Click here to load reader

Download (2.49 MB )

  • View
    218

  • Download
    1

Embed Size (px)

Text of Download (2.49 MB )

  • Immunity, Volume 44

    Supplemental Information

    MicroRNAs 24 and 27 Suppress Allergic Inflammation

    and Target a Network of Regulators

    of T Helper 2 Cell-Associated Cytokine Production

    Heather H. Pua, David F. Steiner, Sana Patel, Jeanmarie R. Gonzalez, Jorge F.Ortiz-Carpena, Robin Kageyama, Ni-Ting Chiou, Antonia Gallman, Dimitride Kouchkovsky, Lukas T. Jeker, Michael T. McManus, David J. Erle, and K. Mark Ansel

  • 1

    SUPPLEMENTAL FIGURES Figure S1.

  • 2

    Figure S1 (related to Figure 1). Ago deficiency in T cells results in enhanced cytokine production, reduced cell numbers, and impaired proliferation. (A) Immunoblot of purified T cells from WT, Ago2 /, Ago1+/Ago2 / and Ago1/Ago2 / mice. (B) EGFP expression measuring miRNA sensor activity in WT and Ago-deficient mice. (C,D) Intracellular staining for cytokine production in T cells cultured in ThN conditions. Numbers in quadrants are percent of live CD4+ singlets and each dot represents an individual mouse (n=4-5 mice from 3-4 independent experiments, one-way ANOVA with Tukeys multiple comparison test). Flow cytometry analysis of T cells among total live cells (E) and nave versus activated cells among CD4+ T cells (F) from spleen and peripheral lymph nodes. (G) Summary of the numbers and percentages of CD19+ B cells, CD4+ T cells and CD8+ T cells. Bars graphs are mean+s.d. (n=3-4 mice from 3 independent experiments, one-way ANOVA with Tukeys multiple comparison test). (H) Proliferation of T cells labeled with CellTrace Violet dye and analyzed by flow cytometry. Numbers refer to the percentage of cells in each box indicated by a lower case letter. Data is representative of three biological replicates.

  • 3

    Figure S2.

    Figure S2 (related to Figure 2). Individual miRNAs inhibit Th2 cytokine production. (A) IL-4 and IL-13 production by Dgcr8/Tbx21-/- T cells cultured in full Th2 conditions (500U/ml IL-4 and anti-IFN- antibody) and transfected with miR-23, miR-24, miR-27, all mimics, or control mimic (CM). Each dot represents an individual mouse (n=5 from 2 independent experiments, two-tailed paired t-test). (B) IL-4 versus IL-13 production in Dgcr8/Tbx21-/- CD4+ T cells transfected with single miRNAs. Highlighted are Mirc11 and Mirc22 cluster family members (red), let-7 family members (orange) and miR-19a (blue).

  • 4

    Figure S3.

    Figure S3 (related to Figure 2). miR-23, miR-24 and miR-27 mimics specifically inhibit target sequences. (A, B) GFP expression measuring miRNA sensor activity in Mirc11-/-Mirc22T/T CD4+ T cells transfected with miRNA mimics and control mimic (CM) or WT cells transfected with CM. (C) Live cell count on day 5 or day 6 of culture of Dgcr8/Tbx21-/- CD4+ T cells transfected with miRNA mimics expressed as a ratio when compared to CM (n=7 from 7 independent experiments, mean + s.e.m., one sample t-test).

  • 5

    Figure S4.

