Embed Size (px)
Citation preview
ELUCIDATING THE ROLES OF THE DIGUANYLATE CYCLASES CELR AND AVMA IN ATTACHMENT AND CELLULOSE SYNTHESIS WITH THE RESPONSE
REGULATOR DIVK IN AGROBACTERIUM TUMEFACIENS
BY
DAVID MICHAEL BARNHART
DISSERTATION
Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology
in the Graduate College of the University of Illinois at Urbana-Champaign, 2014
Urbana, Illinois
Doctoral Committee:
Professor Stephen K Farrand, Chair Associate Professor Richard Tapping Professor Gary Olsen Professor Andrei Kuzminov
Abstract
Agrobacterium tumefaciens, the causative agent of crown gall disease in plants,
physically interacts with plant cells to remain anchored within the nutrient-rich
rhizosphere. Part of this interaction involves the production of cellulose fibrils by the
bacteria, leading to the aggregation of the cells to each other as well as to the plant
surface. While this interaction between the bacteria and plants has been partially
characterized, little is known concerning the regulatory system that controls cellulose
synthesis within A. tumefaciens. One possible mechanism is through the secondary
messenger cyclic diguanosine monophosphate (c-di-GMP), a small molecule used in
numerous complex physiological processes in bacteria, including regulation of
exopolysaccharide production. In this study, we attempt to characterize the effects of two
diguanylate cyclases (DGC), CelR and AvmA, and other components involved in
regulating cellulose production and attachment.
CelR positively influences cellulose synthesis through the production of c-di-
GMP. This effect occurs when the DGC is activated, likely by phosphorylation.
Overexpressing celR also results in changes in cell morphology, attachment, unipolar
polysaccharide (UPP) production and virulence, although deleting the gene does not
affect any of these phenotypes. Overexpressing a DGC of similar structure to CelR,
AvmA, also affects these processes. Deleting the gene impacts attachment, UPP
deployment and virulence, suggesting that avmA is important for regulating the processes
not under direct control of celR. The cellulose synthase subunit, CelA, contains a c-di-
GMP-binding PilZ domain, which is necessary for the complex to produce the polymer in
response to the signal molecule. Deleting divK, the first gene of a two-gene operon with
ii
celR, also reduced cellulose production. This requirement for the response regulator was
alleviated by expressing a constitutively active form of CelR, suggesting that the DGC
must be activated and that DivK acts upstream of this event. A constitutively-active form
of DivK also results in increased cellulose production, but only in the presence of wild-
type CelR. Based on bacterial two-hybrid assays, CelR forms homodimers but does not
interact directly with DivK. In Caulobacter crescentus, DivK is required for polar
localization of cell division components; mutants of divK form branched and elongated
cells. Similarly, deleting the response regulator in A. tumefaciens results in branched and
misshapen cells. The phenotype is fully corrected by complementation with divK, but not
with wild-type celR or the constitutively active form of the DGC. These results support
our hypothesis that the function of CelR is restricted to stimulating cellulose synthesis,
and that the DivK/CelR signaling pathway in Agrobacterium separates production of the
polymer from cell cycle checkpoints mediated by DivK.
iii
Acknowledgements
I have had the support and guidance of many people over the course of this
dissertation work. First, I wish to thank my advisor, Dr. Stephen K. Farrand, who helped
me develop as a scientist over these years. I want to thank members of the Farrand
laboratory, past and present, who provided insight and ideas to my project. I especially
want to thank Margaret Wetzel, Yingping Qin, Sharik Khan and Shengchang Su for all of
their help these past years.
In addition to my coworkers, I want to thank all of the colleagues and professors
who lent me assistance in my work. I thank Dr. Peter Orlean for his help and guidance
with assays, and Dr. Lois Banta for her assistance and thoughts on microscopy and
attachment. I also want to thank my committee members, Richard Tapping, Gary Olsen,
Andrei Kuzminov and Carl Woese.
Finally, I want to express my love and gratitude to my family and friends for their
support on this journey. To my wife, Katey, who always stood by me and loved me on
even the hard days. To my son, Evan, who lights up my life. To my parents and siblings,
for all of their support and love. To all of you, thank you, and my love.
iv
Table of Contents
Page
Chapter 1 Introduction and literature review………………………………... 1
1.1
1.2
1.3
1.4
1.5
1.6
1.7
1.8
1.9
Taxonomy and physiology of Agrobacterium tumefaciens………...
Characteristics of crown gall tumors…………………………..…...
Transfer of T-DNA from Agrobacterium to plant tissue…………...
Attachment and colonization of plant tissue by Agrobacterium……
The role of cellulose synthesis in secondary attachment and
biofilm formation...............................................................................
The biology of c-di-GMP regulation……………………………….
Cyclic-di-GMP regulation of cellulose biosynthesis in bacteria…...
Objectives of this research project………………………………….
Figures…………………………………………………………..….
1
3
6
9
13
17
20
21
25
Chapter 2 CelR, an ortholog of the diguanylate cyclase PleD of Caulobacter,
regulates cellulose synthesis in Agrobacterium tumefaciens……….
27
2.1
2.2
2.3
2.4
Notes and Acknowledgements……………………………………...
Summary……………………………………………………………
Introduction…………………………………………………………
Materials and Methods……………………………………………...
2.4.1 Strains, cultures and growth conditions…………………….
2.4.2 Strain construction………………………………………….
2.4.3 Cellulose extraction assays………………………………....
2.4.4 Cellulase treatment………………………………………....
27
27
28
31
31
32
36
37
v
2.5
2.6
2.4.5 Microscopy and lectin-binding assays………………….......
2.4.6 Microscopic analysis of bacterial attachment to
Arabidopsis....…………………………………………………..
2.4.7 Biofilm assays………………………………………..……..
2.4.8 Virulence assays…………………..………………………..
Results………………………………………………………………
2.5.1 Overexpressing different putative diguanylate cyclases in
Agrobacterium tumefaciens has varying effects on
exopolysaccharide production………………………………….
2.5.2 Increasing the expression of atu1060 and atu1297 affects
the production of cellulose……………………………………...
2.5.3 atu1297, but not atu1060, is a positive regulator of
cellulose production………………………………………….....
2.5.4 Overexpression of celR affects the aggregation phenotype
of individual cells……………………………………………….
2.5.5 Overexpression of celR affects polar lectin binding……......
2.5.6 Modification of celR expression affects the attachment of
cells to plant tissue……………………………………………...
2.5.7 Overexpression of celR affects production of biofilms…….
2.5.8 celR overexpression severely attenuates virulence in
Agrobacterium tumefaciens…………………………………….
Discussion………………………………………………………......
2.6.1 CelR controls cellulose synthesis in A. tumefaciens………..
37
38
39
39
40
40
41
44
45
45
46
47
48
49
49
vi
2.7
2.6.2 CelR, but not Atu1060, directly controls production of
cellulose………………………………………………………...
2.6.3 The impact of celR overexpression on other phenotypes
suggests multiple processes are regulated by c-di-GMP in A.
tumefaciens………………………………………………....…..
2.6.4 Altering the expression of celR affects biofilm formation
and attachment to plants, exclusive of cellulose production.......
2.6.5 CelR orthologs within the alphaproteobacteria have
diverged to regulate separate processes………………………...
2.6.6 Cellulose biosynthesis in A. tumefaciens is regulated at
several levels…………………………………………………....
Tables and Figures………………………………………………….
51
52
54
55
57
59
Chapter 3 A signaling pathway involving the diguanylate cyclase CelR and
the response regulator DivK controls cellulose synthesis in
Agrobacterium tumefaciens………………………………………...
81
3.1
3.2
3.3
3.4
Notes and Acknowledgements……………………………………...
Summary…………………………………………………………....
Introduction…………………………………………………………
Materials and Methods……………………………………………...
3.4.1 Strains, culture and growth conditions…………………….
3.4.2 Strain construction…………………………………………
3.4.3 E. coli two-hybrid assays…………………………………..
3.4.4 Cellulose assays……………………………………………
81
81
82
85
85
85
91
91
vii
3.5
3.6
3.4.5 β-galactosidase assays……………………………………..
3.4.6 Microscopy…………………………………………………
Results………………………………………………………………
3.5.1 Alteration of key residues affects the influence of CelR on
cellulose production…………………………………………….
3.5.2 CelR regulates cellulose biosynthesis through its activation
and synthesis of c-di-GMP……………………………………..
3.5.3 An Asp53 Glu mutation in the first CheY domain of
CelR results in increased cellulose production…………………
3.5.4 An intact PilZ domain of CelA is required for cellulose
biosynthesis……………………………………………………..
3.5.5 Altering celR expression does not affect transcription of
celA……………………………………………………………..
3.5.6 The response regulator DivK affects production of
cellulose through CelR………………………………………….
3.5.7 The aspartate residues in the CheY domains of both DivK
and CelR are important for cellulose production……………….
3.5.8 Deleting divK affects cell morphology……………………..
3.5.9 CelR forms homodimers but does not interact with DivK…
Discussion……………………………………………………......…
3.6.1 CelR regulates cellulose synthesis through production of c-
di-GMP…………………………………………………………
91
92
93
93
94
94
95
96
97
99
101
101
102
102
viii
3.7
3.6.2 CelR requires the conserved aspartate residue in the CheY
domain to stimulate cellulose production………………………
3.6.3 The PilZ domain of CelA is necessary for cellulose
synthesis…………………………………………………….......
3.6.4 DivK participates in regulating cellulose synthesis through
CelR………………………………………………………….....
3.6.5 DivK but not CelR functions in pathways for both cellulose
synthesis and cell division……………………………………...
Tables and Figures………………………………………………….
103
104
105
107
110
Chapter 4 AvmA, a homolog of the cyclic-di-GMP synthase CelR, modulates
unipolar polysaccharide production and virulence in
Agrobacterium tumefaciens through different mechanisms……......
140
4.1
4.2
4.3
4.4
Notes and Acknowledgements……………………………………...
Summary……………………………………………………………
Introduction…………………………………………………………
Materials and Methods……………………………………………...
4.4.1 Strains, cultures and growth conditions…………………….
4.4.2 Strain construction………………………………………….
4.4.3 Microscopy and lectin-binding assays……………………...
4.4.4 Microscopic analysis of bacterial attachment to
Arabidopsis surfaces....................................................................
4.4.5 Biofilm assays………………………………………………
4.4.6 Virulence assays…….……………………………………...
140
140
141
143
143
143
145
145
146
147
ix
4.5
4.6
4.7
4.4.7 Expression analysis of virB4 by qPCR………………….….
Results………………………………………………………......…..
4.5.1 AvmA affects aggregation and interaction of A.
tumefaciens with surfaces………………………………………
4.5.2 Modification of avmA expression results in increased polar
lectin binding…………………………………………………...
4.5.3 Modifying expression of avmA significantly impacts
biofilm formation on borosilicate glass………………………...
4.5.4 AvmA suppresses polar attachment of bacteria to leaf
tissue……………………………………………………………
4.5.5 Modifying avmA expression and structure significantly
impacts virulence of A. tumefaciens…………………………....
4.5.6 Modifying avmA expression affects transcription of virB4...
4.5.7 avmA is found only in biovar 1 agrobacteria……………….
Discussion……………………………………………………..........
4.6.1 AvmA directly regulates UPP production and attachment in
A. tumefaciens…………………………………………………..
4.6.2 AvmA is the first DGC directly linked to virulence in A.
tumefaciens……………………………………………………..
4.6.3 AvmA is unique to biovar 1 genomovars of
agrobacteria……………………………………………………..
Tables and Figures………………………………………………….
148
148
148
150
151
152
152
154
154
155
155
158
159
161
Chapter 5 Conclusions………………………………………………………… 173
x
5.1
5.2
5.3
5.4
5.5
5.6
5.7
5.8
5.9
5.10
CelR is a direct regulator of cellulose synthesis through production
of c-di-GMP………………………………………………………...
CelR requires activation, probably by phosphorylation, to stimulate
cellulose synthesis…………………………………………………..
CelA is likely stimulated by c-di-GMP synthesized by CelR……...
Modifying expression of celR affects attachment and cell-cell
interactions………………………………………………………….
Cyclic-di-GMP is targeted to the appropriate signal pathway by
variations in the structure of diguanylate cyclases…………………
Mutating avmA affects UPP production and virulence……………..
The response regulator DivK impacts cellulose synthesis through
CelR………………………………………………………………...
DivK may connect CelR and AvmA in determining the type of
attachment in A. tumefaciens……………………………………….
Future Directions…………………………………………………...
Figures……………………………………………………………...
173
174
175
178
179
181
185
187
189
191
Chapter 6 References………………………………………………………….. 192
xi
Chapter 1
Introduction and literature review
1.1 Taxonomy and physiology of Agrobacterium tumefaciens
Agrobacterium tumefaciens is an alphaproteobacterium within the family
Rhizobiaceae (98). This family is organized into three genera- Agrobacterium, in which
A. tumefaciens resides, and Rhizobium and Sinorhizobium, containing the nitrogen-fixing
bacteria. Originally, these genera were organized based on the pathogenic or mutualistic
traits of the bacteria, including tumor formation, hairy root induction and nodulation.
However, the taxonomy using this methodology is problematic, as the traits are encoded
on plasmids that are transmissible between species (117, 118). Today, there is debate as
to whether Rhizobium and Agrobacterium should be combined into one genus (297). This
argument is based on 16s RNA similarity, biochemical and phylogenetic analyses and the
ability of species from each genus to maintain plasmids from the other (297). However,
further examination of these species demonstrates variation between Rhizobium and
Agrobacterium, and the names of each genus are accepted in the literature (73). Further,
several genomes from representative members in both genera demonstrate that some
members of Rhizobium and Agrobacterium are sufficiently different to keep the two
groups separate (234), although one group of agrobacteria does display characteristics
closer to the Rhizobium (discussed below).
The genus Agrobacterium is best known for the ability of some members to
induce cancerous growths on plants. Early classification of species of this genus
organized the bacteria based on disease phenotypes (121). Thus, Agrobacterium was
1
divided into five species: A. tumefaciens, which induces crown gall tumors in susceptible
plants; A. rhizogenes, which causes hairy root disease; A. rubi, which induces galls on
cane-type plants like raspberries; A. vitis, which induces galls on grapevines; and A.
radiobacter, isolates of which are not pathogenic. With the discovery that these
designations were based on traits encoded on mobilizable elements, it became clear that
this method of classification did not accurately organize the species. A more traditional
taxonomy was developed, based on DNA relatedness and chromosomal-based
biochemical properties of each species (98, 114, 122, 285). In this classification,
Agrobacterium is arranged into three types- biovar I, biovar II and biovar III. Each
biotype contains isolates that are pathogenic and non-pathogenic. Recent studies utilizing
multilocus sequence analysis confirm that biovars 1 and 3 are distinct from Rhizobium,
while it was suggested that species in biovar 2 are moved to the Rhizobium clade (174).
Biovar 3 is significant in that it contains isolates, called A. vitis, which induce galls only
on grapevines (98, 186). This division into biovars demonstrates the polyphyletic nature
of the Rhizobiaceae even within a genus, and supports the separation of the genera
Agrobacterium and Rhizobium.
Members of the genus Agrobacterium all are soil-based, rod-shaped, Gram-
negative cells measuring around two microns in length (121). These bacteria are motile,
driven by one to four peritrichous flagella (121, 241). Members of the genus
Agrobacterium are aerobic, strictly respiring, chemo-organotrophs, utilizing a wide
variety of sugars and plant-based compounds for carbon and energy. These bacteria lack
an intact Embden-Meyerhof pathway, and instead catabolize sugars via the Entner-
Doudoroff pathway and the tricarboxylic acid cycle (TCA). They also utilize a broad
2
range of amino and organic acids (85, 292). Like with many alphaproteobacteria,
succinate and glutamate are the preferred carbon sources for Agrobacterium, and growth
with either compound results in catabolite repression.
The genome of a biovar 1 strain, A. tumefaciens C58, the most studied member of
the genus, consists of two chromosomes: a 2.8 Mbp circular chromosome, and a 2.0 Mbp
linear chromosome (86). The circular chromosome contains genes and DNA sequences
reminiscent of an oriC-based system, similar to the replication system of Escherichia coli
(85, 292). Interestingly, the linear chromosome replicates via a plasmid-type repABC
system (85, 292), suggesting that chromosome 2 is distantly evolved from larger
extrachromosomal elements. All other biovar 1 isolates examined exhibit a similar, if not
identical, chromosomal organization. Strain C58 also harbors two large plasmids: a 214
kbp tumor-inducing (Ti) plasmid and a 542 kbp At plasmid (85, 292). Ti plasmids
contain genes required for virulence and are essential for the ability of the bacteria to
induce crown gall tumors (274, 282). The At family of plasmids encode catabolic
pathways for carbon utilization and metabolic flexibility (85, 177).
1.2 Characteristics of crown gall tumors
Agrobacterium tumefaciens was first described as the causal agent of crown galls
in 1907 (241). Research since then established that these growths are true tumors. The
galls are self-propagating (108), and can be cultured in vitro without added plant
hormones (21). Axenically cultured crown gall tissue retains its tumorigenic properties
(24, 286), demonstrating that the once tumors are induced, the bacteria are no longer
necessary to maintain the plant cells in a transformed state. Further experiments showed
3
that tumorigenesis involves an inception phase and a development phase, and that the
bacteria are not required for the second step (21, 23). These observations suggested that
some element, called the “Tumor Inducing Principle” (TIP), was transferred from the
bacteria to the plant cell during tumor induction (23, 24). Biochemical studies of the
tumors demonstrate that the tissue contains novel carbon compounds called opines, that
are not present in normal plant tissues (146, 172). The type of opines present in tumor
tissue is specified by the strain of Agrobacterium that induced the tumor (18, 193). The
opines not only are secreted from the tumors, but they also are translocated throughout
the plant (221). The observation that opines serve as specific growth substrates for the
inducing bacterial strain (119, 149, 193) led to the “opine concept” (194, 260, 261). This
model proposes that the invading bacteria engineer opine synthesis into the host to create
a dedicated source of carbon for the bacteria. Furthermore, the tumors effectively
increase the number of plant cells that synthesize the opines, which provides a rich source
of a nutrient utilized only by the inducing bacteria.
With the relationship between Agrobacterium and tumor induction established,
researchers sought to identify a substance that induces tumor formation. That the tumor
cells continue dividing after removal of the bacteria demonstrates that the inducing factor
is systemic and delivered during the initial infection (23, 24). The knowledge that the
plant tissue becomes malignant, and the observation that opines are produced by the cells
only after infection, suggest that a genetic factor is involved in inducing tumorigenesis
(193). Kerr and associates (116, 117) demonstrated that tumorigencity and the specificity
of opines found in the tumors can be transferred from virulent to avirulent agrobacteria.
Further, the virulence of C58, and its ability to catabolize opines, could be lost following
4
growth of the bacteria at elevated temperatures (90), suggesting that a transferrable
genetic element is responsible for virulence. Indeed, all virulent strains contain large
plasmids, and some of these, called Ti plasmids, confer the ability to induce tumors when
transferred to avirulent strains (274, 282, 300). Chilton et al. (42) made the key discovery
that a specific region of the Ti plasmid, called the T-region, is found in DNA extracted
from crown galls but not normal plant tissues. Subsequently, the segments of DNA,
called T-DNA, are integrated into chromosomal DNA in a random manner (42).
The T-DNA encodes the genes for tumorigenesis and the biosynthetic pathway of
opines. The oncogenes include ipt, which encodes an enzyme that synthesizes a
derivative of the plant hormone cytokinin (2), and iaaH and iaaM, which are involved in
the pathway for synthesis of a second hormone, indolacetic acid (228, 263, 264).
Expression of these genes from the T-DNA leads to increased levels of the two
hormones, resulting in proliferation of plant cells (17). Each T-region also encodes one or
more opine biosynthetic pathways, each producing a specific opine (18, 193, 199). There
are eight known opine families, generally with one or two families associated with any
given Ti plasmid (64, 65). The cohort of opines associated with a Ti plasmid is often used
to classify the plasmids into groups. For example, the T-region of pTiC58 contains genes
for synthesizing two opine types: nopaline, formed though a 1,4 imine linkage between
arginine and α-keto-glutarate, and the agrocinopines A and B, formed by a
phosphodiester linkage of either sucrose or glucose to L-arabinose (65, 215). The Ti
plasmid also carries the genes that allow strain C58 to utilize these two opine types, and
only these two types, as a sole source of carbon.
5
1.3 Transfer of T-DNA from Agrobacterium to plant tissue
The mechanism by which the T-DNA is transferred from Agrobacterium to the
host involves numerous steps, from assembly of the delivery system, to the transfer and
integration of the T-DNA into the plant. Components of this process are encoded by the
vir regulon, a set of transcriptional units found on Ti plasmids (110, 191). This regulon in
pTiC58 consists of seven separate transcribed elements, including the operons virB, virC,
virD, virE, and virF, and the monocistronic genes, virA and virG (112, 113, 202). In some
octopine-type Ti plasmids, the vir regulon includes repABC, encoding the replication
system of the element (43). When the regulon is stimulated, increased transcription of
repABC results in higher copy number of these plasmids (43). Together, these elements
of the regulon encode the regulatory, processing and delivery systems resulting in the
transfer to and incorporation of T-DNA into the plant chromosome.
The vir regulon is activated by the VirA/VirG/ChvE sensory system. Phenolics,
hexose sugars and other environmental cues released from a wounded plant stimulate
autophosphorylation of VirA (101). The activated receptor phosphorylates VirG, a
transcription factor (192). VirG binds to the vir box, a sequence located within the
promoters of elements of the vir regulon, and activates transcription of the operons (110,
191, 192). In the cases of virA and virG, upregulation of the promoters results in positive
feedback of the system, promoting increased activation of the regulon (248, 290).
Once the vir regulon is stimulated, the T-DNA is processed for delivery to the
plant. The target region is marked by T-borders, named the left and right border, that are
composed of a 14-bp imperfect direct repeat sequence (229, 233, 279, 280). The T-region
is processed by two proteins, VirD1 and VirD2, creating the initial T-complex. VirD1
6
separates the DNA strands for processing (83). VirD2, a tyrosine site-specific
recombinase, is a multicomponent protein that nicks one strand of the DNA at the border
sequences (247, 250, 276, 295), and forms a covalent bond with the 5´ end of the strand
(95, 187, 296). During this processing, the DNA is coated by VirE2, a single-strand
DNA-binding protein, protecting the T-complex from degradation (49, 50, 232, 309).
The processed T-complex and ancillary proteins are delivered to the plant cell
through a pilus-like type IV secretion system (T4SS). This secretion apparatus is
comprised of proteins encoded by the 11-gene virB operon (72, 265, 281) and virD4 (75,
265). The core of the complex is composed of multiple subunits of VirB6, VirB7, VirB8,
VirB9 and VirB10, which organize into a pore-like structure through the inner and outer
membranes (36, 47, 48). A pilus consisting of VirB2 and VirB5 extends beyond the
bacterium from the core complex (134, 224, 299). VirB2 comprises the majority of the
pilus, forming a hollow structure (120). VirB5 binds at the end of the T-pilus and along
the extended channel, and may be involved in interacting with the plant cell (5, 135, 224,
299). The T4SS is energized by three components, VirB4, VirB11 and VirD4, each
containing a Walker A nucleotide-binding domain characteristic of AAA ATPases (8, 59,
76, 251, 275). These proteins provide the energy for transferring the T-complex and
protein substrates through the T4SS (8, 218). Translocation of these substrates occurs
through ring-like assemblies in the apparatus to the pilus (33, 262).
In addition to translocation of the T-complex into the plant cell, the T4SS delivers
several protein substrates involved in nuclear transport and integration of the T-DNA into
the plant chromosome. These factors, which include VirE2, VirE3 and VirF, can be
7
transported separately from the DNA into the host (34). The proteins are thought to
translocate through the T4SS, in a manner similar to the T-complex (33).
Once secreted into the plant, the DNA is again coated by VirE2, reforming the T-
complex, and the complex is directed towards the nucleus (53, 81, 99, 232, 277, 309).
VirD2, VirE2 and VirE3 of the T-complex interact with components of the importin α
pathway, including the transport protein VIP1, mediating delivery of the nucleoprotein to
the nucleus (51, 133, 270, 301). Both VirD2 and VirE2 are involved in directing transport
of the fragment through the nucleopore channel (51, 52, 270). Once the T-complex passes
into the nucleus, VirE2 and VIP1 are thought to recognize nucleosomes and bind with the
chromatin (132). VirD2 also associates with the TATA binding protein, which may
facilitate T-strand/ chromatin binding (13). Once the complex interacts with the
nucleosomes, an F-box protein, VirF, targets both VIP1 and VirE2 for degradation, likely
to allow recombination between the T-strand and the target (227, 269, 301). Once the
transferred DNA is stripped of its accessory proteins, it integrates into the chromosome.
Initial reports suggested that the T-DNA was targeted to gene-rich, transcribed, A/T-rich,
and/or promoter regions of genes (29, 38, 226). However, these studies based the assay
for successful insertions into the plant on expressible and selectable traits, and would not
recognize insertions that did not express the selectable phenotype. Later analysis
demonstrated that the insertions appear to be random throughout the plant genome (125).
There are currently two models describing the integration of T-DNA (269). In the
first model, the homologous recombination system of the plant incorporates the DNA by
strand invasion. This would occur by targeting the T-strand via interaction of VirD2 to
nicks in the target DNA, then scanning for regions of microhomology between the
8
bacterial and plant DNA (176, 187). Once associated, the two strands would be
incorporated by nicking and rejoining activity of VirD2, followed by synthesis of the
complementary strand (266). The second model involves double strand break repair to
integrate the T-DNA into the chromosome. Here, the complementary strand of the T-
DNA is synthesized to form double stranded DNA, which is integrated into the target at
double strand breaks by non-homologous end joining (NHEJ) (144). Genetic analysis in
the yeast Saccharomyces cerevisie and the plant Arabidopsis thaliana indicate that
component proteins of NHEJ are required for integration of the T-DNA (273), and VirE2
inhibits XRCC4, a component of the end joining system, to promote double-stranded
breaks (272). To date, there is no consensus as to which of these two systems is used to
integrate the T-DNA into the plant chromosome.
1.4 Attachment and colonization of plant tissue by Agrobacterium
Cells of A. tumefaciens attach to the plant host for several purposes, including
association with the nutrient-rich environment of the rhizosphere, delivery of T-DNA for
virulence and utilization of opines produced by the crown gall tumors. The bacteria
require direct contact with a host to induce tumors (147, 148), and this interaction must
persist for at least eight hours in order for tumors to develop (256).
It is generally accepted that A. tumefaciens interacts with plant cell surfaces in a
two-step process: first, a reversible association between the bacteria and receptors on the
surface of the plant, followed by a second interaction involving a tighter binding between
the bacteria and the tissue (156, 163). It is likely that the reversible interaction is
mediated by some plant factor. Among the possible components are lectins, plant-
9
associated exopolymers, and receptors on the cell surface (20). Some potential factors
were identified by isolating mutants of Arabidopsis thaliana resistant to A. tumefaciens,
called rat mutants (304). Among these plant factors are enzymes involved in synthesizing
arabinogalactans (80) and a cellulose synthase-like complex (82, 303). However, there is
no conclusive evidence that any of these factors are involved in either recognition of
plant tissue or binding of the bacteria.
There has been an extensive search for the bacterial factors responsible for the
initial attachment of A. tumefaciens to plant cells. However, the complex relationship
between these factors, attachment and virulence remains poorly understood. In early
studies, lipopolysaccharide (LPS) synthesized by the bacteria was proposed as a potential
component. Extracts of the polymer seemingly block the bacteria from attaching to plant
tissue, presumably by competitive inhibition (284). In these studies, tumor induction was
used as the assay for attachment, and actual binding was not examined. Later, researchers
determined that LPS activates host defense systems, thereby inhibiting tumor induction
(305).
Smit et al. (238) described a small, Ca2+-dependent protein in Rhizobium
leguminosarum, called rhicadhesin, that is similar to cadhesins in eukaryotes. This
protein, later annotated as RapA1, is important for the colonization of pea shoots by R.
leguminosarum (60, 236). RapA1 requires Ca2+, likely released from the tissue, to
increase attachment of Rhizobium and Bradyrhizobium to plant surfaces (60, 237). In A.
tumefaciens, competition assays with purified rhicadhesin from R. leguminosarum
resulted in decreased attachment of the bacteria to plant tissue (254). However, there is
10
no homolog of rapA1 in A. tumefaciens, and the gene is only found in a few species of
Rhizobium (10, 171).
The synthesis of β-1,2-glucans, exopolysaccharides synthesized by ChvA and
ChvB, may contribute to attachment in A. tumefaciens. A chvA mutant was unable to
attach to Zinnia leaf tissue (67, 68, 308) and was affected in transfer of T-DNA (255).
However, studies of β-1,2-glucans demonstrate that the polysaccharides are key
components of the adaptive response to periplasmic osmotic stress (32). Mutants of
chvAB show pleiotropic effects, including reduced production of flagella, decreased
exopolysaccharide synthesis and altered composition of membrane proteins (25). These
effects cloud an accurate assessment of the role of chvAB in attachment.
A study of transposon mutants of strain C58 revealed a potential genome
fragment that, when disrupted, resulted in lower attachment of Agrobacterium to the
surfaces of cut carrot disks (155). This segment, called the att region, contains genes
encoding a diverse set of functions, including catabolic pathways, ABC transporters,
polysaccharide synthases, peptidases, Mg2+ transporters and transcription regulators (164,
165). Deleting one gene in this region, annotated attR, resulted in the strongest effect on
attachment and virulence (159, 201). However, the att region is carried on one of the
extrachromosomal plasmids, pAtC58 (85, 292), and curing the plasmid from C58 has
little effect on attachment or virulence (177). These observations cast doubt on the role of
the att region in the attachment process.
Recently, it was reported that A. tumefaciens synthesizes a lectin-binding
structure, named the unipolar polysaccharide (UPP), that localizes to one pole of the cell
(267). The UPP is similar to the holdfast on the tip of the stalk in a related
11
alphaproteobacterium, Caulobacter crescentus (130). The holdfast contains N-acetyl
glucosamine (GlcNAc) residues that interact with lectins (168). These polysaccharides
are anchored to the holdfast by holdfast attachment (Hfa) proteins localized at the end of
the stalk (54, 92, 130, 131). In A. tumefaciens, the UPP is likely synthesized by a pathway
encoded by uppABCDEF (293). Production of the adhesive complex is stimulated by
contact of the bacterium with surfaces, suggesting that pressure is a signal for deployment
of the structure (143). Interestingly, while the UPP likely contains GlcNAc residues,
there are no conserved orthologs of Hfa proteins in A. tumefaciens (267). It is possible
that other anchoring proteins exist in this structure, although these factors have not been
identified. The role of the UPP in attachment and colonization to plant tissue has not been
fully determined, although mutants in which the upp operon is deleted remain virulent
(294). It is important to note, however, that the traditional assays used in these studies
involve direct inoculation of suspensions or pastes of bacteria into wound sites on the
plant. Under these conditions, the bacteria may initiate tumorigenesis without need for
the tight binding associated with the UPP. However, in the real biology of the interaction
between A. tumefaciens and host plant surfaces, the UPP remains a possible component
of initial attachment.
In addition to A. tumefaciens and C. crescentus, other alphaproteobacteria
produce polar binding structures, suggesting that these apparati may be a conserved
feature of the family. Isolates of R. leguminosarum synthesize a WGA-binding polar
polysaccharide, very similar to the UPP, which contributes to polar attachment of the
bacteria to pea shoots (139, 140). A majority of sequenced genomes of the Rhizobiaceae
contain orthologs of the upp genes (NBCI), suggesting that components of the polar
12
structure are highly conserved within the family. Another alphaproteobacterium,
Asticcacaulis biprosthecum, produces a holdfast construct similar to that of C. crescentus
(278). The presence of these adhesion-like attachment structures and their location at the
cell pole among a wide range of alphaproteobacteria suggests that polar attachment is a
common phenomenon throughout the family. The Rap proteins in R. leguminosarum,
including rhicadhesin, also are polarly localized (10). Strains of R. leguminosarum
overproducing RapA1 display increased binding to roots of pea shoots and increased
frequency of nodulation (171). However, the rap genes are found only in select members
of the genus (298), and have not been observed in members of the genus Agrobacterium
(10).
1.5 The role of cellulose synthesis in secondary attachment and biofilm formation
As described above, the interaction of A. tumefaciens with plant surfaces occurs in
two steps: initial attachment and secondary attachment. The initial attachment phase
likely involves unidentified components that associate the bacteria with the target surface.
After this initial interaction, the cells form a very tight binding between the surface of the
plant cell as well as with other bacteria, resulting in colonization and biofilm formation.
This anchoring allows the bacteria to remain within the nutrient-rich space surrounding
the plant, and prevents the cells from dispersing into the soil environment. This binding is
likely mediated by a number of factors, including several different exopolysaccharides.
One of the components in this secondary binding is cellulose, produced by A. tumefaciens
during formation of microcolonies and biofilms (156, 157, 180).
13
Cellulose is critical for long-term attachment and biofilm formation. Root
colonization by both Agrobacterium and Rhizobium, but not individual attachment of
cells, is dependent upon cellulose synthesis (140, 158, 160). While cellulose synthesis
may be critical for colonization and stable binding to the plant, it is not well understood
how the fibers affect initial attachment or virulence. Mutants deficient in cellulose
production still attach individually to plant tissue (158). Using standard virulence assays,
cel- mutants are fully tumorigenic (156). However, as described above, assays for
virulence involve applying the bacteria directly into wound sites on the plant. These
methods do not reflect the real-life conditions that cells of the bacterium contend with
during contact and interaction with the plant tissue. Indeed, gentle washing of the wound
sites inoculated with a cel- mutant within eight hours post-infection prevents
tumorigenesis (256). Thus, the real-life impact of cellulose synthesis on attachment and
virulence remains unresolved.
Cellulose is a common component of attachment mechanisms in many
proteobacteria, and the components for synthesizing the polymer are highly conserved
among these species. Cellulose synthesis in bacteria was first described in a number of
alphaproteobacteria, including Gluconacetobacter (formerly Acetobacter), Rhizobium
and Agrobacterium (27, 180). Later, species of Salmonella, Escherichia, Vibrio,
Pseudomonas and Burkholderia were reported to produce the polymer (16, 244, 307). A
system of four genes, called bcsABCD, encoding the enzymes for cellulose synthesis was
first described in Gluconacetobacter (291). The products of these genes include the two
subunits of cellulose synthase, BcsA and BcsB; a putative secretion channel through the
outer membrane, BcsC; and BcsD, which to date has no known function (223, 288, 291).
14
Homologs of these genes are present in most, if not all, species known to produce
cellulose, with variation in organization and additional components (288).
Agrobacterium tumefaciens also contains the genes encoding the pathway for
synthesis of cellulose, annotated as the cel operons (85, 292). These two operons are
organized on the linear chromosome as celABCG and celDE (Figure 1.1; (85, 162, 292)).
Of these genes, celA, celB and celC encode components orthologous to bcsABC in other
organisms (161, 162, 223, 291). The celD, celE and celG genes are orthologous to other
genes in the cel operons of other proteobacteria, but have no known function in the
pathway (161, 162, 288). This organization of the cel operons is conserved in the biovar 1
isolates of Agrobacterium (NBCI; (234)), while other members of the family
Rhizobiaceae, including the biovar 2 agrobacteria, contain the single cel(bcs)ABCD
operon, the organization of the genes that is found in the majority of proteobacteria that
synthesize cellulose.
CelA and celB encode the inner membrane-spanning cellulose synthase complex
that catalyzes production of the polymer. These components in other systems form a
heterodimer, with CelA(BcsA) embedded in the inner membrane, and CelB(BcsB)
localized in the periplasmic space (173). The bitopic BcsA contains a glycosyltransferase
domain that catalyzes the addition of UDP-glucose to the extending cellulose chain and a
domain that recognizes an activating signal (discussed below; (173, 216)). The BcsB
subunit assists in translocating the cellulose fibril through the periplasm (173). These
complexes often are localized to the poles of rod-shaped cells, including in some species
of Rhizobium (137, 288).
15
Less is known concerning the functions of celC, celD, celE and celG, the
remaining genes in the cel operons. CelC is a transmembrane protein that likely localizes
to the outer membrane (223). The celC gene is required for in vivo, but not in vitro,
synthesis of cellulose, suggesting that the protein acts in exporting the fibril (223). The
functions of CelD and CelE remain unknown, although it is hypothesized that the
proteins act in synthesizing or recruiting UDP-glucose to the synthase (161, 162). CelG
has no known domain structure, but mutating its corresponding gene results in the
production of increased levels of cellulose (158), suggesting it has some regulating role in
the system.
Agrobacterium also synthesizes a second glucose-based polymer, the β-1,3-linked
polysaccharide curdlan (178). This polymer is synthesized by CrdS, an enzyme with a
catalytic domain structure similar to CelA (249). Curdlan is present in cell free extracts
from some species of Agrobacterium (249). Recently, curdlan synthesis has been tied to
nitrogen starvation, with production of the polymer being increased under conditions of
limiting nitrogen (212). Further, curdlan production responds to ppGpp, a small molecule
involved in the stringent response associated with starvation and other stress conditions
(212). These observations suggest that curdlan synthesis may respond to environmental
signals.
There is strong evidence that cellulose synthesis in A. tumefaciens is also
regulated. Matthysse (158) reported that synthesis of the polymer is induced by the
addition of soytone to media, although our laboratory has been unable to replicate this
result (Sharik Khan, Personal Communication). Mutational analysis suggests that two
genes, celG and celI, negatively regulate cellulose production; mutating either ORF
16
results in increased synthesis of the polymer (158). However, attempts to define
environmental signals stimulating cellulose synthesis have been unproductive.
While the environmental signal regulating cellulose production in A. tumefaciens
remains elusive, there is evidence of an intracellular molecule that influences synthesis of
the polymer. Benziman (6) reported that in cell-free extracts of the bacteria, cellulose
synthesis is stimulated by adding cyclic-di-guanosine monophosphate (c-di-GMP). In R.
leguminosarum, mutating a gene predicted to synthesize this intracellular signal also
affects production of the polymer (11). These observations suggest that c-di-GMP is a
factor in regulating cellulose synthesis.
1.6 The biology of c-di-GMP regulation
Cyclic-di-GMP is one of the internal signals used by bacteria to regulate
intracellular processes (for an overview, see (205)). The signal consists of two molecules
of GTP linked together at the 3´ and the 5´ carbons of the deoxyribose sugars (Figure 1.2;
(79, 211)). Where determined, cyclic-di-GMP is present at relatively low levels with
concentrations around 100-500 nM in C. crescentus, although under certain conditions
levels of the signal can reach above 1 mM (46). Recent studies of sequenced genomes
suggest that up to 85% of gram-negative bacteria use c-di-GMP in some manner (7, 246).
Other studies have identified c-di-GMP signaling in Bacillus subtilis (39). The field of c-
di-GMP signaling has exploded in recent years, with descriptions of numerous processes
being regulated by the signal, including virulence, exopolysaccharide production,
motility, biofilm production, cell cycle progression and DNA competence (reviewed in
(205, 243)).
17
Interest in c-di-GMP traces directly to studies of the regulation of cellulose
biosynthesis in G. xylinus (208). In cell-free extracts of this bacterium, adding the signal
stimulates production of the polymer (208, 211). Later, Ross et al. (210) demonstrated
that c-di-GMP directly stimulates synthesis in purified extracts of the cellulose synthase
complex. Further research in G. xylinus showed that a class of enzymes called
diguanylate cyclases, or DGCs, synthesize c-di-GMP (Figure 1.2; (257)). Diguanylate
cyclases are characterized by the presence of a conserved GG(D/E)EF motif at the
catalytic site (190, 217, 257). This motif interacts with two molecules of GTP bound to
the enzyme and catalyzes the linkage forming c-di-GMP (188, 190). Many DGCs are
bitopic, and contain a signal reception domain, suggesting that synthesis of c-di-GMP is
itself regulated by sensory pathways (205, 206).
The breakdown of c-di-GMP is catalyzed by two different classes of
phosphodiesterases, phosphodiesterase A (PDEA) and HD-GYP (Figure 1.2; (78, 79,
257)). Both enzymes hydrolyze c-di-GMP to pGpG, lowering the intracellular
concentration of the signal (79, 225, 231). PDEAs catalyze this reaction through the
conserved EAL motif (225, 231), while HD-GYP-type enzymes degrades the molecule
using the conserved HDXXXGYP motif (70, 214). These enzymes act in conjunction
with DGCs to modulate the intracellular levels of c-di-GMP.
Cyclic-di-GMP is bound by target proteins, with such binding often resulting in
regulation of a specific process. The first such protein discovered was PilZ, a small
receiver found in species of Pseudomonas (7). Proteins containing the PilZ-like domain
are present in a large percentage of organisms (7). Since then, a number of c-di-GMP-
binding domains have been identified. These additional motifs include modified GGDEF,
18
EAL or HD-GYP domains, which can bind to c-di-GMP without processing (71, 142)
and inhibitory binding sites (I-sites) found in a number of DGCs (35, 181, 188). Of
considerable interest, several riboswitches bind c-di-GMP as the folding ligand (141,
253).
