Drug Metabolism & Disposition - Pharmacokinetic …dmd.aspetjournals.org/content/dmd/early/2009/10/15/dmd...2009/10/15 · clinical drug-drug interactions caused by CYP3A4 enzyme

DMD 29637

1

Evaluation of Cynomolgus Monkey PXR, Primary Hepatocyte and In Vivo

Pharmacokinetic Changes in Predicting Human CYP3A4 Induction

Sean Kim, Joseph E. Dinchuk, Monique N. Anthony, Tami Orcutt, Mary E. Zoeckler, Mary

B. Sauer, Kathleen W. Mosure, Ragini Vuppugalla, James E. Grace Jr., Jean

Simmermacher, Heidi A. Dulac, Jennifer Pizzano and Michael Sinz

Metabolism and Pharmacokinetics (S.K., M.E.Z., K.W.M., J.E.G., J.S. and M.S.), Lead

Discovery (M.N.A.), Discovery Toxicology (T.O. and J.P.) and Veterinary Science (M.B.S.

and H.A.D.), Bristol-Myers Squibb Company, Wallingford, CT; Discovery Biology-

Oncology (J.E.D.) and Metabolism and Pharmacokinetics (R.V.), Bristol-Myers Squibb

Company, Lawrenceville, NJ

DMD Fast Forward. Published on October 15, 2009 as doi:10.1124/dmd.109.029637

Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637

at ASPE

T Journals on June 1, 2020

dmd.aspetjournals.org

Dow

nloaded from

http://dmd.aspetjournals.org/

DMD 29637

2

RUNNING TITLE:

Characterization of CYP3A induction in cynomolgus monkey

Corresponding author:

Sean Kim, Ph.D.

Metabolism and Pharmacokinetics

Bristol-Myers Squibb

5 Research Parkway

Wallingford, CT 06492

Email: [email protected]

Telephone: (203) 677-6147

Fax: (203) 677-6193

The number of text pages: 25

The number of tables: 3

The number of figures: 5

The number of references: 26

The number of words in abstract: 242

The number of words in introduction: 723

The number of words in discussion: 1432


at ASPE



Dow

nloaded from


DMD 29637

3

ABBREVIATIONS:

AUC, area under the plasma concentration-time curve; cynoPXR, cynomolgus monkey

PXR; CYP, cytochrome P450; DMSO, dimethylsulfoxide; PXR, pregnane X receptor;

ADME, absorption, distribution, metabolism and elimination; MDZ, midazolam; LBD,

ligand-binding domain; DMEM, Dulbecco’s Modified Eagle’s Media; CAR, constitutive

androstane receptor; SJW, St. John’s Wort; CITCO, 6-(4-chlorophenyl)imidazo;

[1,3]thiazole-5-carbaldehyde O-3,4-dichlorobenzyl) oxime; TCPOBOP, 1,4-bis[2-(3,5-

dichloropyridyloxy)]benzene; PCN, pregnenolone 16α-carbonitrile; Cmax, maximum plasma

concentration


at ASPE



Dow

nloaded from


DMD 29637

4

ABSTRACT

Monkeys have been proposed as an animal model to predict the magnitude of human

clinical drug-drug interactions caused by CYP3A4 enzyme induction. To evaluate whether

the cynomolgus monkey can be an effective in vivo model, human CYP3A4 inducers were

evaluated both in vitro and in vivo. First, a full-length PXR was cloned from the cynomolgus

monkey and the sequence compared to those of rhesus monkey and human PXR.

Cynomolgus and rhesus monkey PXR differed by only one amino acid (Ala68Val) and both

were highly homologous to human PXR (~ 96 %). When the transactivation profiles of 30

compounds including known inducers of CYP3A4 were compared between cynomolgus and

human PXR, a high degree of correlation with EC50 values was observed. These results

suggest that cynomolgus and human PXR respond in a similar fashion to these ligands.

Second, two known human CYP3A4 inducers, rifampicin and hyperforin, were tested in

monkey and human primary hepatocytes for induction of CYP3A enzymes. Both monkey

and human hepatocytes responded similarly to the inducers and resulted in increased RNA

and enzyme activity changes of CYP3A8 and CYP3A4, respectively. Lastly, in vivo

induction of CYP3A8 by rifampicin and hyperforin was demonstrated by significant

reductions of midazolam exposure which were comparable to those in humans. These results

demonstrate that the cynomolgus monkey can be a predictive in vivo animal model of PXR-

mediated induction of human CYP3A4 and can provide a useful assessment of the resulting

pharmacokinetic changes of affected drugs.


at ASPE



Dow

nloaded from


DMD 29637

5

INTRODUCTION

Induction of cytochrome P450 (CYP) enzymes can result in serious drug-drug

interactions through loss of therapeutic efficacy or increased toxicity and is considered one

of the major liabilities during the treatment of disease states involving multiple drug

regimens (Lin, 2006). Drug-drug interactions involving CYP3A4 are of particular

importance because of its significant involvement in metabolizing over 50% of marketed

drugs. Thus, the elimination of this liability through proper screening as well as accurately

predicting the magnitude of CYP3A4 induction in patients has been a long standing pursuit

in preclinical development.

Non-human primates, including cynomolgus (Macaca fascicularis) and rhesus

monkeys (Macaca mulatta), have been used in pharmaceutical development as preclinical

models of drug safety, drug metabolism and pharmacokinetics as their absorption,

distribution, metabolism and elimination (ADME) properties are closely related to humans

(Akahori et al., 2005). For example, it has been shown that both cynomolgus and rhesus

monkey CYP2E1 and CYP2C activities are similar to the human isoforms (Sharer et al.,

1995; Zuber et al., 2002). The recently cloned rhesus CYP3A64 was also characterized and

found to be similar to human CYP3A4 in its amino acid sequence (93% homology) and

enzyme kinetics (Carr et al., 2006). Monkey and human intestinal microsomes also show

similar enzyme kinetic profiles for testosterone 6β-hydroxylation, suggesting a comparable

intestinal first pass metabolism by CYP3A substrates (Komura and Iwaki, 2007).

Collectively, these findings have led to the use of monkeys as an in vivo model to estimate

the absorption and first-pass hepatic or intestinal extraction of xenobiotics (Ward et al.,

2004; Ogasawara et al., 2007). Monkeys have also been used to study CYP3A enzyme

inhibition and the resulting drug-drug interactions in vivo between midazolam and CYP3A


at ASPE



Dow

nloaded from


DMD 29637

6

inhibitors such as ketoconazole, erythromycin, diltiazem as well as several preclinical

development candidates (Kanazu et al., 2004; Prueksaritanont et al., 2006; Zhang et al.,

2007).

