCTTTCCTGTCAGAR: TGCTTCGTAGAAGTCTCGGATGT</p><p>Fig. 1. SDSPAGE analysis of the recombinant flagellins after purification by affinitychromatography. Vibrio vulnificus (Vvul, ffi43 kDa), Marinobacter algicola (FR, ffi57 kDa) and Salmonella Typhimurium (STF, ffi53 kDa). Size differences betweenflagellins are due to the length of hypervariable region between constant domains.</p><p>162 J. Montero et al. / Developmental and Comparative Immunology 47 (2014) 160167the maximum of the reaction curve from 127 to 1016 s, fromwhichthe apparatus background was subtracted.</p><p>2.7. Quantification of G7+ cells (acidophilic granulocytes)</p><p>The percentage of G7+ cells from head kidney or peritoneal exu-date populations was evaluated by using flow cytometry. In thecase of head kidney, the G7+ cells correspond to the R1 region(FSChigh, SSChigh), as described (Sepulcre et al., 2002). To analyzecells from the peritoneal exudate, 0.2 106 cells/well were dis-posed in a 96-well plate and incubated with a 1:1000 dilution ofthe G7mAb for 1 h at 4 C. After three washes, cells were incubatedwith commercial FITC-labeled anti-mouse IgG, and analyzed by aFACSCalibur flow cytometer. The data were analyzed using FlowJosoftware. All data were obtained from triplicate biological samplesto confirm the results.</p><p>2.8. Analysis of gene expression</p><p>Total RNA was extracted using Trizol (Life Technologies) follow-ing the manufacturers instructions and quantified with a spectro-photometer (Nanodrop, ND-1000). RNA was then treated withDNAse I (amplification grade 1 unit/lg RNA, Life Technologies),and SuperScript III RNAse H-Reverse Transcriptase (Life Technolo-gies) was used to synthesize first strand cDNA with oligo (dT)18primer from 1 lg of total RNA at 50 C for 50 min. The mRNA levelsof different genes were determined by real-time PCR (RT-qPCR)with an ABI PRISM 7500 instrument (Applied Biosystems) usingSYBR Green PCR Core Reagents (Applied Biosystems). Reactionmixtures were incubated for 10 min at 95 C, followed by 40 cyclesof 15 s at 95 C, 1 min at 60 C and 15 s at 95 C. For each mRNA,gene expression was corrected by the ribosomal protein S18(rps18) content in each sample, using the comparative Ct method(2DDCt). The primers used are shown in Table 1. All amplificationswere performed in triplicate.</p><p>2.9. Statistical analysis</p><p>Data were analyzed by one-way ANOVA and a Tukey multiplerange test to determine differences between groups (p 6 0.05).For samples that did not follow a Normal distribution, a KruskalWallis non-parametric test and a Dunn test were used.</p><p>3. Results</p><p>3.1. In vivo effect of the intraperitoneal injection of recombinantflagellins</p><p>After the intraperitoneal injection of recombinant MA, STF andVvul flagellins (Fig. 1), the production of reactive oxygen species(ROS) was measured at different points in isolated cells from headkidney and peritoneal exudates (Fig. 2). In the peritoneal exudate, astrong enhancement in ROS production was observed 1 day afterthe injection with each of the three flagellins, MA more powerfulthan the PBS-injected controls (Fig. 2A). In addition, MA and Vvulsignificantly increased ROS levels after 3 h. However, the responseof head kidney leukocytes was not affected by flagellin injection(Fig. 2B). These data suggest that an inflammatory process isinduced at the injection site rather than a systemic effect.</p><p>Using immunofluorescence coupled to flow cytometry to mea-sure the percentage of acidophilic granulocytes following flagellininjection, it was found that the percentage of acidophilic granulo-cytes in peritoneal exudate had i...</p></li></ul>