As an internal signal, c-di-GMP diffuses easily throughout the cell within
milliseconds of production, and could influence other processes beyond the intended
target. This issue of spatial organization is controlled in two ways. In the first, receptors
of c-di-GMP may show different affinities for the signal and exhibit sensitivity to
variations in concentration of the signal. In the second, the molecule may be localized
and/or contained within a compartment of the bacterium. In the first model, a given
receiver domain has a defined affinity for c-di-GMP, resulting in different phenotypes
associated with different concentrations of the signal. Studies of two c-di-GMP-binding
proteins in S. enterica serovar Typhimurium, YcgR and BcsA, demonstrated that each
receptor has a different binding affinity, resulting in either altered motility or cellulose
synthesis depending on the in vivo concentration of c-di-GMP (197). In the second
model, DGCs are localized to specific regions of the cell to prevent the signal from
affecting receptors in other locations in the bacterium. The well-studied regulation of cell
differentiation and division in C. crescentus exemplifies this method, with several DGCs
localized to coordinate both processes at one specific pole of the cell (1, 4, 268). These
examples suggest that a combination of the two principles - targeting the c-di-GMP
synthase and variations in binding affinities of the receptors - are necessary for separating
processes regulated by the signal.
19
In many bacteria, c-di-GMP regulates the transition of the cell from motility to a
sessile lifestyle (205). In these organisms, a low concentration of the signal results in
production of flagella and a corresponding motile lifestyle (205, 246). As levels of c-di-
GMP increase, the bacteria transition to a sessile lifestyle through increased production of
exopolysaccharides, upregulation of anchoring systems and transition into biofilms (205).
1.7 Cyclic-di-GMP regulation of cellulose biosynthesis in bacteria
The discovery of c-di-GMP as an intracellular regulator derived from studies of
cellulose synthesis. In addition to biochemical studies previously described, purified
synthase complexes of G. xylinus bound radiolabeled c-di-GMP, suggesting that the
enzyme is stimulated by directly interacting with the signal (283). Crystallographic
studies later demonstrated that c-di-GMP is bound within the PilZ domain of BcsA in
Salmonella (74, 173). These results suggest that c-di-GMP activates cellulose synthesis
by directly binding with the enzyme.
Genetic studies support the biochemical evidence demonstrating that c-di-GMP
regulates cellulose synthesis. Three operons encoding DGCs and PDEAs that affect
production of the polymer were identified in G. xylinus (257). Each of these two-gene
operons, annotated pde-cdg, contain a phosphodiesterase (Pde) and a diguanylate cyclase
(Dgc) (257), suggesting divergent duplication of an original locus. Later research
determined biochemically that the Dgc and Pde proteins possess cyclase and
phosphodiesterase activity, respectively (12, 37). These observations suggest that
modulation of c-di-GMP levels through these enzymes controls cellulose synthesis in G.
xylinus.
20
In many other bacteria, c-di-GMP serves to regulate cellulose synthesis. Genes
encoding DGCs that regulate cellulose production have been identified in Rhizobium
(11), Salmonella (307), Pseudomonas (57, 245) and Vibrio (198). Phylogenetic analysis
of these organisms demonstrated that each contains the genes encoding the cellulose
synthesis pathway, including BcsA(CelA) (7). In all of these species, this subunit of the
synthase contains a conserved PilZ domain (7, 288). The use of c-di-GMP in a diverse
group of bacteria suggests a conserved system of regulating production of the polymer in
at least the alpha- and gammaproteobacteria.
Regulation of cellulose biosynthesis by a DGC also was described in R.
leguminosarum, a close relative of A. tumefaciens. Using a cellulose-overproducing strain
of R. leguminosarum, Ausmees et al. (11) reported that mutations in a two-gene operon,
consisting of a histidine kinase, named celR1, and a putative diguanylate cyclase,
annotated as celR2, negatively affected cellulose production. Complementing the
mutations with celR2 restored cellulose production to levels of the parent, suggesting that
the product of the gene stimulated synthesis of the polymer (11). However, while CelR2
contains a GGEEF motif for synthesizing c-di-GMP, at the time the importance of this
domain was not known, and therefore the role of c-di-GMP in controlling cellulose
production in R. leguminosarum was not examined.
1.8 Objectives of this research project
Attachment of A. tumefaciens to plant cells is required for colonization and
proliferation of the bacteria. Additionally, interaction of the bacteria with plants is critical
for delivery of T-DNA during induction of crown gall tumors. While the biochemistry of
21
one component of binding, cellulose, has been studied in some detail in A. tumefaciens,
less is known about how production of the polymer is regulated. Cyclic-di-GMP
stimulates cellulose synthesis in cell-free extracts of A. tumefaciens (6), yet the DGC
synthesizing the signal has not been identified. Further, despite attempts to determine its
function in attachment and virulence, the role of cellulose in these processes remains
poorly understood. The effects of other components involved in attachment, including the
UPP, also are not yet clear. Characterizing the factors regulating production of
components like cellulose and the UPP is necessary to understand the attachment process.
In this study, I propose to determine the role of c-di-GMP in regulating cellulose
synthesis and UPP production in A. tumefaciens. Biochemical and bioinformatic analyses
suggest that production of the polymer is controlled by c-di-GMP (6, 7). In R.
leguminosarum, overproducing a GGEEF-containing protein, CelR2, results in increased
cellulose synthesis (11). Further, deleting specific genes encoding DGCs affects UPP
production in A. tumefaciens (294). These observations suggest that other GGEEF-
containing proteins are involved in regulating cellulose synthesis and UPP formation in
A. tumefaciens.
In Chapter 2, I examine the effects of two genes encoding DGCs, atu1060 and
atu1297, on a number of phenotypes typically affected by c-di-GMP. These two
enzymes, similar to their ortholog in R. leguminosarum, CelR2, contain two CheY-like
receiver domains and a C-terminal GGEEF domain (11). Given the relatedness of
Atu1297 and Atu1060 to other DGCs, including CelR2, I hypothesized that one, the
other, or both of these two proteins would impact attachment, cellulose synthesis and
virulence. Overexpressing either gene results in increased production of the polymer and
22
increased cell aggregation. A cel- mutant, unable to produce cellulose, did not express
these phenotypes. Overexpressing atu1297 also impacts cell-cell interactions, attachment
to plant tissue, biofilm formation and virulence. Deleting the gene results in a significant
decrease in cellulose synthesis, suggesting that atu1297 is necessary to stimulate
production of the polymer. However, deleting this gene does not significantly impact
other phenotypes affected by overexpressing atu1297, suggesting that other DGCs are
involved in regulating these traits. From these results, I concluded that atu1297 directly
regulates cellulose synthesis in A. tumefaciens, and named the gene celR.
In Chapter 3, I focus on CelR-mediated regulation of cellulose synthesis. The
DGC contains a conserved GGEEF domain and a CheY-like receiver domain, the latter
suggesting that the protein is an intermediate component of a larger signal pathway. Site-
directed mutagenesis of critical residues in the GGEEF and CheY domains demonstrate
that CelR is a functional diguanylate cyclase, and likely requires phosphorylation in the
receiver domain for its activation. The signal synthesized by CelR must be received by a
target protein, and the cellulose synthase subunit CelA contains a PilZ-type c-di-GMP-
binding domain. A site-directed mutation in the PilZ domain of CelA prevents
stimulation of cellulose synthesis by CelR, suggesting that CelA requires c-di-GMP for
maximum enzymatic activity. Further, a gene encoding a response regulator is located
upstream of celR in a two-gene operon. This gene, annotated as divK, is required for full
CelR-dependent stimulation of cellulose synthesis, as deleting the response regulator
prevents stimulation of production of the polymer by CelR. A constitutively active form
of the DGC overproduces cellulose in the divK deletion mutant, suggesting that this
response regulator is part of the activation cascade for CelR. The response regulator also
23
is a component of cell cycle regulation, similar to orthologs of divK in other
alphaproteobacteria. These observations suggest that DivK contributes to the regulation
of progression of the cell cycle and cellulose synthesis through separate mechanisms,
while CelR specifically regulates cellulose synthesis in A. tumefaciens.
In Chapter 4, I continue examining Atu1060, renamed AvmA, to determine its
role in attachment and virulence. Similar to CelR, AvmA contains two CheY-like
domains and the GGEEF domain. This observation suggests that some of the phenotypes
unaffected by deleting celR may be influenced by AvmA. Deleting the gene results in
increased UPP production and polar attachment and a decrease in biofilm formation. The
mutant phenotypes are complemented by expression of wild-type avmA, while
overexpressing alleles of the gene altered at either the activation residue or the GGEEF
motif failed to replicate the phenotypes displayed when overexpressing the wild-type
gene. Interestingly, as compared to the wild-type parent, the avmA deletion mutant
requires a 10-fold lower dose of bacteria to induce tumors. However, the mutant alleles of
avmA fully complemented the virulence phenotype of the deletion mutant. These results
suggest that, like CelR, AvmA requires activation to synthesize c-di-GMP, and that this
signal regulates traits including UPP production and attachment to surfaces. However, the
influence of AvmA on virulence is not dependent on the production of c-di-GMP.
Combined, these observations suggest that CelR and AvmA regulate the conversion from
initial attachment to stable binding in A. tumefaciens.
24
1.9 Figures
Figure 1.1. The cel operons of A. tumefaciens. Scale bar represents approximately 1 kb
of DNA.
25
Figure 1.2. A model of cyclic diguanosine monophosphate (c-di-GMP) cycling, with
corresponding domains catalyzing the reactions and processes upregulated by the
signal.
26
Chapter 2
CelR, an ortholog of the diguanylate cyclase PleD of Caulobacter, regulates cellulose
synthesis in Agrobacterium tumefaciens
2.1 Notes and Acknowledgements
This chapter is adapted from the Applied and Environmental Microbiology article,
entitled “CelR, an ortholog of the diguanylate cyclase PleD of Caulobacter, regulates
cellulose synthesis in Agrobacterium tumefaciens”, November 2013, Volume 79, Pages
7188- 7202, with authors D. M. Barnhart, S. Su, B. E. Baccaro, L. M. Banta, and S. K.
Farrand. Additionally, I would like to thank Dr. Peter Orlean for his guidance in the
protocols and interpetation of the cellulose extraction assays.
A portion of the data presented in this chapter was produced by co-authors. The
strain NTL7Δcel was produced by Dr. Shengchang Su, University of Illinois. Analysis of
Agrobacterium attachment using SEM was performed in the laboratory of Dr. Lois Banta,
Williams College, MA.
2.2 Summary
Cellulose fibrils play a role in attachment of Agrobacterium tumefaciens to its
plant host. While the genes for cellulose biosynthesis in the bacterium have been
identified, little is known concerning the regulation of the process. The signal molecule
cyclic diguanosine monophosphate (c-di-GMP) has been linked to the regulation of
exopolysaccharide biosynthesis in many bacterial species, including A. tumefaciens. In
this study, we identified two putative diguanylate cyclases, celR (atu1297) and atu1060
27
that influence production of cellulose in A. tumefaciens. Overexpression of either gene
resulted in increased cellulose production, while deletion of celR, but not atu1060,
resulted in decreased cellulose biosynthesis. CelR overexpression also affected other
phenotypes including biofilm formation, formation of a polar adhesion structure, plant
surface attachment, and virulence, suggesting that the gene plays a role in regulating
these processes. Analysis of celR and Δcel mutants allowed differentiation between
phenotypes, such as biofilm formation, associated with cellulose production and
phenotypes probably resulting from c-di-GMP signaling, which include polar adhesion,
attachment to plant tissue and virulence. Phylogenetic comparisons suggest that species
containing both celR and the cellulose synthase subunit celA adapted the CelR protein to
regulate cellulose production, while those that lack celA use CelR, called PleD, to
regulate specific processes associated with polar localization and cell division.
2.3 Introduction
The ability to attach to surfaces is critical for the survival and growth of many
bacteria in their native environments. Such attachments can provide a protective barrier
from harsh environmental conditions and predation, and also are important in establishing
a relationship between pathogens and symbionts and their hosts. The interaction of the
plant pathogen Agrobacterium tumefaciens with its plant host in particular is dependent
on such attachment phenomena (147, 148). This bacterium binds to plant cell surfaces
and at plant wound sites forming microcolonies and biofilms.
Attachment as biofilms or microcolonies often requires the formation of matrices
of complex carbohydrate polymers, with such matrices anchoring the bacteria to each
28
other as well as to surfaces. One component of the matrix produced by A. tumefaciens is
cellulose, a β1,4-linked glucose polymer. The cellulose fibrils apparently serve to anchor
the bacteria to each other as well as to the plants (157). Mutants deficient in the
production of cellulose bind less tightly to plant cell surfaces (156, 160), and do not
efficiently establish biofilms (158).
The production of cellulose by A. tumefaciens strain C58 is encoded by two
closely linked operons, celABCG and celDE, located on the linear chromosome (162).
The two operons encode the cellulose synthase complex, a membrane-bound structure
that includes the catalytic complex composed of a CelA/CelB heterodimer. This complex
catalyzes the addition of UDP-glucose to the extending cellulose fiber (161, 222, 307).
CelC is similar to outer porin-like proteins, and may serve as the complex for secreting
the polymer into the extracellular environment (223). The functions of CelD and CelE in
the synthesis and secretion of cellulose are unknown (161, 223), while CelG, although of
unknown function, apparently contributes to the regulation of cellulose synthesis (158).
Based on evidence in other bacteria, the cellulose fibrils are believed to be extruded into
the extracellular milieu from the synthase complex imbedded within the membrane of the
cells (173, 288). While much is known about the synthesis of the polymer, little is known
concerning mechanisms that control cellulose production in A. tumefaciens.
In some bacteria, production of cellulose is activated in response to the
intracellular signal, cyclic di-guanosine monophosphate (c-di-GMP) (for reviews, see
(106, 203, 206, 209)). Synthesis of c-di-GMP is catalyzed by a family of enzymes called
diguanylate cyclases (DGC), most of which are characterized by a conserved GG(D/E)EF
motif (257). The correct balance of c-di-GMP within the cell is maintained by the
29
breakdown of the signal molecule mainly by phosphodiesterase A (PDEA), marked by a
conserved EAL motif (257) or by the HD-GYP domain (69, 78). The c-di-GMP acts as
an allosteric ligand, and is bound by receptor proteins containing one of several identified
c-di-GMP binding domains. Such domains include the PilZ domain; modified HD-GYP,
EAL and GGDEF motifs; and even riboswitches (7, 35, 181, 204, 216, 253). In recent
years, c-di-GMP has been implicated in regulatory systems that control motility, biofilm
formation, exopolysaccharide production, and virulence in many bacterial species (for
reviews, see (19, 56, 107, 206, 243, 258)).
The production of c-di-GMP regulates at least two attachment processes in the α-
proteobacteria. In Caulobacter crescentus, c-di-GMP produced by the diguanylate
cyclase PleD regulates the formation and localization of the polarly-localized holdfast
stalk, which anchors the cell to surfaces through a terminal adhesive structure (4, 94).
Rhizobium leguminosarum bv. Trifoli uses an ortholog of PleD, called CelR2, to regulate
production of cellulose (11). There also is evidence that c-di-GMP plays a role in
exopolysaccharide production in A. tumefaciens; addition of the signal to cell-free lysates
resulted in an increased rate of cellulose synthesis (6). Consistent with this observation,
the CelA component of the cellulose synthase of A. tumefaciens contains a PilZ domain
(7).
In this study, we identified probable DGCs that influence exopolysaccharide
production and examined the effects of such enzymes on cellular processes in A.
tumefaciens, including the production of cellulose, the formation of attachment structures
and the behavioral consequences of these changes. Our studies indicate that
overexpressing two putative DGCs, celR (atu1297) and atu1060, positively affects
30
cellulose biosynthesis. Deleting celR resulted in a decrease in the production of cellulose,
while removal of atu1060 did not affect production of the polymer. Overexpressing celR
also influenced other phenotypes, including biofilm formation, formation of a polar
attachment structure, and virulence, suggesting that the protein or the c-di-GMP signal
plays a role in regulating these processes as well.
2.4 Materials and Methods
2.4.1 Strains, cultures and growth conditions. The strains used in this study are
listed in Table 2.1. Strains of Escherichia coli were grown on Luria- Bertani (LB,
Invitrogen) agar plates with appropriate antibiotics at 37°C. Strains of A. tumefaciens
were maintained on nutrient agar (NA, Fisher) or AB minimal medium agar (41)
supplemented with 0.2% mannitol (ABM) with appropriate antibiotics at 28°C. Cultures
of E. coli were grown in LB broth with the corresponding antibiotics at 37°C with
shaking. Cultures of A. tumefaciens were grown in MG/L (100) complex medium with
appropriate antibiotics at 28°C with shaking. For some experiments, cultures of A.
tumefaciens were grown in AB minimal medium- based vir induction medium (100)
supplemented with 0.2% mannitol and 200 µg/ml acetosyringone (ABIM). Antibiotics
used include ampicillin (100µg/ml for E. coli), carbenicillin (50 µg/ml for A.
tumefaciens), kanamycin (50 µg/ml for E. coli and A. tumefaciens), gentamicin (50 µg/ml
for E. coli, 25 µg/ml for A. tumefaciens), and tetracycline (10 µg/ml for both E. coli and
A. tumefaciens). When necessary, Congo red (50 µg/ml) or aniline blue (50 µg/ml) was
added to ABM plates for assessing production of exopolysaccharides.
31
2.4.2 Strain construction. Production of overexpression strains: Genomic DNA
was prepared from an overnight culture of A. tumefaciens NTL7 as described previously
(84). Genes to be cloned were amplified by PCR using Pfu polymerase (Stratagene) and
the following primer sets: atu1297-f (5′- GCGGATCCCATATGACGGCGAGAGTTCT-
3′) and atu1297-r (5′- CGGATCCTCAGGCCGCGGCGGCCACGACGCG-3′), atu1060-
f (5′- CGGATCCCATATGCAGGATAAAATCCTTCTG-3′) and atu1060-r (5′-
CGGATCCTCAGCCGTTCAGCCCGAT-3′), atu0826-f (5′-
GCGGATCCCATATGCAGGCCGTCGCGCTA-3′)and atu0826-r (5′-
GCGGATCCTCAATTTGCCTCGCCGAATAC-3′), atu2228-f (5′-
CGGATCCCATATGGCTCATTCCGTCGAAAGC-3′)and atu2228-r (5′-
CGGATCCTCACGCTTGTCGCGCCGC-3′), and atu4490-f (5′-
CGCGGATCCCATATGCGGATTGCGCCGCGC-3′)and atu4490-r (5′-
CGCGGATCCTCACGCCCCCGCCCGAAG-3′). The PCR products were digested with
BamHI and ligated into BamHI- digested pUC18. The resulting ligation products were
introduced into DH5α by CaCl2 transformation, with selection on LB plates containing
ampicillin. Resistant colonies were selected, the plasmids purified and digested with NdeI
and BamHI. The resulting fragments were ligated into the expression vector pZLQ (Table
2.1), placing the gene under the transcriptional control of the lac promoter, and
transformed into DH5α. After selecting for kanamycin resistance, the plasmids were
isolated, analyzed, and the correct constructs were electroporated into the appropriate
strains of A. tumefaciens.
Deletion of the A. tumefaciens chromosomal cel locus: Removal of the cel locus
was performed by Dr. Shengchang Su. An 800 bp BamHI-HindIII fragment of celD
32
(atu3302) and a 1 kb HindIII-SpeI fragment containing sequences of celC (atu3307),
celG (atu8186) and celB (atu3308) were amplified by PCR from NTL4 genomic DNA
using Pfu DNA polymerase and two pairs of primers: celD/Bm (5′-
CGGGATCCATGCGCATCGATATC-3′ and celD/Hind 5′-
CCCAAGCTTTCGCCGAACCACAGC-3′); celC/Hind (5′ -
CCCAAGCTTACGGATTGACCACCG-3′ and celB/Sp 5′ -
GCTCTAGAACTAGTTGGATGAAGCGGAAT-3′), respectively. The above two PCR
products were treated with the appropriate restriction endonucleases, mixed with a 1.6 kb
HindIII fragment carrying the tetA gene from pBBR1MCS-3, and inserted between the
BamHI and SpeI sites of pSR47s (Table 2.1). The resulting ligation products were
transformed into S17-1 λ pir. A ligation product, pSR∆cel, in which the tetA gene was
flanked on one side by the first 500 bp of celC and the last 800 bp of celD on the other
side (Figure 2.1), was identified and mated into NTL7 as previously described (55).
NTL7 carrying the chromosomal disruption in the cel gene cluster was selected by
plating on medium containing the appropriate antibiotics and 5% sucrose. Allelic
exchange of the altered cel region was verified by PCR using additional primers located
further upstream and downstream from the original fragments.
Mutation of celR by allelic exchange: Two flanking regions of celR were
amplified from genomic DNA of strain NTL7 using pfu DNA polymerase and two pairs
of primers: celRdel1-f (5′-GCTCTAGAGGGCCCACGTAGCCAACCATACTCCG-3′)
and celRdel1-r (5′-GCGCCCGGGCTCGCCGTCATAACAGTTCC-3′); celRdel2-f (5′-
CGCGGCATGCCTTTACGAGGCGAAACATGC-3′) and celRdel2-r (5′-
CGGGATCCACTAGTCGTGGAAATAAAGGCAGAGC-3′), respectively. The
33
fragments were digested using XbaI and SmaI for fragment celRdel1 and SphI and
BamHI for fragment celRdel2, and the fragments were then inserted separately into
pUC18. The resulting ligation products were transformed into DH5α. The plasmids were
identified for the correct insertions and digested again with XbaI and SmaI for fragment
celRdel1 and SphI and BamHI for fragment celRdel2. A gentamicin resistance cassette
from pMGm (Table 2.1) was digested using SmaI and SphI, and the fragment was ligated
between the two flanking regions of celR, forming pUCcelRdel (Figure 2.2). The new
construct was digested with XbaI and BamHI and ligated into pWM91 (Table 2.1), a
suicide vector containing sacB, and transformed into S17-1 λpir by electroporation.
Successful constructs were selected for by resistance to ampicillin and gentamicin, and
the plasmids were isolated, analyzed and electroporated into A. tumefaciens. Initial
transformants were selected for resistance to gentamicin and 5% sucrose, followed by
screens for sensitivity to carbenicillin. Potential marker-exchange mutants were
confirmed using PCR and Southern analysis.
Indel mutation of atu1060: The atu1060 gene was replaced with a kanamycin
resistance cassette using a protocol modified from that of Datsenko and Wanner (61).
Briefly, a set of primers, atu1060frt-f (5′-
GCGTTTTTTGTGCCTAGAGACTAGAGCTGAGCGTTGCCGCGGCCTGTGTAGGC
TGGAGCTGCTTC -3′) and atu1060frt-r (5′-
GAGGAAAGACTGGGGAGACGGGCCAGGGGGGCTTGGGACGGCCCATATGAA
TATCCTCCTTA-3′), were used to amplify the kanamycin cassette from pKD4 (Table
2.1) by PCR, and the product was treated with DpnI to blunt the ends. Additionally, a 3.6
kb fragment containing atu1060 was amplified from NTL7 genomic DNA using the
34
primers atu1060region-f (5′-GGGGTACCGCGATTGTGCATGCTAAAGA-3′) and
atu1060region-r (5′-GGGGTACCGCGCCCTCATCTATGTCATT-3′). The fragment
was digested with KpnI and cloned into pRK415, creating the construct
pRKatu1060region. The construct was introduced into DH5α by CaCl2 transformation,
and the plasmid was purified and analyzed by restriction digest and sequencing. The
kanamycin fragment was then electroporated into an E. coli strain harboring both the red
recombinase plasmid pKD46 (Table 2.1) and pRKatu1060region. The transformants
were selected for resistance to kanamycin, and plasmids were purified and examined for
replacement of atu1060 by restriction digest and PCR. The correct plasmids containing
the replaced gene were digested with KpnI, the modified atu1060 gene was cloned into
pWM91 (Table 2.1), producing the construct pWMatu1060kan, and this plasmid was
transformed into S17-1 λpir. Successful constructs were selected for resistance to
ampicillin and kanamycin, and a verified plasmid was electroporated into A. tumefaciens.
Initial transformants were selected for resistance to kanamycin and 5% sucrose, followed
by screening for sensitivity to carbenicillin. Potential mutants were confirmed using PCR
and Southern analysis.
Complementation of NTL7ΔcelR::Gm: Wild-type celR is the second gene in an
operon with atu1296, an ortholog of divK in Caulobacter crescentus ((93); Figure 2.2).
To delete atu1296 and keep celR under regulation of its native promoter, a 400 bp region
containing the promoter of the divK/celR operon was amplified using Pfu DNA
polymerase and the primers prcelR-f (5′-GCGGATCCTGGCCGGCATTGCCTTTGTTT-
3′) and prcelR-r (5′-GCGGATCCCATATGGTGGGCAGTCCCCGTTTC-3′), digested
with BamHI, and cloned into pUC18. The promoter fragment and the cloned celR gene
35
were digested with NdeI and BamHI, and ligated together to form pUCprcelR (Figure
2.2). The clone was purified and confirmed by sequence analysis. In this construct, divK
is deleted and celR is driven directly by the divK- celR promoter. The correct clone was
digested with BamHI and the prcelR fragment was inserted into pUC18-miniTn7T-Km
(44) to form pUCTn7T-prcelR. The new construct, as well as the transposase plasmid
pTNS2 (Table 2.1; (44)), were electroporated into NTL7ΔcelR::Gm, with selection for
resistance to kanamycin. Potential mini-Tn7 integrants were confirmed by PCR analysis.
2.4.3 Cellulose extraction assays. Cellulose was quantified following extraction
using a modified Updegraff protocol (271). Briefly, cells were grown in 12 ml of MG/L
with appropriate antibiotics overnight at 28°C with shaking. From this culture, a 10 ml
volume was centrifuged at 3000 x g at 4°C for 10 minutes, while the remaining 2 ml were
reserved for protein concentration determinations. The cell pellets were resuspended in 3
ml of 85% acetic/ 5% nitric acid, and the suspension was boiled for 30 minutes. The
resulting suspension was centrifuged for 30 minutes, the pellet was washed with 5 ml of
double distilled water (ddH2O), and collected by centrifugation for 30 minutes. The
resulting pellet, which represents the remaining acid-stable carbohydrate polymers, was
resuspended in 5 ml 67% H2SO4 and incubated for 1 hour at room temperature. The acid-
digested samples were diluted 1:5 into ddH2O, mixed with 3 volumes of anthrone reagent
[50 mg of anthrone (Sigma-Aldrich) per 1 ml H2SO4], boiled for 15 minutes, and chilled
to room temperature. Absorbance of the solution at 620 nm was determined using a
BioRad SmartSpecTM Plus spectrophotometer. Absorbance values were compared to a
standard curve created from a stock solution of pure cellulose (Sigma-Aldrich) dissolved
in 67% H2SO4.
36
The amount of anthrone-reactive material was standardized based on the soluble
protein concentration of the sample. Cells in the remaining 2 ml of sample were collected
by centrifugation, resuspended in 100 µl of 0.9% NaCl solution and disrupted by
sonication. The insoluble components were removed by centrifugation, the remaining
soluble protein was assayed using Coomassie PlusTM Assay Reagent (Thermo Scientific),
and absorbance of Coomassie-bound protein was measured at 595 nm. Statistical analysis
was performed using the Student t-test using a one-sided distribution model.
2.4.4 Cellulase treatment. Cells from cultures grown as described above were
collected by centrifugation at room temperature for 10 minutes at 3000 x g, and
resuspended in 3 ml of LTE buffer (10 mM Tris-Base, 1.2 mM EDTA, pH 8.0). Purified
cellulase (Sigma-Aldrich) was added to the cell suspension to a final concentration of 20
µg/ ml, and the suspension was incubated for 1 hour at 37ºC with shaking. The cells were
recovered by centrifugation, and the amount of glucose-containing polymer remaining
associated with the cells was quantified as described above.
2.4.5 Microscopy and lectin-binding assays. Cells, grown in liquid culture for
two days at 28°C, were collected by centrifugation for 5 minutes before resuspending in
0.9% NaCl to a final OD600 of 0.4. For lectin staining, the resuspended cells were
incubated with 100 µg per ml of Alexafluor633-WGA (Thermo Scientific) for 15
minutes, and washed three times with 0.9% NaCl by centrifugation. Cells were visualized
by differential interference contrast (DIC) microscopy at the Institute for Genomic
Biology-Microscopy and Imaging Facility (University of Illinois) using a Zeiss
AxiovertTM 200M microscope equipped with an Apotome Structured Illumination Optical
Sectioning System set at 63x/1.40 objective magnification, and images were captured
37
using a Zeiss MRc 5 camera. Where cells were treated with lectin, samples were excited
at 633nm and observed for fluorescence at 647 nm. Images were compiled and analyzed
using Zeiss AxiovisionTM software. For statistical analysis, four randomly-chosen images
containing cells were compiled, and the number of cells in each image and their
arrangement/ lectin labeling were counted. The data was analyzed for statistical
significance using the Chi-squared test.
2.4.6 Microscopic analysis of bacterial attachment to Arabidopsis. SEM
analysis of bacterial attachment was performed in the laboratory of Dr. Lois Banta,
Williams College, MA. Seeds of Arabidopsis thaliana ecotype Columbia (Col-0) were
surface-sterilized with a solution of 50% bleach/0.1% SDS, and sown onto solid
Gamborg’s B5 media containing 100 mg/l tricarcillin (Research Products International).
Seeds were incubated for 2 days at 4°C, and then germinated and grown at room
temperature for 16 days. Bacterial strains were grown in MG/L medium at 28°C
overnight, with addition of antibiotics if required. Strains of A. tumefaciens were
subcultured into ABIM containing either 100 or 200 µM acetosyringone and grown on a
rotary shaker at 22°C to mid-exponential phase (OD600 ≈ 0.5). Sterile forceps were used
to wound leaves excised from seedlings before co-cultivating with bacterial cells for 2
days at 21°C. Co-cultivated leaf pieces were rinsed three times in ABIM with gentle
vortexing (20 sec/wash) to remove any unattached bacteria. Samples were fixed in 3%
glutaraldehyde (in 0.1 M HEPES; pH 7.1) for 3 days and rinsed three times in 0.1M
HEPES (pH 7.1) before postfixing in 1% OsO4 for 1-2 hours. Samples were subsequently
rinsed with distilled H2O, sequentially dehydrated in 70, 80, 90 and 100% ethanol, and
immediately dried in a Ladd critical-point drying apparatus under CO2. Samples were
38
loaded on aluminum specimen holders, sputter-coated with gold-palladium using a
Polaron SEM autocoating unit, and viewed on a FEI Quanta 400 Series scanning electron
microscope. Three to five leaves were examined for each bacterial strain per assay, and
several representative images per leaf were captured for analysis. Analysis of the SEM
samples was performed “blind” (i.e. without knowing the identity of the sample) to
ensure a lack of observer bias. For statistical analysis, the number of cells in each image
and the number of polarly-bound cells were counted. The data was analyzed for statistical
significance using the Student t-test.
2.4.7 Biofilm assays. Cells were grown overnight with shaking in MG/L at 28°C
with appropriate antibiotics, and diluted 1/1000 into 2 ml of MG/L with antibiotics. The
diluted samples were incubated for 5 days at room temperature without shaking in 13 X
100 mm sterile borosilicate tubes. After incubation, 1 ml of 0.1% crystal violet was added
to each sample and the cultures were incubated at room temperature for 15 minutes.
Supernatants were carefully decanted, and the inside walls of the stained tubes were
gently washed three times with 2 ml of ddH2O. The remaining adherent crystal violet
stain was solubilized using 1 ml of ice-cold 70% ethanol. The absorbance of the ethanolic
samples was measured at 540 nm using a BioRad SmartSpecTM Plus spectrophotometer.
2.4.8 Virulence assays. Two different assays were utilized on different host
plants. For Kalanchöe daigremontiana, bacteria were grown for 2 days at 28°C, collected
by centrifugation, and resuspended in 1 ml of 0.9% NaCl. The population sizes of the
resuspended cells were standardized to an OD600 of 1.0, and the suspensions were then
diluted 1:10 and 1:100 in 1 ml of 0.9% NaCl. Kalanchöe leaves were wounded using a
thin syringe needle, and 2 µl volumes of cell suspensions from each dilution were
39
inoculated into the wound sites. At least six leaves on three different plants were
wounded and inoculated in this manner. Tumors were visualized and photographed 3 to 5
weeks after inoculation, depending on day length and plant growth rates.
For virulence assays on Solanum lycopersicum (tomato), bacterial cultures were
grown and standardized as described above. The suspensions were diluted in ten-fold
increments from 10-1 to 10-5. Twenty mm-long wounds between the primary leaves and
the first set of secondary leaves were produced using a razor blade. As above, 2 µl
volumes of the bacterial suspensions were inoculated into the wound sites, and the plants
were incubated in the greenhouse for 3 to 5 weeks, depending on day length and plant
growth rates. At least four different plants per condition (sample strain and dilution
amount) were wounded and inoculated in this manner. Total tumor mass was determined
by excising the segment of stem, cutting just above and below the wound site. The stem
pieces were weighed individually, and the tumor mass was removed by cutting with a
cork borer and weighed. The tumor mass was averaged between the four plants. The
experiments were repeated at least three times, and the total average of the samples, as
well as standard error, was calculated from these experiments. Statistical analysis was
performed using the Student t-test with a one-sided distribution model.
2.5 Results
2.5.1 Overexpressing different putative diguanylate cyclases in
Agrobacterium tumefaciens has varying effects on exopolysaccharide production. In
A. tumefaciens, the stimulation of cellulose production in cell extracts by the addition of
exogenous c-di-GMP (6) suggests that a diguanylate cyclase (DGC) is involved in
40
regulating production of this polymer. Annotation indicates that the genome of A.
tumefaciens strain C58 may encode as many as 32 proteins with DGC activity (85, 292).
Of these candidates, five genes- atu0826, atu1060, atu1297, atu2228 and atu4490, were
chosen for testing based on the association of the GGDEF motif with a signaling domain
(Figure 2.3). Of particular interest was atu1297, annotated as pleD, which, in C.
crescentus, is known to synthesize c-di-GMP (188, 294). We tested these genes to
determine if any, when overexpressed, resulted in changes in the production of cellulose.
For the initial examination, the five GGDEF-containing ORFs were cloned into
the overexpression vector pZLQ (Table 2.1) and introduced into strain NTL7.
Overexpression of atu4490 had no effect on colony morphology on solid medium or
growth in liquid media (Figure 2.4A, B). Strains overexpressing either atu0826 or
atu2228 formed smaller colonies on solid medium (Figure 2.4A), although the strains
were unaffected in growth in liquid culture (Figure 2.4B). However, overexpression of
atu1060 and atu1297 resulted in the formation of small, hard colonies on agar surfaces
(Figure 2.4A). When tested on solid medium containing Congo red, colonies of these
strains, but not those expressing the other three genes, incorporated more dye than did the
strain lacking an overexpression construct (Figure 2.4A). Unlike the parent, when grown
in liquid media, cells of both NTL7(pZLQatu1297) and NTL7(pZLQatu1060) formed
large aggregates (Figure 2.4B) and these aggregates were difficult to disrupt by physical
means. These results suggested that atu1060 and atu1297 play a role in
exopolysaccharide production and in cell-cell interactions.
2.5.2 Increasing the expression of atu1060 and atu1297 affects the production
of cellulose. Congo red binding is indicative of exopolysaccharides and some amyloid
41
proteins (259, 302), and suggests that atu1060 and atu1297 influence the production of
such products. To test if the exopolysaccharide induced by overexpression of atu1297 or
atu1060 is cellulose, the effects of pZLQatu1297 and pZLQatu1060 on NTL7 were
examined by genetic manipulation and by quantification of total anthrone-positive
material. First, the constructs were introduced into NTL7Δcel (Table 2.1), a mutant
prepared by Dr. Shengchang Su in which components of the cel locus have been deleted.
Overexpressing either of the two genes in NTL7Δcel did not result in any of the
phenotypes displayed during overexpression in the wild-type parent, including hard
colony formation, Congo Red binding and aggregation in liquid media (Figures 2.5A and
B). These results suggest that at least some of the phenotypes associated with
overexpression of atu1060 and atu1297 involve production of cellulose.
Strain C58, the parent of NTL4 and NTL7, produces at least two polyglucose-type
exopolysaccharides: β1,4 linked cellulose and β1,3 linked curdlan (249). To determine if
curdlan biosynthesis is affected by the overexpression of these genes, the strains were
grown on solid ABM medium containing aniline blue, a dye that binds to the β1,3
polymer but not to cellulose (178). Colonies overexpressing either of the two genes were
no more intensely blue than those of the wild-type NTL7, while a curdlan-overproducing
strain, Agrobacterium sp. ATCC31749 ((91); Table 2.1), grew as dark blue colonies
(Figure 2.6). Moreover, NTL7Δcel yielded colonies that bound amounts of aniline blue
similar to NTL7 (Figure 2.6). Notably, colonies of ATCC31749 yielded darker red
colonies on Congo red plates as compared to NTL7 (Figure 2.6), suggesting that Congo
red binding is indicative of both cellulose and curdlan production. These results suggest
that overexpression of atu1060 or atu1297 does not affect curdlan biosynthesis.
42
We next quantified the amount of anthrone-positive exopolysaccharide material
produced by our strains using the Updegraff protocol ((271); see Materials and Methods).
Wild-type NTL7 produced, on average, 998 µg, while the Δcel mutant produced 545 µg
of anthrone-positive material per milligram of soluble protein (Figure 2.7). Strains
overexpressing either atu1060 or atu1297 produced two to three times as much anthrone-
positive material, respectively, as compared to NTL7 (Figure 2.7 and Table 2.2).
NTL7Δcel overexpressing either atu1060 or atu1297 produced amounts of anthrone-
positive material comparable to the levels produced by the parent cel- mutant (Figure 2.7
and Table 2.2).
To confirm that the anthrone-reacting material recovered by the Updegraff
protocol is cellulose, the cultures were pretreated with purified cellulase prior to analysis,
as described in Materials and Methods. In cells of NTL7 pretreated with the enzyme, the
amount of anthrone-positive material recovered dropped to levels comparable to those
seen in NTL7Δcel (Table 2.2). The decrease in the amount of material collected from
wild-type cells suggests that the difference between NTL7 and NTL7Δcel cultures
represents the amount of cellulose produced by the wild-type bacteria (Table 2.2). The
strain overexpressing atu1297 also showed lower amounts of anthrone-reacting material
after cellulase treatment (Table 2.2). The results taken as a whole suggest that
overexpression of atu1297 and atu1060 causes increased production of cellulose by
NTL7, and that this increase in cellulose production requires genes of the cellulose
synthesis locus. Based on these results, we suspect that the anthrone-positive material
produced by NTL7Δcel is curdlan and perhaps other yet to be identified glucose-
containing exopolysaccharides. In subsequent experiments we express levels of anthrone-
43
positive material in relative units normalized against the amounts detected from
NTL7Δcel set at a value of zero.
2.5.3 atu1297, but not atu1060, is a positive regulator of cellulose production.
Overexpressing DGCs in bacteria often results in pleiotropic phenotypes (4, 152, 179,
216). This effect suggests that not only are multiple regulatory systems dependent on c-
di-GMP, but that the signal produced by overexpression of any active DGC can crosstalk
with other c-di-GMP responding systems. To determine if Atu1060 and Atu1297 both are
directly involved in regulating cellulose production, the genes were deleted by allelic
replacement with either a kanamycin- or a gentamicin- resistance cassette. The resulting
mutants NTL7Δatu1297::Gm and NTL7Δatu1060::Km were tested for changes in Congo
red binding and levels of cellulose production. On medium containing Congo red, neither
mutant showed a visible difference in dye binding compared to wild-type NTL7 (Figure
2.8A). When assessed quantitatively, the atu1297 mutant produced significantly less
cellulose as compared to NTL7, its wild-type parent (Figure 2.8B). The atu1060 mutant,
however, showed no significant difference in the amounts of cellulose produced as
compared to NTL7 (Figure 2.8B), suggesting that atu1297, but not atu1060, has a direct
regulatory effect on production of the polymer. Based on these results, we focused our
studies on atu1297.
To confirm that the deletion of atu1297 is responsible for the decrease in cellulose
production, NTL7Δatu1297::Gm was complemented by mini-Tn7-mediated insertion of
the wild-type gene expressed at unit copy number from its native promoter into a single
site downstream of the glmS gene on chromosome 1 (44, 45). The complemented
atu1297 mutant produced levels of cellulose comparable to that of wild-type NTL7
44
(Figure 2.8B). These results confirm that atu1297 is required for production of wild-type
levels of cellulose in A. tumefaciens. Based on this evidence, we renamed the atu1297
gene celR (cellulose regulator).