The use of non-human primate as a surrogate animal model to study human CYP

induction has also been gradually increasing. In vivo studies with cynomolgus monkeys

revealed that hepatic CYP1A, CYP2B and CYP3A enzymes are inducible in response to

human CYP inducers (Bullock et al., 1995; Lee et al., 2006). In a recent study with rhesus

monkeys, rifampicin, a human CYP3A4 inducer, markedly induced CYP3A64 mRNA and

midazolam-1’-hydroxylase activity in primary hepatocytes and demonstrated a significant

reduction in midazolam exposure in vivo (Prueksaritanont et al., 2006). Also, the induction

profiles of CYP1A and CYP3A mRNA expression in primary cynomolgus monkey

hepatocytes were closer to those in primary human hepatocytes compared to rat hepatocytes

(Nishimura et al., 2007). The similarities in CYP induction responses, especially with

CYP3A between rhesus monkeys and humans, can be explained by the fact that their ligand-

binding domains (LBDs) of the pregnane X receptor (PXR, NR1a2) share relatively high

sequence homology (~96 %) (Moore et al., 2002). Therefore, monkey PXR is expected to

exhibit similar ligand-specificity to human PXR (hPXR). This is in contrast to the rodent

PXR where the relatively large differences in sequence homology and ligand binding

affinities between human and rodent PXR has complicated the extrapolation of rodent

induction responses to human drug-drug interactions (Gonzalez and Yu, 2006). Overall,

these similarities in ADME as well as induction properties favor the use of the monkey as an

in vivo animal model to assess the CYP3A4 induction potential of new chemical entities.

This study investigated whether the cynomolgus monkey can be an effective in vivo

surrogate animal model for predicting human CYP3A4 induction potential. The first step to


at ASPE



Dow

nloaded from


DMD 29637

7

validate such animal model was to evaluate human CYP3A4 inducers in in vitro assays

derived from the cynomolgus monkey, namely PXR transactivation and primary

hepatocytes, to confirm that induction responses from these in vitro assays are comparable

to the corresponding assays of human origin. Our laboratory cloned the full-length cynoPXR

and incorporated it into a transactivation assay. Subsequently, thirty compounds including

known inducers of human CYP3A4 were evaluated in both human and monkey PXR

transactivation assays. In addition, the induction responses of two known CYP3A4 inducers,

rifampicin and hyperforin, were evaluated in freshly-isolated primary hepatocytes from

cynomolgus monkey and human donors. Lastly, in vivo drug-drug interactions between

CYP3A4/CYP3A8 substrate (midazolam) and inducers (rifampicin and hyperforin) were

assessed in cynomolgus monkeys to establish whether the induction of CYP3A8 in monkey

can result in midazolam pharmacokinetic changes comparable to those observed in humans

at therapeutic doses and/or plasma exposures.


at ASPE



Dow

nloaded from


DMD 29637

8

MATERIALS AND METHODS

Chemicals and Reagents. Hyperforin-DHCA was purchased from Alexis Biochemicals

(Lausen, Switzerland). Celecoxib, rosiglitazone, and terbinafine were obtained from Sequoia

Research Products (Oxon, UK). Midazolam hydrochloride syrup (2 mg/ml) was obtained

from Roxanne Laboratories, Inc (Columbus, OH). 1’- and 4’-Hydroxymidazolam were

purchased from BD Gentest (Woburn, MA). All cell culture media and reagents were

obtained from Invitrogen (Rockville, MA) including LipofectamineTM 2000 and

charcoal/dextran-treated fetal bovine serum (FBS). Alamar-Blue reagent was purchased

from Trek Diagnostics (Cleveland, OH). All other chemicals including rifampicin were of

analytical or HPLC grade and were purchased from Sigma-Aldrich (St. Louis, MO). St.

John’s Wort (SJW, 300 mg containing 0.3 % hypericin) capsules were purchased from GNC

Corporation (Pittsburgh, PA). LC/MS-MS analysis of ethanolic extracts of SJW showed that

each 300 mg SJW capsule contained 0.29 ± 0.02 % (w/w) hyperforin or 0.87 mg per

capsule.

Molecular Cloning of Cynomolgus Monkey PXR. A cynomolgus monkey liver cDNA

panel was purchased from the Biochain Institute (Hayward, CA). Forward (nucleotide 1-27)

and reverse (1274-1305) primers were selected based upon a rhesus monkey PXR

(AF454671) sequence with the exception that CTG at the translation start site was

substituted with ATG. Using an Advantage2™ PCR kit (Beckton-Dickinson, San Jose, CA),

the primary cDNA sequences were amplified by reverse transcription and a total of nine

putative full-length (1.3 kb) cynomolgus PXR clones were selected for sequencing. Raw

sequence data was processed using an Applied Biosystems 3730 Sequencer (Foster City,

CA) and imported into the Sequencher program (Genecodes, Ann Arbor, MI) for alignment

and editing. The consensus cynomolgus PXR was then cloned into the CMV-based


at ASPE



Dow

nloaded from


DMD 29637

9

mammalian expression vector pcDNA3.1 from Invitrogen Corporation (Carlsbad, CA).

Contigs were imported into the Vector NTI program (Invitrogen Corporation) where

sequences were compared, translated and aligned and displayed using the AlignX tool.

Cynomolgus Monkey and Human PXR Transactivation Assays. Human PXR (hPXR)

and cynomolgus monkey PXR (cynoPXR) transactivation assays were performed following

the protocol described previously (Zhu et al., 2007) with the exception that the cynoPXR

was expressed in African-Green Monkey kidney cells (CV-1) instead of HepG2 cells.

Briefly, cells were plated in T-175 flasks with DMEM containing 10% fetal bovine serum to

achieve ~80% confluency one day prior to transfection. On the day of transfection, 20 μg of

CYP3A-luciferase vector and 1 μg of either cyno- or hPXR vector were premixed with

LipofectamineTM 2000 reagent for each flask and incubated for 30 min at room temperature.

The transfection mixture was then added to the cells and incubated for 24 hr. Following the

removal of transfection mixture, HepG2 and CV-1 cells were resuspended to a final

concentration of 1.6 x 105 cells/ml in DMEM media supplemented with 5%

charcoal/dextran-stripped FBS, 200 mM L-glutamine, 100 mM sodium pyruvate, and 10

mM non-essential amino acids. The transfected HepG2 and CV-1 cells were plated into 384-

well plates at a density of 8,000 cells per well. The plates already contained test articles that

were serially diluted in DMSO at a ratio of 1:3 to achieve ten final concentrations ranging

from 2.5 nM to 50 μM (0.5% DMSO v/v) in triplicates. Rifampicin (10 μM final

concentration) was included in all assay plates as a positive control. After an overnight

incubation in a 5% CO2 incubator at 37oC, Alamar Blue reagent was added to each well.