    Figure S4 (related to Figure 3). Mirc11-/-Mirc22T/T mice have normal peripheral T cell numbers and in vitro proliferation. (A) Expression of miR-23, miR-24, and miR-27 by qPCR in CD4+ T cells (n=3-6 mice, mean + s.e.m., one-way ANOVA with Dunnetts multiple comparison test) (B) GFP expression measuring miRNA sensor activity in WT versus Mirc11-/-Mirc22T/T CD4+ T cells. (C) Flow cytometry analysis of T cells from the spleen including nave, activated, and regulatory subsets. Numbers in left plots are percent of live singlets. Numbers in middle left, middle right and right plots are percent of live CD4+ singlets. Quantification of the number of B220+ B cells, CD4+ T cells and CD8+ T cells from spleen (D) and peripheral lymph nodes (E). (F) Proliferation of T cells labeled with CellTrace Violet dye and analyzed by flow cytometry on day 3 of culture. (n=6 mice from 2 independent experiments for C-F, mean + s.e.m., one-way ANOVA with Bonferronis multiple comparison test).

  • 6

    Figure S5.

    Figure S5 (related to Figure 5). Pathway analysis for miR-23 targets upstream of IL-4. IPA pathway analysis of gene and target networks significantly regulated upstream of IL-4 after transfection with miR-23 mimic versus control mimic in Dgcr8/Tbx21-/- CD4+ T cells. Interactions between genes/targets and IL-4 (tan) and targets with genes/targets upstream of IL-4 (black) are depicted.

  • 7

    Figure S6.

    Figure S6 (related to Figure 6). miR-24 and miR-27 siRNA screens identify candidate target genes. (A) Filtering strategy for candidate targets expressed in RNA sequencing data from miR-24 or miR-27 transfected Dgcr8/Tbx21-/- CD4+ T cells. (B) After filtering on fold change from a Gene Set Enrichment Analysis leading edge analysis and P value from RNA sequencing data, remaining targets were rank ordered without bias to prior Th2 function for testing in a RNAi screen. siRNA re-testing of top 30 candidate targets measuring (C) IL-4 production by intracellular staining and (D) proliferation by CellTrace Violet dye dilution calculated by FlowJo. Bars are singlicate measures.

  • 8

    (excel file) Table S1 (related to Figure 2). Results of miRNA mimic screen in Dgcr8/Tbx21-/- CD4+ T cells. Z scores for IL-4 and IL-13 production measured by intracellular cytokine staining. (excel file) Table S2 (related to Figure 5). Ingenuity Pathway Analysis output for miR-24 or miR-27 transfected Dgcr8/Tbx21-/- CD4+ T cells. All genes with a significant change (P

  • 9

    SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse strains

    Targeted JMA83 (C57BL/6N-Atm1Brd) embryonic stem (ES) cells(Prosser et al.,

    2011) were used to generate chimeric mice with a deletion of the cluster containing miR-

    23a, miR-27a and miR-24-2 (Mirc11tm1Wtsi, here Mirc11-; Sanger MirKO ES cell line

    Mir23a-Mir24-2 cluster 8N2, 036362-UCD, Mutant Mouse Regional Resource Centers).

    These chimeras were crossed to Actin-cre mice (Tg(ACTB-cre)2Mrt, 019099, the Jackson

    Laboratory) to delete the selection cassette. E14 (129P2/OlaHsd) ES cells were targeted

    as described(Park et al., 2012) and used to generate chimeric mice with a conditionally

    mutant allele of the cluster containing miR-23b, miR-27b, and miR-24-1 (Mirc22tm1.1Mtm,

    here Mirc22f). These chimeras were crossed to Rosa26-Flp mice

    (Gt(ROSA)26Sortm1(FLP1)Dym; 009086, the Jackson Laboratory) to delete the selection

    cassette and the progeny crossed to Cd4-cre mice (Tg(CD4-cre)1Cwi; 4196, Taconic).

    These two lines were intercrossed to generate mice with T cells lacking expression of all

    Mirc11 and Mirc22 cluster miRNAs (here Mirc11-/-Mirc22T/T).