2.5.4 Overexpression of celR affects the aggregation phenotype of individual
cells. Cellulose produced by A. tumefaciens is involved in stabilizing colonization of
plant surfaces (156-158, 160). In addition, production of cellulose may impact
interactions of the cells with one another. To determine if celR is responsible for the
aggregation phenotype seen in liquid medium, the overexpression and mutant strains
were visualized using DIC microscopy. Cells of NTL7 overexpressing celR formed dense
masses at a much higher frequency as compared to wild-type NTL7 (compare Figures
2.9A and B). Interestingly, cells of NTL7(pZLQcelR) that were separated from these
large masses often were arranged in rosettes, with three to five cells connected to each
other at one pole (Figure 2.9B, Table 2.3). NTL7Δcel(pZLQcelR) produced fewer and
smaller aggregates (Figure 2.9C). However, a number of cells were still associated with
rosettes (Figure 2.9D, Table 2.3). We conclude from these results that the aggregation
phenotype, but not rosette formation, is due to overproduction of cellulose resulting from
overexpression of celR.
2.5.5 Overexpression of celR affects polar lectin binding. In Caulobacter
crescentus the diguanylate cyclase PleD, an ortholog of CelR, regulates production and
localization of the stalk with its holdfast structure (4, 94, 190). A similar, but stalk-less
lectin-binding holdfast structure was recently described in A. tumefaciens, with the
structure forming at one pole of the cell (143, 267, 294). This unipolar polysaccharide
(UPP) structure also may play a role in initial attachment of the bacteria to plant cells
45
(143). To explore the role, if any, of CelR in the formation of the UPP, strains altered in
expression of celR were examined for the polar adhesive.
The UPP in A. tumefaciens can be visualized using fluorescently labeled lectin
conjugates, which bind the glucomannan fibers that constitute the adhesive. Similar to
previous studies (267), when strain NTL7 was incubated with WGA-Alexafluor-633, a
small subset of the cells showed polar binding of the lectin label (Figure 2.10A, Table
2.3). In contrast, cells of NTL7 overexpressing celR were labeled over the entirety of the
aggregates (Figure 2.10B), making it difficult to identify the location of the lectin on
individual cells. When cells of NTL7(pZLQcelR) were separated from the aggregate,
about three times as many exhibited polar lectin binding (Table 2.3), suggesting that
overexpression of celR results in increased formation of the UPP. Problems arising from
the aggregation phenotype associated with overexpressing celR in a cel+ strain were
resolved by overexpressing the gene in the Δcel background. Such cells continued to
show an increase in polar lectin binding (Figure 2.10C, Table 2.3). Additionally, the
rosettes produced by the Δcel strain overexpressing celR showed polar labeling at the
center of the clustered cells. NTL7ΔcelR::Gm, on the other hand, did not display any
alteration in lectin binding or in cellular aggregation as compared to wild-type cells
(Figure 2.10D, Table 2.3). Consistent with the report by Xu et al. (294), these
observations suggest that a DGC may play a role in UPP formation in A. tumefaciens,
although it is likely that CelR is not directly involved in regulating this phenotype.
2.5.6 Modification of celR expression affects the attachment of cells to plant
tissue. While cellulose helps to stabilize the attachment of the bacteria to plants, its role
in attachment per se is not entirely understood. To assess the effects of altering celR
46
expression on primary attachment to plant tissue, the laboratory of Dr. Lois Banta
incubated wild-type and mutant strains with Arabidopsis leaves, and binding was
visualized using SEM. In comparison to NTL7, the cells of the celR mutant exhibited a
statistically significant increase in attachment to plant tissue (Figures 2.11A and B; Table
2.4). In addition, compared to the wild-type parent, a significantly greater number of
ΔcelR cells attached to the surface in a polar orientation (Figure 2.11B; Table 2.4). These
results suggest that deleting celR and its resultant negative effect on cellulose production
impacts the initial attachment of the bacteria to plant cell surfaces.
To determine if CelR affected initial cellulose-independent attachment, the celR
gene was overexpressed in the Δcel background. NTL7Δcel bound to the plant tissue at
numbers comparable to those of NTL7 (Figures 2.11A and C). On the other hand, in
comparison to the cel- parent, NTL7Δcel overexpressing celR was more sparsely bound to
the plant tissue (Figures 2.11C and D). Interestingly, when viewing the cultured material
by light microscopy before fixation for SEM, NTL7Δcel(pZLQcelR) formed large
aggregation patches on the surfaces of the plant tissue (data not shown). These patches
are fragile and were disrupted by gentle washing before the fixation process. When
attached to the plant cells, the overexpressing strain also displayed altered cell
morphologies, forming branched structures and elongated cells (Figures 2.11E and F).
These effects on cell morphology suggest that increasing expression of celR can alter cell
division programming in the cells.
2.5.7 Overexpression of celR affects production of biofilms. Both the
production of the UPP and cellulose influence attachment by A. tumefaciens to surfaces
(143, 158, 267). To test the influence of celR on the ability of the bacteria to form
47
biofilms, a crystal violet staining protocol was used as a metric to quantify the number of
cells bound to borosilicate glass. Strain NTL7(pZLQcelR) exhibited a significant
decrease in crystal violet staining as compared to its parent (Figure 2.12), indicating that
overexpressing celR negatively affects biofilm formation. The amount of bound crystal
violet was increased in the Δcel strain, regardless of whether or not celR was
overexpressed (Figure 2.12). This increase in biofilm production by the Δcel mutant
suggests not only that A. tumefaciens does not require cellulose for attachment to glass
surfaces, but also that the production of this polymer inhibits the process. This
phenomenon has been noted in other studies, where strains of A. tumefaciens that
overproduced cellulose appeared to form elevated biofilms on tomato roots, but the
aggregates were easily dislodged and therefore represented unanchored masses of cells
(158). Deleting celR resulted in increased crystal violet staining as compared to the wild-
type parent (Figure 2.12), with the ΔcelR mutant binding to glass at the same level as the
Δcel mutant of NTL7 (Figure 2.12).
2.5.8 celR overexpression severely attenuates virulence in Agrobacterium
tumefaciens. Pathogenic isolates of A. tumefaciens induce tumors on wounded plants,
with tumor induction requiring attachment of the bacteria to the plant cells (147, 148). To
examine the effects of altering celR expression or other putative DGCs on tumorigenesis,
cultures of strains to be tested were inoculated onto wounded leaves of Kalanchöe
daigremontiana and onto wounded tomato stems, and virulence was quantified as
described in Materials and Methods. Overexpressing atu0826, atu2228 or atu4490 had no
detectible effect on virulence on Kalanchöe leaves (Figure 2.13A). However, NTL7
overexpressing either celR or atu1060 was strongly attenuated on both host plants
48
(Figures 2.13A and B). Overexpressing celR or atu1060 in the cellulose-deficient
background led to the same attenuated phenotype (Figure 2.13B), while the parent Δcel
strain remained fully virulent (Figure 2.13B). These results suggest that cellulose
production is not a contributing factor to the loss of tumorigencity in the overexpressing
strains. Interestingly, NTL7ΔcelR::Gm produced slightly larger tumors on tomato stems
as compared to NTL7, although this difference was not statistically significant (Figure
2.13B). These results suggest that putative DGCs may play some role in tumor induction.
However, this effect on virulence is not mediated through cellulose biosynthesis, and is
not dependent on celR.
2.6 Discussion
2.6.1 CelR controls cellulose synthesis in A. tumefaciens. Our results clearly
show that the putative diguanylate cyclase CelR regulates cellulose production in A.
tumefaciens. Overexpressing the gene resulted in increased production of the
exopolysaccharide, while deleting celR led to a substantial decrease in cellulose
production (Figure 2.8). Complementation of the null mutant with a single copy of the
gene expressed from its native promoter restored cellulose production to wild-type levels,
further supporting the requirement of celR for inducing synthesis of the polymer (Figure
2.8).
Several lines of evidence support our hypothesis that CelR is an active c-di-GMP
synthase. First, c-di-GMP stimulates synthesis of cellulose in cell extracts of A.
tumefaciens (6). Coupled with the observation that CelA, the catalytic subunit of the
49
cellulose synthase, contains a PilZ domain, this result supports the notion that the
nucleotide signal controls activity of the enzyme. This conclusion is, in turn, consistent
with the role of c-di-GMP in regulating the activity of the cellulose synthase purified
from Gluconacetobacter xylinus (74, 166). Second, Xu et al. (294) report that extracts of
E. coli overexpressing CelR, which they called PleD, from A. tumefaciens contained a
46-fold greater amount of c-di-GMP as compared to extracts from cells in which the gene
was not overexpressed. Third, we show that overexpressing CelR alters several
phenotypes, most of which are not directly affected by the protein when expressed at
normal levels. This observation is consistent with overproduction of a soluble and
promiscuous intracellular signal molecule. However, definitive proof of its activity awaits
further analysis of CelR.
Agrobacterium tumefaciens also synthesizes curdlan, another poly-glucose
polymer (178, 249), and it is conceivable that production of this polysaccharide is
impacted by c-di-GMP. Curdlan binds both aniline blue and Congo red (178), an
observation that suggests that increased staining of colonies by Congo red is indicative of
higher levels of glucose-based polymers in general, and is not specific to cellulose.
Indeed, colonies of the curdlan-overproducing strain ATCC31749 bound both aniline
blue and Congo red (Figure 2.6). However, overexpressing either celR or atu1060 in
strain NTL7 only resulted in increased binding of Congo red, and not aniline blue (Figure
2.6), suggesting that neither protein stimulates curdlan production. Alignments of CelA,
the cellulose synthase of A. tumefaciens, and the curdlan synthase, CrdS (Atu3056), show
that while both share similar catalytic sites for polymer elongation, only CelA has the
conserved PilZ c-di-GMP binding domain (data not shown; (7)). Moreover, CrdS does
50
not contain any other known c-di-GMP binding domains. Given that curdlan is a glucose-
based polymer, we consider it likely that production of this polysaccharide accounts for at
least some of the residual anthrone-positive material produced by the Δcel mutant (Figure
2.7). Additionally, these results demonstrate that of the two reagents, Congo red binding
is the better in situ assay for cellulose production.
2.6.2 CelR, but not Atu1060, directly controls production of cellulose.
Overexpression of a second gene, atu1060, also resulted in increased cellulose
production. Only overexpression of atu1060 and celR, and not the other three putative
DGCs studied, affected these phenotypes. Atu1060 has a domain structure similar to that
of CelR (Figure 2.3), which when combined with the similar phenotypes observed when
either gene is overexpressed, suggests that these two potential synthases can crosstalk to
their respective target pathways. However, while deleting celR resulted in decreased
levels of cellulose, deleting atu1060 had no such effect (Figure 2.8), suggesting that at
native levels of expression celR, but not atu1060, is a regulator in the pathway.
Consistent with this interpretation, celR is conserved in all members of the Rhizobiaceae
that produce cellulose, while atu1060 is found only in the genomes of biovar 1
agrobacteria.
Assuming that CelR is an active DGC, and that overexpressing celR, but not three
of the other potential DGCs studied, affects cellulose production suggests these enzymes
or their signal product can be compartmentalized. Overexpression of atu0826 and
atu2228, while having no effect on Congo red binding, did result in greatly reduced
colony sizes (Figure 2.4A). That overexpressing other putative DGCs affects different
51
phenotypes suggests that the role of a particular DGC may not impact processes outside
of that specific system. Of the genes examined, only atu1060 appears to crosstalk with
celR. These observations suggest that signal compartmentalization, as well as some level
of specificity, are held in common by the two proteins.
2.6.3 The impact of celR overexpression on other phenotypes suggests
multiple processes are regulated by c-di-GMP in A. tumefaciens. Overexpressing celR
affected phenotypes in addition to cellulose synthesis, including colony size, cell
morphology, polar UPP production, rosette formation and virulence. The overexpression
of either celR or atu1060 in NTL7 resulted in greatly reduced colony size, similar to the
effect of overexpressing atu0826 and atu2228 (Figure 2.4A). However, overexpression of
celR or atu1060 in NTL7Δcel resulted in colonies of a size comparable to those of either
wild-type NTL7 or NTL7Δcel (Figure 2.5A). The Δcel mutant overexpressing atu0826 or
atu2228 continued to grow as small colonies (data not shown). These observations
suggest that the effects of celR and atu1060 on the size of colonies is a result of cellulose
production, and that celR and atu1060 do not crosstalk to the cellular processes affected
by atu0826 and atu2228.
Overexpressing celR affected the morphology of wild-type NTL7, with cells
forming branches and elongated rods. This effect was observed in the cellulose-deficient
background, indicating that the effects on cell morphology are not due to alterations in
production of cellulose. If CelR is an active DGC, it is likely that the signal produced by
overexpressing the enzyme influences systems involved in controlling cell division. This
conclusion is supported by the absence of such morphological alterations in the celR
52
indel mutant, and supports the hypothesis that in A. tumefaciens c-di-GMP is a critical
intracellular signaling component in cell cycle regulation (124). However, as with several
other phenotypes, the signal produced by overexpressing celR may be cross talking to
some non-cognate system.
The influence of celR on rosetting, a unipolar attachment phenomenon first
described by Braun and Elrod (22), is interesting. Overexpressing the gene in both the
wild-type and the Δcel mutant resulted in increased frequency of rosettes, suggesting that
celR is associated with this patterning phenomenon. However, the celR mutant
demonstrated wild-type levels of rosetting, ruling out a role for this protein in the process.
The overexpression of celR also increased UPP production in both backgrounds, a
phenotype seen in other studies (124, 294). However, as with rosetting, deleting celR did
not negatively impact the number of cells expressing UPP as compared to the wild-type
(Figure 2.10), suggesting that celR is not the regulating protein.
Attenuation of virulence associated with overexpressing celR or atu1060 also is
not due to overproduction of cellulose. Overexpressing either celR or atu1060 in
NTL7Δcel resulted in the same attenuated phenotype as observed in wild-type NTL7
(Figure 2.13B). Furthermore, overexpression of the two putative DGCs that affected
colony size, atu0826 and atu2228, had no impact on virulence (Figure 2.13A). Deleting
celR did not influence virulence (Figure 2.13B), suggesting that this protein does not
contribute to regulating this process. This result is consistent with the observation that
cel- mutants of A. tumefaciens are fully virulent (158), but these results do suggest that an
53
unknown DGC controls some process important for tumorigenesis. The relevant protein
and its target remain to be identified.
2.6.4 Altering the expression of celR affects biofilm formation and
attachment to plants, exclusive of cellulose production. Overexpressing celR in wild-
type NTL7 dramatically decreased biofilm formation (Figure 2.12) and attachment to leaf
surfaces (Figure 2.11). This result is in contrast to the results reported by Xu et al. (294),
and may be due to differences in the methodology of the experiments. NTL7Δcel
overexpressing celR yielded wild-type levels of crystal violet staining (Figure 2.12),
suggesting that the failure to form biofilms on glass is due to overproduction of cellulose
in the wild-type strain. This inhibition of biofilm formation mirrors the effects reported
with two other cellulose-overproducing mutants (158). The overproduction of cellulose
may affect biofilm formation by increasing cell-cell aggregation, which could inhibit
strong interactions between the cells and other surfaces. A similar effect likely occurs
during the attachment of cells of NTL7Δcel overexpressing celR to plant tissue, with the
cells aggregating through some other means rather than through cellulose production.
Deleting celR resulted in increased polar attachment of individual bacteria to
plant tissue (Figure 2.11), an unexpected result given the loss of cellulose production and
lack of effect on the UPP. This effect on attachment is similar to the increase in single
cell binding to root hairs reported for the celR2 mutant of R. leguminosarum (11).
Further, strains of Rhizobium produce aggregate caps at root hair tips, with the formation
of these caps dependent on cellulose (239). Based on this evidence, the alteration in cell
attachment exhibited by the celR indel mutant of A. tumefaciens most probably is due to
54
an inability to aggregate as efficiently as wild-type cells, resulting in increased single cell
attachment to the plant tissue.
2.6.5 CelR orthologs within the alphaproteobacteria have diverged to
regulate separate processes. Interestingly, in those bacteria where c-di-GMP contributes
to regulating cellulose biosynthesis, the cellulose synthase complex contains a subunit
with the PilZ domain (7, 216). In both Gluconacetobacter xylinus and Salmonella
enterica serovar Typhimurium, BcsA, the PilZ-containing ortholog of CelA from A.
tumefaciens, directly binds c-di-GMP, and this binding activates the enzyme (74, 197,
216). Additionally, the genomes of a number of other bacterial species encode a putative
cellulose synthase with a PilZ domain orthologous to CelA (7). Conservation of this
domain suggests that regulation of cellulose synthesis by c-di-GMP is a common if not
universal phenomenon in the Proteobacteriaceae.
The DGC responsible for regulating cellulose production has been identified in a
number of species. In Salmonella and Escherichia species, two orthologous genes, adrA
and yaiC, control cellulose biosynthesis, resulting in the rdar morphotype (207, 307). In
Gluconacetobacter xylinus, a member of the Acetobacteraceae of the
alphaproteobacteria, three DGCs, annotated as Dgc, are involved in controlling cellulose
production (257). Moreover, other families of the alphaproteobacteria, including the
Rhodobacteraceae, encode a celA gene, and contain the dgc operons (Table 2.5). These
three enzymes, which are related to each other, are not orthologous to AdrA/YaiC. In
both A. tumefaciens and R. leguminosarum, the probable DGCs CelR and its ortholog
CelR2 regulate cellulose production (11). However, apart from shared GGDEF domains,
55
CelR and its orthologs are structurally distinct from the Dgc proteins of G. xylinus, and
AdrA/YaiC in the Enterobacteraceae. These observations suggest that distinct c-di-GMP-
dependent signaling pathways utilizing different DGCs have evolved within the
Proteobacteriaceae as a whole, and even among the alphaproteobacteria.
Putative DGCs with a domain structure essentially identical to CelR are found
throughout many families of the alphaproteobacteria (NCBI), and have been identified in
at least two members of the gammaproteobacteria, Pseudomonas aeruginosa (57, 97) and
Pseudomonas fluorescens (152, 245). Within the alphaproteobacteria, these CelR
orthologs are usually organized as the second gene of a two-gene operon with the first
encoding a small CheY-like receiver protein, generally annotated as divK (Table 2.5,
Figure 2.14). Studies of divK in alphaproteobacteria, including Caulobacter, Brucella and
Agrobacterium, link this gene to the polar localization of cell division proteins (4, 89,
103, 124). These observations suggest that divK is a conserved component of cell cycle
regulation among a number of the alphaproteobacteria.
While the organization of divK and celR as an operon is conserved in many
families of the alphaproteobacteria, the GGDEF-containing protein does not always
regulate cellulose synthesis. In the Caulobacteraceae, for example, the celR ortholog,
named pleD, plays a role in the production and polar localization of the holdfast stalk
during differentiation (4, 94). Interestingly, this group of bacteria apparently does not
produce cellulose; genome analyses indicate that the Caulobacteraceae, as well as several
other families of the alphaproteobacteria that contain the divK/celR(pleD) gene set do not
encode a celA gene or any other genes associated with cellulose biosynthesis (Table 2.5;
56
(153)). However, the genomes of other taxa within the alphaproteobacteria, including
families as diverse as the Rhizobiaceae, Bradyrhizobiaceae, Pelagibacteriaceae and
Phyllobacteriaceae, contain both the divK/celR operon and a cel system that includes a
PilZ-containing CelA subunit (Table 2.5). Furthermore, celR is not a component of cell
cycle regulation in A. tumefaciens (124). Our results support the notion that, at least
among the Rhizobiaceae, the celR/celR2 gene product is dedicated to controlling polymer
production and does not participate directly in regulating cell cycle events or polar
localization. Taken together, these observations suggest that the divK/celR(pleD)
regulatory system has evolved along at least two independent tracts; controlling polar
localization and adhesion, as in the case of Caulobacteraceae, and regulating cellulose
production, as seen in the Rhizobiaceae. It is possible that this separation occurred with
the acquisition of cellulose biosynthesis among the Rhizobiaceae.
2.6.6 Cellulose biosynthesis in A. tumefaciens is regulated at several levels.
Our work as well as previous studies (158) suggest that in A. tumefaciens, cellulose
production is regulated at least two levels. CelR contains a pair of CheY-like domains
(Figure 2.3), suggesting that the activity of this protein is controlled by some unknown
upstream signal. In addition, mutations in two other genes in A. tumefaciens, celG and
celI, result in overproduction of the polymer (158). While CelG has no predictable
structure, CelI is a putative member of the MarR/ArsR family of transcriptional
regulators, suggesting that production of cellulose is also regulated at the level of
transcription. These two genes, with celG located in the cel gene cluster and celI located
elsewhere on the chromosome, are conserved within other members of the Rhizobiaceae,
including R. leguminosarum. Based on this evidence, cellulose production in the
57
Rhizobiaceae may be regulated by transcriptional control of the cel cluster, possibly
through celI, and by modulating the rate of cellulose synthesis in the cell through
allosteric regulation of the synthase.
The impact of celR on cellulose production in A. tumefaciens suggests that there is
a signaling cascade involved in regulating synthesis of the polymer. One of the CheY-like
domains in CelR contains a conserved aspartate residue, which in PleD of C. crescentus
is a target for phosphorylation (190). This observation suggests that CelR can be
activated by phosphorylation by some unidentified kinase. The identity of this kinase and
how its activity is regulated remains to be determined. Continuing to examine the
components of the pathway regulating the function of CelR in cellulose biosynthesis may
help us to better understand the interaction of A. tumefaciens and the host plant.
58
2.7 Tables and Figures
Table 2.1. Strains and plasmids used in this studya.
Strain or Plasmid Genotype Reference
E. coli
DH5α supE44ΔlacU169(ϕ80lacZΔM15) hsdR17
recA1 endA1 gyrA96 thi-1 relA1
(219)
S17-1 λpir Pro- Res- Mod+ recA; integrated RP4-
Tcr::Mu-Kan::Tn7, Mob+;Smr λ::pir
(62)
A. tumefaciens
NTL4 A derivative of C58, ΔtetRS, lacks pTiC58 (150)
NTL7 A derivative NTL4 with pTiC58
reintroduced
(150)
NTL7Δcel NTL7 with celC and celDE deleted, Tcr Shengchang
Su, This Study
ATCC31749 Curdlan-overproducing strain (91)
NTL7ΔcelR::Gm NTL7 celR::Gmr This Study
NTL7Δatu1060::Km NTL7 atu1060::Kmr This Study
Plasmid
pUC18 Cloning vector, Apr Invitrogen
pUCcelR celR gene cloned into pUC18 This Study
pUCatu1060 atu1060 gene cloned into pUC18 This Study
pUCatu0826 atu0826 gene cloned into pUC18 This Study
pUCatu2228 atu2228 gene cloned into pUC18 This Study
59
Table 2.1. (cont.)
pUCatu4490 atu4490 gene cloned into pUC18 This Study
pUCcelRdel Gm cassette between DNA sections
flanking the celR gene, Gmr, Apr
This Study
pUCatu1060region Section of chromosome surrounding
atu1060 locus cloned into pUC18
This Study
pUCpr Promoter of celR cloned into pUC18 This Study
pUCprcelR pUCpr with celR cloned into constructed
NdeI site in frame with promoter
This Study
pMGm Vector source of gentamicin cassette, Apr,
Gmr
(175)
pZLQ pBBR1MCS-2 based expression vector,
Kmr
(151)
pZLQcelR celR locus from pUCcelR cloned into
NdeI/BamHI sites of pZLQ
This Study
pZLQatu1060 atu1060 locus from pUCatu1060 cloned
into NdeI/BamHI sites of pZLQ
This Study
pZLQatu0826 atu0826 locus from pUCatu0826 cloned
into NdeI/BamHI sites of pZLQ
This Study
pZLQatu2228 atu2228 locus from pUCatu2228 cloned
into NdeI/BamHI sites of pZLQ
This Study
pZLQatu4490 atu4490 locus from pUCatu4490 cloned
into NdeI/BamHI sites of pZLQ
This Study
60
Table 2.1. (cont.)
pUC18mini-Tn7T-Km Tn7 carrier vector containing Km cassette,
Apr, Kmr
(44)
pTNS2 Tn7 helper plasmid encoding the
TnsABC+D specific transposition
pathway, Apr
(44)
pUCTn7-Km-prcelR prcelR fragment cloned into BamHI site of
pUC18mini-Tn7T-Km
This Study
pRK415 InP1α broad host range cloning vector, Tcr (115)
pRKatu1060region The atu1060 region inserted into pRK415 This Study
pRKatu1060kan Allellic replacement of atu1060 with a
kanamycin cassette on pRKatu1060region
This Study
pWM91 λpir-dependent cloning vector, Apr (170)
pWMcelRdel celRdel fragment cloned into BamHI site
of pWM91
This Study
pWMatu1060kan atu1060kan fragment cloned into BamHI
site of pWM91
This Study
pKD46 Lambda Red recombinase helper plasmid,
Apr
(61)
pKD4 Template plasmid of kanamycin cassette
for chromosomal exchange, Apr, Kmr
(61)
61
Table 2.1. (cont.)
pBBR1MCS-3 Mobilizable broad host range cloning
vector with extended MCS, Tcr
(128)
pSR47s Suicide vector, Apr (169)
aAbbreviations: Apr, resistance to ampicillin; Cmr, resistance to chloramphenicol; Gm,
resistance to gentamicin; Kmr, resistance to kanamycin; Smr, resistance to streptomycin;
Tcr, resistance to tetracycline.
62
Table 2.2. The increase in anthrone-reacting material from atu1297 overexpression
is due to cellulose.
Extractable Anthrone-Positive Materiala
Strain Plasmid -Cellulase +Cellulase
NTL7 - 782±76b 585±66
NTL7 pZLQatu1297 1831±199 728±59
NTL7Δcel - 542±46 590±45
NTL7Δcel pZLQatu1297 620±68 544±58
a Expressed as µg/mg of protein.
b Average values of four experiments, with ± number indicating standard error range.
63
Table 2.3. Overexpressing CelR affects lectin binding and rosetting.
Total Cells % Labeleda % Rosetteb
NTL7 272 3 1
NTL7Δcel 272 3 1
NTL7(pZLQcelR) 584 11c 1
NTL7Δcel(pZLQcelR) 890 16c 3c
NTL7ΔcelR::Gm 228 5 1
a Percentage of cells examined that displayed polar lectin binding.
b Percentage of cells examined that were observed in rosettes.
c p ≤ 0.005 compared to NTL7 using Chi-squared analysis.
64
Table 2.4. Deleting celR affects attachment of the bacteria to Arabidopsis leaf surfacesa.
No. of cells attachedb
No. of polar-attached
cellsc
NTL7 80±19 2±2
NTL7ΔcelR::Gm 120±26* 44±16*
aSamples were prepared and examined by SEM by Dr. Lois Banta, Williams College,
MA. Attached cells were enumerated from the micrographs by D. M. Barnhart.
bAverage number of cells per field from 10 (NTL7) or 6 (NTL7ΔcelR::Gm) randomly-
chosen fields from 4 leaves inoculated with either strain. Second value represents
standard error.
cAverage number of cells from one randomly-chosen field from each of 3 independent
leaves incubated with either strain. Standard error is represented with the second value.
*Samples statistically significant (p < 0.05) from the parent strain using Student t-test
with one-sided distribution.
65
Table 2.5. Genes present in members of the alphaproteobacteria.
a No members of this family contain these genes or enzymes.
b Several members in this family contain these genes or enzymes.
c Only Bradyrhizobium species contain celA; all other members of the Bradyrhizobiaceae
lack the gene.
d U: No available literature.
Uses CelR to regulate
Family Contains the
divK/celR
operon
Contains CelA
subunit with a
PilZ domain
Cell
differentiation
Cellulose
synthesis
Acetobacteraceae Na Y Ud N
Bradyrhizobiaceae Yb Yc U U
Brucellaceae Y N U N
Caulobacteraceae Y N Y N
Methylobacteriaceae N Y U U
Phyllobacteriaceae Y Y U U
Rhizobiaceae Y Y N Y
Rhodobacteraceae N Y U N
66
Figure 2.1. Organization of the cel locus of A. tumefaciens strain C58 and
construction of NTL7Δcel. The figure represents the gene organization of a 10.5 kb
segment of chromosome 2 of A. tumefaciens strain C58. Arrows indicate each gene and
its orientation. The region within the dotted lines represents the section of the cel locus
that was replaced with tetA.
67
Figure 2.2. Organization of the divK-celR locus of A. tumefaciens strain C58 and
construction of the NTL7ΔcelR::Gm mutant. The gene organization of a 3.6 kb
segment of chromosome 1 of A. tumefaciens strain C58 that encodes the divK-celR
operon. Arrows indicate each gene and its orientation. The fragments flanking the
gentamicin cassette (Gmr) represent the organization of the insert in pUCcelRdel used for
recombination into the chromosome of strain NTL7. The 300 bp fragment containing the
promoter region of divK-celR is fused directly to the celR gene in pUCprcelR.
68
Figure 2.3. Domain structure of GGDEF-containing proteins examined in this study.
The domains of the five studied proteins as derived by analysis of amino acid sequences
in the NCBI databases. CheY: CheY-like receiver domain, GGDEF: diguanylate cyclase
domain, EAL: phosphodiesterase A domain, CBS: cystathionine beta synthase domain,
HAMP: linker domain of receptor histidine kinase and methyl-accepting proteins, PAS:
oxygen-sensing heme-bound domain, TAT: TAT secretion system signal, Chase4: low
molecular weight ligand-binding domain. The number of amino acids in each protein is
shown at the end of each protein structure.
69
Figure 2.4. Overexpressing GGDEF domain proteins results in varied phenotypes
on solid and liquid media. Strain NTL7 with constructs expressing genes coding for
GGDEF domain proteins were grown for two days at 28ºC A) on ABM plates containing
Congo red, and B) in MG/L, with shaking. Both media contained the appropriate
antibiotics.
70
Figure 2.5. Overexpressing atu1297 and atu1060 does not affect exopolysaccharide
production in NTL7Δcel. Strains NTL7 and NTL7Δcel, with or without constructs
overexpressing either atu1297 or atu1060, were grown for two days at 28ºC A) on ABM
plates containing Congo red, and B) in MG/L, with shaking. Both media contained the
appropriate antibiotics.
71
Figure 2.6. Overexpressing atu1060 and atu1297 does not affect curdlan production.
Strains of A. tumefaciens were grown for two days at 28ºC on ABM plates containing (A
and B) aniline blue or (C) Congo red.
72
Figure 2.7. Overexpressing atu1297 and atu1060 results in increased production of
anthrone-reacting material. Strains NTL7 and NTL7Δcel with constructs
overexpressing either atu1297 or atu1060 were grown in MG/L with the appropriate
antibiotics for two days at 28ºC with shaking. The cells were harvested and assessed for
production of anthrone-reacting material as described in the Materials and Methods. Each
experiment was repeated four times. The values represent the average of the four samples
of each strain, and the error bars represent the standard error of the experiments.
73
Figure 2.8. The atu1297 gene, but not the atu1060 gene, positively regulates cellulose
production. Derivatives of NTL7 with mutations in atu1297 or atu1060 were grown A)
on ABM plates containing Congo red for two days at 28ºC, and B) in MG/L, harvested
and assayed for extractable cellulose as described in the Materials and Methods. The total
amount of anthrone-reactive material from each strain was normalized by comparison to
the amount of material extracted from NTL7Δcel, which was set to zero. Each strain was
tested four times and the data was averaged, with the error bars representing the standard
error of the experiments.
74
Figure 2.9. Overexpression of celR affects aggregation and rosetting. Cultures of
NTL7 or NTL7Δcel and their derivatives were grown in MG/L and samples were viewed
by DIC microscopy as described in Materials and Methods. A) NTL7. B)
NTL7(pZLQcelR). C) NTL7Δcel(pZLQcelR). D) NTL7Δcel(pZLQcelR) in rosettes.
Scale bars represent 5 µm.
75
Figure 2.10. Cells overexpressing celR display increased polar binding of lectins.
Cells grown in MG/L with the appropriate antibiotics were collected, incubated with
WGA-Alexafluor 633 and observed by fluorescence microscopy as described in
Materials and Methods. A) NTL7. B) NTL7(pZLQcelR). C) NTL7Δcel(pZLQcelR). D)
NTL7ΔcelR::Gm. Circled cells represent examples of polar-bound lectin.
76
Figure 2.11. Cells altered in the expression of celR are affected in plant attachment.
Strains were cultured and inoculated onto Arabidopsis thaliana leaves, and the
interactions were visualized by SEM as described in Materials and Methods by Dr. Lois
Banta. A) NTL7. B) NTL7ΔcelR::Gm. C) NTL7Δcel. D) NTL7Δcel(pZLQcelR). E and
F) Higher magnification images of NTL7Δcel(pZLQcelR).
77
Figure 2.12. Overexpressing celR decreases biofilm formation on glass surfaces.
Cultures were grown in MG/L with the appropriate antibiotics in borosilicate tubes and
assayed for adherence to the glass surface by crystal violet staining as described in
Materials and Methods. Each strain was grow in triplicate, and each experiment was
repeated three times. The values represent the average of the nine total samples, with
error bars representing the standard error of the experiments.
78
Figure 2.13. Overexpression of celR and atu1060 severely attenuates virulence. A.
Derivatives of NTL7 containing constructs overexpressing one of the GGDEF-containing
proteins were inoculated onto leaves of Kalanchoё daigremontiana as described in
Materials and Methods. B. NTL7 altered in expression of either celR or atu1060 were
inoculated onto tomato stems and assessed for tumor induction as described in Materials
and Methods. Each experiment was repeated three times, with five samples per
experiment. The data indicate the averages of samples for each strain tested, with error
bars representing standard error.
79
Figure 2.14. Comparison of the divK/celR(pleD) region in the genomes of three
members of the α-proteobacteria. The figure represents the gene organization of the
divK-celR operons in A. tumefaciens C58 (At) and R. leguminosarum bv. viciae 3841
(Rl), and the divK-pleD operon in C. crescentus NA1000 (Cc), as well as the surrounding
genes and their annotations. Identical shading indicates orthologous genes. The scale bar
indicates 1 kb.
80
Chapter 3
A signaling pathway involving the diguanylate cyclase CelR and the response
regulator DivK controls cellulose synthesis in Agrobacterium tumefaciens
3.1 Notes and Acknowledgements
This chapter is adapted from the Journal of Bacteriology article, entitled “A
signaling pathway involving the diguanylate cyclase CelR and the response regulator
DivK controls cellulose synthesis in Agrobacterium tumefaciens”, March 2014, Volume
196, Pages 1257- 1274, with authors D. M. Barnhart, S. Su, and S. K. Farrand.
Additionally, I would like to thank Dr. Peter Orlean and Dr. Lois Banta for their guidance
in this chapter. Of note, development of the strain NTL7ΔcelA::lacZ was done by Dr.
Shengchang Su, University of Illinois.
3.2 Summary
The production of cellulose fibrils is involved in the attachment of Agrobacterium
tumefaciens to its plant host. Consistent with previous studies, we reported recently that a
putative diguanylate cyclase, celR, is required for synthesis of this polymer in A.
tumefaciens. In this study, the effects of celR and other components of the regulatory
pathway of cellulose production were explored. Mutational analysis of celR demonstrated
that the cyclase requires the catalytic GGEEF motif, as well as the conserved aspartate
residue of a CheY-like receiver domain, for stimulating cellulose production. Moreover, a
site-directed mutation within the PilZ domain of CelA, the catalytic subunit of the
cellulose synthase complex, greatly reduced cellulose production. In addition, deletion of
81
divK, the first gene of the divK-celR operon, also reduced cellulose production. This
requirement for divK was alleviated by expression of a constitutively active form of
CelR, suggesting that DivK acts upstream of CelR activation. Based on bacterial two-
hybrid assays, CelR homodimerizes but does not interact with DivK. The mutation in
divK additionally affected cell morphology, and this effect was complementable by a
wild-type copy of the gene, but not by the constitutively active allele of celR. These
results support the hypothesis that CelR is a bona-fide c-di-GMP synthase and that the
nucleotide signal produced by this enzyme activates CelA via the PilZ domain. Our
studies also suggest that the DivK/CelR signaling pathway in Agrobacterium regulates
cellulose production independent of cell cycle checkpoint systems that are controlled by
divK.
3.3 Introduction
The interaction of the plant pathogen Agrobacterium tumefaciens with its host is
dependent on attachment (147, 148), which requires the production of anchoring factors.
One component of the attachment matrix produced by the bacterium is cellulose, a β1,4-
linked glucose polymer. The cellulose fibrils serve to anchor the bacteria to each other as
well as to stabilize the interaction of the bacteria to the plant cells (157). Mutants
deficient in the production of cellulose bind less tightly to plant cell surfaces (156, 160),
and, in addition, do not efficiently establish biofilms (158).
The production of cellulose by A. tumefaciens strain C58 is encoded by two
closely linked operons, celABC and celDE, located on the linear chromosome (85, 162,
292). Two of the genes, celA and celB, encode the heterodimeric cellulose synthase
82
complex (161). The CelD and CelE proteins likely are responsible for the synthesis of
UDP-glucose, a process that involves a lipid-glucose intermediate (161). The CelA-CelB
complex then catalyzes the addition of the activated glucose to the extending cellulose
fiber (223, 307). Based on evidence in other bacteria, the cellulose fibrils are extruded
into the extracellular milieu from the synthase complex, perhaps by an exporter encoded
by CelC, imbedded within the membrane of the cells (173, 287).
Cellulose synthesis in A. tumefaciens resembles production of this polymer in the
model bacterium Gluconoacetobacter xylinus (291). In this system, the synthase
complex, coded for by bcsA and bcsB, responds to the secondary signal molecule cyclic-
di-guanosine-monophosphate (c-di-GMP) (208, 211), with the BcsA subunit recognizing
the nucleotide via a PilZ domain, one of several known c-di-GMP-binding domains (7,
216, 283). The sequences of CelA and BcsA are strongly conserved, including the C-
terminal PilZ domain. Consistent with this conserved signal binding domain, Amikam
and Benziman (6) reported that in cell-free extracts of A. tumefaciens, addition of c-di-
GMP substantially increased the rate of cellulose synthesis. These observations strongly
suggest that cellulose synthesis in A. tumefaciens is regulated in part by c-di-GMP.
In previous studies, we reported that production of cellulose in A. tumefaciens is
stimulated by a putative diguanylate cyclase (DGC) we named CelR (14).
Overexpression of celR resulted in increased production of the polymer, while deleting
the gene greatly reduced the amount of cellulose extractable from the cells (14). These
results suggest that celR is involved in activating synthesis of cellulose. The celR gene is
part of the divK-celR operon, which is strongly conserved in many alphaproteobacteria
(Figure S1, (14)). Interestingly, in Caulobacter crescentus, this operon, annotated as divK
83
and pleD, controls events at the poles of the cell. PleD, the ortholog of CelR, is involved
in regulating the formation of the holdfast stalk, while DivK localizes cell cycle
regulators, including factors for activating PleD, to specific poles of the cell during
division (4, 93, 94, 136, 268). The divK gene also controls polar localization during the
cell cycle of Brucella abortus (89), and in Agrobacterium, divK functions in a
phosphorelay cascade that regulates cell division (124). These observations suggest that
the divK-celR(pleD) operon and its component genes may play different roles among the
diverse species of the alphaproteobacteria.
While we have demonstrated that celR influences cellulose production in A.
tumefaciens, the mechanism by which it does so is still unknown. Based on biochemical
and mutational analysis, PleD of C. crescentus has diguanylate cyclase activity (4, 188,
190). However there is limited evidence that CelR, while containing the conserved c-di-
GMP synthesis motif, is a functional DGC (14, 124). There are several examples of
proteins with GGDEF domains that do not exhibit c-di-GMP synthesis activity (reviewed
in (205, 243)). It is conceivable, then, that celR stimulates cellulose synthesis by some
alternate mechanism.
In this study, we examined the effects of targeted mutations in both divK and celR
on cellulose synthesis in A. tumefaciens. Our results indicate that CelR activity requires
an intact GGEEF motif, as well as a conserved aspartate residue in the first of two CheY
domains of the protein. In turn, a substitution mutation in a residue associated with c-di-
GMP binding in the PilZ domain of CelA greatly reduces the amount of cellulose
synthesized by the mutant. We also show that stimulation of cellulose biosynthesis by
CelR is dependent on DivK. However, divK also influences cell division in A.
84
tumefaciens, and this influence is independent of celR. Our results are consistent with the
notion that divK continues to regulate cell division in A. tumefaciens, as in other
alphaproteobacteria, while the divK-celR operon has diverged to also regulate cellulose
production among the Rhizobiaceae.
3.4 Materials and Methods
3.4.1 Strains, culture and growth conditions. The bacteria used in this study are
listed in Table 3.1. Strains of Escherichia coli were grown on Luria-Bertani (LB,
Invitrogen) agar plates with appropriate antibiotics at 37°C. Strains of A. tumefaciens
were grown on nutrient agar (NA, Fisher) or on plates of AB minimal medium (41)
supplemented with 0.2% mannitol (ABM) with appropriate antibiotics at 28°C. Cultures
of E. coli were grown in LB broth with the required antibiotics at 37°C with shaking.