Plates were then incubated for 2 hr at 37 °C and then 1 hr at room temperature after which

fluorescence was read at ex525/em598 to evaluate cytotoxicity of the test articles. The CC50

(concentration causing 50% cytotoxicity) was reported. The luciferase activities were then


at ASPE



Dow

nloaded from


DMD 29637

10

measured on a ViewluxTM (Perkin Elmer, Boston, MA) following the addition of Steady-

GloTM reagent from Promega (Madison, WI). The raw data were normalized against the

signal from 10 μM rifampicin and were expressed as a percent activation (%Act) at each

concentration.

100X(DMSO)SignalBlankn)(rifampiciSignalTotal

(DMSO)SignalBlankSignalCompound%Act

−−=

Emax and EC50 were reported from non-linear regression of concentration-response (%Act)

curves using the 4-parameter Hill equation.

Cynomolgus Monkey and Human Primary Hepatocytes. Freshly isolated cynomolgus

monkey (3 donors) and human primary hepatocytes (3 donors) were obtained from either

CellzDirect (Durham, NC) or Celsis (Chicago, IL) in 24-well collagen-coated plates. Upon

receipt of the cells, the transport media was replaced with a serum-free William’s E media

containing supplements provided by CellzDirect. Following a 24-hr acclimation,

hepatocytes were treated for three consecutive days with either DMSO, rifampicin, or

hyperforin. The media was replaced daily with fresh media containing the test articles in

DMSO (0.1% v/v). The concentrations for rifampicin ranged from 0.78 to 50 μM and

hyperforin was tested at concentrations ranging from 0.01 to 6.25 μM. The hepatocytes were

then washed once with pre-warmed Krebs-Henseleit buffer and incubated with 25 μM

midazolam for 15 min (monkey hepatocytes) or 60 min (human hepatocytes). Metabolite

formation was linear at the midazolam concentration and incubation times used in the

assays. The media was collected in microcentrifuge tubes containing a half-volume of ice-

cold acetonitrile containing an internal standard (0.5 μM terfenadine) to stop the enzymatic

reaction. Protein was separated from the mixture by centrifugation at 10000 rpm for 10 min

and the supernatant was used to quantitate the formation of 1-hydroxymidazolam by


at ASPE



Dow

nloaded from


DMD 29637

11

LC/MS-MS. The remaining monolayer of hepatocytes was incubated with lysis buffer from

a SV-96TM RNA purification kit (Promega, Madison, WI) and total RNA was purified from

the lysate following the manufacturer’s protocol.

TaqmanTM Real-Time RTPCR. TaqmanTM real-time RT-PCR was used to measure

expression levels of monkey CYP3A8 and human CYP3A4 mRNA using custom designed

primers and a FAM-MGB probe. The sequences used for monkey CYP3A8 were as follows:

Forward Primer: TGCAGGAGGAAATTGATACAGTTTT; Reverse Primer: TC-

GAGATACTCCATCTGTAGCACAGT; and Probe: CCCAATAAGGCACCACCCACCT-

ATGA. For human CYP3A4, the following sequences were used: Forward Primer: TGGT-

GAATGAA-ACGCTCAGATT; Reverse Primer: CATCTTTTTTGCAGACCCTCTCA; and

Probe: TTCCCAATTGCTATGAGAC. Ribosomal 18S RNA was used as an endogenous

control. Each RNA sample was analyzed in triplicate and ~10 ng/ul of RNA was used in a

one-step RT-PCR reaction. The RT reactions were performed for 30 min at 48°C. The PCR

reactions were then started at 95°C for 10 min followed by 40 amplification cycles of 15 sec

at 95°C and 1 min at 60°C. Relative quantification was determined via the ΔΔCT method

using the SDS 2.3 software (Applied Biosystems, Foster City, CA).

Pharmacokinetics Drug-Drug Interaction Studies in Cynomolgus Monkey. The in vivo

study, approved by Bristol-Myers Squibb Animal Care and Use Committee, was carried out

in three male cynomolgus monkeys (4-8 kg). On day 0 and day 7, each monkey received 2

mg/kg midazolam hydrochloride syrup by oral gavage followed by a sterile water rinse and

blood samples were collected at 0.25, 0.5, 0.75, 1, 2, 4, 6, 7, 8 and 24 hr post dose in K2-

EDTA containing tubes. Following the centrifugation of blood samples for 3 min at 13000

rpm, the resultant plasma was stored at -20°C until analysis. On days 1 thru 6, each monkey

received an oral dose of 15 mg/kg rifampicin (as a suspension in PEG-400) or a single


at ASPE



Dow

nloaded from


DMD 29637

12

capsule of SJW (300 mg) daily. On day 3 and day 6, blood was withdrawn from each

monkey to determine plasma levels of hyperforin (1 hr post dose) or rifampicin (2 hr post

dose). Throughout the study, monkeys were fasted before each dose of midazolam, SJW or

rifampicin.

LC/MS-MS Analysis of Midazolam, 1’- and 4’-Hydroxymidazolam, Hyperforin and

Rifampicin. For the analysis of midazolam, 1’-hydroxymidazolam, 4-hydroxymidazolam

and rifampicin from monkey plasma, a 25 µL aliquot was extracted into 100 µL of quench

solution (90% acetonitrile:10% isopropyl alcohol containing 0.5 µM terfenadine as internal

standard) while a 50 µL aliquot of plasma was extracted into 200 µL of quench solution

(100% acetonitrile with 0.1% formic acid containing 0.5 µM of terfenadine) for the analysis

of hyperforin. Following protein precipitation using a strata impact protein precipitation

plate (Phenomenex®, Torrance, CA), the supernatants were injected into an API4000 Q-

Trap (Applied Biosystems, Foster City, CA) triple quadruple mass spectrometer. The HPLC

system consisted of two LC-20AD (Shimadzu, Norwell, MD) delivery pumps and a SIL-

HTc autosampler or an Agilent 1200 coupled with a HTS PAL autoinjecter system (Leap

Technologies, Carrboro, NC). The mobile phase, which consisted of 0.1% formic acid in

water (A) and 0.1% formic acid in acetonitrile (B) was delivered at a flow rate of 0.4 ml/min

with the gradient condition as follows: the proportions of mobile phases A and B at 0, 3, 3.5,

4.5, 4.6, and 6 min where 95/5, 50/50, 0/100, 0/100, 95/5, and 95/5, respectively.

LC/MS/MS analysis was carried out using multiple reaction monitoring transitions for each

test compound: midazolam (326 � 291), 1’-hydroxymidazolam (342 � 324), 4’-

hydroxymidazolam (342 � 297), rifampicin (823 � 791), hyperforin (535.2 � 313.2) and

terfenadine (472 � 436). Standard curves were fit with a linear regression weighted by


at ASPE



Dow

nloaded from


DMD 29637

13

reciprocal concentration (1/x2) weighting. Calibration ranges were from 5 to 10000 nM for

all analytes except hyperforin which was 0.2 to 125 nM.