    Dgcr8tm1.1Blel (here Dgcr8f/f); Gt(ROSA)26Sortm3(CAG-EYFP)Hze (here Rosa-YFP);Cd4-

    cre mice (here Dgcr8/) were further crossed with Tbx21tm1Glm mice (here Tbx21-/-;

    004648, the Jackson Laboratory) to generate Dgcr8f/fCd4-creTbx21-/-Rosa-YFP mice

    (here Dgcr8/Tbx21-/-). Conditional mutant Ago2tm1.1Tara (here Ago2f/f) and

    Ago1tm1a(KOMP)Wtsi (here Ago1f/f; Mouse Genetics Project, Wellcome Trust Sanger

    Institute) mice were crossed to Cd4-cre mice and intercrossed to generate Ago2f/f;Cd4-cre

    (here Ago2 /), Ago1+/fAgo2f/fCd4-cre (here Ago1+/Ago2 /), and Ago1f/fAgo2f/fCd-4cre

    (here Ago1/Ago2 /) mice.

  • 10

    B6-Ly5.1/Cr (here CD45.1+) were purchased from Charles River

    Laboratory.

    T cell polarization cultures

    Cells were cultured in DMEM high glucose media supplemented with 10% FCS,

    pyruvate, nonessential amino acids, MEM vitamins, L-arginine, L-asparagine, L-

    glutamine, folic acid, beta mercaptoethanol, penicillin, and streptomycin. Most

    stimulations were performed with hamster anti-mouse CD3 (clone 2C11, 0.25g/ml) and

    anti-mouse CD28 (clone 37.51, 1g/ml) antibodies on plates coated with goat anti-

    hamster IgG (0.3mg/ml in PBS; MP Biomedicals). During the course of this study, a

    revision was made to our culture conditions such that stimulations were performed with

    either anti-mouse CD3 (clone 2C11, 1g/ml) and anti-mouse CD28 (clone 37.51, 1g/ml)

    antibodies directly coated onto non-tissue coated treated plates or biotinylated anti-CD3

    (clone 2C11, 0.25g/ml) and anti-mouse CD28 (clone 37.51, 1g/ml) on plates coated

    with NeutrAvidin (5g/ml, Thermo Fischer Scientific). Additional exogenous cytokines

    and neutralizing antibodies were added throughout the culture to routine stimulation for

    polarization (ThN: no additional reagents; Th2: 500 units/ml IL-4 added as a supernatant

    from I3L6 cells(Tepper et al., 1989), and 5g/ml anti-IFN- (cloneXMG1.2); Th1:

    10ng/ml IL-12 (R&D Systems) and 10ug/ml anti-IL-4 (clone 11B11); Th17: 5ng/ml

    recombinant human TGF- (Peprotech), 25ng/ml recombinant murine IL-6 (Peprotech),

    10ug/ml anti-IL-4 (clone11B11) and 10ug/ml anti-IFN- (cloneXMG1.2).

  • 11

    3UTR cloning

    Constructs containing near full length 3UTRs of Gata3, Ikzf1, Cnot6 and Ccnk

    were cloned into the psiCHECK-2 luciferase reporter construct (Promega). Primer

    sequences were: Gata3 F: TAGTAGCTCGAGAGTGTGCGAAGAGTTCCTCC, Gata3

    R: TAGTAGGCGGCCGCAACACACAGGGGCTAACAGT Ikf1 F:

    TAGTAGGTCGACTAGCTGGTTATGCCTCCTTC, Ikzf1 R:

    TAGTAGGCGGCCGCACAGCATATAGCCACCTTCA, Cnot6 F:

    TAGTAGCTCGAGGCAGGAGGTAGTCACTTTCA, Cnot6 R:

    TAGTAGGCGGCCGCACCAAAAGGAATAAAGCGAACA, Ccnk F:

    TAGTAGCTCGAGTTGAAGAATAGACTGAGGGGG, Ccnk R:

    TAGTAGGCGGCCGCTTTATTCGGGCAACTGACTG.

    Intracellular staining, flow cytometry, sorting

    For intracellular stains, cells were harvested after restimulation and stained with

    viability dye eFluor780 (eBiosciences). For cytokine stains, cells w