Cultures of A. tumefaciens were grown in MG/L medium (31) with appropriate
antibiotics at 28°C with shaking. Antibiotics used include ampicillin (100 µg/ml for E.
coli), carbenicillin (50 µg/ml for A. tumefaciens), kanamycin (50 µg/ml for E. coli and A.
tumefaciens), gentamicin (50 µg/ml for E. coli, 25 µg/ml for A. tumefaciens), and
tetracycline (10 µg/ml for both E. coli and A. tumefaciens). When necessary, Congo red
(50 µg/ml), isopropyl-β-D-thiogalactopyranoside (IPTG; 400 mM) or 5-bromo-4-chloro-
3-indolyl-β-D-galactopyranoside (X-gal, 80 µg/ml) was added to plates for phenotype
assessment.
3.4.2 Strain construction. Primers used for PCR amplification are listed on Table
3.2.
85
Construction of overexpression strains: Genomic DNA was prepared from an
overnight culture of A. tumefaciens NTL7 as described previously (84). To create the
overexpression plasmid pKK38celR, the celR gene was amplified by PCR using Pfu
polymerase (Stratagene) and the primers celR-fnco and celR-r. The amplicon was
digested with BamHI and ligated into BamHI-digested pUC18. The resulting ligation
products were introduced into DH5α by CaCl2 transformation with selection on LB plates
containing ampicillin. The plasmids were purified, and the resulting fragment was ligated
into NcoI- and BamHI-digested pKK38ASH (Table 3.1) and transformed into DH5α.
After selecting for tetracycline resistance, the plasmid was isolated, analyzed, and the
correct construct was electroporated into the appropriate strains of A. tumefaciens. To
express celA from a controlled promoter, the gene was amplified by PCR using Pfu
polymerase and the primers celA-f and celA-r. The PCR product was digested with
BamHI, ligated into BamHI- digested pUC18, and the resulting ligation products were
transformed into DH5α. Colonies resistant to ampicillin were selected, the plasmids
purified and digested with NdeI and BamHI. The resulting fragment of celA was ligated
into the expression vector pSRK-Gm (Table 3.1) and transformed into DH5α. After
selecting for gentamicin resistance, the plasmid was isolated, analyzed, and the correct
construct was electroporated into the appropriate strains of A. tumefaciens.
Production of Tn7 insertion vectors. A 400 bp segment containing the promoter
region of the divK-celR operon along with additional DNA encoding either divK or divK-
celR was amplified using Pfu polymerase and the primers prdivKcelR-f and divK-r, or
prdivKcelR-f and celR-r. The amplicons were digested and cloned into BamHI- digested
pUC18. The resulting ligation products were transformed into DH5α, transformants were
86
isolated on LB plates containing ampicillin, and the recombinant plasmids were purified
and confirmed by sequence analysis. The correct clones were digested with BamHI, and
the fragments were ligated into pUC18-miniTn7t-Gm to form pUCTn7-prdivK and
pUCTn7-prdivKcelR. The resulting plasmids were transformed into DH5α, selected for
resistance to ampicillin and gentamicin, purified and tested for the appropriate insertion
by restriction digest analysis.
Site-directed mutagenesis: The target fragments cloned into either pUC18, pUC-
miniTn7t-Gm/Km, or pSRK-Gm were amplified by PCR using Pfu polymerase with
primers containing point mutations at the target residue (See Table 3.2). The resulting
amplified plasmids were digested with DpnI to remove the original template DNA, and
the remaining plasmids were transformed into DH5α. After selecting for resistance to the
appropriate antibiotic, the plasmids were isolated and the mutations were confirmed by
sequence analysis. The altered plasmids were introduced into the appropriate strains by
electroporation or by Tn7 insertion, as described below. Fragments containing the correct
mutation on pUC18 were recovered by digesting with the appropriate restriction
enzymes, and then ligating into either pZLQ (Table 3.1) or pKK38ASH.
Disruption of the chromosomal celA gene. A nonpolar deletion of celA (atu3309)
was constructed as follows by Dr. Shengchang Su. A 500 bp internal fragment of celA
was amplified by PCR from genomic DNA of strain NTL7 using Pfu DNA polymerase
and primers celA/Eco and celA/Xb. The resulting amplicon was digested with EcoRI and
XbaI and cloned between the corresponding sites on pVIK112 (111). The resulting
ligation products were transformed into S17-1λ pir with selection for resistance to
kanamycin. The resulting plasmid, pVIKcelA, was identified and transformed into NTL7
87
by electroporation. NTL7 carrying the disruption of celA resulting from a single
crossover event was selected by plating on media containing the appropriate antibiotics.
Insertional disruption of celA was verified by PCR using additional primers located
further upstream and downstream from the original fragments. The resulting mutant
creates a celA::lacZ transcriptional fusion.
Deleting celR by allelic exchange in the celA mutant. The celR gene was removed
from NTL7ΔcelA::lacZ using the procedure described in Barnhart et al. (14).
Indel mutation of divK: The divK gene was replaced with a kanamycin resistance
cassette using a protocol modified from that of Datsenko and Wanner (61). Briefly, a set
of primers, divKfrt-f and divKfrt-r was used to amplify the kanamycin cassette from
pKD4 (Table 3.1) by PCR, and the product was treated with DpnI to blunt the ends.
Additionally, a 3.9 kb fragment containing divK was amplified from NTL7 genomic
DNA using the primers divKregion-f and divKregion-r. The fragment was digested with
KpnI and cloned into pRK415 (Table 3.1), creating the construct pRKdivKregion. The
construct was introduced into DH5α by CaCl2 transformation, and the plasmid was
purified and confirmed by restriction analysis and sequencing. The PCR-generated
kanamycin fragment was electroporated into an E. coli strain harboring both the red
recombinase plasmid pKD46 (Table 3.1) and pRKdivKregion, transformants were
selected for resistance to kanamycin, and plasmids were purified and examined for
replacement of divK on pRK415 by restriction analysis and PCR. The correct plasmids
containing the replaced gene were digested with KpnI, the modified divK gene was
cloned into the pir-dependent vector pWM91 (Table 3.1), producing the construct
pWMdivKkan, and this plasmid was transformed into S17-1/λpir. Successful constructs
88
were selected for resistance to ampicillin and kanamycin, and a verified plasmid was
electroporated into A. tumefaciens. Initial transformants were selected for resistance to
kanamycin and sucrose, followed by screening for sensitivity to carbenicillin. Potential
mutants were confirmed using PCR and Southern analysis.
Allelic exchange of divKcelR: The divKcelR operon was deleted using a different
modification to the protocol from Datsenko and Wanner (61). A set of primers, divKfrt-f
and celRfrt-r, were used to amplify the kanamycin cassette from pKD4 by PCR, and the
product was treated with DpnI to blunt the ends. Additionally, a 4.2 kb fragment
containing divK and celR was amplified from NTL7 genomic DNA using the primers
divKregion-f and celRregion-r. The fragment was digested with KpnI and cloned into
pRK415, creating the construct pRKdivKcelRregion. The construct was introduced into
DH5α by CaCl2 transformation, and the plasmid was purified and verified by restriction
digestion and sequencing. The fragment containing the kanamycin cassette was
electroporated into an E. coli strain harboring both the red recombinase plasmid pKD46
and pRKdivKcelRregion, transformants were selected for resistance to kanamycin, and
plasmids were purified and examined for replacement of the operon with the kanamycin
cassette by restriction digest and PCR. The correct plasmid containing the replaced
operon, renamed pRKdivKcelRkan, was electroporated into an E. coli strain containing
the plasmid pCP20, which expresses the flp recombinase gene. A construct in which the
kanamycin cassette was deleted was identified by screening for resistance to tetracycline
but sensitivity to kanamycin, and the plasmids were purified and examined for loss of the
kanamycin cassette by restriction digest. The correct plasmids were digested with KpnI,
the modified region was cloned into pWM91, producing the construct pWMdivKcelRdel,
89
and this plasmid was transformed into S17-1/λpir. Successful constructs were selected for
resistance to ampicillin, and a verified plasmid was electroporated into A. tumefaciens.
Initial transformants were selected for resistance to ampicillin for single recombination
events, followed by growth in MG/L and screening for resistance to sucrose and
sensitivity to carbenicillin. Potential marker-exchange mutants were confirmed using
PCR and Southern analysis.
Complementation of NTL7ΔcelR::Gm, NTL7ΔdivK::Km and NTL7ΔdivKcelR. To
complement disruptions of divK and celR, appropriate Tn7 constructs, as well as the
transposase plasmid pTNS2 (Table 3.1), were electroporated into the target mutant at a
1:2 ratio of Tn7 vector to pTNS2. The transformed cells were selected for resistance to
gentamicin, and mini-Tn7 integrants were confirmed by PCR analysis using the primers
Tn7insert-L and either pTn7-L, divK-r or celR-r.
Two-hybrid constructs: Both divK and celR genes were amplified from genomic
DNA of strain NTL7 using Pfu polymerase and primers specific for insertion into two-
hybrid expression vectors. The appropriate alleles of divK and celR were amplified from
their recombinant plasmids using Pfu polymerase and the above primers. Fragments of
divK were digested with XhoI and KpnI, while fragments of celR were digested with
BamHI and KpnI. The fragment encoding divK was ligated into pSR658, transformed into
DH5α, and selected for on medium containing tetracycline. The fragment encoding celR
was ligated into pSR659, transformed into DH5α, and selected for on medium containing
ampicillin. The plasmids were recovered, purified and examined for the correct insertion
by restriction digest and sequencing. Plasmids containing the correct insert were
90
transformed into either E. coli strains SU101 or SU202, and were selected for resistance
to kanamycin and either tetracycline or ampicillin.
3.4.3 E. coli two-hybrid assays. Bacterial two-hybrid assays were performed as
described (58). Strains SU101 containing plasmids with alleles of celR-lexA or SU202
containing plasmids with alleles of divK and celR fused to the DNA-binding fragment of
lexA were plated on LB medium containing the appropriate antibiotics, IPTG and X-gal.
Plates were incubated at 28ºC for three days to determine if the lacZ gene of the test
strain was repressed. Interactions between fusion proteins yield light blue colonies due to
repression of lacZ driven by a LexA-regulated promoter (58). All experiments were
repeated at least three times, with negative controls of the parent strains harboring the
empty vectors pSR658 or pSR659, and the parent strains harboring the positive control
plasmids pMS604 or pDP804 (66), each containing full-length lexA for dimerization.
3.4.4 Cellulose assays. Cellulose was quantified following extraction using a
modified Updegraff protocol (271) as previously described (14). The amount of anthrone-
reactive material extractable from a sample was standardized to the number of cells as
determined by OD600 measurement. Cel mutants of strain NTL7 still produce anthrone-
positive material, probably curdlan (14). Because of this, the average amount of cellulose
extractable per 109 cells was then normalized by subtracting out the amount of anthrone-
positive material extracted from either NTL7Δcel or NTL7ΔcelA::lacZ, depending on the
experiment, all as we described previously (14). Statistical analysis was performed using
the Student t-test using a one-sided distribution model.
3.4.5 β-galactosidase assays. β-galactosidase activity was quantified using a
microtiter assay as described by Slauch and Silhavy (235). Cells grown overnight at 28°C
91
in MG/L with appropriate antibiotics were subcultured into 2 ml of ABM medium, grown
for 24 hours to mid-exponential phase, collected by centrifugation, and resuspended in
1.5 ml of Z-buffer, pH 7.1 (235). Volumes of 250 µl of each suspension were removed
for turbidity measurements at 600 nm. Fifteen µl of 1% SDS and 30 µl of chloroform was
added to the remaining volumes, the samples were vortexed for 10 seconds, incubated for
15 minutes at room temperature and 60 µl volumes of the lysates were distributed to
polystyrene microtiter wells (Corning). The final volume in each well was adjusted to
200 µl with Z-buffer. The reaction was initiated by adding 50 µl of o-nitrophenyl-3-D-
galactopyranoside (ONPG; 10 mg/ml) in Z-buffer without added 3-mercaptoethanol and
the absorbance at 420 nm was monitored in a Cambridge Biotechnology Model 700
microplate reader. Readings were taken at 3-minute intervals for 24 minutes. β-
galactosidase activity was calculated as described (235). Each strain was assayed nine
times, and the reaction rates were averaged and statistically analyzed using the Student t-
test with a one-sided distribution model.
3.4.6 Microscopy. Cells were grown in MG/L with appropriate antibiotics
overnight at 28ºC with shaking. Cells from each culture grown to the same OD600 were
examined by phase contrast microscopy using an Olympus BH-2 Research Microscope
(Olympus) with an Olympus Camedia Digital Camera (Olympus). Two image-fields
were recorded for each sample, and the total number of cells and the number of
malformed cells were counted in each field. The percentage of malformed cells was
calculated from two repetitions (four fields total), with statistical analysis performed
using the Student t-test with a one-sided distribution model.
92
3.5 Results
3.5.1 Alteration of key residues affects the influence of CelR on cellulose
production. Previously, we showed that celR is required to stimulate cellulose
biosynthesis (14). Bioinformatic analysis of this protein identified two N-terminal CheY-
like receiver domains, the first containing a conserved aspartate residue, as well as a C-
terminal catalytic GGEEF motif associated with synthesis of c-di-GMP (Figure 3.1).
Proteins with CheY domains often transition between activated and inactive forms based
on the phosphorylation state of a conserved aspartate residue (4, 35, 152). Given its
domain structure, these observations suggest that CelR is a c-di-GMP synthase, and that
its activity is modulated by modification of the Asp residue in the CheY domain.
In a set of preliminary experiments, we overexpressed celR mutated at Asp53 in
the CheY domain (celRD53A) or at a key residue of the enzymatic GGEEF motif
(celRE373A) in wild-type strain NTL7. We assessed the effect of these mutations on
cellulose production by colony color on Congo red plates (302) and by growth properties
in liquid media. As we described previously (14), when compared to the parent,
overexpressing wild-type celR resulted in increased Congo red binding (Figure 3.2A) and
also pronounced aggregation in liquid media (Figure 3.2B). NTL7 overexpressing either
celRD53A or celRE373A exhibited little change in Congo red binding (Figure 3.2A), and
showed virtually no observable aggregation during growth in liquid media (Figure 3.2B).
In quantitative assays, NTL7 overexpressing celR produced a significantly higher level of
extractable cellulose as compared to the parent strain (Figure 3.3A). In contrast,
overexpressing either celRD53A or celRE373A had no significant effect on the amount of
the polymer produced (Figure 3.3A). These results suggest that, to stimulate cellulose
93
synthesis, CelR requires an intact GGEEF motif and the conserved aspartate residue in
the CheY domain.
3.5.2 CelR regulates cellulose biosynthesis through its activation and
synthesis of c-di-GMP. While overexpressing the D53A and E373A mutants of CelR
has no effect on phenotypes associated with cellulose synthesis, these results do not
establish the role of these residues in stimulating production of the polymer. We therefore
tested celRD53A and celRE373A for their ability to complement the indel mutant of celR,
NTL7ΔcelR::Gm. As previously described (14), the ΔcelR mutant does not produce
cellulose as compared to wild-type NTL7 (Figure 3.3B). Expressing wild-type celR from
its native promoter in the mutant restored cellulose production to wild-type levels (Figure
3.3B). Complementing the indel mutant with either celRD53A or celRE373A failed to
restore cellulose synthesis as compared to the uncomplemented mutant (Figure 3.3B).
Taken together, the data indicate that CelR requires both the conserved aspartate in the
CheY domain and the conserved glutamate in the GGEEF motif for stimulating cellulose
production.
3.5.3 An Asp53 Glu mutation in the first CheY domain of CelR results in
increased cellulose production. Analysis of the D53A mutant of CelR indicates that this
amino acid is critical for the proper function of the protein. In proteins containing similar
CheY-like receiver domains, the aspartate residue can be phosphorylated (220), and
converting this residue to a glutamate often results in a constitutively-active form of the
protein (190). We examined the role of Asp53 in CelR by mutating this residue to
glutamate and assessing the effect on cellulose synthesis. Overexpressing celRD53E in
NTL7 resulted in increased cellulose production, even as compared to a strain
94
overexpressing wild-type celR (Figure 3.4). Complementing the ΔcelR mutant with
celRD53E inserted at unit copy number and expressed from its native promoter also
resulted in increased levels of cellulose synthesis as compared to the mutant
complemented with wild-type celR (Figure 3.4). These observations suggest that
substituting glutamate for aspartate at position 53 results in a more active form of celR.
Taken together, our results are consistent with the notion that CelR is a bona fide c-di-
GMP synthase, and that it is part of a signaling pathway that involves phosphorylation at
Asp53 in the CheY domain.
3.5.4 An intact PilZ domain of CelA is required for cellulose biosynthesis.
The presence of a PilZ domain on CelA suggests that full activity of the cellulose
synthase depends upon binding c-di-GMP. Altering a conserved serine in the PilZ
domain of other proteins can result in a significant decrease in the binding affinity of the
nucleotide signal (127, 167). Based on these observations, we tested if an intact PilZ
domain of CelA is necessary by comparing levels of cellulose produced by a celA mutant
complemented with either the wild-type gene or celAS594A, an allele with a mutation in
the conserved serine (Figure 3.1, (162)). As expected, the celA::lacZ mutant did not
produce detectable levels of cellulose (Figure 3.5A). Complementing the indel mutant
with wild-type celA expressed from pSRK-Gm restored cellulose production to wild-type
levels (Figure 3.5A), confirming that the celA mutation is not deleteriously polar on celB
and celC. However, expressing the celAS594A allele failed to restore cellulose
production to levels observed in NTL7ΔcelA::lacZ complemented with the wild-type
gene (Figure 3.5A). Further, while overexpressing wild-type celA in NTL7 led to high
levels of cellulose production, overexpressing celAS594A in this strain led to
95
considerably lower levels of the polymer (Figure 3.5A). This result suggests that
celAS594A exerts a modest dominant negative effect on the wild-type gene. Moreover,
these results support a requirement for the PilZ domain of CelA.
In carefully studied systems, the mutation of the serine residue in the PilZ domain
lowers, but does not eliminate, the binding affinity of c-di-GMP (167). It is conceivable,
then, that the effect of the mutant PilZ domain on cellulose synthesis can be compensated
for by overexpressing celR. We tested this possibility by overexpressing celR in
NTL7ΔcelA::lacZ complemented with either wild-type celA or the celAS594A allele.
Overexpressing celR in the celA mutant complemented with wild-type celA resulted in
increased levels of cellulose as compared to the parent strain (Figure 3.5B). Further,
overexpressing celR increased cellulose production in the celA mutant complemented
with celAS594A, although not to the levels of the mutant complemented with wild-type
celA (Figure 3.5B). The results suggest that increasing the concentration of c-di-GMP can
partially compensate for the mutation in the PilZ domain of CelA.
3.5.5 Altering celR expression does not affect transcription of celA. While our
results suggest that the c-di-GMP signal produced by CelR stimulates cellulose synthesis
via the PilZ domain of CelA, it is conceivable that CelR or its nucleotide signal product
induces transcription of the celA gene. To determine if expression of celA is affected by
CelR, we utilized the lacZ transcriptional fusion in NTL7ΔcelA::lacZ. As shown in
Figure 3.5C, the reporter mutant expresses celA at a modest level. Overexpressing celR in
the celA mutant resulted in a two-fold decrease in β-galactosidase activity compared to
the parent strain (Figure 3.5C), while deleting celR in the reporter mutant resulted in
slightly lower levels of β-galactosidase activity as compared to the parent strain (Figure
96
3.5C). These results suggest that celR, expressed at its normal levels, has little or no
direct effect on the transcription of celA.
3.5.6 The response regulator DivK affects production of cellulose through
CelR. In A. tumefaciens, celR is the distal gene in a two-gene operon that begins with
atu1296, a gene generally annotated as divK (Figure 3.1). The product of the well-studied
founder ortholog, divK in Caulobacter crescentus, is required for localizing factors
involved in cell division as well as activation of PleD, the ortholog of CelR (183, 189,
268). Given the operonic structure of divK-celR and the function of divK in other
alphaproteobacteria, these observations suggest the possibility that divK plays a role in
stimulating cellulose synthesis.
We first assessed the role of divK in regulating cellulose production by deleting
the gene, creating NTL7ΔdivK::Km. The mutant accumulated significantly lower
amounts of the polymer as compared to the wild-type, and matched the amount of
cellulose produced by the ΔcelR mutant (Figure 3.6A). This effect on cellulose
production most likely is due to the polar nature of the ΔdivK indel mutation on celR.
When introduced into this mutant at single copy, celR under the control of its native
promoter increased cellulose synthesis appreciably, although not to wild-type levels
(Figure 3.6A). Interestingly, this strain produced levels of cellulose equivalent to the
amounts produced by NTL7ΔcelR::Gm complemented with the D53A allele of celR
(Figure 3.6A), suggesting that DivK plays a role in the pathway for activation of CelR.
Complementing NTL7ΔdivK::Km with a chromosomally-inserted construct containing
both divK and celR (Tn7-prdivKcelR) restored cellulose production to wild-type levels
(Figure 3.6A). This result suggests that it is the absence of celR in the divK-celR deletion
97
mutant that is responsible for most, but not all, of this decrease in levels of cellulose
observed in NTL7ΔdivK::Km.
The influence of DivK suggests that this CheY-like protein, a putative response
regulator (85, 292), is required for CelR-mediated stimulation of cellulose synthesis. If
this is correct, the full effect of celR overexpression should require an expressed copy of
divK. To test this hypothesis, pKK38celR was introduced into NTL7ΔdivK::Km
complemented with either Tn7-prcelR or Tn7-prdivKcelR. Overexpressing celR did lead
to a modest increase in cellulose production in NTL7ΔdivK::Km or in
NTL7ΔdivK::Km/Tn7-prcelR (Figure 3.6B). That increased celR expression failed to
fully compensate for the loss of divK further demonstrates the importance of the CheY
homolog in the signaling pathway. When celR was overexpressed in the divK deletion
mutant complemented with Tn7-prdivKcelR, levels of cellulose accumulation were
significantly higher, exceeding even the levels observed in wild-type NTL7
overexpressing celR (Figure 3.6B).
These results support the involvement of DivK in the signaling pathway that
activates CelR. To test this requirement for DivK, we determined if the constitutively-
active form of celR stimulates cellulose production in the divK mutant. As described
earlier, compared to wild-type celR, overexpression of celRD53E in NTL7 resulted in a
significant increase in cellulose production (Figure 3.4A). While introducing wild-type
celR into NTL7ΔdivK::Km did not restore cellulose production to wild-type levels
(Figure 3.6C), introducing the constitutively-active form of the DGC yielded significantly
higher levels of cellulose in the divK mutant (Figure 3.6C). We conclude from these
98
results that the constitutively-active form of CelR can compensate for the loss of divK,
and from this, that DivK is involved in the pathway for activation of CelR.
3.5.7 The aspartate residues in the CheY domains of both DivK and CelR are
important for cellulose production. The effects of altering the conserved aspartate
residues of divK and celR suggest that the two residues are critical for stimulating
cellulose synthesis. To examine the roles of these two residues, the divKcelR operon was
deleted, and the resulting strain, NTL7ΔdivKcelR, was complemented with wild-type and
mutant alleles of divK and celR using the mini-Tn7 chromosomal insertion system.
Deleting divK and celR resulted in a 5-fold decrease in cellulose production as compared
to the wild-type parent (Figure 3.7A). Complementing the mutant with Tn7-prdivKcelR,
in which both genes are wild-type, restored cellulose production to wild-type levels,
while complementation with either divK or celR alone did not fully restore synthesis of
the polymer (Figure 3.7A). These results are consistent with our complementation
analysis of the divK mutant with either gene (Figure 3.6). Complementing the ΔdivKcelR
mutation with divKD53A or divKD53E resulted in modest increases in levels of cellulose
production (Figure 3.7B), suggesting that the presence of divK has a minor effect on
polymer production. Introducing celRD53A into the ΔdivKcelR mutant also failed to fully
restore cellulose synthesis (Figure 3.7B). On the other hand, complementing the mutation
with celRD53E restored cellulose production to greater than wild-type levels (Figure
3.7B). That constitutively-active CelR can compensate for the loss of the putative
response regulator, while wild-type CelR does not suggests that DivK is necessary for
CelR to fully stimulate cellulose production.
99
To more fully evaluate the role of the aspartate residues of both celR and divK, the
divKcelR operon, with either divK or celR mutated at D53, was reintroduced into the
divK-celR double mutant at unit copy number using the Tn7 system. NTL7ΔdivKcelR
complemented with wild-type divK and celRD53A failed to increase cellulose production
as compared to the parent mutant (Figure 3.8A). However, complementation with wild-
type divK and celRD53E resulted in a 2-fold increase in cellulose synthesis as compared
to levels of the polymer produced by wild-type NTL7 (Figure 3.8A). Complementing the
double mutant with wild-type celR and divKD53A restored cellulose production to wild-
type levels (Figure 3.8A), while complementation with wild-type celR and divKD53E
resulted in cellulose levels 2-fold greater than those observed in NTL7 (Figure 3.8A).
These data indicate that the D53E alleles of both celR and divK stimulate cellulose
production.
The effect of mutating aspartate to glutamate on both DivK and CelR suggests
that altering the residue in both proteins also would increase cellulose production. To test
this hypothesis, the divKcelR deletion mutant was complemented with a mini-Tn7
insertion carrying both genes mutated at Asp53. Insertions with either
divKD53A/celRD53A or divKD53E/celRD53A did not result in significantly higher
levels of cellulose as compared to the parent mutant (Figure 3.8B), suggesting that divK
alone does not stimulate cellulose synthesis. When divKD53A/celRD53E or
divKD53E/celRD53E were inserted into the double mutant, the complemented strains
produced amounts of cellulose comparable to or somewhat greater than amounts
produced by wild-type NTL7 (Figure 3.8B). These results suggest that constitutively-
100
active CelR stimulates cellulose production, regardless of the allelic nature of Asp53 in
divK.
3.5.8 Deleting divK affects cell morphology. In C. crescentus, DivK acts as a
critical checkpoint regulator for cell cycle progression (1, 189). DivK also is involved in
regulating cell division in A. tumefaciens; deleting the gene results in morphologically
abnormal cells (124). We assessed the effect of deleting both divK and celR on cell
morphology by phase-contrast microscopy. As compared to the parent, the ΔdivKcelR
mutant displayed a greater number of cells with morphological defects, including
branched and elongated forms (compare Figures 3.9A and B; Table 3.3). Complementing
the mutation with Tn7-prdivKcelR restored the frequency of abnormal cell morphologies
to that of the wild-type (compare Figures 3.9A and 8C; Table 3.3). As expected from the
report by Kim et al. (124), complementing the double mutant with divK alone lowered
the frequency of the cell morphology defects to wild-type levels (Figure 3.9F; Table 3.3).
Further, the constitutively-active form of divK complemented the defects in
NTL7ΔdivKcelR in the presence or absence of celR (Figures 3.9G and H, Table 3.3).
However, complementing the ΔdivKcelR mutant with only prcelR or prcelRD53E did not
reduce the number of cells exhibiting morphological defects, (Figure 3.9D and E; Table
3.3), suggesting that celR has no effect on processes that control morphology. These
results support the involvement of divK in cell division of A. tumefaciens, but suggest that
celR does not play a role in cell cycle regulation.
3.5.9 CelR forms homodimers but does not interact with DivK. That DivK
contributes to the regulation of cellulose production through CelR suggests that the
CheY-like protein is a component of the pathway for activation of the DGC. Since DivK
101
functions by binding with its targets in other species of alphaproteobacteria (189), it is
possible that the protein interacts directly with CelR. We tested this hypothesis using a
bacterial two-hybrid assay as described in Materials and Methods. In this assay,
interaction between two proteins leads to repression of lacZ, resulting in light blue
colonies when grown on medium containing X-gal. The two-hybrid strain expressing
celR from pSR659 formed light blue colonies in the presence of X-gal, suggesting that
the DGC interacts with itself to generate an active hybrid LexA repressor (Figure 3.10A).
Mutating Asp53 to Ala or Glu had no effect on this reaction (Figure 3.10A), suggesting
that although CelR homodimerizes, this interaction is not dependent on signal-induced
modifications at Asp53. Strains expressing wild-type CelR and DivK on separate
plasmids hydrolyzed X-gal (Figure 3.10B), indicative of a failure of the two proteins to
interact. Mutating Asp53 to alanine or glutamate on both DivK and CelR did not result in
a positive reaction for protein interaction (Figures 3.10B and C).
3.6 Discussion
3.6.1 CelR regulates cellulose synthesis through production of c-di-GMP.
Previously, we reported that the putative diguanylate cyclase CelR is required for
stimulating cellulose production in A. tumefaciens (14). Given that CelR contains both a
CheY-like response receiver domain and a catalytic GGEEF domain (Figure 3.1), we
hypothesized that CelR is a part of a signaling system that controls cellulose synthesis.
Recent biochemical studies showed that CelR likely produces c-di-GMP (294), but did
not link this signal to regulating cellulose synthesis. Our results reported here
demonstrate that CelR requires the catalytic GGEEF motif to stimulate production of the
102
polymer; a mutant modified in this motif failed to complement strains in which celR had
been deleted (Figure 3.4). This observation, coupled with results from Xu et al. (294),
supports our hypothesis that CelR is a bona fide cyclase, and that the cyclic dinucleotide
signal produced by this enzyme influences cellulose synthesis.
3.6.2 CelR requires the conserved aspartate residue in the CheY domain to
stimulate cellulose production. Conservation of an aspartate in the CheY domain of
CelR and its orthologs in other species (Figure 3.11) suggests that the residue is
important for activation of the protein, likely as a target for phosphorylation (220). Our
current results support this hypothesis; mutating aspartate 53 to an alanine abolished
CelR-dependent stimulation of cellulose production either when overexpressed or when
the mutant allele was used to complement a celR deletion mutant (Figure 3.4). A similar
mutation in the conserved aspartate in the CheY domain of PleD of C. crescentus
prevented cells from building the polarly-located holdfast stalk (4, 94, 188).
In the case of PleD of C. crescentus, mutating the conserved aspartate in the
CheY domain to glutamate creates a constitutively-active form of the protein; expressing
the mutant allele results in increased formation of holdfast structures and deformed cells
(4). In other proteins with CheY-related receiver domains, the conversion of the aspartate
residue to glutamate often but not always mimics the activated state (126, 138). These
observations suggest that a similar mutation on celR will result in a constitutively-active
form of the protein. Indeed, either overexpressing celRD53E or complementing the ΔcelR
mutant with the mutant allele resulted in increased amounts of cellulose synthesis as
compared to the deletion mutant expressing wild-type celR (Figure 3.4). Taken together,
103
our analysis of the two Asp53 mutants of CelR suggests that for its activity, the protein
requires activation, likely by phosphorylation of the conserved aspartate residue.
That CelR requires activation, likely by a kinase, suggests that cellulose synthesis
is controlled by some as yet unidentified environmental cue that results in delivery of c-
di-GMP from the DGC to a target further along the pathway. To date, our attempts to
identify the environmental signal that stimulates cellulose production have not been
successful (data not shown). Further work will be needed to identify both the upstream
signal and the kinase that activates CelR.
3.6.3 The PilZ domain of CelA is necessary for cellulose synthesis. Given that
CelR is a bona-fide c-di-GMP synthase, there must be a downstream signal receptor that
is involved in cellulose synthesis. In many organisms, the catalytic subunit of the
cellulose synthase, including CelA of A. tumefaciens, contains a c-di-GMP-binding PilZ
domain (7). Certain residues in PilZ-containing proteins, including a serine within a
DxSxxG motif, are required for binding c-di-GMP (196, 230). CelA in A. tumefaciens
contains this motif, and mutating Ser594 to alanine prevented full complementation of a
celA deletion mutant (Figure 3.5), suggesting that the serine residue within this motif is
required for cellulose synthesis. In in vitro studies of both PlzD of Vibrio cholerae and
Alg44 of P. aeruginosa (167, 196), mutating this serine lowers the binding affinity for c-
di-GMP. One might expect that increasing the levels of the signal could compensate for
the lower affinity of the altered PilZ domain in CelA. Indeed, overexpressing celR
somewhat stimulated cellulose synthesis in the celA deletion mutant complemented with
celAS594A (Figure 3.5), further supporting the role of c-di-GMP in regulating production
of the polymer.
104
We considered the possibility that CelR, in some manner, regulates transcription
of the cel regulon. Based on our assays of a celA::lacZ fusion, expression of the synthase
from its native promoter is relatively low (Figure 3.5). Mutating or overexpressing celR
did not significantly affect the level of celA expression, suggesting that the cyclase does
not affect transcription of the celABC operon. This result further supports our hypothesis
that CelR stimulates cellulose production through activation of CelA via c-di-GMP.
Taken together, our observations are consistent with a pathway in which CelR
produces c-di-GMP, and that this signal stimulates cellulose synthesis by activating
CelA. Biochemical analysis of BcsA in S. typhimurium, a homolog to CelA,
demonstrated that c-di-GMP binding activates cellulose synthesis, and that mutating
critical binding residues in the PilZ domain abolished signal binding and enzymatic
activity (184, 197). According to the current model, signal binding at the PilZ domain of
BcsA allosterically controls cellulose production by triggering conformational changes in
the complex that result in increased enzymatic activity (184, 197). Moreover, because
CelR requires activation to synthesize c-di-GMP, the combined results suggest that any
stimulation of polymer production by CelA requires an upstream signaling cascade.
3.6.4 DivK participates in regulating cellulose synthesis through CelR. The
operonal organization of celR with divK suggests that both genes are involved in
regulating cellulose synthesis. Previous studies demonstrated that DivK of C. crescentus
is a CheY-type response regulator, and is phosphorylated by the hybrid kinase DivJ (136,
189). Our studies of DivK in A. tumefaciens support a role for this putative response
regulator in stimulating production of the polymer through CelR. In a divK deletion
mutant, wild-type CelR failed to fully stimulate cellulose production (Figure 3.6).
105
However, a constitutively-active form of the c-di-GMP synthase compensated for the loss
of the response regulator; expressing celRD53E restored polymer synthesis to the divK
mutant. These results suggest that DivK is important for the Asp53-dependent activation
of CelR and subsequent stimulation of cellulose synthesis.
That DivK is composed of a single CheY-like domain (Figure 3.1) with its
conserved aspartate residue suggests that the protein is activated in a manner similar to
CelR. Indeed, conversion of Asp53 in DivK to alanine prevented full stimulation of
cellulose synthesis (Figure 3.7). On the other hand, complementing the ΔdivK mutant
with the divKD53E allele resulted in higher levels of cellulose as compared to the
deletion mutant complemented with wild-type divK (Figures 3.6 and 3.8). Consistent with
this interpretation, the levels of cellulose produced by the divKD53E mutant were
comparable to the levels observed from strains expressing celRD53E (Figure 3.8B).
These results support the hypothesis that DivK, like many other members of the CheY
family, can be activated, probably by phosphorylation at Asp53, and that this activation is
part of a signaling pathway that results in activating CelR.
In C. crescentus, phosphorylated DivK interacts with its target, the master
response regulator CtrA, resulting in localization of the CtrA-DivK complex to the target
pole of the cell (104, 105, 189). Based on our two-hybrid analyses, DivK does not
directly interact with CelR (Figure 3.9), although our two-hybrid analysis indicates that
CelR likely homodimerizes. This latter result is consistent with our observation that the
celRD53A mutation exerts dominant negativity (Figure 3.3), as well as with
crystallographic and biochemical studies of PleD, the CelR ortholog in C. crescentus (35,
106
188). Interestingly, the DGC activity of PleD requires dimerization (188). Clearly, DivK
must interact with some upstream kinase, and in its phosphorylated form must interact
with some downstream target that affects the phosphorylation state of CelR. While we
have no evidence that DivK directly interacts with CelR, the response regulator may
localize other components of the signal pathway. Further studies of these interactions will
be necessary to determine the mechanism by which DivK participates in the regulation of
cellulose synthesis.
3.6.5 DivK but not CelR functions in pathways for both cellulose synthesis
and cell division. In addition to regulating cellulose synthesis, a recent study by Kim et
al. (124) clearly showed that DivK functions in regulating processes important for cell
division in A. tumefaciens. Our results support this hypothesis; deleting divK resulted in
cell division defects, illustrated by elongated and branched cells (Figure 3.9). In several
alphaproteobacteria, including A. tumefaciens and the related Sinorhizobium meliloti,
divK and its orthologs are linked to both polar localization of cell division proteins (4, 89,
103, 124, 195), and initiation of S-phase through localization and degradation of CtrA
(1). Coupled with our observations that DivK is required for activating CelR, it is clear
that the CheY homolog of A. tumefaciens retains its role in regulating cell division while
also modulating cellulose synthesis.
Such a role for DivK in other alphaproteobacteria is not without precedent. In C.
crescentus, activated DivK stimulates construction of the stalk and holdfast assembly, as
well as initiating cell cycle progression. The response regulator apparently participates in
these two pathways by stimulating the PleC and DivJ hybrid kinases associated with the
107
two systems (1, 189, 268). The activated forms of PleC and DivJ either phosphorylate or
dephosphorylate cell division proteins as well as PleD, which signals the construction of
the stalk (268). Given the relatedness of DivK in A. tumefaciens to its orthologs (Figure
3.12), the effects of mutating divK on cell division in a number of bacteria (4, 89, 103,
124, 195), and the presence of homologs of divK in a large number of the
alphaproteobacteria (26), it is likely that the protein plays a critical role in regulating cell
division in all of the alphaproteobacteria that carry the gene. Further, in C. crescentus,
DivK interfaces stalk production to cell division by activating PleD through stimulation
of the activating kinase, DivJ (189, 268). In this manner, activated DivK not only drives
the cell cycle through S-phase, but also initiates stalk construction concurrently with cell
cycle progression, through a separate signal transduction pathway.
Our results demonstrate that DivK maintains a dual function in A. tumefaciens,
but unlike C. crescentus, it regulates these pathways independently. CelR mutants show
no morphological or developmental defects ((14); Figure 3.9), suggesting that the DGC,
although requiring DivK for activity, does not influence cell division. Furthermore,
expressing divKD53E stimulated cellulose synthesis but did not affect cell morphology.
That the regulatory effects of DivK on production of the polymer are independent from
the controls on cell division suggest that DivK regulates both processes, but does not
necessarily link the two pathways.
While the role of DivK in cell cycle regulation is conserved among many
alphaproteobacteria, its adaption to a secondary regulatory function seems dependent
upon the corresponding DGC in the operon. The observation that CelR has adapted to
108
stimulate cellulose synthesis in A. tumefaciens and R. leguminosarum (11), rather than
regulating polar adhesion (11, 14), suggests that the role of the DGC is based on the
biological system needed by the bacteria. In this manner, the divK-celR(pleD) operon
functions as a system to regulate species-specific processes through established signal
transduction pathways. The dual roles of DivK likely allow some species of
alphaproteobacteria to connect cell division to specific needs, such as attachment or
biofilm formation. DivK may also respond to different signal inputs, resulting in
activation of each pathway based on these cues.
Given the number of processes regulated by c-di-GMP in A. tumefaciens (14,
294), production and distribution of the signal must be tightly controlled to prevent
crosstalk with other systems. The requirement for c-di-GMP binding by CelA resulted in
adapting the transduction pathway containing CelR for regulating production of cellulose.
However, some but not all DGCs can influence cellulose synthesis when overexpressed
(14). Therefore, the interaction of c-di-GMP and CelA must be spatially and temporally
controlled, either through direct interaction of the DGC with the synthase, or by
localization of CelR near the cellulose synthase complex. Further analysis of CelR
localization will help determine how the c-di-GMP signal is targeted to CelA.
109
3.7 Tables and Figures
Table 3.1. Strains and Plasmids used in this studya.
Strain or Plasmid Genotype Reference
E. coli
DH5α supE44ΔlacU169(ϕ80lacZΔM15) hsdR17
recA1 endA1 gyrA96 thi-1 relA1
(219)
S17-1 λpir Pro- Res- Mod+ recA; integrated RP4-
Tcr::Mu-Kan::Tn7, Mob+;Smr λ::pir
(62)
SU101 lexA71::Tn5(Def)sulA211
Δ(lacIPOZYA)169/F’lacIqlacZΔM15::Tn9;
Cmr, Kmr
(66)
SU202 lexA71::Tn5(Def)sulA211
Δ(lacIPOZYA)169/F’lacIqlacZΔM15::Tn9;
Cmr, Kmr
(66)
A. tumefaciens
NTL7 A derivative of NTL4, ΔtetRS, with
pTiC58 re-introduced
(150)
NTL7/Tn7-Km NTL7 with Tn7-Km inserted at the glmS
site
This Study
NTL7/Tn7-prcelR NTL7 with Tn7-Km-prcelR inserted at the
glmS site
This Study
NTL7Δcel NTL7 with celC and celDE deleted, Tcr (14)
110
Table 3.1. (cont.)