Pharmacokinetic and Statistical Analysis. Pharmacokinetic analysis of plasma

concentrations of midazolam and its metabolites vs. time profiles were performed by non-

compartmental analysis using Kinetica v4.4 software (Thermo Fisher Scientific, Waltham,

MA). Statistical analyses including linear and nonlinear-regression and calculation of

confidence interval were performed using GraphPad Prism v4.0 for Windows (GraphPad

Software, San Diego, CA).


at ASPE



Dow

nloaded from


DMD 29637

14

RESULTS

Molecular Cloning and Sequencing of Cynomolgus Monkey PXR. The full-length

cynomolgus monkey PXR sequence has been deposited to GenBank and was assigned the

accession number of GQ412289. The consensus cynoPXR sequence showed two amino-

acid residue differences at Cys182 and Glu189 in the ligand binding domain when it was

compared to the previously published partial cynoPXR sequence (EU153253) which has Tyr

and Arg at the same positions, respectively (Milnes et al., 2008). It also demonstrated two

wobble base pair changes relative to the rhesus PXR sequence at nucleotide positions 354

and 1158 of the open reading frame (not shown). One non-wobble base pair change in the

DNA binding domain was also noted in relation to the rhesus and human PXR and resulted

in a conservative amino acid substitution (Ala68Val) located within the DNA binding

domain as shown in Fig. 1. Except for this change, both rhesus and cynomolgus monkey

PXRs are identical in their amino acid sequences and are highly homologous to the human

orthologue (96%). Within the ligand binding domain, 11 amino acids were found to be

different between human and monkey PXR (consensus between cyno- and rhesus);

Leu184Met, Ser200Asn, Cys207Trp, Leu209Val, Leu213Val, Ser231Asn, Ser256Asn,

Ala280Thr, Thr311Pro, Leu357Val and Pro369Tyr.

Evaluation of Known CYP3A Inducers in Cynomolgus Monkey and Human PXR

Transactivation Assays. Among the thirty compounds tested in both hPXR and cynoPXR

transactivation assays, hyperforin was the most potent activator of human and monkey PXR

with EC50 values of 0.04 and 0.08 μM, respectively. SR-12813 was the second most potent

with EC50 values of 0.16 (hPXR) and 0.63 μM (cynoPXR). All other known activators of

hPXR such as clotrimzole, rosiglitazone, glimepride, ritonavir, pioglitazone, verapamil,


at ASPE



Dow

nloaded from


DMD 29637

15

artemisinin, terbinafine, troleandomycin, troglitazone, mifepristone and carbamezepine

activated both cyno- and human PXR equally and their EC50 values are in good agreement

between two species. While all these compounds demonstrated similar affinities to PXR for

both species, rifampicin appeared to be the stronger activator of hPXR (EC50 = 0.84 μM)

than cynoPXR (EC50 = 5.1 μM) as shown in Fig. 2 and Table 1. Similar differences (less

affinity for cynoPXR) were observed with several other compounds including 1, 9-

dideoxyforkskolin, paclitaxel, nifedipine and celecoxib. However, the differences exhibited

by these compounds were less prominent (2-4 fold) than rifampicin (~6-fold). The most

noticeable differences in terms of maximum PXR activation were exhibited by reserpine and

sulfinpyrazone. The Emax values for reserpine and sulfinpyrzone were 103 and 73 % for

hPXR and 16 and 11 % for cynoPXR. Both compounds thus appear to be more potent

human PXR activators among the compounds tested. As shown in Table 1, negative control

compounds, methotrexate and probenecid, did not elicit any significant activation of PXR

up to 50 μM, regardless of the species tested. Pregnenolone 16α-carbonitrile (PCN), a

potent rodent CYP3A inducer, was shown to be a moderate PXR activator in both species

with an EC50 of approximately 25 μM. Dexamethasone, another potent rodent CYP3A

inducer, did not transactivate hPXR or cynoPXR. Phenytoin, meclizine, TCPOBOP and

CITCO are all known as preferential CAR activators, however, in our study all three

compounds activated PXR in both species. Phenobarbital, another CAR activator, did not

transactivate PXR up to 50 μM. In order to assess which parameter would yield the best

correlation of PXR transactivation between the two species, linear regression analyses were

performed with EC50, Emax and intrinsic induction activity (IIA, EC50/Emax) values obtained

from both assays. The initial estimates of correlation coefficients were 0.71, 0.49 and 0.99


at ASPE



Dow

nloaded from


DMD 29637

16

for EC50, Emax and IIA, respectively. However, when both reserpine and sufinpyrazone were

excluded from the analyses due to their differential affinity for cyno- and human PXR, the

correlation coefficients for EC50 and Emax improved to 0.93 and 0.64, respectively (Fig. 3).

IIA values were found to be well correlated between hPXR and cynoPXR transactivation

assays (R2 = 0.99) regardless of the inclusion of reserpine and sufinpyrazone. As shown in

Fig. 3, most of the data points were plotted within the 95 % confidence interval lines,

suggesting that most of the compounds tested have a reasonably similar affinity for PXR in

both species. Most of the compounds tested in the assays were relatively non-cytotoxic up to

50 μM (Supplemental Table 1). Hyperforin was tested from 0.025 to 1 μM due to

cytotoxicity at concentrations above 1 μM.

CYP3A Induction in Cynomolgus Monkey and Human Primary Hepatocytes with

Rifampicin and Hyperforin. Both rifampicin and hyperforin, a known CYP3A4 inducers,

increased CYP3A RNA expression and activity (midazolam-1-hydroxylation) in primary

hepatocytes from cynomolgus monkey and human in a concentration-dependent manner

(Fig.4). The normalized rifampicin concentration-response curves for CYP3A8 RNA

expression and the activity in 3 preparations of monkey hepatocytes were almost super-

imposable to those of CYP3A4 RNA expression and activity in human hepatocytes from 3

individual donors. Non-linear regression analysis (Table 3) of the concentration-response

curves showed that the maximum induction of CYP3A8 (100-151.1 and 101.2-104.5 %RIF

for RNA and activity, respectively) was within the range shown by three human donors

(131-177.5 %RIF and 107.5-116.8 %RIF for RNA and activity, respectively). This result is

consistent with PXR transactivation profiles where the maximum transactivation by

rifampicin was similar between the species. While rifampicin appears to be a more potent

activator of human PXR, there were no significant differences in EC50 values between


at ASPE



Dow

nloaded from


DMD 29637

17

human and monkey hepatocytes for the induction of CYP3A RNA or activity. EC50 value

for CYP3A8 RNA (3.38-12.18 μM) induction by rifampicin was within the range shown by

human donors (3.06-14.23 μM) and the EC50 for CYP3A8 activity (0.67-2.34 μM) was also

similar to EC50 values for human donors (0.76-1.94 μM). The comparison of concentration-

response curves for hyperforin between monkey and human hepatocytes was complicated by

the variable results at higher concentrations as shown in Fig. 4. This is probably due to the

combined effects of previously reported cytotoxicity at concentrations above 1 μM as well

as the inhibitory potential against CYP3A4 (IC50 = 2.3 μM) at high concentrations (Obach,

2000). Cynomolgus monkey hepatocytes appear to be more resistant to these combined

effects. Therefore, non-linear regression analysis was performed using only the data from

non-toxic concentrations of 0-1.65 μM. Human hepatocytes appeared to be more sensitive to

the inductive effects by hyperforin for CYP3A RNA expression than monkey hepatocytes.