NTL7ΔcelA::lacZ NTL7 celA::lacZ, Kmr Shengchang
Su, This
Study
NTL7ΔcelR::Gm NTL7 celR::Gmr (14)
NTL7ΔcelA::lacZ,ΔcelR::Gm NTL7 celA::lacZ celR::Gm, KmrGmr This Study
NTL7ΔcelR::Gm/Tn7-Km NTL7ΔcelR::Gm with Tn7-Km inserted at
the glmS site
This Study
NTL7ΔcelR::Gm/Tn7-prcelR NTL7ΔcelR::Gm with Tn7-Km-prcelR
inserted at the glmS site
(14)
NTL7ΔcelR::Gm/Tn7-
prcelRD53A
NTL7ΔcelR::Gm with Tn7-Km-
prcelRD53A inserted at the glmS site
This Study
NTL7ΔcelR::Gm/Tn7-
prcelRD53E
NTL7ΔcelR::Gm with Tn7-Km-
prcelRD53E inserted at the glmS site
This Study
NTL7ΔdivK::Km NTL7 divK::Kmr This Study
NTL7ΔdivK::Km/Tn7-prcelR NTL7ΔdivK::Km with Tn7-Gm-prcelR
inserted at the glmS site
This Study
NTL7ΔdivK::Km/Tn7-
prdivK
NTL7ΔdivK::Km with Tn7-Gm-prdivK
inserted at the glmS site
This Study
NTL7ΔdivK::Km/Tn7-
prdivKcelR
NTL7ΔdivK::Km with Tn7-Gm-
prdivKcelR inserted at the glmS site
This Study
NTL7ΔdivKcelR NTL7 with divK and celR deleted This Study
111
Table 3.1. (cont.)
NTL7ΔdivKcelR/Tn7-prcelR NTL7ΔdivKcelR with Tn7-Gm-prcelR
inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-prdivK NTL7ΔdivKcelR with Tn7-Gm-prdivK
inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKcelR
NTL7ΔdivKcelR with Tn7-Gm-
prdivKcelR inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prcelRD53A
NTL7ΔdivKcelR with Tn7-Gm-
prcelRD53A inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prcelRD53E
NTL7ΔdivKcelR with Tn7-Gm-
prcelRD53E inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKD53AcelR
NTL7ΔdivKcelR with Tn7-Gm-
prdivKD53AcelR inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKD53EcelR
NTL7ΔdivKcelR with Tn7-Gm-
prdivKD53EcelR inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKcelRD53A
NTL7ΔdivKcelR with Tn7-Gm-
prdivKcelRD53A inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKcelRD53E
NTL7ΔdivKcelR with Tn7-Gm-
prdivKcelRD53E inserted at the glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKD53AcelRD53A
NTL7ΔdivKcelR with Tn7-Gm-
prdivKD53AcelRD53A inserted at the
glmS site
This Study
112
Table 3.1. (cont.)
NTL7ΔdivKcelR/Tn7-
prdivKD53EcelRD53A
NTL7ΔdivKcelR with Tn7-Gm-
prdivKD53EcelRD53A inserted at the
glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKD53AcelRD53E
NTL7ΔdivKcelR with Tn7-Gm-
prdivKD53AcelRD53E inserted at the
glmS site
This Study
NTL7ΔdivKcelR/Tn7-
prdivKD53EcelRD53E
NTL7ΔdivKcelR with Tn7-Gm-
prdivKD53EcelRD53E inserted at the
glmS site
This Study
Plasmid
pUC18 Cloning vector, Apr Invitrogen
pUCcelR celR gene cloned into pUC18 (14)
pUCcelRE373A pUCcelR altered at E373 to an alanine This Study
pUCcelRD53A pUCcelR altered at D53 to an alanine This Study
pUCcelRD53E pUCcelR altered at D53 to a glutamate This Study
pUCcelA celA gene cloned into pUC18 This Study
pUCcelAS594A pUCcelA altered at S594 to an alanine This Study
pUCprdivKcelR pUC18 containing the divKcelR operon
and 400 bp of the promoter region
This Study
pUCprcelR pUC18 containing celR and 400 bp of the
promoter region
(14)
pUCprcelRE373A pUCprcelR altered at E373 to an alanine This Study
113
Table 3.1. (cont.)
pUCprcelRD53A pUCprcelR altered at D53 to an alanine This Study
pUCprcelRD53E pUCprcelR altered at D53 to a glutamate This Study
pUCprdivK pUC18 containing divK and 400 bp of the
promoter region
This Study
pZLQ pBBR1MCS-2 based expression vector,
Kmr
(151)
pZLQcelR celR gene from pUCcelR cloned into
NdeI/BamHI sites of pZLQ
(14)
pZLQcelRE373A celR gene from pUCcelRE373A cloned
into NdeI/BamHI sites of pZLQ
This Study
pZLQcelRD53A celR gene from pUCcelRD53A cloned into
NdeI/BamHI sites of pZLQ
This Study
pZLQcelRD53E celR gene from pUCcelRD53E cloned into
NdeI/BamHI sites of pZLQ
This Study
pUC18mini-Tn7t-Km Tn7 carrier vector containing Km cassette,
Apr, Kmr
(44)
pUC18mini-Tn7t-Gm Tn7 carrier vector containing Gm cassette,
Apr, Gmr
(44)
pTNS2 Tn7 helper plasmid encoding the
TnsABC+D specific transposition
pathway, Apr
(44)
114
Table 3.1. (cont.)
pUCTn7-Km-prcelR prcelR fragment cloned into BamHI site of
pUC18mini-Tn7t-Km
(14)
pUCTn7-Km-prcelRD53A prcelRD53A fragment cloned into BamHI
site of pUC18mini-Tn7t-Km
This Study
pUCTn7-Km-prcelRD53E prcelRD53E fragment cloned into BamHI
site of pUC18mini-Tn7t-Km
This Study
pUCTn7-Km-prcelRE373A prcelRE373A fragment cloned into BamHI
site of pUC18mini-Tn7t-Km
This Study
pUCTn7-Gm-prcelR prcelR fragment cloned into BamHI site of
pUC18mini-Tn7t-Gm
This Study
pUCTn7-Gm-prcelRD53A prcelRD53A fragment cloned into BamHI
site of pUC18mini-Tn7t-Gm
This Study
pUCTn7-Gm-prcelRD53E prcelRD53E fragment cloned into BamHI
site of pUC18mini-Tn7t-Gm
This Study
pUCTn7-prdivKcelR prdivKcelR fragment cloned into BamHI
site of pUC18mini-Tn7t-Gm
This Study
pUCTn7-prdivKD53AcelR prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of divK to an alanine
This Study
pUCTn7-prdivKD53EcelR prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of divK to a glutamate
This Study
pUCTn7-prdivKcelRD53A prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of celR to an alanine
This Study
115
Table 3.1. (cont.)
pUCTn7-prdivKcelRD53E prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of celR to a glutamate
This Study
pUCTn7-
prdivKD53AcelRD53A
prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of divK and celR to an
alanine
This Study
pUCTn7-
prdivKD53AcelRD53E
prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of divK to an alanine
and at D53 of celR to a glutamate
This Study
pUCTn7-
prdivKD53EcelRD53A
prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of divK to a glutamate
and at D53 of celR to an alanine
This Study
pUCTn7-
prdivKD53EcelRD53E
prdivKcelR fragment in pUC18mini-Tn7t-
Gm, altered at D53 of divK and celR to a
glutamate
This Study
pKK38ASH Broad-host-range IncP cloning vector, tac
promoter, Tcr
(145)
pKK38celR celR gene cloned into pKK38ASH at
BamHI site
This Study
pKK38celRD53E celRD53E allele cloned into pKK38ASH
at BamHI site
This Study
pRK415 InP1α broad host range cloning vector, Tcr (115)
116
Table 3.1. (cont.)
pRKdivKregion The divK gene and flanking DNA inserted
into pRK415
This Study
pRKdivKcelRregion The divKcelR operon and flanking DNA
inserted into pRK415
This Study
pRKdivKkan Allellic replacement of divK with a
kanamycin cassette on pRKdivKregion
This Study
pRKdivKcelRkan Allellic replacement of divKcelR with a
kanamycin cassette on
pRKdivKcelRregion
This Study
pRKdivKcelRdel pRKdivKcelRkan with kanamycin cassette
removed by flp recombinase
This Study
pWM91 λpir-dependent cloning vector, AprSucs (170)
pWMdivKkan divKkan fragment cloned into BamHI site
of pWM91
This Study
pWMdivKcelRdel divKcelRdel fragment cloned into BamHI
site of pWM91
This Study
pWMcelRdel celRdel fragment cloned into BamHI site
of pWM91
(14)
pSRK-Gm Broad host range expression vector, ara
promoter, Gmr
(123)
pSRKcelA celA inserted at the NdeI/BamHI sites of
pSRK-Gm
This Study
117
Table 3.1. (cont.)
pSRKcelAS594A S594A allele of celA cloned into pSRK-
Gm at the NdeI/BamHI sites
This Study
pKD46 Lambda Red recombinase helper plasmid,
Apr
(61)
pKD4 Template plasmid of kanamycin cassette
for chromosomal exchange, Apr, Kmr
(61)
pCP20 Temperature-sensitive replicon containing
the FLP recombinase, Apr, Cmr
(40)
pSR658 Expression plasmid for LexA dimerization
system, Tcr
(58)
pSR659 Expression plasmid for LexA dimerization
system, Apr
(58)
pMS604 Expression plasmid carrying a LexA-WT-
Fos fusion positive control for
dimerization, Tcr
(66)
pDP804 Expression plasmid carrying a LexA-Jun
fusion positive control for dimerization,
Apr
(66)
pSR659celR pSR659 with celR cloned at the BamHI
and KpnI sites
This Study
pSR659celRD53A pSR659 with celRD53A cloned at the
BamHI and KpnI sites
This Study
118
Table 3.1. (cont.)
pSR659celRD53E pSR659 with celRD53E cloned at the
BamHI and KpnI sites
This Study
pSR658divK pSR658 with divK cloned at the XhoI and
KpnI sites
This Study
pSR658divKD53A pSR658 with divKD53A cloned at the
XhoI and KpnI sites
This Study
pSR658divKD53E pSR658 with divKD53E cloned at the
XhoI and KpnI sites
This Study
aAbbreviations: Apr, resistance to ampicillin; Cmr, resistance to chloramphenicol; Gm,
resistance to gentamicin; Kmr, resistance to kanamycin; Smr, resistance to streptomycin;
Sucs, sensitivity to sucrose; Tcr, resistance to tetracycline.
119
Table 3.2. PCR primers used.
Primer Name Sequence
celR-f GCGGATCCCATATGACGGCGAGAGTTCT
celR-r CGGATCCTCAGGCCGCGGCGGCCACGACGCG
celA-f GCGGATCCCATATGAACAAGGCCATCACAGTC
celA-r GCGGATCCTCATTTCACGGCTCCGACAGGCTT
divKregion-f GCGAATTCACTAGTGGCCGACACGACTGTATT
divKregion-r GCGAATTCACTAGTCACAGTCTCAGCGGATCG
divKfrt-f TCTGGATGAAGGTTTCAAAGCGAAACGGGGACTGCC
CACCCATATGAATATCCTCCTTAG
divKfrt-r CAACCAGAACTCTCGCCGTCATAACAGTTCCCCAACC
GCCGTGTAGGCTGGAGCTGCTTC
celRfrt-r GAGGAAAGACTGGGGAGACGGGCCAGGGGGGCTTG
GGACGGCCCATATGAATATCCTCCTTA
celRregion-r GGGGTACCGCGCCCTCATCTATGTCATT
prdivKcelR-f GCGGATCCTGGCCGGCATTGCCTTTGTTT
divK-r GCGGATCCTCAATTTGCCTCGCCGAATAC
celR-fncoI GCGGATCCATGGCGGCGAGAGTTCTGG
celR-fBam GCGGATCCATGACGGCGAGAGTTC
celR-rkpn GCGGTACCTCAGGCCGCGGCGGCC
divK-fxho GCCTCGAGATGCCCAAGCAGGTCA
divK-rkpn GCGGTACCTTACGCATCGCCAAGA
celR_D53A-f CATCATTCTGCTCGCTATCATGATGCCGG
120
Table 3.2. (cont.)
celR_D53A-r CCGGCATCATGATAGCGAGCAGAATGATG
celR_E373A-f CCGTTATGGCGGAGAGGCATTCGTCGTCGTCATGC
celR_E373A-r GCATGACGACGACGAATGCCTCTCCGCCATAACGG
celR_D53E-f CATCATTCTGCTCGAAATCATGATGCCGG
celR_D53E-r CCGGCATCATGATTTCGAGCAGAATGATG
celA_S594A-f ATCGACAACGTGGCGGTGCACGGCC
celA_S594A-r GGCCGTGCACCGCCACGTTGTCGAT
divK_D53A-f TCATCCTCATGGCTATCCAGCTGCC
divK_D53A-r GGCAGCTGGATAGCCATGAGGATGA
divK_D53E-f CATCCTCATGGAAATCCAGCTGCCG
divK_D53E-r CGGCAGCTGGATTACCATGAGGATG
celA/Eco GGAATTCGCGAAAACGAGATGT
celA/Xb GCTCTAGACATCATCAGATTCACGAG
Tn7insert-L GAATTAAGCGTTGTCGCCAT
pTn7-L ATTAGCTTACGACGCTACACCC
121
Table 3.3. The loss of divK results in increased frequency of branched and
misshapen cells.
Strain Complementing Tn7
Insertion
Total Cell
Count
Total
Misshapen Cells
Percent
Misshapen
NTL7 None 962 5 0.52%
NTL7ΔdivKcelR None 736 29 3.91%*
NTL7ΔdivKcelR prdivKcelR 1057 9 0.87%
NTL7ΔdivKcelR prcelR 631 17 2.63%*
NTL7ΔdivKcelR prcelRD53E 799 21 2.62%*
NTL7ΔdivKcelR prdivK 938 7 0.74%
NTL7ΔdivKcelR prdivKD53E 789 6 0.78%
NTL7ΔdivKcelR prdivKD53EcelR 764 5 0.69%
*Denotes significant difference from NTL7, p < 0.05.
122
Figure 3.1. The divK and celR genes are organized in an operon on the circular
chromosome. Organization of the divKcelR operon of A. tumefaciens C58. The protein
products of divK and celR both contain conserved aspartate residues at position 53 within
a CheY-like receiver domain. CelR contains the GGEEF motif at residues 369-374. CelA
contains the conserved serine at 594 in the PilZ domain.
123
Figure 3.2. Overexpressing mutant alleles of celR does not induce Congo red binding
and aggregation on solid and liquid media. Strain NTL7 and its constructs expressing
genes coding for altered alleles of celR were grown for two days at 28ºC A) on ABM
plates containing Congo red, and B) in MG/L, with shaking. Both media contained the
appropriate antibiotics.
124
Figure 3.3. Mutant alleles of celR do not stimulate production of cellulose. Strains
NTL7, NTL7Δcel and NTL7ΔcelR:Gm and their constructs A) overexpressing alleles of
celR or B) expressing alleles introduced by Tn7 insertion were grown in MG/L with the
appropriate antibiotics for two days at 28ºC with shaking. The cells were harvested and
assessed for production of anthrone-reacting material as described in Materials and
Methods. The values represent the average of the four samples of each strain, and the
error bars represent the standard error of the experiments.
125
Figure 3.4. Mutating Asp53 of celR to glutamate increases production of cellulose.
Strains NTL7, NTL7Δcel or NTL7ΔcelR:Gm either A) overexpressing celRD53E or B)
expressing celRD53E from Tn7 insertions were grown in MG/L with the appropriate
antibiotics for two days at 28ºC with shaking. The cells were harvested and assessed for
production of cellulose as described in Materials and Methods. The values represent the
average of the four samples of each strain, and the error bars represent the standard error
of the experiments.
126
Figure 3.5.
127
Figure 3.5. (cont.)
Figure 3.5. The cellulose synthase subunit CelA requires an intact PilZ domain to
fully promote cellulose production. A) Alleles of celA expressed on pSRK-Gm were
introduced into strains NTL7 and NTL7ΔcelA::lacZ and the constructs were examined for
cellulose production as described in Materials and Methods. The values represent the
average of the four samples of each strain, and the error bars represent the standard error
of the experiments. B) The wild-type celR gene was overexpressed in either NTL7 or
NTL7ΔcelA::lacZ containing alleles of celA, and assessed for production of cellulose as
described in Materials and Methods. The values represent the average of four
experiments with the error bars representing the standard error of the experiments. C)
Strains of NTL7 and NTL7ΔcelA::lacZ were grown in MG/L containing the appropriate
antibiotics overnight. The cells were harvested and examined for β-galactosidase activity
all as described in Materials and Methods. Each experiment was repeated nine times, and
error bars represent the standard error of the experiments.
128
Figure 3.6.
129
Figure 3.6. (cont.)
Figure 3.6. DivK is required for full stimulation of cellulose production by CelR. A)
Strains with mutations in divK and celR were examined for cellulose production as
described in the Materials and Methods. Each experiment was repeated four times. The
values represent the average of the four samples of each strain, and the error bars
represent the standard error of the experiments. B) The celR gene was overexpressed in
NTL7, NTL7ΔcelA::lacZ or NTL7ΔdivK::Km and the constructs were assessed for
production of cellulose as described in Materials and Methods. Each experiment was
repeated four times. The values represent the average of the four samples of each strain,
and the error bars represent the standard error of the experiments. C) Either celR or
celRD53E was introduced into NTL7 and NTL7ΔdivK::Km by Tn7 insertion, and the
constructs were examined for cellulose production as described in Materials and
Methods. The experiments were repeated four times. The values represent the average of
four samples of each strain, and the error bars represent the standard error of the
experiments.
130
Figure 3.7.
131
Figure 3.7. (cont.)
Figure 3.7. Stimulation of cellulose synthesis requires both celR and divK. Strain
NTL7ΔdivKcelR was complemented by Tn7 insertion with A) wild-type divK, celR or
divKcelR, and B) alleles of divK or celR altered at Asp53. Strains were assessed for
production of cellulose as described in Materials and Methods. The values represent the
average of four samples of each strain, and the error bars represent the standard error of
the experiments.
132
Figure 3.8.
133
Figure 3.8. (cont.)
Figure 3.8. An aspartate at position 53 in both DivK and CelR is necessary for
stimulating cellulose production. Strain NTL7ΔdivKcelR was complemented by Tn7
insertion with prdivKcelR containing A) an altered form of divK or celR at Asp53 to
either alanine or glutamate, or B) with both divK and celR mutated at Asp53 to either
alanine or glutamate. The cells were grown, harvested and assessed for production of
cellulose as described in Materials and Methods. The values represent the average of four
samples of each strain, and the error bars represent the standard error of the experiments.
134
Figure 3.9.
135
Figure 3.9. (cont.)
Figure 3.9. Deleting divK affects cell morphology. Cultures of NTL7 and its derivatives
were grown in MG/L, and samples were viewed by phase-contrast microscopy as
described in Materials and Methods. A) NTL7. B) NTL7ΔdivKcelR. C)
NTL7ΔdivKcelR/Tn7-prdivKcelR. D) NTL7ΔdivKcelR/Tn7-prcelR. E)
NTL7ΔdivKcelR/Tn7-prcelRD53E. F) NTL7ΔdivKcelR/Tn7-prdivK. G)
NTL7ΔdivKcelR/Tn7-prdivKD53E. H) NTL7ΔdivKcelR/Tn7-prdivKD53EcelR. Scale
bars represent 10 µm. Arrows mark branched or elongated cells.
136
Figure 3.10. CelR forms homodimers, but does not interact with DivK. A) Reporter
strain SU101 with positive (pDP804) and negative controls (pSR659) and with two-
hybrid expression vectors containing alleles of celR. B) Reporter strain SU202 containing
positive (pDP804/pMS604) and negative controls (pSR658/pSR659) and two-hybrid
expression vectors with wild-type divK and altered alleles of celR, or celR and altered
alleles of divK. C) Reporter strain SU202 containing positive (pDP804/pMS604) and
negative controls (pSR658/pSR659) and two-hybrid expression vectors with altered
alleles of divK and celR. All strains were grown on LB agar plates containing the
appropriate antibiotics, IPTG and X-gal overnight at 28ºC.
137
Figure 3.11. Amino acid sequence alignment of CelR of A. tumefaciens, CelR2 of R.
leguminosarum and PleD of C. crescentus. The catalytic GGEEF motif is boxed, and
the conserved aspartate residue and the altered glutamate in the GGEEF motif are marked
with arrows. Identical residues between the three genes are purple, conserved residues
between two genes are blue, similar residues are in red, and non-conserved residues are in
white. The Textbox graphic was produced from the ClustalW multiple sequence
alignment routine of SDSC Biology Workbench (SDSC).
138
Figure 3.12. Amino acid sequence alignment of DivK of A. tumefaciens, CelR1 of R.
leguminosarum and DivK of C. crescentus. The conserved aspartate residue is marked
with an arrow. Identical residues between the three genes are purple, conserved residues
between two genes are blue, similar residues are in red, and non-conserved residues are in
white. The Textbox graphic was produced from the ClustalW multiple sequence
alignment routine of SDSC Biology Workbench (SDSC).
139
Chapter 4
AvmA, a homolog of the cyclic-di-GMP synthase CelR, modulates unipolar
polysaccharide production and virulence in Agrobacterium tumefaciens through
different mechanisms
4.1 Notes and Acknowledgements
Some of the information provided in this chapter is incorporated into U.S. Patent,
US 8,581,045 B2, entitled “HYPERVIRULENT MUTANT OF AGROBACTERIUM
TUMEFACIENS”, issued November 12, 2013 to inventors D. M. Barnhart and S. K.
Farrand.
Additionally, I would like to thank Dr. Lois Banta for contributing to the SEM
and qPCR data provided in this chapter, as well as to Dr. Xavier Nesme for his analysis
of biovar 1 genomovars for this project.
4.2 Summary
Agrobacterium tumefaciens must attach to plant tissue to establish microcolonies
and biofilms, as well as to initiate tumorigenesis. This process is likely mediated by
several mechanisms, including the formation of a unipolar polysaccharide, or UPP.
Recent studies suggest that the intracellular signal c-di-GMP regulates production of this
polar structure. Here, we provide evidence that one diguanylate cyclase, AvmA, not only
is an active enzyme that synthesizes c-di-GMP, but is directly involved in regulating
production of the UPP. Mutants of avmA display increased UPP synthesis and polar
attachment to surfaces, suggesting that the product of this gene negatively influences
140
production of the structure. Deleting the gene also results in reduced biofilm formation,
while increasing individual cell attachment. These observations suggest that the DGC
influences establishment of microcolonies after the bacteria associate with a surface.
While overexpressing avmA strongly attenuated virulence, deleting the gene significantly
lowered the number of bacteria necessary to initiate crown gall tumors. Interestingly, this
effect on tumorigenesis did not require the GGEEF and CheY motifs, suggesting that
although AvmA appears to negatively modulate tumorigenesis, the enzyme does not
affect virulence through synthesis of c-di-GMP.
4.3 Introduction
Attachment to surfaces is critical for the survival and growth of many pathogenic
bacteria. Agrobacterium tumefaciens, the causative agent of crown gall disease in plants,
must attach in order to initiate infection (147, 148), a process that involves transfer of
DNA and proteins from the bacteria directly to the plant host (47, 77). Interaction with
the plant is likely through a two-step process, beginning with a reversible interaction
between the bacteria and the surface, followed by a tighter, irreversible binding (156,
163).
Recently, an attachment structure named the unipolar polysaccharide (UPP) was
identified as a potential component for anchoring cells of A. tumefaciens to plant tissue
(267). This glucomannan-based adhesin is typically located at one pole of the cell (267),
that associates with the attached surface (143). The UPP is similar to attachment
structures seen in other alphaproteobacteria, including the holdfast adhesive located at the
end of the stalk of Caulobacter crescentus (168), and a polar adhesion structure found in
141
Rhizobium leguminosarum (10, 139). The presence of these polar anchoring structures in
a number of alphaproteobacteria suggests a common theme of polar attachment within
this family.
Attachment to surfaces by bacteria is often tightly controlled to allow ordered
transitions between motile and sessile forms of the cell, and studies of the UPP in A.
tumefaciens suggest that production of this structure is also regulated. Formation of UPP
apparently is triggered by physical contact of the cell with a surface, thereby anchoring
the cell in a polar orientation (143). In addition, synthesis of the UPP responds to levels
of the small intracellular signal molecule cyclic di-guanosine monophosphate (c-di-GMP)
(14, 294). This molecule is synthesized by a class of enzymes, called diguanylate
cyclases (DGC), identified by a conserved GG(D/E)EF motif within the catalytic domain
(106, 206). Cyclic-di-GMP is utilized by bacteria for regulating a number of cellular
processes, one being the conversion from motile to sessile cells (106, 205, 206). In A.
tumefaciens, Xu et al. (294) identified three DGCs, encoded by atu1257, atu1691, and
atu2179, that affect UPP formation and subsequent attachment.
In this study, we identify another DGC encoded by atu1060 that influences UPP
production, biofilm formation, attachment to plant surfaces and virulence of A.
tumefaciens. Based on the effects of this gene, we renamed the ORF as attachment and
virulence modulator A, or AvmA. Deleting avmA increases lectin binding and surface
attachment, suggesting that the DGC negatively regulates UPP formation and attachment.
Furthermore, deleting avmA lowers the effective number of cells necessary to induce
tumors, suggesting that this DGC is involved in regulating some event involved in
virulence. The phenotypes associated with deleting avmA on attachment, UPP production
142
and virulence suggest that this protein may interface initial attachment of the bacteria to
plant tissue with later events specific to virulence.
4.4 Materials and Methods
4.4.1 Strains, cultures and growth conditions. The strains used in this study are
listed in Table 4.1. Strains of Escherichia coli were grown on LB agar plates with
appropriate antibiotics at 37°C. Strains of A. tumefaciens were maintained on NA or
ABM (41) plates with appropriate antibiotics at 28°C. Cultures of E. coli were grown in
LB broth with the corresponding antibiotics at 37°C with shaking. Cultures of A.
tumefaciens were grown in MG/L (31) minimal medium with appropriate antibiotics at
28°C with shaking. For some experiments, cultures of A. tumefaciens were grown in AB
minimal medium-based vir induction medium (ABVIM) (31) supplemented with 0.2%
glucose and 200 µg/ml acetosyringone. Antibiotics used include ampicillin (100 µg/ml
for E. coli), carbenicillin (50 µg/ml for A. tumefaciens), kanamycin (50 µg/ml for E. coli
and A. tumefaciens), gentamicin (50 µg/ml for E. coli, 25 µg/ml for A. tumefaciens), and
tetracycline (10 µg/ml for E. coli and A. tumefaciens). When necessary, Congo red (50
µg/ml) was added to ABM plates for assessing production of exopolysaccharides (302).
4.4.2 Strain construction. The deletion mutant NTL7ΔavmA::Km was
constructed as described (14).
Complementation of NTL7ΔavmA::Km: A 2.2 kb fragment containing both the
promoter and open reading frame (atu1060) of avmA was amplified using Pfu DNA
polymerase and the primers pravmA-f (5′-
GCGGTACCCAAAACCGCCTGAAAACATT-3′) and avmA-r (5′-
143
CGGATCCTCAGCCGTTCAGCCCGAT-3′). The PCR product was digested with
BamHI and KpnI, and cloned into pUC18. After introduction into DH5α, potential
constructs were purified and confirmed by restriction analysis. The correct clone was
digested with BamHI and KpnI, and the fragment was inserted into pUC18-miniTn7t-Gm
to form pUCTn7t-pravmA. The new construct, as well as the transposase plasmid pTNS2,
were co-electroporated into NTL7ΔavmA::Km (Table 4.1), with selection for resistance
to kanamycin and gentamicin. Potential mini-Tn7 integrants were confirmed by PCR
analysis.
Site-directed mutagenesis of avmA. Single nucleotide substitutions in avmA were
introduced by a PCR-based site-directed mutagenesis protocol (15) using pUCavmA and
pUCTn7-Gm-pravmA as the target plasmids. To alter the aspartate residue at position 59
to an alanine, the adenosine at position 158 was changed to a cytosine using the primers
avmA_D59A-f (5′-TCAACCTGCCCGCTGCGCCCAAGGG-3′) and avmA_D59A-r (5′-
CCCTTGGGCGCAGCGGGCAGGTTGA-3′). The second glutamate residue in the
GGEEF motif, located at position 338 of the amino acid sequence, was also converted to
an alanine by exchanging the adenosine located at position 1118 to a cytosine using the
primers avmA_E338A-f (5′-TCGGCGGTGAGGCATTTGCCGTGTT-3′) and
avmA_E338A-r (5′-AACACGGCAAATGCCTCACCGCCGA-3′). The resulting
amplified plasmids were digested with DpnI and transformed into DH5α (219). After
selecting for resistance to the appropriate antibiotic, the plasmids were isolated and the
mutations were confirmed by sequence analysis. The altered alleles were recloned into
pZLQ and were introduced into the appropriate strains by electroporation. Alleles
144
constructed in the mini-Tn7 vector were introduced into the bacterial chromosome by
transposition (15).
4.4.3 Microscopy and lectin-binding assays. Cells, grown in liquid culture for
two days at 28°C, were collected by centrifugation at 4000x g for five minutes before
resuspending in 0.9% NaCl to a final OD600 of 0.4. For lectin staining, the resuspended
cells were incubated with 100 µg per ml of Alexafluor633-WGA (Thermo Scientific) for
15 minutes, and washed three times with 0.9% NaCl by centrifugation. Cells were
visualized by differential interference contrast (DIC) microscopy at the Microscopy and
Imaging Facility, Institute for Genomic Biology (University of Illinois) using a Zeiss
AxiovertTM 200M microscope equipped with an Apotome Structured Illumination Optical
Sectioning System set at 63x/1.40 objective magnification, and images were captured
using a Zeiss MRc 5 camera. Where cells were treated with lectin, samples were excited
at 633 nm and observed for fluorescence at 647 nm. Images were compiled and analyzed
using Zeiss AxiovisionTM software. For statistical analysis, four images containing cells
were compiled, and the number of bacteria in each image, and their arrangement and
lectin labeling were counted, with statistical analysis performed using the Chi-squared
test.
4.4.4 Microscopic analysis of bacterial attachment to Arabidopsis surfaces.
Scanning Electron Microscopy (SEM), performed in the laboratory of Dr. Lois Banta
(Williams College, MA), was used to assess attachment of the bacteria to plant tissue.
Seeds of Arabidopsis thaliana ecotype Columbia (Col-0) were surface-sterilized with a
solution of 50% bleach/0.1% SDS, and sown onto solid Gamborg’s B5 medium
containing 100 µg/ml tricarcillin (Research Products International). Seeds were incubated
145
for two days at 4°C, and then germinated and grown at room temperature for sixteen
days. Strains were grown in MG/L medium with appropriate antibiotics at 28°C
overnight. The cells were subcultured into ABVIM containing either 100 or 200 µM
acetosyringone and grown on a rotary shaker at 22°C to mid-exponential phase (OD600 ≈
0.5). Sterile forceps were used to wound leaves excised from seedlings before co-
cultivating with bacterial cells for two days at 21°C. Co-cultivated leaf pieces were
rinsed three times in ABVIM with gentle vortexing to remove any unattached bacteria.
Samples were fixed in 3% glutaraldehyde (in 0.1 M HEPES; pH 7.1) for three days, then
rinsed three times in 0.1 M HEPES (pH 7.1) before postfixing in 1% OsO4 for one to two
hours. Samples were subsequently rinsed with distilled H2O, sequentially dehydrated in
70, 80, 90 and 100% ethanol, and immediately dried in a Ladd critical-point drying
apparatus under CO2. Samples were loaded on aluminum specimen holders, sputter-
coated with gold-palladium using a Polaron SEM autocoating unit, and viewed on a FEI
Quanta 400 Series scanning electron microscope. Three to five leaves were examined for
each bacterial strain per assay, and several representative images per leaf were captured
for analysis. Analysis of the SEM samples was performed “blind” (i.e. without knowing
the identity of the sample) to ensure a lack of observer bias. For statistical analysis, the
number of bacterial cells in each image and the number that were attached in a polar
orientation were counted. The data were analyzed for statistical significance using the
Student t-test.
4.4.5 Biofilm assays. Cells were grown overnight at 28°C with appropriate
antibiotics in borosilicate glass tubes under shaking conditions, then diluted 1/1000 into 2
ml of MG/L with antibiotics. The diluted samples were incubated in borosilicate tubes for
146
five days at room temperature without shaking. After incubation, 1 ml of 0.1% crystal
violet was added to each sample and the tubes were allowed to sit at room temperature
for fifteen minutes. The liquid phase of the culture was carefully decanted, and the
stained tubes were gently washed three times with 2 ml ddH2O. The remaining crystal
violet stain was solubilized using 1 ml of ice-cold ethanol, and the absorbance of the
ethanolic samples was measured at 540 nm using a BioRad SmartSpecTM Plus
spectrophotometer. Values were compared to the average absorbance of crystal violet
solutions prepared from similarly grown cultures of wild-type strain NTL7 included as a
positive control.
4.4.6 Virulence assays. Bacteria were grown for two days at 28°C, collected by
centrifugation, and resuspended in 1 ml of 0.9% NaCl. The population sizes of the
resuspended cells were standardized to an OD600 of 1.0, and the suspensions were diluted
to ratios of 1:10, 1:100, 1:1000, 1:10,000 and 1:100,000. Twenty mm-long wounds were
produced between the primary leaves and the first set of secondary leaves on stems of
Solanum lycopersicum (tomato). Two-µl volumes of cell suspensions at each dilution
were inoculated into the wound sites, and the plants were incubated in the greenhouse for
three to five weeks, depending on day length and plant growth rates. Each dilution of
each strain was tested on four plants. Total tumor mass was determined by excising a
segment of the stem, cutting above and below the wound site. The stem pieces were
weighed individually, and the tumor mass was removed by cutting with a cork borer and
weighed. The tumor mass was averaged between the four plants. The experiments were
repeated at least three times, and the total average of the samples, as well as standard
147
error, were calculated from these experiments. Statistical analysis was performed using
the Student t-test using a one-sided distribution model.
4.4.7 Expression analysis of virB4 by qPCR. Expression of the virB operon was
assessed by quantitative PCR in the laboratory of Dr. Lois Banta as follows. Bacterial
cultures were grown in ABVIM for from six to 18 hours at 28ºC with shaking. Total
RNA was isolated (Qiagen), reverse transcribed into cDNA, and amplified by qPCR
using primers specific for virB4 or the A. tumefaciens housekeeping gene, purA, as a
control. The fold change in virB4 expression was determine by comparing the difference
in cycle threshold (Ct) values of the gene to values obtained for purA. Each experiment
was performed in triplicate, each experiment was repeated four times, and the average of
the experiments with standard error was calculated.
4.5 Results
4.5.1 AvmA affects aggregation and interaction of A. tumefaciens with
surfaces. Previously, we reported that overexpressing celR results in increased cellulose
synthesis and lectin binding, while decreasing biofilm formation and virulence (14).
Further analysis demonstrated that CelR is a positive regulator of cellulose production,
but this DGC does not regulate lectin binding or virulence (14, 15). Overexpressing a
related DGC encoded by atu1060, which we rename avmA, also resulted in increased
cellulose synthesis, but does not directly regulate production of the polymer (14). These
observations prompted a more thorough analysis of the role of avmA in phenomenon that
involve attachment.
148
Our previous results indicate that when overproduced, AvmA can crosstalk with
CelR to stimulate cellulose synthesis (14), suggesting that when overexpressed both
DGCs can influence the same systems. Since deleting celR does not affect polar
attachment to surfaces or lectin binding, AvmA instead may directly influence UPP
production and adhesion to surfaces. To assess the effects of overexpressing and deleting
avmA on individual bacteria, we examined cells of NTL7 altered in expression of the
gene using DIC microscopy. Wild-type NTL7 grew in liquid as dispersed individual
bacteria (Figure 4.1A). When wet mounts were prepared for microscopy, some cells
interact with the slide, binding in both polar and lateral orientations (Figure 4.1A).
Overexpressing avmA resulted in dense masses of cells unassociated with the glass
surface, as compared to the wild-type NTL7 (Figures 4.1A and B). The clumping
decreased when avmA was overexpressed in NTL7Δcel (Figures 4.1C and D),
demonstrating that increased synthesis of cellulose is responsible for the massive
aggregation. Deleting avmA did not affect cellulose-based aggregation as compared to
wild-type NTL7 (Figures 4.1A and F). Interestingly, as compared to its parent, a
significantly greater number of cells of the avmA mutant were attached to the glass
microscopic slide in a polar orientation (Figure 4.1F; Table 4.2). This increase in polar
attachment exhibited by the mutant suggests that avmA is affecting how the bacteria
interact with surfaces.
Among cells not associated with masses, both NTL7 and NTL7Δcel
overexpressing avmA formed rosettes, with three to five cells interacting with each other
at the poles of the bacteria (Figures 4.1D and E; Table 4.2). Neither wild-type NTL7 nor
the cel- mutant formed detectable numbers of rosettes (Table 4.2), indicating that
149
overexpressing avmA stimulates formation of these arrangements, regardless of cellulose
synthesis. The avmA deletion mutant displayed a slight but statistically insignificant
change in the frequency of rosetting as compared to the wild-type parent (Table 4.2).
These observations suggest that overexpressing avmA increases rosetting by the bacteria.
CelR, a close homolog to AvmA, requires the conserved GGEEF motif and the
conserved aspartate in the CheY-like receiver domain to regulate cellulose synthesis (15).
To determine if AvmA is a bona fide c-di-GMP synthase, we utilized cellulose-based
aggregation as a measurement of activity of mutants of the DGC altered at the aspartate
residue (avmAD59A) or at a key residue of the GGEEF motif (avmAE338A). In cultures
grown in MG/L, overexpressing avmAE338A in NTL7 did not increase aggregation to
levels comparable to overexpressing wild-type avmA in NTL7 (Figures 4.1B and G).
There was some aggregation when avmAD59A was overexpressed in NTL7, as compared
to the parent (Figures 4.1A and H), but much less than we observed for NTL7
overexpressing the wild-type gene (Figures 4.1B and H). These observations suggest that
like CelR, AvmA synthesizes c-di-GMP, and requires the conserved aspartate residue in
the CheY domain for maximum activity.
4.5.2 Modification of avmA expression results in increased polar lectin
binding. Previously, we considered the possibility that CelR regulates other mechanisms
of attachment beyond cellulose synthesis. However, deleting celR had no effect on lectin
binding (14), a marker for UPP formation. This result suggests that another DGC is
involved in stimulating formation of the polar structure. Xu et al. (294) demonstrated that
three other putative DGCs stimulate formation of the UPP, suggesting that multiple
enzymes regulate polar attachment of the bacteria. Given that deleting avmA results in
150
increased polar attachment to glass slides, we considered the possibility that avmA also
regulates UPP production in A. tumefaciens.
We examined the effects of overexpressing or deleting avmA on UPP production
by incubating strains with fluorescently-labeled WGA. Individual cells of NTL7 and
NTL7Δcel overexpressing avmA showed increased binding of labeled lectin, as compared
to the wild-type parents (Figures 4.2A-D; Table 4.2). Interestingly, a significant number
of rosetting cells overexpressing avmA bound the WGA label at the junction of where the
poles of the cells interact (Table 4.2). These results suggest that UPP is responsible for
rosetting, and that overexpressing avmA affects rosette formation through increased UPP
production. Deleting avmA from NTL7 also resulted in increased WGA binding, as
compared to the parent (Figures 4.2A, 4.2E and 4.2F; Table 4.2). These observations
demonstrate that avmA participates in regulating UPP formation, which may affect polar
attachment to surfaces and to other bacteria.
4.5.3 Modifying expression of avmA significantly impacts biofilm formation
on borosilicate glass. That avmA appears to regulate attachment in A. tumefaciens
opened the possibility that it may influence biofilm formation. To determine if the gene
modulates establishment of biofilms, cultures were grown in MG/L medium in
borosilicate glass tubes and adherent cells were stained with crystal violet as described in
Materials and Methods. Strains NTL7 and NTL7Δcel displayed similar levels of staining,
forming rings of biofilm at the meniscus of the media (Figure 4.3). These results indicate
that under the conditions tested cellulose does not contribute detectibly to biofilm
formation on glass surfaces, in agreement with our previous findings (14).
Overexpressing avmA in NTL7 resulted in less staining as compared to its parent, while
151
overexpressing the gene in the cel- background did not affect staining (Figure 4.3). These
results indicate that increased expression of avmA negatively affected biofilm formation,
probably by stimulating cellulose synthesis. The deletion mutant NTL7ΔavmA exhibited
significantly decreased levels of crystal violet staining at the meniscus as compared to
wild-type (Figure 4.3). However, unlike its wild-type parent, the deletion mutant formed
a thin film of cells bound to the glass tube (data not shown), suggesting increased
individual cell attachment. This effect indicates that avmA is required for successful
biofilm establishment on glass and negatively regulates attachment of individual cells to
surfaces.