EC50 values for CYP3A4 were within 0.37-1.27 μM compared to 2.64-3.38 μM for

CYP3A8. On the contrary, there was no significant differences for the activity between the

two species (EC50 = 0.23-0.32 μM for CYP3A4 vs. 0.98-1.54 μM for CYP3A8).

In Vivo Pharmacokinetic Study of Midazolam with Rifampicin and Saint John’s Wort

(SJW). Drug-drug interaction studies were conducted in male cynomolgus monkeys using

rifampicin and SJW as the inducing agents and midazolam as the probe substrate. The

pharmacokinetic parameters of midazolam exposure were determined on day 0 and day 7

before and after six days of daily oral administration of either rifampicin (10 mg/kg) or SJW

(300 mg). The plasma concentrations of hyperforin and rifampicin were monitored on days

3 and 6 at 1 or 2 hr after oral administration of the inducers, respectively. On day 3 and 6,

the average plasma levels of rifampicin were 15.9 ± 2.4 and 4.2 ± 1.2 μM, respectively and


at ASPE



Dow

nloaded from


DMD 29637

18

the hyperforin levels were 0.48 ± 0.14 and 0.96 ± 0.59 nM, respectively (the lower limit of

quantitation for hyperforin was 0.2 nM). As shown in Fig. 5, the plasma concentration-time

profiles of midazolam were significantly altered following 6 days of rifampicin or SJW

treatment. Oral administration of rifampicin lowered the Cmax and AUC of midazolam by

92.6 and 91.8 % respectively (Table 2). SJW also lowered these parameters but the

magnitude of change was less pronounced. The Cmax and AUC of midazolam were

decreased by 62.3 and 58.0 %, respectively with SJW treatment. In contrast, the half-life of

midazolam did not change significantly before or after treatment with rifampicin or SJW.

The exposure changes of two midazolam metabolites, 1’-hydroxy (1-OH) and 4’-hydroxy

(4-OH) midazolam, appear to closely follow the changes observed for the parent compound.

A similar extent of Cmax and AUC reduction in plasma for 1-OH-MDZ was observed in

animals treated with either rifampicin (91.9 and 96.8%) or SJW (66.1 and 53.4 %). In SJW-

treated monkeys, the reduction in Cmax and AUC of 4-OH-MDZ were again similar (62.6

and 56.1 %) to those of the parent compound. The plasma level of 4-OH-MDZ in

rifampicin-treated animals was below the lower limit of quantitation and the decreases in

pharmacokinetic parameters could not be determined. The metabolite:parent ratio of 1- and

4-OH-MDZ was not significantly altered by SJW while rifampicin increased the ratio from

1.3 to 2.1.


at ASPE



Dow

nloaded from


DMD 29637

19

DISCUSSION

Monkeys have been widely used in drug development as a species for toxicological

evaluation as well as the characterization of ADME properties of new chemical entities.

Recent advancements in our understanding of PXR as a master regulator of CYP3A

expression as well as the high sequence homology between monkey and human PXR led us

to hypothesize that monkeys may be an effective surrogate in vivo animal model of human

CYP3A4 induction. Such a model is important, especially in late-stage drug development,

where the induction potential of a clinical candidate requires more extensive evaluation at

therapeutically-relevant in vivo concentrations in order to assess pharmacokinetic changes

that may result from an interaction.

Previously, the rhesus monkey PXR was cloned and shown to have a high sequence

homology (~96%) to the ligand binding domain of human PXR. We report here the cloning

of full-length cynoPXR and confirm that there are only minor differences in the nucleotide

(354 and 1158) as well as amino acid sequences (Ala68Val) between rhesus and cynoPXR.

This difference is not expected to affect the ligand-binding specificities of PXR between

cynomolgus- and rhesus monkey because the amino acid change is located in the DNA

binding domain, not in the ligand-binding domain (LBD) of PXR. This was further

confirmed in studies conducted in our laboratory where the PXR transactivation response of

selected compounds was nearly identical between cynomolgus and rhesus PXR reporter

assays (unpublished results). These results suggest that, in PXR transactivation and binding

assays, the PXR protein from both monkey strains may be used interchangeably. Within the

ligand-binding domain, our consensus sequence was different from the partial cynoPXR

reported by Milnes, et al, by two amino acid changes. These amino acid residues are

conserved between human, rhesus, Japanese macca and our cynoPXR sequences but not in


at ASPE



Dow

nloaded from


DMD 29637

20

Milnes’ cynoPXR. Further studies are necessary to reconcile the difference between the two

cynoPXR sequences. Excluding that difference, there are 11 amino acids within the LBD

which are different between the monkey and the human PXR, which may result in

differential binding and transactivation profiles for certain PXR ligands between human and

monkey.

As there has been no comprehensive evaluation of monkey PXR reported in the

literature, we investigated how well cynoPXR transactivation correlates to the hPXR

activation response by testing 30 compounds in both cynomolgus monkey and human

systems. When parameters representing intrinsic induction were used to compare PXR

transactivation between cynomolgus monkey and human, Emax values between the two

species showed a poor correlation while EC50 and IIA (Emax/EC50) demonstrated good

correlations between the two species as shown in Figure 3. Often, the maximum

transactivation of PXR is obscured at high concentrations where cytotoxicity or poor

solubility can interfere with the accurate determination of Emax. Therefore, it is not

surprising that Emax values did not correlate well between the two assays. The most notable

exceptions in transactivation response between the two species were reserpine and

sulfinpyrazone where both compounds appear to be more potent activators of hPXR. When

these two compounds were excluded from the linear regression analysis, the correlation of

PXR transactivation between the two species was improved. Therefore, these results suggest

that, while the cynoPXR transactivation assay can be predictive of human CYP3A4

induction, there are exceptions that require further evaluation. Interestingly, the amino acid

change between human and monkey PXR at position 209 (Leu209Val) did not alter the

agonist properties of hyperforin despite the known interaction between Leu209 of PXR

ligand-binding domain and hyperforin (Teotico et al., 2008). Nonetheless, the close


at ASPE



Dow

nloaded from


DMD 29637

21

agreement of monkey and human in vitro data for the induction potential of the majority of

these compounds gave us confidence that in vivo drug-drug interactions in monkeys would

be predictive of human CYP3A4 induction.