4.5.4 AvmA suppresses polar attachment of bacteria to leaf tissue. The effects
of avmA on UPP formation suggest that the gene negatively regulates binding of cells to
surfaces. To determine if the effects of the DGC also impact attachment of the bacteria to
plant tissue, we submitted samples to Lois Banta (Williams College, MA) to examine
interactions of the cells with leaf explants of Arabidopsis thaliana by SEM. In
comparison to NTL7, fewer cells of the avmA mutant were attached to the plant tissue
(Figures 4.4A and B). Additionally, as compared to the wild-type parent, a greater
fraction of cells of the avmA mutant were attached in a polar orientation (Figure 4.4B).
These results, which are consistent with our microscopy observations described above,
show that deleting avmA has both qualitative and quantitative effects on attachment of the
bacteria to plant cell surfaces.
4.5.5 Modifying avmA expression and structure significantly impacts
virulence of A. tumefaciens. Strains NTL7 or NTL7Δcel overexpressing avmA are
severely attenuated for virulence (14). Because the ΔcelR mutant is fully virulent (14), it
152
is possible that AvmA directly impacts tumorigenesis. Plants infected with the avmA
mutant produced significantly larger tumors compared to those infected with NTL7, the
wild-type parent (Figure 4.5A). As assessed quantitatively, the deletion mutant induced
tumors at populations 10-fold lower than wild-type (Figure 4.5A), suggesting that
deleting the gene lowers the number of cells needed to initiate tumorigenesis. To confirm
that avmA, and not a random mutation, affects virulence, the wild-type gene under control
of its native promoter was reintroduced into the mutant by Tn7 insertion. Complementing
the mutant with avmA restored the dose dependence for tumor induction to wild-type
levels (Figure 4.5A).
Given its domain structure, we considered the possibility that AvmA affects
virulence by synthesizing c-di-GMP in response to some signal. To assess this, the two
mutant alleles altered in the GGEEF or the CheY-like domain, under control of their
native promoters, were tested for their ability to complement the ΔavmA mutant.
Interestingly, both Tn7-pravmAD59A and Tn7-pravmAE338A restored dose-dependent
virulence of the mutant to wild-type levels (Figure 4.5A). These observations suggest that
AvmA does not affect virulence through c-di-GMP synthesis, and does not require
activation through its CheY domain. However, while overexpressing wild-type avmA
significantly attenuated virulence (Figure 4.5B; (14)), overexpressing either mutant allele
in NTL7 failed to influence tumor induction as compared to the wild-type parent lacking
the overexpression plasmid (Figure 4.5B). These results indicate that the overexpression
phenotype of avmA on virulence is due to c-di-GMP production, and suggest that the
DGC is crosstalking with another DGC, although likely not CelR.
153
4.5.6 Modifying avmA expression affects transcription of virB4. While our
results suggest that AvmA affects virulence, the mechanism by which it does so is
unknown. One possibility is that the product of the gene affects transcription of
components of the vir regulon. To determine if expression of the vir operons is affected
by AvmA, Lois Banta’s group at Williams College examined the transcript levels of
virB4, a gene within the virB operon of the regulon, in strains modified for expression of
avmA. In strain NTL7, virB4 was induced to increasingly higher levels after six and
eighteen hours of induction in VIM supplemented with acetosyringone (Figure 4.6). The
cel- mutant exhibited a slight decrease in expression as compared to the wild-type parent
(Figure 4.6), suggesting that failure to produce cellulose modestly affects induction of the
virB operon. Overexpressing avmA in NTL7Δcel significantly lowered transcription of
virB4, with no increase in expression even after eighteen hours as compared to NTL7 or
the cel- parent (Figure 4.6). Interestingly, deleting avmA in NTL7 slightly lowered
expression of virB4 as compared to the wild-type, and to levels comparable to the cel
mutant (Figure 4.6). Based on these observations, AvmA in its wild-type state likely does
not affect tumor induction through regulation of transcription of the virB operon.
4.5.7 avmA is found only in biovar 1 agrobacteria. Given its roles in attachment
and virulence, we examined the phylogenetic distribution of avmA in the family
Rhizobiaceae. A BLAST search showed the gene to be present in only a subset of the
available Agrobacterium genomes (NBCI). Strains with the gene all fell in the biovar 1
group, with some of the orthologs annotated as pleD (NBCI). Dr. Xavier Nesme, Lyon,
France, has determined the complete genome sequence of one or more representatives of
all nine genomovars of the biovar 1 group. His analysis showed that all members harbor
154
highly related orthologs of avmA, and that the gene occupies the same syntenic location
in all of these genomovars (Fig 4.7). Further, all of the other rhizobia examined have
genes less related to avmA, and are likely orthologs of celR. We conclude from these
analyses that avmA is unique to the biovar 1 agrobacteria.
4.6 Discussion
4.6.1 AvmA directly regulates UPP production and attachment in A.
tumefaciens. Previously, we demonstrated that overexpressing celR stimulates
aggregation and UPP formation, while deleting the gene does not affect these processes
(14). These observations suggest that another DGC directly regulates attachment and
UPP production. In this study, our genetic evidence indicates that atu1060, we now call
avmA, negatively influences polar attachment by reducing deployment of the UPP. We
also provide supporting evidence that the UPP is involved in attaching the bacteria to
plant cells in a polar orientation, suggesting that this structure contributes to the initial
attachment step necessary for the bacteria to establish an interaction with their plant
hosts.
Several studies support the role of c-di-GMP in modulating UPP production and
attachment. Xu et al. (294) reported that deployment of the polar adhesion structure is
induced by c-di-GMP, resulting in increased polar lectin binding. These researchers also
reported that three putative DGCs stimulate formation of the polar structure (294).
Increased c-di-GMP levels also drive holdfast production in C. crescentus (94),
suggesting that DGC-mediated regulation of UPP synthesis is a theme that is conserved
among the alphaproteobacteria.
155
Here we show that avmA, a fourth DGC, influences UPP production.
Interestingly, either overexpressing or deleting avmA results in increased UPP production
and polar attachment in A. tumefaciens (Table 4.2). This is a surprising result, given that
in many cases, overexpressing and deleting a gene result in opposite phenotypes. These
observations raise the question as to which modification of avmA best represents its
function in UPP production. Similar to these effects, either overexpressing or deleting
wspR, a DGC of P. fluorescens, stimulates attachment of the bacteria to surfaces (57,
152). Further research demonstrated that overproduction of WspR results in crosstalk
with other DGCs involved in modulating attachment (152), suggesting that deleting wspR
is a more accurate assessment for the role of the gene. This observation indicates that
overexpressing avmA increases levels of c-di-GMP and induces UPP production,
probably by crosstalk with one or more of the other three putative DGCs in this system
(294). Based on the phenotypes of the ΔavmA mutant, it is likely that AvmA negatively
regulates UPP deployment. We propose that the c-di-GMP signal produced by AvmA
targets some unknown factor that modulates UPP assembly or disassembly.
Our studies using lectin binding indicate that the UPP also is responsible for
rosetting and that the cells are held together by the UPP at their poles. A number of
alphaproteobacteria form rosettes, including biovar 1 strains of Agrobacterium (22, 96,
289), some species of Rhizobium (88), uncharacterized species of oceanic
alphaproteobacteria (213), Caulobacter (185) and Roseobacter (28). In Caulobacter, the
rosettes are formed by the bacteria interacting with each other at their adhesive holdfasts
at the tip of the stalks (168, 185). In Agrobacterium, these arrangements form at the
surface of unshaken medium, and only after several hours of incubation (22). Our results
156
demonstrate that the production of the UPP is linked to the formation of rosettes, and that
AvmA prevents the cells from forming into these arrangements. Combined, these
observations strongly suggest that UPP-like structures are responsible for rosette
formation among other species of alphaproteobacteria.
The function of the UPP in attachment to nonbiological surfaces is well known
(143, 267), yet its role in interactions with plant tissue has not been described. Our
studies of avmA confirm that overproduction of the UPP increases individual cell
attachment to glass surfaces in a polar orientation (Figure 4.3). Importantly, we
demonstrate that the avmA deletion mutant exhibits increased polar attachment of
individual bacteria not only to glass surfaces, but also to leaf tissue (Figure 4.4). While
we did not directly confirm that the pole containing the UPP contacts the plant surface,
our evidence suggests that the structure is necessary for polar attachment to plant tissue.
Our work on the function of avmA in attachment and UPP formation provides
evidence for a role of the polar structure in the initial attachment of A. tumefaciens to
plant tissue. We propose a model in which production of the UPP is stimulated by surface
contact (143), suggesting that a rapid signaling mechanism, perhaps mediated by the
three DGCs described by Xu et al. (294), is necessary to form the polar attachment
structure. Deployment of the UPP is responsible for the initial polar interaction between
the bacterium and the plant cell. At some later time in the process of attachment, in
response to a signal, AvmA is activated, resulting in inactivation or disassembly of the
UPP and release of the polar-bound bacteria. Presumably, the bacteria then reestablish a
second, stable binding to form microcolonies. Interestingly, lon mutants of strain C58,
which are strongly attenuated (252), display increased and very strong polar attachment
157
(Su, unpublished), suggesting that the protease plays a role in transitioning from polar
binding to some other type of interaction. It is possible that AvmA recruits or activates
Lon in some manner, resulting in removal of the UPP. Further analysis of AvmA and
polar attachment will be necessary to explore these possibilities.
4.6.2 AvmA is the first DGC directly linked to virulence in A. tumefaciens. In
earlier studies we reported that overexpressing either celR or avmA attenuates virulence
in A. tumefaciens (14). Here, we demonstrate that AvmA exerts a modulatory effect on
tumorigenesis. Deleting avmA significantly lowers the population size of bacteria
necessary to initiate tumors (Figure 4.5), suggesting that the DGC affects virulence
efficiency in some manner. Surprisingly, even though more efficient at inducing tumors,
the avmA mutant displayed a statistically lower level of transcription of virB4 (Figure
4.6), demonstrating that tumor induction does not require high levels of expression of the
virB operon. That other supervirulent strains of A. tumefaciens display high levels of
expression for both the virB operon and virG (109) suggests that the effects of avmA on
tumor induction involve a previously undescribed mechanism.
The role of avmA in virulence is clouded by complementation studies with the
two mutant alleles of the gene. Both avmAD59A and avmAE338A complemented the
deletion mutant for tumor induction (Figure 4.5A), indicating that AvmA does not require
activation or enzymatic activity to impact virulence. However, in contrast to the
attenuated phenotype of cells overexpressing wild-type avmA, overexpressing either
altered allele did not reduce virulence (Figure 4.5B). From these observations, we
hypothesize that overexpressing avmA affects virulence through c-di-GMP synthesis and
158
crosstalk with other DGCs, while deleting the gene affects tumor induction through a
separate mechanism.
Based on these combined studies, it is likely that AvmA negatively modulates
deployment of the UPP, indirectly affecting virulence in biovar 1 species of
Agrobacterium. Surface contact with the plant cell results in production of the polar
structure (143), likely due to signaling through specific DGCs (294). An increased
number of bacteria producing the UPP results in more cells associated with the plant,
keeping the bacteria within the nutrient-rich rhizosphere. AvmA most likely is activated
in response to some unknown signal, likely resulting in phosphorylation at its CheY-like
domain. Activation of AvmA results in removal or inactivation of the UPP. In this
manner, AvmA plays a role in transitioning the cells from UPP-dependent polar binding
for initial interactions with the plant to later stages of attachment, including microcolony
formation through cellulose.
4.6.3 AvmA is unique to biovar 1 genomovars of agrobacteria. The high
degree of relatedness and organization of avmA among the biovar 1 isolates suggests that
the DGC plays a specific role in attachment within these genomovars. No other member
of the family Rhizobiaceae contains avmA (NBCI), suggesting that the species evolved
this mode of regulation of initial attachment separately from the rest of the family.
Interestingly, another set of genes involved in attachment, annotated as the rap genes, are
only present in select isolates on the genus Rhizobium (171), suggesting that different
species of the Rhizobiaceae utilize variations in the attachment mechanism to interact
with plants. These observations strongly suggest that AvmA was established as a specific
159
regulator for transitioning biovar 1 genomovars of agrobacteria from polar attachment to
later stages of interaction with the plant.
160
4.7 Tables and Figures
Table 4.1. Strains and plasmids used in this studya.
Strain or Plasmid Genotype Reference
E. coli
DH5α supE44ΔlacU169(ϕ80lacZΔM15) hsdR17
recA1 endA1 gyrA96 thi-1 relA1
(219)
S17-1 λpir Pro- Res- Mod+ recA; integrated RP4-
Tcr::Mu-Kan::Tn7, Mob+;Smr λ::pir
(62)
A. tumefaciens
NTL4 A derivative of C58, ΔtetRS, lacks pTiC58 (150)
NTL7 NTL4 with pTiC58 re-introduced (150)
NTL7Δcel NTL7 with celC and celDE deleted, Tcr (14)
NTL7ΔavmA::Km NTL7 avmA::Kmr (14)
NTL7ΔavmA::Tn7-
pravmA
NTL7ΔavmA::Km with Tn7-Gm-pravmA
inserted at the glmS site
This Study
NTL7ΔavmA::Km/Tn7-
pravmAD59A
NTL7ΔavmA::Km with Tn7-Gm-
pravmAD59A inserted at the glmS site
This Study
NTL7ΔavmA::Km/Tn7-
pravmAE338A
NTL7ΔavmA::Km with Tn7-Gm-
pravmAE338A inserted at the glmS site
This Study
Plasmid
pUC18 Cloning vector, Apr Invitrogen
pUCavmA avmA cloned into pUC18 This Study
161
Table 4.1. (cont.)
pUCavmAE338A pUCavmA altered at E338 to an alanine This Study
pUCavmAD59A pUCavmA altered at D59 to an alanine This Study
pUCpravmA pUC18 containing avmA and 400 bp of the
promoter region
This Study
pUCpravmAE338A pUCpravmA altered at E338 to an alanine This Study
pUCpravmAD59A pUCpravmA altered at D59 to an alanine This Study
pZLQ pBBR1MCS-2 based expression vector, Kmr (151)
pZLQavmA avmA from pUCavmA cloned into
NdeI/BamHI sites of pZLQ
This Study
pZLQavmAE338A Allele from pUCavmAE338A cloned into
NdeI/BamHI sites of pZLQ
This Study
pZLQavmAD59A Allele from pUCavmAD59A cloned into
NdeI/BamHI sites of pZLQ
This Study
pUC18mini-Tn7t-Gm Tn7 carrier vector containing Gm cassette,
Apr, Gmr
(44)
pTNS2 Tn7 helper plasmid encoding the TnsABC+D
specific transposition pathway, Apr
(44)
pUCTn7-Gm-pravmA pravmA fragment cloned into BamHI site of
pUC18mini-Tn7t-Gm
This Study
pUCTn7-Gm-
pravmAE338A
pUCTn7-Gm-pravmA altered at E338 to an
alanine
This Study
162
Table 4.1. (cont.)
pUCTn7-Gm-
pravmAD59A
pUCTn7-Gm-pravmA altered at D59 to an
alanine
This Study
aAbbreviations: Apr, resistance to ampicillin; Cmr, resistance to chloramphenicol; Gm,
resistance to gentamicin; Kmr, resistance to kanamycin; Smr, resistance to streptomycin;
Tcr, resistance to tetracycline.
163
Table 4.2. Altering avmA expression affects lectin binding, polar binding and rosette formation.
Total Cells % Labeleda % Polarb % Rosettec
NTL7 272 3 1 0
NTL7Δcel 272 3 1 0
NTL7(pZLQavmA) 1040 12* 2* 2*
NTL7Δcel(pZLQavmA) 478 9* 4* 3*
NTL7ΔavmA::Km 209 23* 18* 1
a Percentage of cells examined that displayed polar lectin binding.
b Percentage of cells examined that were bound to the glass slide in a polar orientation.
c Percentage of cells examined that were observed in rosettes.
* p ≤ 0.05 compared to NTL7 using Chi-squared analysis.
164
Figure 4.1.
165
Figure 4.1. (cont.)
Figure 4.1. Overexpressing avmA affects aggregation and rosetting. Cultures of
NTL7 or NTL7Δcel and their derivatives were grown in MG/L and samples were viewed
by DIC microscopy as described in Materials and Methods. A) NTL7. B)
NTL7(pZLQavmA). C) NTL7Δcel. D) NTL7Δcel(pZLQavmA). E) Enlargement of
rosette arrangement from NTL7Δcel(pZLQavmA). F) NTL7ΔavmA::Km. G)
NTL7(pZLQavmAE338A). H) NTL7(pZLQavmAD59A). Circles mark representative
rosette formations. Scale bars represent 5 µm or 20 µm.
166
Figure 4.2. Cells modified in avmA expression display increased polar binding of
WGA at their poles. Cells grown in MG/L with the appropriate antibiotics were
collected, incubated with WGA-Alexafluor 633 and observed by fluorescence
microscopy as described in Materials and Methods. A) NTL7. B) NTL7(pZLQavmA). C)
NTL7Δcel(pZLQavmA). D) NTL7Δcel. E) NTL7ΔavmA::Km. F) Enlargement of cells of
NTL7ΔavmA::Km. Circled cells represent examples of polar-bound lectin, with polar
attached cells marked with arrows. Scale bars represent distance as depicted.
167
Figure 4.3. AvmA affects biofilm formation on glass surfaces. Cultures were grown in
MG/L with the appropriate antibiotics in borosilicate tubes and assayed for adherence to
the glass surface by crystal violet staining as described in Materials and Methods. Each
strain was grow in triplicate, and each experiment was repeated three times. The values
represent the average of the nine total samples, with error bars representing the standard
error of the experiments.
168
Figure 4.4. Cells altered in the expression of avmA are affected in plant attachment.
Strains were cultured and inoculated onto Arabidopsis thaliana leaves, and the
interactions were visualized by SEM as described in Materials and Methods by the
laboratory of Dr. Lois Banta, Williams College, MA. A) NTL7. B) NTL7ΔavmA::Km.
169
Figure 4.5. Altering expression of avmA affects virulence. A) Derivatives of NTL7
expressing altered alleles of avmA at wild-type levels were inoculated onto tomato stems
and assessed for tumor induction as described in Materials and Methods. Each
experiment was repeated three times, with five samples per experiment. The data indicate
the averages of samples for each strain tested, with error bars representing standard error.
B) Derivatives of NTL7 overexpressing alleles of avmA were inoculated onto tomato
stems as described in Materials and Methods. Each experiment was repeated three times,
with five samples per experiment. The data indicate the averages of samples for each
strain tested, with error bars representing standard error.
170
Figure 4.6. Modifying expression of avmA affects transcription of virB4. Strains of
NTL7 and NTL7Δcel were grown in Vir Induction Medium with acetosyringone as
described in Materials and Methods by the laboratory of Dr. Lois Banta, Williams
College, MA. Total RNA was isolated from cells sampled at six and 18 hours and
amplified by qPCR as described in the Materials and Methods. Each experiment was
performed in triplicate, and was repeated four times. The values represent the average of
the twelve total samples, with error bars representing the standard error of the
experiments.
171
Figure 4.7. Phylogenetic tree of AvmA in biovar 1 isolates of A. tumefaciens, with
representative genomes from other members of Rhizobiaceae. Analysis of isolates
was prepared by Dr. Xavier Nesme, Lyon, France.
172
Chapter 5
Conclusions
5.1 CelR is a direct regulator of cellulose synthesis through production of c-di-GMP
In this study, I proposed to determine factors involved in regulating attachment
and cellulose synthesis in Agrobacterium tumefaciens. Cellulose is a component of the
matrix used to establish microcolonies and biofilms (158), although little is known
concerning regulation of production of this polymer in A. tumefaciens. Early research
demonstrated that cellulose synthesis is stimulated by increased levels of c-di-GMP (6).
Here, I show that one diguanylate cyclase, CelR, is involved in stimulating production of
the polymer in A. tumefaciens. Overexpressing celR results in increased cellulose
synthesis, while this phenotype is lost when the cel operons are disrupted (Chapter 2).
Deleting celR results in decreased production of the polymer to levels equivalent to the
cel- mutant (Chapter 2). These results identify a specific DGC, CelR, as being required
for cellulose synthesis in A. tumefaciens.
While the phenotypes associated with deleting celR indicate that the gene is
necessary for stimulating cellulose production, the data do not establish whether the
encoded protein synthesizes c-di-GMP. Overexpressing an allele of celR altered at the
GGEEF motif did not stimulate cellulose synthesis (Chapter 3). Further, the altered allele
failed to complement the celR deletion mutant (Chapter 3). These observations confirm
that CelR is a bona fide DGC, and suggest that CelR stimulates cellulose production
through synthesis of c-di-GMP.
173
This study compellingly links a functional DGC, CelR, to cellulose production in
A. tumefaciens, complementing previous work in other laboratories. Amikam and
Benziman (6) connected c-di-GMP to cellulose synthesis in A. tumefaciens through
biochemical analysis. The ortholog of CelR in R. leguminosarum, CelR2, was implicated
in stimulating cellulose synthesis (11), suggesting that c-di-GMP regulates production of
the polymer in other species of the Rhizobiaceae. However, no specific active DGC had
been identified in A. tumefaciens. My research describes CelR as the enzyme stimulating
cellulose synthesis.
Stimulation is necessary for full production of the cellulose fibrils in A.
tumefaciens. The amount of cellulose synthesized by strain C58 in culture is very low
(Chapter 2), and the cel genes are not transcribed at a high level (Chapter 3). Production
of the polymer also is likely repressed, as celG and celI mutants of C58 display increased
synthesis of cellulose (158). That CelI has a helix-turn-helix domain suggests that the
expression of the cel regulon is controlled, in part, at the level of transcription (158). My
results demonstrate that CelR stimulates cellulose synthesis above basal levels of
production through a second, signal-dependent level of regulation, likely in response to
some upstream signal.
5.2 CelR requires activation, probably by phosphorylation, to stimulate cellulose
synthesis
The protein structure of CelR consists of the catalytic domain for synthesizing c-
di-GMP and two CheY-like receiver domains, with one containing a conserved aspartate
residue (Chapter 2). The presence of a conserved CheY domain with a putative active site
174
residue suggests that enzymatic activity of the DGC requires activation. Indeed, an allele
of celR in which Asp53 was changed to an alanine is unable to stimulate cellulose
synthesis (Chapter 3). This observation demonstrates that the conserved aspartate is
required for CelR to stimulate production of the polymer. In other proteins with CheY-
like receiver domains, converting the aspartate residue to glutamate results in a
constitutively-active form of the protein (190, 220). It is generally accepted that this
alteration to glutamate mimics phosphorylation (190, 220). Expressing CelR with an
Asp53 to glutamate mutation increased the level of stimulation of cellulose synthesis as
compared to expressing wild-type celR (Chapter 3). Combined, these effects of altering
Asp53 suggest that CelR is an activation-dependent DGC that requires phosphorylation
to stimulate synthesis of c-di-GMP.
The requirement for an active CheY domain suggests that CelR is an intermediate
component of a larger signaling pathway, similar to other two-component response
regulators (63, 190). That CelR is a bona fide diguanylate cyclase suggests that the DGC
synthesizes c-di-GMP that then is sensed by another component of the cellulose synthesis
pathway. Through this mechanism, CelR channels the upstream signal from some
unidentified environmental cue to a downstream receptor.
5.3 CelA is likely stimulated by c-di-GMP synthesized by CelR
That CelR produces c-di-GMP (Chapter 3) points to an enzymatic component of
cellulose synthesis that is activated by the nucleotide signal. In A. tumefaciens, the
cellulose synthase subunit CelA contains a C-terminal PilZ-type motif that could be a c-
di-GMP-binding region (7). This observation led me to hypothesize that the subunit
175
responds to the signal produced by CelR. This hypothesis is consistent with the
biochemical analysis demonstrating that addition of c-di-GMP to cell free extracts of A.
tumefaciens stimulates cellulose synthesis (6). My studies demonstrate that CelA requires
an intact PilZ domain to fully stimulate cellulose synthesis (Chapter 3). Further,
overexpressing celR in NTL7ΔcelA::Km complemented with celA altered at the PilZ
domain resulted in only a slight increase in production of the polymer (Chapter 3). These
observations strongly suggest that CelA responds to c-di-GMP to stimulate cellulose
synthesis, with the signal likely produced by CelR.
It was possible that c-di-GMP produced by CelR affects cellulose synthesis by
regulating transcription of the cel regulon. Examining the transcription rate of celABCG
revealed that expression of the operon is generally low (Chapter 3). Further, deleting celR
did not affect expression of celA, while overexpressing the DGC resulted in a slight drop
in transcription of celA (Chapter 3). These results confirm that CelR does not stimulate
cellulose synthesis by regulating transcription of celA.
In a number of other bacteria c-di-GMP stimulates cellulose synthesis by
activating the cellulose synthase complex. In G. xylinus, in vitro synthesis of cellulose by
the purified complex of BcsA and BcsB is stimulated by c-di-GMP (166, 210). In S.
enterica, biochemical, crystallographic and molecular studies of BcsA, the catalytic
component, demonstrate that the subunit directly binds c-di-GMP, and that this binding
stimulates cellulose synthesis (173, 184, 306, 307). The critical residues of the PilZ
domain, the c-di-GMP binding region, are highly conserved among the cellulose
synthases in bacteria (7). These observations suggest that c-di-GMP is used to regulate
cellulose synthesis in most if not all bacteria that produce the polymer.
176
While the use of c-di-GMP as an inducing signal for cellulose synthesis is
conserved among bacteria, the cyclases and pathways resulting in the signal are varied. In
the Alphaproteobacterium G. xylinus, stimulation of cellulose synthase is driven by the
diguanylate cyclases Cdg1, Cdg2 and Cdg3 (Figure 5.1; (257)). These three DGCs each
contain a PAS oxygen-sensing domain, the conserved GGDEF domain and a disrupted
EAL domain (Figure 5.1), and all three cyclases are activated by high levels of oxygen
(257). Salmonella enterica activates cellulose production through the global regulator
CgsD and the diguanylate cyclase AdrA (207, 307), with AdrA containing a MASE2-
type membrane-associated signal-sensing domain and the GGDEF domain (Figure 5.1).
These cyclases are structurally distinct from CelR of A. tumefaciens and R.
leguminosarum (Figure 5.1). Combined, these observations indicate that regulation of
cellulose synthesis is adapted for different conditions among cellulose-producing
bacteria, and even between members of the alphaproteobacteria.
Interestingly, cellulose synthesis in species of Pseudomonas is stimulated by
surface contact through a modified chemosensory system encoded by the wsp operon.
Signal perception results in activation of the DGC WspR (87, 102, 152, 182). Although
only 30% identical to CelR, WspR contains a single CheY-like receiver domain and the
GGDEF domain (Figure 5.1). In Pseudomonas spp., the Wsp signal transduction complex
recognizes surface contact, eventually resulting in phosphotransfer from a specific kinase,
WspE, to an aspartate in the CheY domain of WspR (97, 102, 152, 182). The gene
context of wspR and celR also differ. While the gene encoding WspR is part of the
operon encoding most or all of the Wsp system (97), celR is part of a two-gene operon
with divK in A. tumefaciens (15), and there are no highly conserved orthologs of the wsp
177
operon in A. tumefaciens (NCBI). These observations suggest that although the activities
of the two DGCs are modulated by phosphorylation cascades, the systems differ in how
they sense signals and transfer the information to downstream components.
5.4 Modifying expression of celR affects attachment and cell-cell interactions
Cellulose synthesis is an important component of the stable attachment to and
colonization of plant surfaces by A. tumefaciens (158). Therefore, modulating production
of this polymer by CelR and its c-di-GMP signal likely will affect attachment and
establishment of microcolonies. In support of this hypothesis, overexpressing the gene
results in increased UPP production and rosette formation, decreased attachment to plant
tissue and reduced biofilm formation (Chapter 2). Deletion mutants of celR attach as
individual cells at higher frequencies to plant tissue, as compared to the wild-type
(Chapter 2). Further, the celR mutant does not efficiently establish multicellular groups of
cells on solid surfaces (Chapter 2). These observations suggest that c-di-GMP is used to
regulate the nature of the attachment mechanism and associated phenotypes. Consistent
with my results, mutants of strain C58 displaying increased cellulose synthesis exhibit
increased cellular aggregation and weaker attachment to surfaces as compared to the
wild-type strain, with both traits affecting establishment of biofilms (158). These
observations suggest that cellulose production must be regulated to optimize attachment
of the bacteria to surfaces.
Overexpressing celR affected UPP deployment and binding of the bacteria to
plant tissue (Chapter 2), suggesting that c-di-GMP is involved in regulating initial
attachment events. Studies in other laboratories confirm that the nucleotide signal induces
178
UPP deployment (294). Of five putative DGCs examined in my study, only
overexpression of celR or avmA induced deployment of the polar structure (Chapter 2).
However, deleting celR did not affect UPP deployment (Chapter 2), suggesting that
another DGC, perhaps AvmA, is involved in regulating this process.
These studies point to a regulatory role for CelR in determining the stability of the
interaction of the bacteria with plant tissue. CelR likely induces cellulose synthesis to aid
in establishing microcolonies on plant surfaces. I propose that under specific conditions,
CelR stimulates production of the polymer, likely to levels of cellulose synthesized by the
celR mutant expressing the constitutively-active form of the cyclase. Cellulose fibrils
allow the cells to aggregate, while interacting with the plant surface. This contact
between bacteria and the plant results in stable aggregates of tethered cells that are
anchored to the colonized surface. Over time, these aggregates develop into established
microcolonies and biofilms.
5.5 Cyclic-di-GMP is targeted to the appropriate signal pathway by variations in the
structure of diguanylate cyclases
Overexpressing celR leads to a number of altered phenotypes (Chapter 2),
suggesting that the c-di-GMP signal is involved in several if not many regulatory
pathways in A. tumefaciens. Alternatively, overexpression may lead to overall higher
cellular concentrations of signal, which could result in activating non-cognate systems.
To prevent crosstalk between systems utilizing c-di-GMP, the signaling pathways must
be separated, either by containment of the signal within a compartment of the cell or by
variations in the sensitivity of the receptors to c-di-GMP. Examining the effects of
179
overexpressing different DGCs in A. tumefaciens could shed light on how c-di-GMP-
dependent regulatory pathways are insulated from each other.
Similar to the effects of celR, overexpressing avmA results in increased cellulose
synthesis, UPP deployment and attenuated virulence (Chapter 2, Chapter 4). These two
DGCs are structurally related, each with two CheY-like receiver domains and the
GGEEF domain (Chapter 2). These observations suggest that the two DGCs are similar
enough to crosstalk between each other. In support of this hypothesis, overexpressing
atu2228, which could code for an unrelated DGC, affects cell morphology and colony
size but no other notable phenotypes (Chapter 2). Taken together, these results suggest
that under normal levels of expression structurally distinct DGCs may not interact
significantly between their respective target pathways. These variations in protein
structure in other systems could allow the DGCs to partition to different components,
localize with specific components, interact with the appropriate receptor, or activate by
different mechanisms (129, 154). It is tempting to speculate that such alterations in
domain organization provide a means to segregate each cyclase from the others,
preventing excessive crosstalk among all the signaling systems utilizing c-di-GMP (154,
205).
My results demonstrate that CelR and AvmA can affect similar processes.
However, deleting avmA did not affect cellulose synthesis (Chapter 2), confirming that
only CelR directly regulates this polymer. Further, the celR deletion mutant displays
normal levels of UPP deployment and virulence (Chapter 2), demonstrating that the DGC
does not directly impact these processes. These observations suggest that despite their
structural similarities, CelR and AvmA modulate different systems in A. tumefaciens.
180
5.6 Mutating avmA affects UPP production and virulence
Although modifying expression of celR affected several phenotypes, my further
analysis indicated that not all of these traits are directly regulated by the DGC.
Overexpressing celR results in increased UPP formation and polar attachment, and
severely attenuated virulence (Chapter 2). However, deleting celR did not affect any of
these phenotypes (Chapter 2). Given that overexpressing avmA resulted in phenotypes
similar to those displayed by cells overexpressing celR (Chapter 2), these observations
suggest that avmA may regulate one or more of these processes.
Deleting avmA affects UPP deployment and polar binding to surfaces, indicating
that the product of this gene participates in regulating initial attachment events. Deletion
mutants of this DGC display increased polar-oriented attachment and increased UPP
production (Chapter 4). From these observations I conclude that AvmA negatively
regulates UPP deployment, which in turn influences polar attachment of the bacteria to
surfaces. However, overexpressing the DGC also results in increased UPP production
(Chapter 4), suggesting that c-di-GMP stimulates deployment of the structure. Work from
Fuqua’s laboratory showing that deleting three putative DGCs results in decreased UPP
formation (294) strongly supports the hypothesis that c-di-GMP regulates this process. It
is possible that UPP deployment is affected by different DGCs depending on the
upstream signal. In this model, contact of the bacteria with a surface stimulates the three
DGCs. Increased synthesis of c-di-GMP activates their respective receptors, resulting in
deployment of the UPP and tight polar binding. Upon sensing some different signal, or at
some subsequent time, AvmA is activated and synthesizes c-di-GMP. The signal from
181
AvmA is bound by an unidentified receptor, which activates a system that disassembles
the UPP. This attendant release from polar attachment likely allows the bacteria to
interact with the plant tissue by other attachment mechanisms. In this manner, AvmA
would act as a switch from UPP-mediated attachment to other forms of interaction, with
one involving cellulose synthesis. Interestingly, lon mutants of A. tumefaciens bind
tightly to surfaces, and in a polar orientation (Su, unpublished data). Further, on the
cellular level the lon mutant displays a significant increase in polar lectin binding and
rosette formation (unpublished data), suggesting that the protease is necessary to release
the bacteria from UPP-mediated attachment. It is possible that AvmA recruits Lon to the
pole, thereby signaling the degradation or disassembly of the UPP.
In addition to affecting polar attachment, modifying expression of avmA results in
increased rosette formation (Chapter 4). These aggregates of cells are held together by
interactions between the UPP-containing poles of the bacteria (Chapter 4). Further,
AvmA prevents the cells from forming these arrangements. Interestingly, rosette
formation by wild-type A. tumefaciens was first described in cultures grown in a broth
prepared from steamed carrots (22). Moreover, the rosettes apparently were confined to
the pellicle of static cultures (22). It is possible that some component from the plant
stimulates deployment of the UPP, increasing rosette formation. Other
alphaproteobacteria form rosettes, and in some species, UPP-like structures were
identified in these arrangements (22, 28, 88, 185, 213). Based on these observations, it is
possible that other DGCs modulate deployment of UPP-like structures, and that these
adhesive structures are responsible for forming rosettes in select alphaproteobacteria.
182
AvmA greatly impacts tumorigenesis, connecting c-di-GMP and a specific DGC
directly to regulation of this process in A. tumefaciens. As with celR, cells overexpressing
avmA are strongly attenuated (Chapter 2). Unlike celR, avmA deletion mutants induce
tumors at population sizes considerably lower than wild-type (Chapter 4). These results
suggest that high levels of c-di-GMP from the two DGCs negatively impact virulence,
and that AvmA, expressed at normal levels, directly affects this process. Interestingly,
alleles of avmA altered at either the GGEEF motif or the conserved aspartate residue of
the CheY-like domain complemented the deletion mutant (Chapter 4). These results
clearly show that AvmA-mediated regulation of virulence does not involve c-di-GMP
synthesis or an upstream signal, and must operate through some different mechanism.
Based on my observations, it is likely that AvmA participates in reversing UPP
deployment in biovar 1 strains of A. tumefaciens. I suggest a model in which at the onset
of attachment to normal tissue, such as roots, the bacteria physically contact the plant
cell, resulting in deployment of the polar structure (143). This rapid response is likely
mediated by c-di-GMP, synthesized by three DGCs (294). Once the bacteria are
associated with the plant by polar attachment, the cells recognize signals from the plant
and the environment. If the environment is conducive to growth, a signal activates
AvmA, initiating removal of the UPP, possibly through disassembly or degradation of
components by Lon. Once the cells are released from polar attachment through
disassembly of the UPP, CelR stimulates cellulose synthesis, anchoring the bacteria to
each other and to the surface of the plant, and thereby transitioning the cells from polar
attachment to microcolony formation. This model is entirely consistent with both light
183
and SEM microscopy studies by the Matthysse laboratory showing that wild-type cells
form plant-associated aggregates held together by cellulose fibrils (156, 157).
A similar model of attachment could account for the interactions that occur when
the bacteria encounter an infection site, such as a wound on the plant. Polar attachment
via the UPP is likely stimulated by surface contact, similar to attachment to normal tissue.
Once associated with the wounded plant, the bacteria initiate other forms of attachment,
while signaling from AvmA releases the UPP. These associations involve cellulose
synthesis, since cel- mutants, but not wild-type cells, can be washed out of infection sites
(156). Disassembly of the UPP may be directed by Lon, although it is important to note
that lon mutants are severely attenuated (252). Given that deleting lon results in a number
of altered phenotypes, including altered cell morphologies, increased polar attachment
and attenuated virulence ((252); Su, unpublished data), it is likely that the protease is
involved in several distinct processes, any or all of which could affect tumorigenesis. In
this model, Lon assists in releasing the UPP, while also modulating virulence. In
addition, cel- mutants are unable to induce tumors when the bacteria are washed out of
wound sites up to eight hours after inoculation (156, 256), suggesting that cellulose
fibrils, but not UPP, stabilize attachment of the bacteria at the infection site during tumor
induction. This observation supports a model in which the UPP is removed early during
infection, perhaps by a pathway dependent on AvmA, and suggests that the cellulose
fibrils are necessary to maximize subsequent host cell binding of the bacteria at the
infection site.
184
5.7 The response regulator DivK impacts cellulose synthesis through CelR
Our studies of CelR and AvmA suggest that they are likely part of regulatory
pathways governing cellulose synthesis and attachment processes, respectively. celR is
the distal gene in a two-gene operon that begins with divK. This gene encodes a response
regulator consisting of a single CheY-like receiver domain (Chapter 3). Homologs of
DivK in the alphaproteobacteria are involved in cell cycle regulation, and in some species
holdfast production (89, 93, 124, 136, 189). These observations suggest that DivK may
regulate attachment systems in A. tumefaciens. My studies not only confirm the role of
divK in cell cycle regulation (Chapter 3; (124)), but demonstrate that the regulator
stimulates cellulose synthesis through CelR. Compared to wild-type, divK mutants
produce lower levels of the polymer (Chapter 3). Further, a constitutively-active form of
DivK increases stimulation of cellulose synthesis, but only when celR is present (Chapter
3). These results show that DivK regulates both cell cycle progression and cellulose
synthesis.
The dual roles of DivK in A. tumefaciens mirror the regulation network of cell
cycle progression and polar attachment in C. crescentus. The ortholog of DivK in C.
crescentus acts as a critical localization factor for both cell cycle and polar
morphogenesis pathways, linking the two systems (1, 30). DivK is activated by
phosphorylation through the kinase DivJ (9, 200). The activated regulator then binds and
localizes DivL, another kinase, initiating a cascade resulting in polar localization and
dephosphorylation of the master regulator CtrA (1, 189). CtrA is then degraded by
ClpXP, allowing the cell to progress past the G1-to-S phase transition checkpoint (1, 189,
268). In this manner, DivK drives cell cycle progression in C. crescentus.
185
DivK also regulates pole morphogenesis by stimulating activation of PleD, the
ortholog of CelR in C. crescentus. In swarmer cells, PleD is inhibited by the hybrid
kinase/phosphatase PleC (190, 240, 242). Upon stimulation of DivJ and the kinase
activity of PleC by DivK, the two proteins phosphorylate PleD (1, 189). The
phosphorylated DGC dimerizes and localizes to the flagellated pole of the swarmer cell,
resulting in detachment of the flagella and formation of the holdfast stalk (4, 35, 188,
190). By connecting the activation of PleD and degradation of CtrA, DivK links cell
cycle progression to holdfast attachment in C. crescentus.
While my studies demonstrate that DivK in A. tumefaciens maintains regulatory
control over both cellulose synthesis and cell cycle progression, it is likely that these
processes are not directly linked. A constitutively-active form of the CheY-like regulator
stimulates production of the polymer, but does not affect cell division (Chapter 3).
Further, DivK is essential in C. crescentus (93), but not in A. tumefaciens or R.
leguminosarum (11, 15, 124). Agrobacterium tumefaciens also contains two orthologs
each of PleC and DivJ, as well as other orthologous components of the division signaling
pathway of C. crescentus (124). PleC is not essential in A. tumefaciens, while it is
required in C. crescentus (124). These observations suggest that DivK-mediated
regulation of cell cycle progression in A. tumefaciens differs from that of C. crescentus.
Interestingly, DivK is essential in Sinorhizobium meliloti, and components of the cell
checkpoint pathway with divK are important for the symbiotic interaction of the bacteria
with alfalfa (195). This observation suggests that among alphaproteobacteria, and even
among members of Rhizobiales, there are variations in the regulatory systems controlled
186
by DivK. In the case of A. tumefaciens, the adaption of DivK may be due to the switch
from regulating holdfast formation to cellulose synthesis.