The in vitro-in vivo correlation were further tested with rifampicin and hyperforin in

primary hepatocytes and in vivo. In primary hepatocytes isolated from both human and

cynomolgus monkeys, rifampicin and hyperforin induced both RNA expression and enzyme

activities of CYP3A as predicted by their PXR transactivation results. However, some

quantitative differences were also observed between PXR transactivation and CYP3A

induction in hepatocytes by both inducers. While rifampicin appeared to be a less potent

activator of PXR, it was an equally potent inducer of CYP3A in both cynomolgus monkey

and human hepatocytes. In contrast, hyperforin appears to be a less potent inducer of

CYP3A8 RNA expression compared to that of CYP3A4 RNA expression in primary

hepatocytes although the cytotoxicity and potential CYP3A inhibition complicated the

quantitative comparison between human and monkey induction responses. This species-

difference in the induction of CYP3A RNA expression did not significantly impact the

activity changes mediated by hyperforin. Midazolam-1-hydroxylase activities in hepatocytes

from both species were induced in a similar fashion (excluding the data from concentrations

above 1.65 μM). These quantitative differences in the prediction of CYP3A induction can

be attributed to the differences in either metabolic capacity or transporter functions between

the host cell lines in PXR assay (HepG2 and CV-1) and primary hepatocytes, which can

result in differential intracellular concentrations of the inducers.

Nonetheless, authors concluded that both compounds were still appropriate

candidates to be evaluated in a monkey in vivo model because the most important in vitro

parameter for CYP3A induction (activity changes in primary hepatocytes) is similar


at ASPE



Dow

nloaded from


DMD 29637

22

between the two species and the differences are minimal considering the therapeutic

concentrations that these inducers reach during an established standard of care treatment

(i.e., EC50 << Cmax). When 15 mg/kg rifampicin was administered, the plasma

concentrations in monkeys were 15.9 and 4.2 μM, 2 hr post dose on days 2 and 6,

respectively. The decrease in C2h values after multiple days of dosing may be the reflection

of autoinduction by rifampicin as reported previously (Zhang et al., 1998; Wilkins et al.,

2008) but these levels are close to the reported Cmax values in patients (2.9 - 12.2 μM)

following a 600 mg oral dose of rifampicin (Israili et al., 1987). The results demonstrate that

the rifampicin dose chosen for the monkey study produced a similar plasma exposure to that

seen in patients. At these levels, rifampicin induction of CYP3A8 resulted in significant

changes in midazolam pharmacokinetics. Midazolam Cmax and AUC on day 7 decreased

from day 1 levels by 92.6 and 91.8 %, respectively, similar to the reported exposure changes

in human subjects following a 600 mg daily administration of rifampicin for 5 days (94 and

96 % respectively) (Backman et al., 1996). On the other hand, the plasma concentrations of

hyperforin 1 hr postdose were 0.48 and 0.96 nM in monkeys which are far lower than the

reported Cmax values (~51.5 nM) following a single dose of 900 mg SJW in human (Cui et

al., 2002). Unlike rifampicin where the Tmax value in monkeys is known (Prueksaritanont et

al., 2006), the Tmax for hyperforin in monkeys is not known. Assuming that hyperforin was

rapidly absorbed, a Tmax of 1 hr was chosen, however, it is not known if this is correct.

Therefore, a better estimation of hyperforin exposure (Cmax), is necessary with additional

sampling times to understand if there is an actual plasma exposure difference between

monkeys and humans at these doses. Despite the potentially lower exposure, oral

administration of 300 mg SJW (0.87 mg hyperforin) to monkeys resulted in Cmax and AUC

decreases in midazolam exposure of 62.3 and 58 %, respectively. The magnitude of


at ASPE



Dow

nloaded from


DMD 29637

23

decreases in midazolam Cmax and AUC were similar to those in patients (42.5 and 52.3 %,

respectively) given daily administration of 900 mg (300 mg three times per day) SJW for 14

days (Wang et al., 2001). Interestingly, rifampicin and SJW treatment caused profound

decreases in both 1- and 4-OH midazolam plasma concentrations. A similar finding for the

midazolam metabolites was also reported in the rhesus monkey CYP3A64 induction study

(Prueksaritanont et al., 2006). Since PXR can also regulate the expression of Phase II

enzymes and transporters in addition to CYP3A, rifampicin and hyperforin may have

simultaneously induced pathways involved in the elimination of the MDZ metabolites, such

as glucuronidation and/or transporters. This secondary induction, in turn, may have

contributed to the rapid metabolism of 1- and 4-OH MDZ metabolites or enhanced

elimination via transporters.

In summary, the induction data from both in vitro (PXR transactivation and primary

hepatocytes) and in vivo (midazolam AUC reduction) experiments from cynomolgus

monkeys have been shown to be predictive of human CYP3A4 induction responses. Given

the positive qualitative and quantitative correlations between monkey and human, the

cynomolgus monkey may serve as an important animal model to more accurately assess

CYP3A4 induction potential and pharmacokinetic changes occurring due to drug-drug

interactions mediated by PXR during preclinical drug development.


at ASPE



Dow

nloaded from


DMD 29637

24

ACKNOWLEDGEMENT

The authors greatly appreciate the critical review of the manuscript by Drs. A. David

Rodrigues and Kenneth Santone. We also acknowledge the significant contributions of Ms.

Sandra Matson and Dr. Tatyana Zvyaga with the hPXR transactivation assay.


at ASPE



Dow

nloaded from


DMD 29637

25

REFERENCES

Akahori M, Takatori A, Kawamura S, Itagaki S and Yoshikawa Y (2005) No regional differences of cytochrome P450 expression in the liver of Cynomolgus monkeys (Macaca fascicularis). Exp Anim 54:131-136.

Backman JT, Olkkola KT and Neuvonen PJ (1996) Rifampin drastically reduces plasma concentrations and effects of oral midazolam. Clin Pharmacol Ther 59:7-13.

Bullock P, Pearce R, Draper A, Podval J, Bracken W, Veltman J, Thomas P and Parkinson A (1995) Induction of liver microsomal cytochrome P450 in cynomolgus monkeys. Drug Metab Dispos 23:736-748.

Carr B, Norcross R, Fang Y, Lu P, Rodrigues AD, Shou M, Rushmore T and Booth-Genthe C (2006) Characterization of the rhesus monkey CYP3A64 enzyme: species comparisons of CYP3A substrate specificity and kinetics using baculovirus-expressed recombinant enzymes. Drug Metab Dispos 34:1703-1712.

Cui Y, Gurley B, Ang CY and Leakey J (2002) Determination of hyperforin in human plasma using solid-phase extraction and high-performance liquid chromatography with ultraviolet detection. J Chromatogr B Analyt Technol Biomed Life Sci 780:129-135.

Gonzalez FJ and Yu AM (2006) Cytochrome P450 and xenobiotic receptor humanized mice. Annu Rev Pharmacol Toxicol 46:41-64.

Israili ZH, Rogers CM and el-Attar H (1987) Pharmacokinetics of antituberculosis drugs in patients. J Clin Pharmacol 27:78-83.

Kanazu T, Yamaguchi Y, Okamura N, Baba T and Koike M (2004) Model for the drug-drug interaction responsible for CYP3A enzyme inhibition. I: evaluation of cynomolgus monkeys as surrogates for humans. Xenobiotica 34:391-402.

Komura H and Iwaki M (2007) Species differences in in vitro and in vivo small intestinal metabolism of CYP3A substrates. J Pharm Sci.

Lee AM, Miksys S and Tyndale RF (2006) Phenobarbital increases monkey in vivo nicotine disposition and induces liver and brain CYP2B6 protein. Br J Pharmacol 148:786-794.

Lin JH (2006) CYP induction-mediated drug interactions: in vitro assessment and clinical implications. Pharm Res 23:1089-1116.

Milnes MR, Garcia A, Grossman E, Grun F, Shiotsugu J, Tabb MM, Kawashima Y, Katsu Y, Watanabe H, Iguchi T and Blumberg B (2008) Activation of steroid and xenobiotic receptor (SXR, NR1I2) and its orthologs in laboratory, toxicologic, and genome model species. Environ Health Perspect 116:880-885.

Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, Kliewer SA, Lambert MH and Moore JT (2002) Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define three pharmacologically distinct classes of nuclear receptors. Mol Endocrinol 16:977-986.

Nishimura M, Koeda A, Suganuma Y, Suzuki E, Shimizu T, Nakayama M, Satoh T, Narimatsu S and Naito S (2007) Comparison of inducibility of CYP1A and CYP3A mRNAs by prototypical inducers in primary cultures of human, cynomolgus monkey, and rat hepatocytes. Drug Metab Pharmacokinet 22:178-186.

Obach RS (2000) Inhibition of human cytochrome P450 enzymes by constituents of St. John's Wort, an herbal preparation used in the treatment of depression. J Pharmacol Exp Ther 294:88-95.


at ASPE



Dow

nloaded from


DMD 29637

26

Ogasawara A, Kume T and Kazama E (2007) Effect of oral ketoconazole on intestinal first-pass effect of midazolam and fexofenadine in cynomolgus monkeys. Drug Metab Dispos 35:410-418.

Prueksaritanont T, Kuo Y, Tang C, Li C, Qiu Y, Lu B, Strong-Basalyga K, Richards K, Carr B and Lin JH (2006) In vitro and in vivo CYP3A64 induction and inhibition studies in rhesus monkeys: a preclinical approach for CYP3A-mediated drug interaction studies. Drug Metab Dispos 34:1546-1555.

Sharer JE, Shipley LA, Vandenbranden MR, Binkley SN and Wrighton SA (1995) Comparisons of phase I and phase II in vitro hepatic enzyme activities of human, dog, rhesus monkey, and cynomolgus monkey. Drug Metab Dispos 23:1231-1241.

Teotico DG, Bischof JJ, Peng L, Kliewer SA and Redinbo MR (2008) Structural basis of human pregnane X receptor activation by the hops constituent colupulone. Mol Pharmacol 74:1512-1520.

Wang Z, Gorski JC, Hamman MA, Huang SM, Lesko LJ and Hall SD (2001) The effects of St John's wort (Hypericum perforatum) on human cytochrome P450 activity. Clin Pharmacol Ther 70:317-326.

Ward KW, Stelman GJ, Morgan JA, Zeigler KS, Azzarano LM, Kehler JR, McSurdy-Freed JE, Proksch JW and Smith BR (2004) Development of an in vivo preclinical screen model to estimate absorption and first-pass hepatic extraction of xenobiotics. II. Use of ketoconazole to identify P-glycoprotein/CYP3A-limited bioavailability in the monkey. Drug Metab Dispos 32:172-177.

Wilkins JJ, Savic RM, Karlsson MO, Langdon G, McIlleron H, Pillai G, Smith PJ and Simonsson US (2008) Population pharmacokinetics of rifampin in pulmonary tuberculosis patients, including a semimechanistic model to describe variable absorption. Antimicrob Agents Chemother 52:2138-2148.

Zhang H, Zhang D, Li W, Yao M, D'Arienzo C, Li YX, Ewing WR, Gu Z, Zhu Y, Murugesan N, Shyu WC and Humphreys WG (2007) Reduction of site-specific CYP3A-mediated metabolism for dual angiotensin and endothelin receptor antagonists in various in vitro systems and in cynomolgus monkeys. Drug Metab Dispos 35:795-805.

Zhang JN, Liu XG, Zhu M, Chiu FC and Li RC (1998) Assessment of presystemic factors on the oral bioavailability of rifampicin following multiple dosing. J Chemother 10:354-359.

Zhu Z, Puglisi J, Connors D, Stewart J, Herbst J, Marino A, Sinz M, O'Connell J, Banks M, Dickinson K and Cacace A (2007) Use of cryopreserved transiently transfected cells in high-throughput pregnane X receptor transactivation assay. J Biomol Screen 12:248-254.

Zuber R, Anzenbacherova E and Anzenbacher P (2002) Cytochromes P450 and experimental models of drug metabolism. J Cell Mol Med 6:189-198.


at ASPE



Dow

nloaded from


DMD 29637

27

LEGENDS FOR FIGURES

Figure 1. Open reading frame of cynomolgus monkey PXR; the protein sequence alignment

with rhesus (rhes) and human (huma) PXR sequences was performed as described in

Methods. The highlighted areas denote the difference between the sequences of

cynomolgus, rhesus or human PXR. The DNA binding domain spans amino acid residues

41-107 while the ligand binding domain spans amino acid residues 139 through 434.

Figure 2. Mean concentration-response profiles of rifampicin and hyperforin in both

cynomolgus (cynoPXR) and human PXR (hPXR) transactivation (A and C, respectively)

and Alamar-blue cytotoxicity assays (B and D, respectively). Each data point is expressed as

average ± SD.

Figure 3. Linear regression analysis between cynomolgus monkey (cynoPXR) and human

PXR (hPXR) transactivation profiles. (A) EC50 (excluding reserpine and sulfinpyrazone);

(B) Emax (excluding reserpine and sulfinpyrazone); (C) IIA (Emax/EC50) with all 30

compounds and (D) an enlarged view of inset square in C. The dashed lines denote 95 %

confidence intervals.