DivK functions as a localization factor in C. crescentus (1), and this mechanism
may be conserved in A. tumefaciens. Indeed, there is evidence that DivK of A.
tumefaciens is required for proper localization of the FtsZ ring during cell division (124).
While DivK and CelR do not physically interact (Chapter 3), it is possible that DivK
functions by localizing another factor, such as the kinase of the DGC, resulting in
activation of CelR and stimulation of cellulose synthesis. Further, localization studies of
the cellulose synthase complex in some species of Rhizobiaceae suggest that production
of the polymer occurs at the pole (140). These observations lead to the hypothesis that
DivK may serve to localize many proteins to the pole of the cell, including the cellulose
synthase complex. In this manner, DivK could influence the site of cellulose synthesis,
but not the enzymatic activity of the synthase complex itself.
5.8 DivK may connect CelR and AvmA in determining the type of attachment in A.
tumefaciens
There is a possibility that DivK modulates AvmA as well as CelR, although
evidence for this hypothesis remains circumstantial. Because DivK likely localizes
proteins (1, 124), the response regulator may direct other factors to the pole at which the
UPP structure assembles. In C. crescentus, DivK localizes factors that target proteases
such as ClpXP to one pole of the cell (1, 268). It is possible that DivK in A. tumefaciens
also activates localization factors that target proteases to the pole, affecting UPP
deployment or assisting in removing initial attachment factors to begin long-term binding
187
through cellulose synthesis. Given that lon mutants attach extremely tightly in a polar
orientation to plant tissue (Su, unpublished data), it is likely that the protease has some
function in controlling UPP deployment. Based on these observations, activated AvmA
may be targeted to the pole by localization through DivK. Once localized to the pole,
AvmA may recruit proteases, including Lon, to the UPP. This process could then initiate
reversal or prevention of UPP deployment though targeted proteolysis of attachment
components.
Examining the functions of AvmA and CelR in A. tumefaciens suggests that c-di-
GMP regulates different attachment mechanisms, and raises the possibility that DivK
contributes to determining which attachment system is activated. It is possible, for
example, that in response to some signal, DivK is activated by phosphorylation, resulting
in localization of the kinases of CelR and AvmA. These kinases would phosphorylate
both DGCs, which could target both CelR and AvmA to the pole. In this manner, DivK
could influence the switch from initial polar attachment to cellulose production.
The site of attachment to the plant likely affects the transition between initial
attachment and subsequent events. At many sites of interaction, such as with roots, the
transition from polar attachment to microcolony formation may depend on cues
associated with environmental conditions such as nutrient availability. After initial
attachment, and if the bacteria sense an appropriate environment, they can initiate a
signal to switch from polar attachment to establishment of microcolonies. This
conversion explains why cel- mutants are loosely associated with carrot disks (156), since
signals from the plant likely stimulate the transition from UPP-mediated attachment to an
intrinsically less stable form of binding. Once the bacteria are released from polar
188
attachment, the failure to synthesize cellulose could limit colonization by preventing
aggregation of the cells with each other and also lessens the stability of the interaction
between the bacteria and the plant.
The functions of AvmA and CelR in switching A. tumefaciens from polar
attachment to other forms of interaction with surfaces provide insight into similar
attachment processes in other alphaproteobacteria. Although AvmA is present only in
biovar 1 isolates of A. tumefaciens (Chapter 4), many members of the family
Rhizobiaceae associate with plants in a polar orientation (10, 139), and eventually
colonize the tissue (140). My research demonstrates that a molecular switch in A.
tumefaciens involving both CelR and AvmA transitions the bacteria from one form of
attachment to another, and a similar system may function in other colonizing bacteria. In
these other species, the regulatory control mediated by AvmA must be replaced by a
different factor, adapted to specialized processes, such as nodulation, unique to those
isolates. Given the number of identified alphaproteobacteria that both attach in a polar
orientation and colonize surfaces (3, 28, 140), it is likely that similar molecular controls
exist in these systems.
5.9 Future Directions
A significant amount of research is necessary to fully understand the molecular
switch between polar attachment and microcolony formation. While both AvmA and
CelR are known regulators in these systems, my research demonstrates that both DGCs
require activation, likely by phosphorylation, for full stimulation of their activity.
Therefore, determining the activating kinases for both proteins will help determine when
189
the DGCs are activated, as well as provide insight into the upstream signals determining
their activation. Further, the environmental signals stimulating the activation of AvmA
and CelR remain unknown.
An increasing body of evidence suggests that localization of AvmA and CelR is
necessary for the successful delivery of c-di-GMP to its target receptor. Therefore,
subcellular localization studies are necessary to determine if the activated DGCs target to
specific regions of the cell. Similarly, determining whether CelR colocalizes with the
cellulose synthase will shed light on how this DGC targets its c-di-GMP signal to its
prospective target.
While my research identified AvmA as a modulator of UPP deployment, it
remains unknown how the DGC affects this process. Determining the downstream
receptor of AvmA is critical to understanding how the UPP is regulated. While it is likely
that production of c-di-GMP by AvmA reduces deployment of the polar structure, there
are only three PilZ-containing proteins in A. tumefaciens (7), of which one is the cellulose
synthase subunit CelA. It is possible that the signal synthesized by AvmA is bound by a
different receptor, such as degenerate DGC and PDEA domains, or riboswitches.
My analysis of DivK demonstrated that the regulator is involved in modulating
cellulose synthesis, and its function in other systems suggests that DivK is involved in
organizing regulatory systems. Therefore, it is critical to determine what DivK targets
during the switch from polar attachment to microcolony formation. The factors which
interact with DivK will not only determine the role the regulator plays in attachment, but
also reveal why the interaction with plant tissue is loosely associated with cell cycle
progression through DivK.
190
5.10 Figures
Figure 5.1. Domain structure of GGDEF-containing proteins involved in regulating
cellulose synthesis. The domains as derived by analysis of amino acid sequences in the
NCBI databases. CheY, CheY-like receiver domain; GG(D/E)EF, diguanylate cyclase
domain; EAL, phosphodiesterase A domain; PAS, oxygen-sensing heme-bound domain;
MASE2, membrane-associated oxygen-sensing domain.
191
Chapter 6
References
1. Abel, S., P. Chien, P. Wassmann, T. Schirmer, V. Kaever, M. T. Laub, T. A. Baker, and U. Jenal. 2011. Regulatory cohesion of cell cycle and cell differentiation through interlinked phosphorylation and second messenger networks. Mol. Cell 43:550-560.
2. Akiyoshi, D. E., H. Klee, R. M. Amasino, E. W. Nester, and M. P. Gordon.
1984. T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proc. Natl. Acad. Sci. U S A 81:5994-5998.
3. Albareda, M., M. S. Dardanelli, C. Sousa, M. Megias, F. Temprano, and D.
N. Rodriguez-Navarro. 2006. Factors affecting the attachment of rhizospheric bacteria to bean and soybean roots. FEMS Microbiol. Lett. 259:67-73.
4. Aldridge, P., R. Paul, P. Goymer, P. Rainey, and U. Jenal. 2003. Role of the
GGDEF regulator PleD in polar development of Caulobacter crescentus. Mol. Microbiol. 47:1695-1708.
5. Aly, K. A., and C. Baron. 2007. The VirB5 protein localizes to the T-pilus tips in
Agrobacterium tumefaciens. Microbiology 153:3766-3775. 6. Amikam, D., and M. Benziman. 1989. Cyclic diguanylic acid and cellulose
synthesis in Agrobacterium tumefaciens. J. Bacteriol. 171:6649-6655. 7. Amikam, D., and M. Y. Galperin. 2006. PilZ domain is part of the bacterial c-
di-GMP binding protein. Bioinformatics 22:3-6. 8. Atmakuri, K., E. Cascales, and P. J. Christie. 2004. Energetic components
VirD4, VirB11 and VirB4 mediate early DNA transfer reactions required for bacterial type IV secretion. Mol. Microbiol. 54:1199-1211.
9. Ausmees, N., and C. Jacobs-Wagner. 2003. Spatial and temporal control of
differentiation and cell cycle progression in Caulobacter crescentus. Annu. Rev. Microbiol. 57:225-247.
10. Ausmees, N., K. Jacobsson, and M. Lindberg. 2001. A unipolarly located, cell-
surface-associated agglutinin, RapA, belongs to a family of Rhizobium-adhering proteins (Rap) in Rhizobium leguminosarum bv. trifolii. Microbiology 147:549-559.
192
11. Ausmees, N., H. Jonsson, S. Hoglund, H. Ljunggren, and M. Lindberg. 1999. Structural and putative regulatory genes involved in cellulose synthesis in Rhizobium leguminosarum bv. trifolii. Microbiology 145:1253-1262.
12. Bae, S. O., Y. Sugano, K. Ohi, and M. Shoda. 2004. Features of bacterial
cellulose synthesis in a mutant generated by disruption of the diguanylate cyclase 1 gene of Acetobacter xylinum BPR 2001. Appl. Microbiol. Biotechnol. 65:315-322.
13. Bako, L., M. Umeda, A. F. Tiburcio, J. Schell, and C. Koncz. 2003. The VirD2
pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants. Proc. Natl. Acad. Sci. U S A 100:10108-10113.
14. Barnhart, D. M., S. Su, B. E. Baccaro, L. M. Banta, and S. K. Farrand. 2013.
CelR, an ortholog of the diguanylate cyclase PleD of Caulobacter, regulates cellulose synthesis in Agrobacterium tumefaciens. Appl. Environ. Microbiol. 79:7188-7202.
15. Barnhart, D. M., S. Su, and S. K. Farrand. 2014. A signaling pathway
involving the diguanylate cyclase CelR and the response regulator DivK controls cellulose synthesis in Agrobacterium tumefaciens. J. Bacteriol. 196:1257-1274.
16. Bassis, C. M., and K. L. Visick. 2010. The cyclic-di-GMP phosphodiesterase
BinA negatively regulates cellulose-containing biofilms in Vibrio fischeri. J. Bacteriol. 192:1269-1278.
17. Binns, A. N., and P. Costantino. 1998. The Agrobacterium oncogenes, p. 251-
266, The Rhizobiaceae. Springer, Netherlands. 18. Bomhoff, G., P. M. Klapwijk, H. C. Kester, R. A. Schilperoort, J. P.
Hernalsteens, and J. Schell. 1976. Octopine and nopaline synthesis and breakdown genetically controlled by a plasmid of Agrobacterium tumefaciens. Mol. Gen. Genet. 145:177-181.
19. Boyd, C. D., and G. A. O'Toole. 2012. Second messenger regulation of biofilm
formation: breakthroughs in understanding c-di-GMP effector systems. Annu. Rev. Cell Dev. Biol. 28:439-462.
20. Boyle, E. C., and B. B. Finlay. 2003. Bacterial pathogenesis: exploiting cellular
adherence. Curr. Opin. Cell Biol. 15:633-639. 21. Braun, A. C. 1958. A physiological basis for autonomous growth of the crown-
gall tumor cell. Proc. Natl. Acad. Sci. U S A 44:344-349.
193
22. Braun, A. C., and R. P. Elrod. 1946. Stages in the life history of Phytomonas tumefaciens. J. Bacteriol. 52:695-702.
23. Braun, A. C., and R. J. Mandle. 1948. Studies on the inactivation of the tumor-
inducing principle in crown gall. Growth 12:255-269. 24. Braun, A. C., and P. R. White. 1943. Bacteriological sterility of tissues derived
from secondary crown-gall tumors. Phytopathology 33:85-100. 25. Breedveld, M. W., H. C. Cremers, M. Batley, M. A. Posthumus, L. P.
Zevenhuizen, C. A. Wijffelman, and A. J. Zehnder. 1993. Polysaccharide synthesis in relation to nodulation behavior of Rhizobium leguminosarum. J. Bacteriol. 175:750-757.
26. Brilli, M., M. Fondi, R. Fani, A. Mengoni, L. Ferri, M. Bazzicalupo, and E.
G. Biondi. 2010. The diversity and evolution of cell cycle regulation in alpha-proteobacteria: a comparative genomic analysis. BMC Syst. Biol. 4:52.
27. Brown, R. M., Jr., J. H. Willison, and C. L. Richardson. 1976. Cellulose
biosynthesis in Acetobacter xylinum: visualization of the site of synthesis and direct measurement of the in vivo process. Proc. Natl. Acad. Sci. U S A 73:4565-4569.
28. Bruhn, J. B., L. Gram, and R. Belas. 2007. Production of antibacterial
compounds and biofilm formation by Roseobacter species are influenced by culture conditions. Appl. Environ. Microbiol. 73:442-450.
29. Brunaud, V., S. Balzergue, B. Dubreucq, S. Aubourg, F. Samson, S. Chauvin,
N. Bechtold, C. Cruaud, R. DeRose, G. Pelletier, L. Lepiniec, M. Caboche, and A. Lecharny. 2002. T-DNA integration into the Arabidopsis genome depends on sequences of pre-insertion sites. EMBO Rep. 3:1152-1157.
30. Burton, G. J., G. B. Hecht, and A. Newton. 1997. Roles of the histidine protein
kinase pleC in Caulobacter crescentus motility and chemotaxis. J. Bacteriol. 179:5849-5853.
31. Cangelosi, G. A., R. G. Ankenbauer, and E. W. Nester. 1990. Sugars induce
the Agrobacterium virulence genes through a periplasmic binding protein and a transmembrane signal protein. Proc. Natl. Acad. Sci. U S A 87:6708-6712.
32. Cangelosi, G. A., G. Martinetti, and E. W. Nester. 1990. Osmosensitivity
phenotypes of Agrobacterium tumefaciens mutants that lack periplasmic beta-1,2-glucan. J. Bacteriol. 172:2172-2174.
194
33. Cascales, E., K. Atmakuri, M. K. Sarkar, and P. J. Christie. 2013. DNA substrate-induced activation of the Agrobacterium VirB/VirD4 type IV secretion system. J. Bacteriol. 195:2691-2704.
34. Cascales, E., and P. J. Christie. 2004. Definition of a bacterial type IV secretion
pathway for a DNA substrate. Science 304:1170-1173. 35. Chan, C., R. Paul, D. Samoray, N. C. Amiot, B. Giese, U. Jenal, and T.
Schirmer. 2004. Structural basis of activity and allosteric control of diguanylate cyclase. Proc. Natl. Acad. Sci. U S A 101:17084-17089.
36. Chandran, V. 2013. Type IV secretion machinery: molecular architecture and
function. Biochem. Soc. Trans. 41:17-28. 37. Chang, A. L., J. R. Tuckerman, G. Gonzalez, R. Mayer, H. Weinhouse, G.
Volman, D. Amikam, M. Benziman, and M. A. Gilles-Gonzalez. 2001. Phosphodiesterase A1, a regulator of cellulose synthesis in Acetobacter xylinum, is a heme-based sensor. Biochemistry 40:3420-3426.
38. Chen, S., W. Jin, M. Wang, F. Zhang, J. Zhou, Q. Jia, Y. Wu, F. Liu, and P.
Wu. 2003. Distribution and characterization of over 1000 T-DNA tags in rice genome. Plant J. 36:105-113.
39. Chen, Y., Y. Chai, J. H. Guo, and R. Losick. 2012. Evidence for cyclic di-
GMP-mediated signaling in Bacillus subtilis. J. Bacteriol. 194:5080-5090. 40. Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Escherichia
coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-14.
41. Chilton, M. D., T. C. Currier, S. K. Farrand, A. J. Bendich, M. P. Gordon,
and E. W. Nester. 1974. Agrobacterium tumefaciens DNA and PS8 Bacteriophage DNA not detected in crown gall tumors. Proc. Nat. Acad. Sci. U S A 71:3672-3676.
42. Chilton, M. D., M. H. Drummond, D. J. Merlo, D. Sciaky, A. L. Montoya, M.
P. Gordon, and E. W. Nester. 1977. Stable incorporation of plasmid DNA into higher plant cells: the molecular basis of crown gall tumorigenesis. Cell 11:263-271.
43. Cho, H., and S. C. Winans. 2005. VirA and VirG activate the Ti plasmid
repABC operon, elevating plasmid copy number in response to wound-released chemical signals. Proc. Natl. Acad. Sci. U S A 102:14843-14848.
195
44. Choi, K. H., J. B. Gaynor, K. G. White, C. Lopez, C. M. Bosio, R. R. Karkhoff-Schweizer, and H. P. Schweizer. 2005. A Tn7-based broad-range bacterial cloning and expression system. Nat. Methods 2:443-448.
45. Choi, K. H., and H. P. Schweizer. 2006. mini-Tn7 insertion in bacteria with
single attTn7 sites: example Pseudomonas aeruginosa. Nat. Protocols 1:153-161. 46. Christen, M., H. D. Kulasekara, B. Christen, B. R. Kulasekara, L. R.
Hoffman, and S. I. Miller. 2010. Asymmetrical distribution of the second messenger c-di-GMP upon bacterial cell division. Science 328:1295-1297.
47. Christie, P. J., K. Atmakuri, V. Krishnamoorthy, S. Jakubowski, and E.
Cascales. 2005. Biogenesis, architecture, and function of bacterial type IV secretion systems. Annu. Rev. Microbiol. 59:451-485.
48. Christie, P. J., and E. Cascales. 2005. Structural and dynamic properties of
bacterial type IV secretion systems. Mol. Membr. Biol. 22:51-61. 49. Citovsky, V., D. E. V. G, and P. Zambryski. 1988. Single-stranded DNA
binding protein encoded by the virE locus of Agrobacterium tumefaciens. Science 240:501-504.
50. Citovsky, V., B. Guralnick, M. N. Simon, and J. S. Wall. 1997. The molecular
structure of agrobacterium VirE2-single stranded DNA complexes involved in nuclear import. J. Mol. Biol. 271:718-727.
51. Citovsky, V., A. Kapelnikov, S. Oliel, N. Zakai, M. R. Rojas, R. L.
Gilbertson, T. Tzfira, and A. Loyter. 2004. Protein interactions involved in nuclear import of the Agrobacterium VirE2 protein in vivo and in vitro. J. Biol.Chem. 279:29528-29533.
52. Citovsky, V., D. Warnick, and P. Zambryski. 1994. Nuclear import of
Agrobacterium VirD2 and VirE2 proteins in maize and tobacco. Proc. Natl. Acad. Sci. U S A 91:3210-3214.
53. Citovsky, V., J. Zupan, D. Warnick, and P. Zambryski. 1992. Nuclear
localization of Agrobacterium VirE2 protein in plant cells. Science 256:1802-1805.
54. Cole, J. L., G. G. Hardy, D. Bodenmiller, E. Toh, A. Hinz, and Y. V. Brun.
2003. The HfaB and HfaD adhesion proteins of Caulobacter crescentus are localized in the stalk. Mol. Microbiol. 49:1671-1683.
196
55. Cook, D. M., and S. K. Farrand. 1992. The oriT region of the Agrobacterium tumefaciens Ti plasmid pTiC58 shares DNA sequence identity with the transfer origins of RSF1010 and RK2/RP4 and with T-region borders. J. Bacteriol. 174:6238-6246.
56. Cotter, P. A., and S. Stibitz. 2007. c-di-GMP-mediated regulation of virulence
and biofilm formation. Curr. Opin. Microbiol. 10:17-23. 57. D'Argenio, D. A., M. W. Calfee, P. B. Rainey, and E. C. Pesci. 2002. Autolysis
and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J. Bacteriol. 184:6481-6489.
58. Daines, D. A., M. Granger-Schnarr, M. Dimitrova, and R. P. Silver. 2002.
Use of LexA-based system to identify protein-protein interactions in vivo. Methods Enzymol. 358:153-161.
59. Dang, T. A., and P. J. Christie. 1997. The VirB4 ATPase of Agrobacterium
tumefaciens is a cytoplasmic membrane protein exposed at the periplasmic surface. J. Bacteriol. 179:453-462.
60. Dardanelli, M., J. Angelini, and A. Fabra. 2003. A calcium-dependent bacterial
surface protein is involved in the attachment of rhizobia to peanut roots. Can. J. Microbiol. 49:399-405.
61. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U S A 97:6640-6645.
62. De Lorenzo, V., and K. N. Timmis. 1994. Analysis and construction of stable
phenotypes in gram-negative bacteria with Tn5-and Tn10-derived minitransposons. Methods Enzymol. 235:386-405.
63. De, N., M. Pirruccello, P. V. Krasteva, N. Bae, R. V. Raghavan, and H.
Sondermann. 2008. Phosphorylation-independent regulation of the diguanylate cyclase WspR. PLoS Biol. 6:e67.
64. Dessaux, Y., A. Petit, S. K. Farrand, and P. J. Murphy. 1998. Opines and
opine-like molecules involved in plant-Rhizobiaceae interactions, p. 173-197, The Rhizobiaceae. Springer.
65. Dessaux, Y., A. Petit, and J. Tempé. 1992. Opines in Agrobacterium biology, p.
109-136. In D. P. S. Verma (ed.), Molecular signals in plant-microbe communications. CRC Press, Inc., Boca Raton, Fla.
197
66. Dimitrova, M., G. Younès-Cauet, P. Oertel-Buchheit, D. Porte, M. Schnarr, and M. Granger-Schnarr. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257:205-212.
67. Douglas, C., W. Halperin, M. Gordon, and E. Nester. 1985. Specific
attachment of Agrobacterium tumefaciens to bamboo cells in suspension cultures. J. Bacteriol. 161:764-766.
68. Douglas, C. J., W. Halperin, and E. W. Nester. 1982. Agrobacterium
tumefaciens mutants affected in attachment to plant cells. J. Bacteriol. 152:1265-1275.
69. Dow, J. M., L. Crossman, K. Findlay, Y. Q. He, J. X. Feng, and J. L. Tang.
2003. Biofilm dispersal in Xanthomonas campestris is controlled by cell-cell signaling and is required for full virulence to plants. Proc. Natl. Acad. Sci. U S A 100:10995-11000.
70. Dow, J. M., Y. Fouhy, J. F. Lucey, and R. P. Ryan. 2006. The HD-GYP
domain, cyclic di-GMP signaling, and bacterial virulence to plants. Mol. Plant Microbe Interact. 19:1378-1384.
71. Duerig, A., S. Abel, M. Folcher, M. Nicollier, T. Schwede, N. Amiot, B. Giese,
and U. Jenal. 2009. Second messenger-mediated spatiotemporal control of protein degradation regulates bacterial cell cycle progression. Genes Dev. 23:93-104.
72. Engstrom, P., P. Zambryski, M. Van Montagu, and S. Stachel. 1987.
Characterization of Agrobacterium tumefaciens virulence proteins induced by the plant factor acetosyringone. J. Mol. Biol. 197:635-645.
73. Farrand, S. K., P. B. Van Berkum, and P. Oger. 2003. Agrobacterium is a
definable genus of the family Rhizobiaceae. Int. J. Syst. Evol. Microbiol. 53:1681-1687.
74. Fujiwara, T., K. Komoda, N. Sakurai, K. Tajima, I. Tanaka, and M. Yao.
2013. The c-di-GMP recognition mechanism of the PilZ domain of bacterial cellulose synthase subunit A. Biochem. Biophys. Res. Commun. 431:802-807.
75. Fullner, K. J., J. C. Lara, and E. W. Nester. 1996. Pilus assembly by
Agrobacterium T-DNA transfer genes. Science 273:1107-1109. 76. Fullner, K. J., K. M. Stephens, and E. W. Nester. 1994. An essential virulence
protein of Agrobacterium tumefaciens, VirB4, requires an intact mononucleotide binding domain to function in transfer of T-DNA. Mol. Gen. Genet. 245:704-715.
198
77. Fuqua, C. 2008. Agrobacterium-Host Attachment and Biofilm Formation, p. 243-277. In T. Tzfira and V. Citovsky (ed.), Agrobacterium: From Biology to Biotechnology. Springer New York, New York City.
78. Galperin, M. Y., D. A. Natale, L. Aravind, and E. V. Koonin. 1999. A
specialized version of the HD hydrolase domain implicated in signal transduction. J. Mol. Microbiol. Biotechnol. 1:303-305.
79. Galperin, M. Y., A. N. Nikolskaya, and E. V. Koonin. 2001. Novel domains of
the prokaryotic two-component signal transduction systems. FEMS Microbiol. Lett. 203:11-21.
80. Gaspar, Y. M., J. Nam, C. J. Schultz, L. Y. Lee, P. R. Gilson, S. B. Gelvin,
and A. Bacic. 2004. Characterization of the Arabidopsis lysine-rich arabinogalactan-protein AtAGP17 mutant (rat1) that results in a decreased efficiency of agrobacterium transformation. Plant Physiol. 135:2162-2171.
81. Gelvin, S. B. 1998. Agrobacterium VirE2 proteins can form a complex with T
strands in the plant cytoplasm. J. Bacteriol. 180:4300-4302. 82. Gelvin, S. B. 2010. Plant proteins involved in Agrobacterium-mediated genetic
transformation. Annu. Rev. Phytopathol. 48:45-68. 83. Ghai, J., and A. Das. 1989. The virD operon of Agrobacterium tumefaciens Ti
plasmid encodes a DNA-relaxing enzyme. Proc. Natl. Acad. Sci. U S A 86:3109-3113.
84. Glickmann, E., L. Gardan, S. Jacquet, S. Hussain, M. Elasri, A. Petit, and Y.
Dessaux. 1998. Auxin production is a common feature of most pathovars of Pseudomonas syringae. Mol. Plant Microbe Interact. 11:156-162.
85. Goodner, B., G. Hinkle, S. Gattung, N. Miller, M. Blanchard, B. Qurollo, B.
S. Goldman, Y. Cao, M. Askenazi, C. Halling, L. Mullin, K. Houmiel, J. Gordon, M. Vaudin, O. Iartchouk, A. Epp, F. Liu, C. Wollam, M. Allinger, D. Doughty, C. Scott, C. Lappas, B. Markelz, C. Flanagan, C. Crowell, J. Gurson, C. Lomo, C. Sear, G. Strub, C. Cielo, and S. Slater. 2001. Genome sequence of the plant pathogen and biotechnology agent Agrobacterium tumefaciens C58. Science 294:2323-2328.
86. Goodner, B. W., B. P. Markelz, M. C. Flanagan, C. B. Crowell, Jr., J. L.
Racette, B. A. Schilling, L. M. Halfon, J. S. Mellors, and G. Grabowski. 1999. Combined genetic and physical map of the complex genome of Agrobacterium tumefaciens. J. Bacteriol. 181:5160-5166.
199
87. Goymer, P., S. G. Kahn, J. G. Malone, S. M. Gehrig, A. J. Spiers, and P. B. Rainey. 2006. Adaptive divergence in experimental populations of Pseudomonas fluorescens. II. Role of the GGDEF regulator WspR in evolution and development of the wrinkly spreader phenotype. Genetics 173:515-526.
88. Gromov, B. V. 1967. "Star-forming bacteria" accompanying algae in cultures.
Vestn. Leningr. Univ. Biol. 3:133-143. 89. Hallez, R., J. Mignolet, V. Van Mullem, M. Wery, J. Vandenhaute, J. J.
Letesson, C. Jacobs-Wagner, and X. De Bolle. 2007. The asymmetric distribution of the essential histidine kinase PdhS indicates a differentiation event in Brucella abortus. EMBO J. 26:1444-1455.
90. Hamilton, R. H., and M. Z. Fall. 1971. The loss of tumor-initiating ability in
Agrobacterium tumefaciens by incubation at high temperature. Cell. Mol. Life Sci. 27:229-230.
91. Harada, T., M. Masada, K. Fujimori, and I. Maeda. 1966. Production of a
firm, resilient gel-forming polysaccharide by a mutant of Alcaligenes faecalis var. myxogenes 10 C3. Agricul. Biol. Chem. 30:196-198.
92. Hardy, G. G., R. C. Allen, E. Toh, M. Long, P. J. Brown, J. L. Cole-Tobian,
and Y. V. Brun. 2010. A localized multimeric anchor attaches the Caulobacter holdfast to the cell pole. Mol. Microbiol. 76:409-427.
93. Hecht, G. B., T. Lane, N. Ohta, J. M. Sommer, and A. Newton. 1995. An
essential single domain response regulator required for normal cell division and differentiation in Caulobacter crescentus. EMBO J. 14:3915-3924.
94. Hecht, G. B., and A. Newton. 1995. Identification of a novel response regulator
required for the swarmer-to-stalked-cell transition in Caulobacter crescentus. J. Bacteriol. 177:6223-6229.
95. Herrera-Estrella, A., Z. M. Chen, M. Van Montagu, and K. Wang. 1988.
VirD proteins of Agrobacterium tumefaciens are required for the formation of a covalent DNA--protein complex at the 5' terminus of T-strand molecules. EMBO J. 7:4055-4062.
96. Heumann, W. 1968. Conjugation in starforming Rhizobium lupini. Mol. Gen.
Genet. 102:132-144. 97. Hickman, J. W., D. F. Tifrea, and C. S. Harwood. 2005. A chemosensory
system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc. Natl. Acad. Sci. U S A 102:14422-14427.
200
98. Holmes, B., and P. Roberts. 1981. The classification, identification and nomenclature of Agrobacteria. J. Appl. Bacteriol. 50:443-467.
99. Howard, E. A., J. R. Zupan, V. Citovsky, and P. C. Zambryski. 1992. The
VirD2 protein of A. tumefaciens contains a C-terminal bipartite nuclear localization signal: implications for nuclear uptake of DNA in plant cells. Cell 68:109-118.
100. Huang, M. L., G. A. Cangelosi, W. Halperin, and E. W. Nester. 1990. A
chromosomal Agrobacterium tumefaciens gene required for effective plant signal transduction. J. Bacteriol. 172:1814-1822.
101. Huang, Y., P. Morel, B. Powell, and C. I. Kado. 1990. VirA, a coregulator of
Ti-specified virulence genes, is phosphorylated in vitro. J. Bacteriol. 172:1142-1144.
102. Huangyutitham, V., Z. T. Guvener, and C. S. Harwood. 2013. Subcellular
clustering of the phosphorylated WspR response regulator protein stimulates its diguanylate cyclase activity. mBio 4:e00242-00213.
103. Hung, D. Y., and L. Shapiro. 2002. A signal transduction protein cues
proteolytic events critical to Caulobacter cell cycle progression. Proc. Natl. Acad. Sci. U S A 99:13160-13165.
104. Iniesta, A. A., and L. Shapiro. 2008. A bacterial control circuit integrates polar
localization and proteolysis of key regulatory proteins with a phospho-signaling cascade. Proc. Natl. Acad. Sci. U S A 105:16602-16607.
105. Jacobs, C., D. Hung, and L. Shapiro. 2001. Dynamic localization of a
cytoplasmic signal transduction response regulator controls morphogenesis during the Caulobacter cell cycle. Proc. Natl. Acad. Sci. U S A 98:4095-4100.
106. Jenal, U. 2004. Cyclic di-guanosine-monophosphate comes of age: a novel
secondary messenger involved in modulating cell surface structures in bacteria? Curr. Opin. Microbiol. 7:185-191.
107. Jenal, U., and J. Malone. 2006. Mechanisms of cyclic-di-GMP signaling in
bacteria. Annu. Rev. Genet. 40:385-407. 108. Jensen, C. O. 1918. Undersøgelser vedrørende nogle svulstlignende dannelser
hos planter. In D. Kgl (ed.), Veterinaer-og Landbohøjskoles Arasskrift. 109. Jin, S. G., T. Komari, M. P. Gordon, and E. W. Nester. 1987. Genes
responsible for the supervirulence phenotype of Agrobacterium tumefaciens A281. J. Bacteriol. 169:4417-4425.
201
110. Jin, S. G., T. Roitsch, P. J. Christie, and E. W. Nester. 1990. The regulatory VirG protein specifically binds to a cis-acting regulatory sequence involved in transcriptional activation of Agrobacterium tumefaciens virulence genes. J. Bacteriol. 172:531-537.
111. Kalogeraki, V. S., and S. C. Winans. 1997. Suicide plasmids containing
promoterless reporter genes can simultaneously disrupt and create fusions to target genes of diverse bacteria. Gene 188:69-75.
112. Kalogeraki, V. S., and S. C. Winans. 1998. Wound-released chemical signals
may elicit multiple responses from an Agrobacterium tumefaciens strain containing an octopine-type Ti plasmid. J. Bacteriol. 180:5660-5667.
113. Kalogeraki, V. S., J. Zhu, J. L. Stryker, and S. C. Winans. 2000. The right end
of the vir region of an octopine-type Ti plasmid contains four new members of the vir regulon that are not essential for pathogenesis. J. Bacteriol. 182:1774-1778.
114. Keane, P. J., A. Kerr, and P. B. New. 1970. Crown gall of stone fruit II.
Identification and nomenclature of Agrobacterium isolates. Aust. J. Biol. Sci. 23:585-596.
115. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved
broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197.
116. Kerr, A. 1971. Acquisition of virulence by non-pathogenic isolates of
Agrobacterium radiobacter. Physiol. Plant Pathol. 1:241-246. 117. Kerr, A. 1969. Transfer of Virulence between Isolates of Agrobacterium. Nature
223:1175-1176. 118. Kerr, A., P. Manigault, and J. Tempe. 1977. Transfer of virulence in vivo and
in vitro in Agrobacterium. Nature 265:560-561. 119. Kerr, A., and W. P. Roberts. 1976. Agrobacterium - Correlations between and
transfer of pathogenicity, octopine and nopaline metabolism and bacteriocin 84 sensitivity. Physiol. Plant Pathol. 9:205-211.
120. Kerr, J. E., and P. J. Christie. 2010. Evidence for VirB4-mediated dislocation
of membrane-integrated VirB2 pilin during biogenesis of the Agrobacterium VirB/VirD4 type IV secretion system. J. Bacteriol. 192:4923-4934.
121. Kersters, K., and J. De Ley. 1984. Genus III. Agrobacterium Conn 1942, p. 244-
254. In N. R. Krieg (ed.), Bergey’s Manual of Systematic Bacteriology, vol. 1. Williams & Wilkins.
202
122. Kersters, K., J. De Ley, P. H. A. Sneath, and M. Sackin. 1973. Numerical Taxonomic Analysis of Agrobacterium. J. Gen. Microbiol. 78:227-239.
123. Khan, S. R., J. Gaines, R. M. Roop, 2nd, and S. K. Farrand. 2008. Broad-
host-range expression vectors with tightly regulated promoters and their use to examine the influence of TraR and TraM expression on Ti plasmid quorum sensing. Appl. Environ. Microbiol. 74:5053-5062.
124. Kim, J., J. E. Heindl, and C. Fuqua. 2013. Coordination of division and
development influences complex multicellular behavior in Agrobacterium tumefaciens. PloS one 8:e56682.
125. Kim, S. I., Veena, and S. B. Gelvin. 2007. Genome-wide analysis of
Agrobacterium T-DNA integration sites in the Arabidopsis genome generated under non-selective conditions. Plant J. 51:779-791.
126. Klose, K. E., D. S. Weiss, and S. Kustu. 1993. Glutamate at the site of
phosphorylation of nitrogen-regulatory protein NTRC mimics aspartyl-phosphate and activates the protein. J. Mol. Biol. 232:67-78.
127. Ko, J., K. S. Ryu, H. Kim, J. S. Shin, J. O. Lee, C. Cheong, and B. S. Choi.
2010. Structure of PP4397 reveals the molecular basis for different c-di-GMP binding modes by PilZ domain proteins. J. Mol. Biol. 398:97-110.
128. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M.
Roop, 2nd, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176.
129. Kulasakara, H., V. Lee, A. Brencic, N. Liberati, J. Urbach, S. Miyata, D. G.
Lee, A. N. Neely, M. Hyodo, Y. Hayakawa, F. M. Ausubel, and S. Lory. 2006. Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')-cyclic-GMP in virulence. Proc. Natl. Acad. Sci. U S A 103:2839-2844.
130. Kurtz, H. D., Jr., and J. Smit. 1992. Analysis of a Caulobacter crescentus gene
cluster involved in attachment of the holdfast to the cell. J. Bacteriol. 174:687-694.
131. Kurtz, H. D., Jr., and J. Smit. 1994. The Caulobacter crescentus holdfast:
identification of holdfast attachment complex genes. FEMS Microbiol. Lett. 116:175-182.
132. Lacroix, B., A. Loyter, and V. Citovsky. 2008. Association of the
Agrobacterium T-DNA-protein complex with plant nucleosomes. Proc. Natl. Acad. Sci. U S A 105:15429-15434.
203
133. Lacroix, B., M. Vaidya, T. Tzfira, and V. Citovsky. 2005. The VirE3 protein of
Agrobacterium mimics a host cell function required for plant genetic transformation. EMBO J. 24:428-437.
134. Lai, E. M., and C. I. Kado. 1998. Processed VirB2 is the major subunit of the
promiscuous pilus of Agrobacterium tumefaciens. J. Bacteriol. 180:2711-2717. 135. Lai, E. M., and C. I. Kado. 2000. The T-pilus of Agrobacterium tumefaciens.
Trends Microbiol. 8:361-369. 136. Lam, H., J. Y. Matroule, and C. Jacobs-Wagner. 2003. The asymmetric spatial
distribution of bacterial signal transduction proteins coordinates cell cycle events. Dev. Cell 5:149-159.
137. Lam, H., W. B. Schofield, and C. Jacobs-Wagner. 2006. A landmark protein
essential for establishing and perpetuating the polarity of a bacterial cell. Cell 124:1011-1023.
138. Lan, C. Y., and M. M. Igo. 1998. Differential expression of the OmpF and
OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR. J. Bacteriol. 180:171-174.
139. Laus, M. C., T. J. Logman, G. E. Lamers, A. A. Van Brussel, R. W. Carlson,
and J. W. Kijne. 2006. A novel polar surface polysaccharide from Rhizobium leguminosarum binds host plant lectin. Mol. Microbiol. 59:1704-1713.
140. Laus, M. C., A. A. van Brussel, and J. W. Kijne. 2005. Role of cellulose fibrils
and exopolysaccharides of Rhizobium leguminosarum in attachment to and infection of Vicia sativa root hairs. Mol. Plant Microbe Interact. 18:533-538.
141. Lee, E. R., J. L. Baker, Z. Weinberg, N. Sudarsan, and R. R. Breaker. 2010.
An allosteric self-splicing ribozyme triggered by a bacterial second messenger. Science 329:845-848.
142. Lee, V. T., J. M. Matewish, J. L. Kessler, M. Hyodo, Y. Hayakawa, and S.
Lory. 2007. A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Mol. Microbiol. 65:1474-1484.
143. Li, G., P. J. Brown, J. X. Tang, J. Xu, E. M. Quardokus, C. Fuqua, and Y. V.
Brun. 2012. Surface contact stimulates the just-in-time deployment of bacterial adhesins. Mol. Microbiol. 83:41-51.
144. Li, J., M. Vaidya, C. White, A. Vainstein, V. Citovsky, and T. Tzfira. 2005.
Involvement of KU80 in T-DNA integration in plant cells. Proc. Natl. Acad. Sci. U S A 102:19231-19236.
204
145. Li, P. L., I. Hwang, H. Miyagi, H. True, and S. K. Farrand. 1999. Essential
components of the Ti plasmid trb system, a type IV macromolecular transporter. J. Bacteriol. 181:5033-5041.
146. Lioret, C. l. 1956. Sur la mise en evidence d’un acide amine non identifie
particulier aux tissus de ‘crown-gall’. Bull. Soc. Fr. Physiol. Veg. 2:76. 147. Lippincott, B. B., and J. A. Lippincott. 1969. Bacterial attachment to a specific
wound site as an essential stage in tumor initiation by Agrobacterium tumefaciens. J. Bacteriol. 97:620-628.
148. Lippincott, B. B., M. H. Whatley, and J. A. Lippincott. 1977. Tumor induction
by Agrobacterium involves attachment of the bacterium to a site on the host plant cell wall. Plant Physiol. 59:388-390.
149. Lippincott, J. A., R. Beiderbeck, and B. B. Lippincott. 1973. Utilization of
octopine and nopaline by Agrobacterium. J. Bacteriol. 116:378-383. 150. Luo, Z. Q., T. E. Clemente, and S. K. Farrand. 2001. Construction of a
derivative of Agrobacterium tumefaciens C58 that does not mutate to tetracycline resistance. Mol. Plant Microbe Interact. 14:98-103.
151. Luo, Z. Q., and S. K. Farrand. 2001. The Agrobacterium tumefaciens rnd
homolog is required for TraR-mediated quorum-dependent activation of Ti plasmid tra gene expression. J. Bacteriol. 183:3919-3930.
152. Malone, J. G., R. Williams, M. Christen, U. Jenal, A. J. Spiers, and P. B.
Rainey. 2007. The structure-function relationship of WspR, a Pseudomonas fluorescens response regulator with a GGDEF output domain. Microbiology 153:980-994.
153. Marks, M. E., C. M. Castro-Rojas, C. Teiling, L. Du, V. Kapatral, T. L.
Walunas, and S. Crosson. 2010. The genetic basis of laboratory adaptation in Caulobacter crescentus. J. Bacteriol. 192:3678-3688.