Figure 4. Mean concentration-response curves for RNA expressions and midazolam-1-

hydroxylase activities in cynomolgus monkey and human primary hepatocytes (A)

rifampicin - RNA (B) rifampicin - activity (C) hyperforin - RNA and (D) hyperforin -

activity.


at ASPE



Dow

nloaded from


DMD 29637

28

Figure 5. Plasma-time profiles of midazolam, 1- (1-OH-MDZ) and 4-hydroxymidazolam (4-

OH-MDZ) on day 0 (before inducer treatment) and day 7 (after inducer dose) in

cynomolgus monkeys treated by either rifampicin (A, B and C, respectively) or SJW (D, E

and F, respectively).


at ASPE



Dow

nloaded from


DMD 29637

29

Table 1. PXR transactivation results for thirty compounds tested in human and cynomolgus

monkey PXR transactivation assays

Substance1 PXR Transactivation (Human / Cyno)

Emax (%RIF)

EC50

(μM) IIA3

(Emax/EC50)

Hyperforin2 148 / 155 0.04 / 0.08 3610 / 2067 SR-12813 120 / 163 0.16/ 0.63 736/ 259

Clotrimazole 115 / 94 1.4 / 1.0 82 / 94 Rosiglitazone 109 / 94 ~ 25 / ~ 25 4.4 / 3.8

1,9-Dideoxy-forskolin 103 / 109 1.4 / 7.5 74 / 15 Reserpine 103 / 16 2.7 / 50 38 / 0.3 Rifampicin 101 / 137 0.84 / 5.1 121 / 27 Glimepride 98 / 96 7.5 / 19 13 / 5.1 Ritonavir 97 / 112 1.7 / 4.5 57 / 25

Piogiltazone 92 / 69 ~ 25 / ~ 25 3.7 / 2.8 CITCO 87 / 109 1.9 / 4.3 46 / 25

Sulfinpyrazone 73 / 11 ~ 25 / > 50 2.9 / 0.2 Verapamil 71 / 180 3.5 / 3.6 20 / 50 Nifedipine 70 / 69 1.7 / 4.5 41 / 15

Artemisinin 67 / 79 29 / 14 2.3 / 5.8 Terbinafine 63 / 40 4.8 / 5.0 13 / 8.0 Paclitaxel 60 / 40 0.55 / 2.2 109 / 18

Troleandomycin 60 / 116 4.1 / 10 15 / 12 Trogiltazone 55 / 65 4.1 / 4.1 13 / 16 Mifepristone 53 / 49 1.8 / 1.6 29 / 31

PCN 50 / 113 ~ 25 / ~ 25 2.0 / 4.5 Celecoxib 36 / 94 2.5 / 8.3 14 / 11 Phenytoin 33 / 23 28 / 16 1.2 / 1.4 Meclizine 25 / 29 8.3 / 6.2 3.0 / 4.7 TCPOBOP 22 / 44 4.3 / 5.9 5.1 / 7.5

Carbamezepine 21 / 21 > 50 / > 50 0.4 / 0.4 Probenecid 9 / 7 > 50 / > 50 0.2 / 0.1

Phenobarbital 3 / 1 > 50 / > 50 0.1 / 0.0 Dexamethasone 0 / 4 > 50 / > 50 0.0 / 0.1

Methotrexate 0 / 2 > 50 / > 50 0.0 / 0.0 1 in order of Emax values (highest-lowest) in the hPXR transactivation assay

2hyperforin was only tested up to 1.0 μM due to known cytotoxicity 3intrinsic induction activity


at ASPE



Dow

nloaded from


DMD 29637

30

Table 2. Pharmacokinetic parameters of midazolam (MDZ), 1- and 4- hydroxymidazolam

(1’- and 4’-OH-MDZ) in cynomolgus monkey plasma following oral administration of

midazolam (2 mg/kg)

Analyte 1Parameter Rifampicin St. John’s Wort

Day 0 Day 7 %

Change Day 0 Day 7

% Change

MDZ

Cmax (nM) 110.7 8.2 -92.6 148.0 55.8 -62.3

AUC (nM*hr) 264.1 21.7 -91.8 435.2 182.7 -58.0

T1/2 (hr) 1.5 1.6 +6.7 1.1 1.2 +9.1

1’-OH-

MDZ

Cmax (nM) 266.1 21.5 -91.9 279.7 94.8 -66.1

AUC (nM*hr) 342.9 45.4 -86.8 453.0 211.0 -53.4

Ratio (M/P2) 1.3 2.1 1.0 1.2

4’-OH-

MDZ

Cmax (nM) 36.5 BLLQ3 32.1 12.0 -62.6

AUC (nM*hr) 39.6 BLLQ 60.1 26.4 -56.1

Ratio (M/P) 0.1 0.1 0.1

1The value is represented as the average of three animals 2Metabolite/parent 3Below lower limit of quantitation


at ASPE



Dow

nloaded from


DMD 29637

31

Table 3. Donor information and non-linear regression analysis of CYP3A4 induction in human and cynomolgus monkey hepatocytes

Species Donor Information

Endpoint Rifampicin Hyperforin2

Vendor/Lot Sex Age Ethnicity EC50

(μM) Emax

1

(%RIF) EC50

(μM) Emax

1

(%RIF)

Human

CellzDirect HU0693

M 41 Caucasian RNA 14.23 177.5 0.37 63.5

Activity 1.94 109.5 0.32 71.5

CellzDirect HU0694

F 54 Caucasian RNA 6.48 169.5 0.51 104.6

Activity 0.76 116.8 0.23 69.7

CellzDirect HU0965

F 27 Caucasian RNA 3.06 131.0 1.27 66.5

Activity 0.93 107.5 0.32 57.9

Cynomolgus Monkey

CellzDirect M - - RNA 12.18 151.1 3.28 118.2

Activity 0.67 104.5 1.54 66.0

CellzDirect M - - RNA 3.38 100.0 3.01 46.9

Activity 1.68 101.2 0.98 68.5

Celsis M - - RNA 6.16 131.0 2.64 28.1

Activity 2.34 101.5 1.50 74.1 1% of induction response compared to that of rifampicin at 12.5 μM 2Non-linear regression analysis for CYP3A induction in human hepatocytes was performed with the partial data set (0-1.56 μM) due to the observed cytotoxicity at higher concentrations of hyperforin

This article has not been copyedited and form

atted. The final version m

ay differ from this version.

DM

D Fast Forw

ard. Published on October 15, 2009 as D

OI: 10.1124/dm

d.109.029637 at ASPET Journals on June 1, 2020 dmd.aspetjournals.org Downloaded from



at ASPE



Dow

nloaded from



at ASPE



Dow

nloaded from



at ASPE



Dow

nloaded from



at ASPE



Dow

nloaded from



at ASPE



Dow

nloaded from


Documents

Drug Metabolism & Disposition - Pharmacokinetic …dmd.aspetjournals.org/content/dmd/early/2009/10/15/dmd...2009/10/15 · clinical drug-drug interactions caused by CYP3A4 enzyme