154. Massie, J. P., E. L. Reynolds, B. J. Koestler, J. P. Cong, M. Agostoni, and C.
M. Waters. 2012. Quantification of high-specificity cyclic diguanylate signaling. Proc. Natl. Acad. Sci. U S A 109:12746-12751.
155. Matthysse, A. G. 1987. Characterization of nonattaching mutants of
Agrobacterium tumefaciens. J. Bacteriol. 169:313-323. 156. Matthysse, A. G. 1983. Role of bacterial cellulose fibrils in Agrobacterium
tumefaciens infection. J. Bacteriol. 154:906-915.
205
157. Matthysse, A. G., K. V. Holmes, and R. H. Gurlitz. 1981. Elaboration of cellulose fibrils by Agrobacterium tumefaciens during attachment to carrot cells. J. Bacteriol. 145:583-595.
158. Matthysse, A. G., M. Marry, L. Krall, M. Kaye, B. E. Ramey, C. Fuqua, and
A. R. White. 2005. The effect of cellulose overproduction on binding and biofilm formation on roots by Agrobacterium tumefaciens. Mol. Plant Microbe Interact. 18:1002-1010.
159. Matthysse, A. G., and S. McMahan. 2001. The effect of the Agrobacterium
tumefaciens attR mutation on attachment and root colonization differs between legumes and other dicots. Appl. Environ. Microbiol. 67:1070-1075.
160. Matthysse, A. G., and S. McMahan. 1998. Root colonization by Agrobacterium
tumefaciens is reduced in cel, attB, attD, and attR mutants. Appl. Environ. Microbiol. 64:2341-2345.
161. Matthysse, A. G., D. L. Thomas, and A. R. White. 1995. Mechanism of
cellulose synthesis in Agrobacterium tumefaciens. J. Bacteriol. 177:1076-1081. 162. Matthysse, A. G., S. White, and R. Lightfoot. 1995. Genes required for
cellulose synthesis in Agrobacterium tumefaciens. J. Bacteriol. 177:1069-1075. 163. Matthysse, A. G., P. M. Wyman, and K. V. Holmes. 1978. Plasmid-dependent
attachment of Agrobacterium tumefaciens to plant tissue culture cells. Infect. Immun. 22:516-522.
164. Matthysse, A. G., H. Yarnall, S. B. Boles, and S. McMahan. 2000. A region of
the Agrobacterium tumefaciens chromosome containing genes required for virulence and attachment to host cells. Biochim. Biophys. Acta 1490:208-212.
165. Matthysse, A. G., H. A. Yarnall, and N. Young. 1996. Requirement for genes
with homology to ABC transport systems for attachment and virulence of Agrobacterium tumefaciens. J. Bacteriol. 178:5302-5308.
166. Mayer, R., P. Ross, H. Weinhouse, D. Amikam, G. Volman, P. Ohana, R. D.
Calhoon, H. C. Wong, A. W. Emerick, and M. Benziman. 1991. Polypeptide composition of bacterial cyclic diguanylic acid-dependent cellulose synthase and the occurrence of immunologically crossreacting proteins in higher plants. Proc. Natl. Acad. Sci. U S A 88:5472-5476.
167. Merighi, M., V. T. Lee, M. Hyodo, Y. Hayakawa, and S. Lory. 2007. The
second messenger bis-(3'-5')-cyclic-GMP and its PilZ domain-containing receptor Alg44 are required for alginate biosynthesis in Pseudomonas aeruginosa. Mol. Microbiol. 65:876-895.
206
168. Merker, R. I., and J. Smit. 1988. Characterization of the adhesive holdfast of marine and freshwater caulobacters. Appl. Environ. Microbiol. 54:2078-2085.
169. Merriam, J. J., R. Mathur, R. Maxfield-Boumil, and R. R. Isberg. 1997.
Analysis of the Legionella pneumophila fliI gene: intracellular growth of a defined mutant defective for flagellum biosynthesis. Infect. Immun. 65:2497-2501.
170. Metcalf, W. W., W. H. Jiang, L. L. Daniels, S. K. Kim, A. Haldimann, and B.
L. Wanner. 1996. Conditionally replicative and conjugative plasmids carrying lacZ alpha for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35:1-13.
171. Mongiardini, E. J., N. Ausmees, J. Perez-Gimenez, M. Julia Althabegoiti, J.
Ignacio Quelas, S. L. Lopez-Garcia, and A. R. Lodeiro. 2008. The rhizobial adhesion protein RapA1 is involved in adsorption of rhizobia to plant roots but not in nodulation. FEMS Microbiol. Ecol. 65:279-288.
172. Morel, G. 1956. Métabolisme de l’arginine par les tissus de crown gall de
topinambour. Bull. Soc. Fr. Physiol. Veg. 2:76. 173. Morgan, J. L., J. Strumillo, and J. Zimmer. 2013. Crystallographic snapshot of
cellulose synthesis and membrane translocation. Nature 493:181-186. 174. Mousavi, S. A., J. Osterman, N. Wahlberg, X. Nesme, C. Lavire, L. Vial, L.
Paulin, P. de Lajudie, and K. Lindstrom. 2014. Phylogeny of the Rhizobium-Allorhizobium-Agrobacterium clade supports the delineation of Neorhizobium gen. nov. Syst. Appl. Microbiol.
175. Murillo, J., H. Shen, D. Gerhold, A. Sharma, D. A. Cooksey, and N. T. Keen.
1994. Characterization of pPT23B, the plasmid involved in syringolide production by Pseudomonas syringae pv. tomato PT23. Plasmid 31:275-287.
176. Mysore, K. S., B. Bassuner, X. B. Deng, N. S. Darbinian, A. Motchoulski, W.
Ream, and S. B. Gelvin. 1998. Role of the Agrobacterium tumefaciens VirD2 protein in T-DNA transfer and integration. Mol. Plant Microbe Interact. 11:668-683.
177. Nair, G. R., Z. Liu, and A. N. Binns. 2003. Reexamining the role of the
accessory plasmid pAtC58 in the virulence of Agrobacterium tumefaciens strain C58. Plant Physiol. 133:989-999.
178. Nakanishi, I., K. Kimura, S. Kusui, and E. Yamazaki. 1974. Complex
formation of gel-forming bacterial (1→3)-β-D-glucans (curdlan-type polysaccharides) with dyes in aqueous solution. Carbohydr. Res. 32:47-52.
207
179. Nakhamchik, A., C. Wilde, and D. A. Rowe-Magnus. 2008. Cyclic-di-GMP regulates extracellular polysaccharide production, biofilm formation, and rugose colony development by Vibrio vulnificus. Appl. Environ. Microbiol. 74:4199-4209.
180. Napoli, C., F. Dazzo, and D. Hubbell. 1975. Production of cellulose microfibrils
by Rhizobium. Appl. Microbiol. 30:123-131. 181. Navarro, M. V., N. De, N. Bae, Q. Wang, and H. Sondermann. 2009.
Structural analysis of the GGDEF-EAL domain-containing c-di-GMP receptor FimX. Structure 17:1104-1116.
182. O'Connor, J. R., N. J. Kuwada, V. Huangyutitham, P. A. Wiggins, and C. S.
Harwood. 2012. Surface sensing and lateral subcellular localization of WspA, the receptor in a chemosensory-like system leading to c-di-GMP production. Mol. Microbiol. 86:720-729.
183. Ohta, N., and A. Newton. 2003. The core dimerization domains of histidine
kinases contain recognition specificity for the cognate response regulator. J. Bacteriol. 185:4424-4431.
184. Omadjela, O., A. Narahari, J. Strumillo, H. Melida, O. Mazur, V. Bulone,
and J. Zimmer. 2013. BcsA and BcsB form the catalytically active core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis. Proc. Natl. Acad. Sci. U S A 110:17856-17861.
185. Ong, C. J., M. L. Wong, and J. Smit. 1990. Attachment of the adhesive holdfast
organelle to the cellular stalk of Caulobacter crescentus. J. Bacteriol. 172:1448-1456.
186. Ophel, K., and A. Kerr. 1990. Agrobacterium vitis sp. nov. for strains of
Agrobacterium biovar 3 from grapevines. Int. J. Syst. Bacteriol. 40:236-241. 187. Pansegrau, W., F. Schoumacher, B. Hohn, and E. Lanka. 1993. Site-specific
cleavage and joining of single-stranded DNA by VirD2 protein of Agrobacterium tumefaciens Ti plasmids: analogy to bacterial conjugation. Proc. Natl. Acad. Sci. U S A 90:11538-11542.
188. Paul, R., S. Abel, P. Wassmann, A. Beck, H. Heerklotz, and U. Jenal. 2007.
Activation of the diguanylate cyclase PleD by phosphorylation-mediated dimerization. J. Biol. Chem. 282:29170-29177.
189. Paul, R., T. Jaeger, S. Abel, I. Wiederkehr, M. Folcher, E. G. Biondi, M. T.
Laub, and U. Jenal. 2008. Allosteric regulation of histidine kinases by their cognate response regulator determines cell fate. Cell 133:452-461.
208
190. Paul, R., S. Weiser, N. C. Amiot, C. Chan, T. Schirmer, B. Giese, and U. Jenal. 2004. Cell cycle-dependent dynamic localization of a bacterial response regulator with a novel di-guanylate cyclase output domain. Genes Dev. 18:715-727.
191. Pazour, G. J., and A. Das. 1990. Characterization of the VirG binding site of
Agrobacterium tumefaciens. Nucleic Acids Res. 18:6909-6913. 192. Pazour, G. J., and A. Das. 1990. virG, an Agrobacterium tumefaciens
transcriptional activator, initiates translation at a UUG codon and is a sequence-specific DNA-binding protein. J. Bacteriol. 172:1241-1249.
193. Petit, A., S. Delhaye, J. Tempe, and G. Morel. 1970. Recherches sur les
guanidines des tissus de crown gall. Mise en evidence d'une relation biochimique specifique entre les souches d'Agrobacterium tumefaciens et les tumeurs qu'elles induisent. Physiol. Vég. 8:205-213.
194. Petit, A., J. Tempe, A. Kerr, M. Holsters, M. Van Montagu, and J. Schell.
1978. Substrate induction of conjugative activity of Agrobacterium tumefaciens Ti plasmids. Nature 271:570-572.
195. Pini, F., B. Frage, L. Ferri, N. J. De Nisco, S. S. Mohapatra, L. Taddei, A.
Fioravanti, F. Dewitte, M. Galardini, M. Brilli, V. Villeret, M. Bazzicalupo, A. Mengoni, G. C. Walker, A. Becker, and E. G. Biondi. 2013. The DivJ, CbrA and PleC system controls DivK phosphorylation and symbiosis in Sinorhizobium meliloti. Mol. Microbiol. 90:54-71.
196. Pratt, J. T., R. Tamayo, A. D. Tischler, and A. Camilli. 2007. PilZ domain
proteins bind cyclic diguanylate and regulate diverse processes in Vibrio cholerae. J. Biol. Chem. 282:12860-12870.
197. Pultz, I. S., M. Christen, H. D. Kulasekara, A. Kennard, B. Kulasekara, and
S. I. Miller. 2012. The response threshold of Salmonella PilZ domain proteins is determined by their binding affinities for c-di-GMP. Mol. Microbiol. 86:1424-1440.
198. Rashid, M. H., C. Rajanna, A. Ali, and D. K. Karaolis. 2003. Identification of
genes involved in the switch between the smooth and rugose phenotypes of Vibrio cholerae. FEMS Microbiol. Lett. 227:113-119.
199. Ream, W. 1989. Agrobacterium tumefaciens and interkingdom genetic exchange.
Annu. Rev. Phytopathol. 27:583-618. 200. Reisinger, S. J., S. Huntwork, P. H. Viollier, and K. R. Ryan. 2007. DivL
performs critical cell cycle functions in Caulobacter crescentus independent of kinase activity. J. Bacteriol. 189:8308-8320.
209
201. Reuhs, B. L., J. S. Kim, and A. G. Matthysse. 1997. Attachment of
Agrobacterium tumefaciens to carrot cells and Arabidopsis wound sites is correlated with the presence of a cell-associated, acidic polysaccharide. J. Bacteriol. 179:5372-5379.
202. Rogowsky, P. M., T. J. Close, J. A. Chimera, J. J. Shaw, and C. I. Kado.
1987. Regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiC58. J. Bacteriol. 169:5101-5112.
203. Romling, U. 2002. Molecular biology of cellulose production in bacteria. Res.
Microbiol. 153:205-212. 204. Romling, U., and D. Amikam. 2006. Cyclic di-GMP as a second messenger.
Curr. Opin. Microbiol. 9:218-228. 205. Romling, U., M. Y. Galperin, and M. Gomelsky. 2013. Cyclic di-GMP: the first
25 years of a universal bacterial second messenger. Microbiol. Mol. Biol. Rev. 77:1-52.
206. Romling, U., M. Gomelsky, and M. Y. Galperin. 2005. C-di-GMP: the dawning
of a novel bacterial signalling system. Mol. Microbiol. 57:629-639. 207. Romling, U., M. Rohde, A. Olsen, S. Normark, and J. Reinkoster. 2000.
AgfD, the checkpoint of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least two independent pathways. Mol. Microbiol. 36:10-23.
208. Ross, P., Y. Aloni, C. Weinhouse, D. Michaeli, P. Weinberger-Ohana, R.
Meyer, and M. Benziman. 1985. An unusual guanyl oligonucleotide regulates cellulose synthesis in Acetobacter xylinum. FEBS Lett. 186:191-196.
209. Ross, P., R. Mayer, and M. Benziman. 1991. Cellulose biosynthesis and
function in bacteria. Microbiol. Rev. 55:35-58. 210. Ross, P., R. Mayer, H. Weinhouse, D. Amikam, Y. Huggirat, M. Benziman,
E. de Vroom, A. Fidder, P. de Paus, and L. A. Sliedregt. 1990. The cyclic diguanylic acid regulatory system of cellulose synthesis in Acetobacter xylinum. Chemical synthesis and biological activity of cyclic nucleotide dimer, trimer, and phosphothioate derivatives. J. Biol. Chem. 265:18933-18943.
211. Ross, P., H. Weinhouse, Y. Aloni, D. Michaeli, P. Weinberger-Ohana, R.
Mayer, S. Braun, E. de Vroom, G. A. van der Marel, J. H. van Boom, and M. Benziman. 1987. Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature 325:279-281.
210
212. Ruffing, A. M., and R. R. Chen. 2012. Transcriptome profiling of a curdlan-producing Agrobacterium reveals conserved regulatory mechanisms of exopolysaccharide biosynthesis. Microb. Cell Fact. 11:17.
213. Ruger, H. J., and M. G. Hofle. 1992. Marine star-shaped-aggregate-forming
bacteria: Agrobacterium atlanticum sp. nov.; Agrobacterium meteori sp. nov.; Agrobacterium ferrugineum sp. nov., nom. rev.; Agrobacterium gelatinovorum sp. nov., nom. rev.; and Agrobacterium stellulatum sp. nov., nom. rev. Int. J. Syst. Bacteriol. 42:133-143.
214. Ryan, R. P., Y. Fouhy, J. F. Lucey, L. C. Crossman, S. Spiro, Y. W. He, L. H.
Zhang, S. Heeb, M. Camara, P. Williams, and J. M. Dow. 2006. Cell-cell signaling in Xanthomonas campestris involves an HD-GYP domain protein that functions in cyclic di-GMP turnover. Proc. Natl. Acad. Sci. U S A 103:6712-6717.
215. Ryder, M. H., M. E. Tate, and G. P. Jones. 1984. Agrocinopine A, a tumor-
inducing plasmid-coded enzyme product, is a phosphodiester of sucrose and L-arabinose. J. Biol. Chem. 259:9704-9710.
216. Ryjenkov, D. A., R. Simm, U. Romling, and M. Gomelsky. 2006. The PilZ
domain is a receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in enterobacteria. J. Biol. Chem. 281:30310-30314.
217. Ryjenkov, D. A., M. Tarutina, O. V. Moskvin, and M. Gomelsky. 2005.
Cyclic diguanylate is a ubiquitous signaling molecule in bacteria: insights into biochemistry of the GGDEF protein domain. J. Bacteriol. 187:1792-1798.
218. Sagulenko, E., V. Sagulenko, J. Chen, and P. J. Christie. 2001. Role of
Agrobacterium VirB11 ATPase in T-pilus assembly and substrate selection. J. Bacteriol. 183:5813-5825.
219. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning, vol. 2.
Cold Spring Harbor Laboratory Press, New York City, NY. 220. Sanders, D. A., B. L. Gillece-Castro, A. M. Stock, A. L. Burlingame, and D.
E. Koshland, Jr. 1989. Identification of the site of phosphorylation of the chemotaxis response regulator protein, CheY. J. Biol. Chem. 264:21770-21778.
221. Savka, M. A., and S. K. Farrand. 1992. Mannityl opine accumulation and
exudation by transgenic tobacco. Plant. Physiol. 98:784-789. 222. Saxena, I. M., and R. M. Brown, Jr. 1995. Identification of a second cellulose
synthase gene (acsAII) in Acetobacter xylinum. J. Bacteriol. 177:5276-5283.
211
223. Saxena, I. M., K. Kudlicka, K. Okuda, and R. M. Brown, Jr. 1994. Characterization of genes in the cellulose-synthesizing operon (acs operon) of Acetobacter xylinum: implications for cellulose crystallization. J. Bacteriol. 176:5735-5752.
224. Schmidt-Eisenlohr, H., N. Domke, C. Angerer, G. Wanner, P. C. Zambryski,
and C. Baron. 1999. Vir proteins stabilize VirB5 and mediate its association with the T pilus of Agrobacterium tumefaciens. J. Bacteriol. 181:7485-7492.
225. Schmidt, A. J., D. A. Ryjenkov, and M. Gomelsky. 2005. The ubiquitous
protein domain EAL is a cyclic diguanylate-specific phosphodiesterase: enzymatically active and inactive EAL domains. J. Bacteriol. 187:4774-4781.
226. Schneeberger, R. G., K. Zhang, T. Tatarinova, M. Troukhan, S. F. Kwok, J.
Drais, K. Klinger, F. Orejudos, K. Macy, A. Bhakta, J. Burns, G. Subramanian, J. Donson, R. Flavell, and K. A. Feldmann. 2005. Agrobacterium T-DNA integration in Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene promoter regions. Funct. Integr. Genomics 5:240-253.
227. Schrammeijer, B., E. Risseeuw, W. Pansegrau, T. J. Regensburg-Tuink, W.
L. Crosby, and P. J. Hooykaas. 2001. Interaction of the virulence protein VirF of Agrobacterium tumefaciens with plant homologs of the yeast Skp1 protein. Curr. Biol. 11:258-262.
228. Schroder, G., S. Waffenschmidt, E. W. Weiler, and J. Schroder. 1984. The T-
region of Ti plasmids codes for an enzyme synthesizing indole-3-acetic acid. Eur. J. Biochem. 138:387-391.
229. Shaw, C. H., M. D. Watson, G. H. Carter, and C. H. Shaw. 1984. The right
hand copy of the nopaline Ti-plasmid 25 bp repeat is required for tumour formation. Nucleic Acids Res. 12:6031-6041.
230. Shin, J. S., K. S. Ryu, J. Ko, A. Lee, and B. S. Choi. 2011. Structural
characterization reveals that a PilZ domain protein undergoes substantial conformational change upon binding to cyclic dimeric guanosine monophosphate. Protein Sci. 20:270-277.
231. Simm, R., M. Morr, A. Kader, M. Nimtz, and U. Romling. 2004. GGDEF and
EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol. Microbiol. 53:1123-1134.
232. Simone, M., C. A. McCullen, L. E. Stahl, and A. N. Binns. 2001. The carboxy-
terminus of VirE2 from Agrobacterium tumefaciens is required for its transport to host cells by the virB-encoded type IV transport system. Mol. Microbiol. 41:1283-1293.
212
233. Simpson, R. B., P. J. O'Hara, W. Kwok, A. L. Montoya, C. Lichtenstein, M.
P. Gordon, and E. W. Nester. 1982. DNA from the A6S/2 crown gall tumor contains scrambled Ti-plasmid sequences near its junctions with plant DNA. Cell 29:1005-1014.
234. Slater, S. C., B. S. Goldman, B. Goodner, J. C. Setubal, S. K. Farrand, E. W.
Nester, T. J. Burr, L. Banta, A. W. Dickerman, I. Paulsen, L. Otten, G. Suen, R. Welch, N. F. Almeida, F. Arnold, O. T. Burton, Z. Du, A. Ewing, E. Godsy, S. Heisel, K. L. Houmiel, J. Jhaveri, J. Lu, N. M. Miller, S. Norton, Q. Chen, W. Phoolcharoen, V. Ohlin, D. Ondrusek, N. Pride, S. L. Stricklin, J. Sun, C. Wheeler, L. Wilson, H. Zhu, and D. W. Wood. 2009. Genome sequences of three Agrobacterium biovars help elucidate the evolution of multichromosome genomes in bacteria. J. Bacteriol. 191:2501-2511.
235. Slauch, J. M., and T. J. Silhavy. 1991. cis-acting ompF mutations that result in
OmpR-dependent constitutive expression. J. Bacteriol. 173:4039-4048. 236. Smit, G., J. W. Kijne, and B. J. Lugtenberg. 1987. Involvement of both
cellulose fibrils and a Ca2+-dependent adhesin in the attachment of Rhizobium leguminosarum to pea root hair tips. J. Bacteriol. 169:4294-4301.
237. Smit, G., J. W. Kijne, and B. J. Lugtenberg. 1989. Roles of flagella,
lipopolysaccharide, and a Ca2+-dependent cell surface protein in attachment of Rhizobium leguminosarum biovar viciae to pea root hair tips. J. Bacteriol. 171:569-572.
238. Smit, G., T. J. Logman, M. E. Boerrigter, J. W. Kijne, and B. J. Lugtenberg.
1989. Purification and partial characterization of the Rhizobium leguminosarum biovar viciae Ca2+-dependent adhesin, which mediates the first step in attachment of cells of the family Rhizobiaceae to plant root hair tips. J. Bacteriol. 171:4054-4062.
239. Smit, G., S. Swart, B. J. Lugtenberg, and J. W. Kijne. 1992. Molecular
mechanisms of attachment of Rhizobium bacteria to plant roots. Mol. Microbiol. 6:2897-2903.
240. Smith, C. S., A. Hinz, D. Bodenmiller, D. E. Larson, and Y. V. Brun. 2003.
Identification of genes required for synthesis of the adhesive holdfast in Caulobacter crescentus. J. Bacteriol. 185:1432-1442.
241. Smith, E. F., and C. O. Townsend. 1907. A Plant-Tumor of Bacterial Origin.
Science 25:671-673.
213
242. Sommer, J. M., and A. Newton. 1989. Turning off flagellum rotation requires the pleiotropic gene pleD: pleA, pleC, and pleD define two morphogenic pathways in Caulobacter crescentus. J. Bacteriol. 171:392-401.
243. Sondermann, H., N. J. Shikuma, and F. H. Yildiz. 2012. You've come a long
way: c-di-GMP signaling. Curr. Opin. Microbiol. 15:140-146. 244. Spiers, A. J., J. Bohannon, S. M. Gehrig, and P. B. Rainey. 2003. Biofilm
formation at the air-liquid interface by the Pseudomonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. Mol. Microbiol. 50:15-27.
245. Spiers, A. J., S. G. Kahn, J. Bohannon, M. Travisano, and P. B. Rainey. 2002.
Adaptive divergence in experimental populations of Pseudomonas fluorescens. I. Genetic and phenotypic bases of wrinkly spreader fitness. Genetics 161:33-46.
246. Srivastava, D., and C. M. Waters. 2012. A tangled web: regulatory connections
between quorum sensing and cyclic di-GMP. J. Bacteriol. 194:4485-4493. 247. Stachel, S. E., and E. W. Nester. 1986. The genetic and transcriptional
organization of the vir region of the A6 Ti plasmid of Agrobacterium tumefaciens. EMBO J. 5:1445-1454.
248. Stachel, S. E., B. Timmerman, and P. Zambryski. 1987. Activation of
Agrobacterium tumefaciens vir gene expression generates multiple single-stranded T-strand molecules from the pTiA6 T-region: requirement for 5' virD gene products. EMBO J. 6:857-863.
249. Stasinopoulos, S. J., P. R. Fisher, B. A. Stone, and V. A. Stanisich. 1999.
Detection of two loci involved in (1-->3)-beta-glucan (curdlan) biosynthesis by Agrobacterium sp. ATCC31749, and comparative sequence analysis of the putative curdlan synthase gene. Glycobiology 9:31-41.
250. Steck, T. R., T. S. Lin, and C. I. Kado. 1990. VirD2 gene product from the
nopaline plasmid pTiC58 has at least two activities required for virulence. Nucleic Acids Res. 18:6953-6958.
251. Stephens, K. M., C. Roush, and E. Nester. 1995. Agrobacterium tumefaciens
VirB11 protein requires a consensus nucleotide-binding site for function in virulence. J. Bacteriol. 177:27-36.
252. Su, S., B. B. Stephens, G. Alexandre, and S. K. Farrand. 2006. Lon protease of
the alpha-proteobacterium Agrobacterium tumefaciens is required for normal growth, cellular morphology and full virulence. Microbiology 152:1197-1207.
214
253. Sudarsan, N., E. R. Lee, Z. Weinberg, R. H. Moy, J. N. Kim, K. H. Link, and R. R. Breaker. 2008. Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science 321:411-413.
254. Swart, S., B. J. Lugtenberg, G. Smit, and J. W. Kijne. 1994. Rhicadhesin-
mediated attachment and virulence of an Agrobacterium tumefaciens chvB mutant can be restored by growth in a highly osmotic medium. J. Bacteriol. 176:3816-3819.
255. Swart, S., G. Smit, B. J. Lugtenberg, and J. W. Kijne. 1993. Restoration of
attachment, virulence and nodulation of Agrobacterium tumefaciens chvB mutants by rhicadhesin. Mol. Microbiol. 10:597-605.
256. Sykes, L. C., and A. G. Matthysse. 1986. Time required for tumor induction by
Agrobacterium tumefaciens. Appl. Environ. Microbiol. 52:597-598. 257. Tal, R., H. C. Wong, R. Calhoon, D. Gelfand, A. L. Fear, G. Volman, R.
Mayer, P. Ross, D. Amikam, H. Weinhouse, A. Cohen, S. Sapir, P. Ohana, and M. Benziman. 1998. Three cdg operons control cellular turnover of cyclic di-GMP in Acetobacter xylinum: genetic organization and occurrence of conserved domains in isoenzymes. J. Bacteriol. 180:4416-4425.
258. Tamayo, R., J. T. Pratt, and A. Camilli. 2007. Roles of cyclic diguanylate in
the regulation of bacterial pathogenesis. Annu. Rev. Microbiol. 61:131-148. 259. Teather, R. M., and P. J. Wood. 1982. Use of Congo red-polysaccharide
interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl. Environ. Microbiol. 43:777-780.
260. Tempé, J., P. Guyon, D. Tepfer, and A. Petit. 1979. The role of opines in the
ecology of the Ti plasmids of Agrobacterium, p. 353-363. In K. N. T. a. A. Puhler (ed.), Plasmids of Medical, Environmental and Commercial Importance. Elsevier/North Holland Biomedical Press, Amsterdam, The Netherlands.
261. Tempé, J., and A. Petit. 1983. La piste des opines, p. 14-32, Molecular genetics
of the bacteria-plant interaction. Springer-Verlag, New York. 262. Thanassi, D. G., J. B. Bliska, and P. J. Christie. 2012. Surface organelles
assembled by secretion systems of Gram-negative bacteria: diversity in structure and function. FEMS Microbiol. Rev. 36:1046-1082.
263. Thomashow, L. S., S. Reeves, and M. F. Thomashow. 1984. Crown gall
oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid. Proc. Natl. Acad. Sci. U S A 81:5071-5075.
215
264. Thomashow, M. F., S. Hugly, W. G. Buchholz, and L. S. Thomashow. 1986. Molecular basis for the auxin-independent phenotype of crown gall tumor tissues. Science 231:616-618.
265. Thompson, D. V., L. S. Melchers, K. B. Idler, R. A. Schilperoort, and P. J.
Hooykaas. 1988. Analysis of the complete nucleotide sequence of the Agrobacterium tumefaciens virB operon. Nucleic Acids Res. 16:4621-4636.
266. Tinland, B., F. Schoumacher, V. Gloeckler, A. M. Bravo-Angel, and B. Hohn.
1995. The Agrobacterium tumefaciens virulence D2 protein is responsible for precise integration of T-DNA into the plant genome. EMBO J. 14:3585-3595.
267. Tomlinson, A. D., and C. Fuqua. 2009. Mechanisms and regulation of polar
surface attachment in Agrobacterium tumefaciens. Curr. Opin. Microbiol. 12:708-714.
268. Tsokos, C. G., B. S. Perchuk, and M. T. Laub. 2011. A dynamic complex of
signaling proteins uses polar localization to regulate cell-fate asymmetry in Caulobacter crescentus. Dev. Cell 20:329-341.
269. Tzfira, T., M. Vaidya, and V. Citovsky. 2004. Involvement of targeted
proteolysis in plant genetic transformation by Agrobacterium. Nature 431:87-92. 270. Tzfira, T., M. Vaidya, and V. Citovsky. 2001. VIP1, an Arabidopsis protein that
interacts with Agrobacterium VirE2, is involved in VirE2 nuclear import and Agrobacterium infectivity. EMBO J. 20:3596-3607.
271. Updegraff, D. M. 1969. Semimicro determination of cellulose in biological
materials. Anal. Biochem. 32:420-424. 272. Vaghchhipawala, Z. E., B. Vasudevan, S. Lee, M. R. Morsy, and K. S.
Mysore. 2012. Agrobacterium may delay plant nonhomologous end-joining DNA repair via XRCC4 to favor T-DNA integration. The Plant cell 24:4110-4123.
273. van Attikum, H., P. Bundock, and P. J. Hooykaas. 2001. Non-homologous
end-joining proteins are required for Agrobacterium T-DNA integration. EMBO J. 20:6550-6558.
274. Van Larebeke, N., G. Engler, M. Holsters, S. Van den Elsacker, I. Zaenen, R.
A. Schilperoort, and J. Schell. 1974. Large plasmid in Agrobacterium tumefaciens essential for crown gall-inducing ability. Nature 252:169-170.
275. Vergunst, A. C., B. Schrammeijer, A. den Dulk-Ras, C. M. de Vlaam, T. J.
Regensburg-Tuink, and P. J. Hooykaas. 2000. VirB/D4-dependent protein translocation from Agrobacterium into plant cells. Science 290:979-982.
216
276. Vogel, A. M., and A. Das. 1992. Mutational analysis of Agrobacterium tumefaciens virD2: tyrosine 29 is essential for endonuclease activity. J. Bacteriol. 174:303-308.
277. Vogel, A. M., J. Yoon, and A. Das. 1995. Mutational analysis of a conserved
motif of Agrobacterium tumefaciens VirD2. Nucleic Acids Res. 23:4087-4091. 278. Wan, Z., P. J. Brown, E. N. Elliott, and Y. V. Brun. 2013. The adhesive and
cohesive properties of a bacterial polysaccharide adhesin are modulated by a deacetylase. Mol. Microbiol. 88:486-500.
279. Wang, K., L. Herrera-Estrella, M. Van Montagu, and P. Zambryski. 1984.
Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome. Cell 38:455-462.
280. Wang, K., S. E. Stachel, B. Timmerman, V. A. N. M. M, and P. C.
Zambryski. 1987. Site-Specific Nick in the T-DNA Border Sequence as a Result of Agrobacterium vir Gene Expression. Science 235:587-591.
281. Ward, J. E., D. E. Akiyoshi, D. Regier, A. Datta, M. P. Gordon, and E. W.
Nester. 1988. Characterization of the virB operon from an Agrobacterium tumefaciens Ti plasmid. J. Biol. Chem. 263:5804-5814.
282. Watson, B., T. C. Currier, M. P. Gordon, M. D. Chilton, and E. W. Nester.
1975. Plasmid required for virulence of Agrobacterium tumefaciens. J. Bacteriol. 123:255-264.
283. Weinhouse, H., S. Sapir, D. Amikam, Y. Shilo, G. Volman, P. Ohana, and M.
Benziman. 1997. c-di-GMP-binding protein, a new factor regulating cellulose synthesis in Acetobacter xylinum. FEBS Lett. 416:207-211.
284. Whatley, M. H., J. S. Bodwin, B. B. Lippincott, and J. A. Lippincott. 1976.
Role of Agrobacterium cell envelope lipopolysaccharide in infection site attachment. Infect. Immun. 13:1080-1083.
285. White, L. O. 1972. The taxonomy of the crown-gall organism Agrobacterium
tumefaciens and its relationship to Rhizobia and other Agrobacteria. J. Gen. Microbiol. 72:565-574.
286. White, P. R., and A. C. Braun. 1942. A cancerous neoplasm of plants -
Autonomous bacteria-free crown-gall tissue. Cancer. Res. 2:597-617.
217
287. Whitney, J. C., K. M. Colvin, L. S. Marmont, H. Robinson, M. R. Parsek, and P. L. Howell. 2012. Structure of the cytoplasmic region of PelD, a degenerate diguanylate cyclase receptor that regulates exopolysaccharide production in Pseudomonas aeruginosa. J. Biol. Chem. 287:23582-23593.
288. Whitney, J. C., and P. L. Howell. 2013. Synthase-dependent exopolysaccharide
secretion in Gram-negative bacteria. Trends Microbiol. 21:63-72. 289. Wibberg, D., J. Blom, S. Jaenicke, F. Kollin, O. Rupp, B. Scharf, S.
Schneiker-Bekel, R. Sczcepanowski, A. Goesmann, J. C. Setubal, R. Schmitt, A. Puhler, and A. Schluter. 2011. Complete genome sequencing of Agrobacterium sp. H13-3, the former Rhizobium lupini H13-3, reveals a tripartite genome consisting of a circular and a linear chromosome and an accessory plasmid but lacking a tumor-inducing Ti-plasmid. J. Biotechnol. 155:50-62.
290. Winans, S. C. 1990. Transcriptional induction of an Agrobacterium regulatory
gene at tandem promoters by plant-released phenolic compounds, phosphate starvation, and acidic growth media. J. Bacteriol. 172:2433-2438.
291. Wong, H. C., A. L. Fear, R. D. Calhoon, G. H. Eichinger, R. Mayer, D.
Amikam, M. Benziman, D. H. Gelfand, J. H. Meade, and A. W. Emerick. 1990. Genetic organization of the cellulose synthase operon in Acetobacter xylinum. Proc. Natl. Acad. Sci. U S A 87:8130-8134.
292. Wood, D. W., J. C. Setubal, R. Kaul, D. E. Monks, J. P. Kitajima, V. K.
Okura, Y. Zhou, L. Chen, G. E. Wood, N. F. Almeida, Jr., L. Woo, Y. Chen, I. T. Paulsen, J. A. Eisen, P. D. Karp, D. Bovee, Sr., P. Chapman, J. Clendenning, G. Deatherage, W. Gillet, C. Grant, T. Kutyavin, R. Levy, M. J. Li, E. McClelland, A. Palmieri, C. Raymond, G. Rouse, C. Saenphimmachak, Z. Wu, P. Romero, D. Gordon, S. Zhang, H. Yoo, Y. Tao, P. Biddle, M. Jung, W. Krespan, M. Perry, B. Gordon-Kamm, L. Liao, S. Kim, C. Hendrick, Z. Y. Zhao, M. Dolan, F. Chumley, S. V. Tingey, J. F. Tomb, M. P. Gordon, M. V. Olson, and E. W. Nester. 2001. The genome of the natural genetic engineer Agrobacterium tumefaciens C58. Science 294:2317-2323.
293. Xu, J., J. Kim, T. Danhorn, P. M. Merritt, and C. Fuqua. 2012. Phosphorus
limitation increases attachment in Agrobacterium tumefaciens and reveals a conditional functional redundancy in adhesin biosynthesis. Res. Microbiol. 163:674-684.
294. Xu, J., J. Kim, B. J. Koestler, J. H. Choi, C. M. Waters, and C. Fuqua. 2013.
Genetic analysis of Agrobacterium tumefaciens unipolar polysaccharide production reveals complex integrated control of the motile-to-sessile switch. Mol. Microbiol. 89:929-948.
218
295. Yanofsky, M. F., S. G. Porter, C. Young, L. M. Albright, M. P. Gordon, and E. W. Nester. 1986. The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease. Cell 47:471-477.
296. Young, C., and E. W. Nester. 1988. Association of the virD2 protein with the 5'
end of T strands in Agrobacterium tumefaciens. J. Bacteriol. 170:3367-3374. 297. Young, J. M., L. D. Kuykendall, E. Martinez-Romero, A. Kerr, and H.
Sawada. 2001. A revision of Rhizobium Frank 1889, with an emended description of the genus, and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. 1998 as new combinations: Rhizobium radiobacter, R. rhizogenes, R. rubi, R. undicola and R. vitis. Int. J Syst. Evol. Microbiol. 51:89-103.
298. Young, J. P., L. C. Crossman, A. W. Johnston, N. R. Thomson, Z. F.
Ghazoui, K. H. Hull, M. Wexler, A. R. Curson, J. D. Todd, P. S. Poole, T. H. Mauchline, A. K. East, M. A. Quail, C. Churcher, C. Arrowsmith, I. Cherevach, T. Chillingworth, K. Clarke, A. Cronin, P. Davis, A. Fraser, Z. Hance, H. Hauser, K. Jagels, S. Moule, K. Mungall, H. Norbertczak, E. Rabbinowitsch, M. Sanders, M. Simmonds, S. Whitehead, and J. Parkhill. 2006. The genome of Rhizobium leguminosarum has recognizable core and accessory components. Genome Biol. 7:R34.
299. Yuan, Q., A. Carle, C. Gao, D. Sivanesan, K. A. Aly, C. Hoppner, L. Krall, N.
Domke, and C. Baron. 2005. Identification of the VirB4-VirB8-VirB5-VirB2 pilus assembly sequence of type IV secretion systems. J. Biol. Chem. 280:26349-26359.
300. Zaenen, I., N. Van Larebeke, H. Teuchy, M. Van Montagu, and J. Schell.
1974. Supercoiled circular DNA in crown-gall inducing Agrobacterium strains. J. Mol. Biol. 86:109-127.
301. Zaltsman, A., A. Krichevsky, A. Loyter, and V. Citovsky. 2010.
Agrobacterium induces expression of a host F-box protein required for tumorigenicity. Cell host & microbe 7:197-209.
302. Zevenhuizen, L. P., C. Bertocchi, and A. R. van Neerven. 1986. Congo red
absorption and cellulose synthesis by Rhizobiaceae. Antonie van Leeuwenhoek 52:381-386.
303. Zhu, Y., J. Nam, N. C. Carpita, A. G. Matthysse, and S. B. Gelvin. 2003.
Agrobacterium-mediated root transformation is inhibited by mutation of an Arabidopsis cellulose synthase-like gene. Plant Physiol. 133:1000-1010.
219
304. Zhu, Y., J. Nam, J. M. Humara, K. S. Mysore, L. Y. Lee, H. Cao, L. Valentine, J. Li, A. D. Kaiser, A. L. Kopecky, H. H. Hwang, S. Bhattacharjee, P. K. Rao, T. Tzfira, J. Rajagopal, H. Yi, Veena, B. S. Yadav, Y. M. Crane, K. Lin, Y. Larcher, M. J. Gelvin, M. Knue, C. Ramos, X. Zhao, S. J. Davis, S. I. Kim, C. T. Ranjith-Kumar, Y. J. Choi, V. K. Hallan, S. Chattopadhyay, X. Sui, A. Ziemienowicz, A. G. Matthysse, V. Citovsky, B. Hohn, and S. B. Gelvin. 2003. Identification of Arabidopsis rat mutants. Plant Physiol. 132:494-505.
305. Zipfel, C., G. Kunze, D. Chinchilla, A. Caniard, J. Jones, T. Boller, and G.
Felix. 2006. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125:749-760.
306. Zogaj, X., W. Bokranz, M. Nimtz, and U. Romling. 2003. Production of
cellulose and curli fimbriae by members of the family Enterobacteriaceae isolated from the human gastrointestinal tract. Infect. Immun. 71:4151-4158.
307. Zogaj, X., M. Nimtz, M. Rohde, W. Bokranz, and U. Romling. 2001. The
multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39:1452-1463.
308. Zorreguieta, A., R. A. Geremia, S. Cavaignac, G. A. Cangelosi, E. W. Nester,
and R. A. Ugalde. 1988. Identification of the product of an Agrobacterium tumefaciens chromosomal virulence gene. Mol. Plant Microbe Interact. 1:121-127.
309. Zupan, J. R., V. Citovsky, and P. Zambryski. 1996. Agrobacterium VirE2
protein mediates nuclear uptake of single-stranded DNA in plant cells. Proc. Natl. Acad. Sci. U S A 93:2392-2397.
220
