DNA – The MoleculeDNA – The Molecule

Deoxyribonucleic AcidDeoxyribonucleic Acid

Deoxyribonucleic AcidDeoxyribonucleic Acid• DNA is made of a phosphate group, a DNA is made of a phosphate group, a

simple sugar and a nitrogenous base.simple sugar and a nitrogenous base.

• Nitrogen BaseNitrogen Base- Organic Ring structure - Organic Ring structure that contains one or more Nitrogen that contains one or more Nitrogen atomsatoms

• Four Nitrogen Bases of DNAFour Nitrogen Bases of DNA– Adenine (A)Adenine (A)– Guanine (G)Guanine (G)– Cytosine (C)Cytosine (C)– Thymine (T)Thymine (T)

Note: No Oxygen on the #2 Note: No Oxygen on the #2 CarbonCarbon

Guanine- double ring Guanine- double ring structurestructure

1 2

AdenineAdenine

Cytosine – single ring Cytosine – single ring structure structure

Base PairingsBase Pairings

• Adenine pairs with ThymineAdenine pairs with Thymine

• Cytosine pairs with GuanineCytosine pairs with Guanine

• Adenine and Guanine are double ring Adenine and Guanine are double ring structures called structures called purinespurines

• Cytosine and Thymine are single ring Cytosine and Thymine are single ring structures called structures called pyrimadinespyrimadines

Ribonucleic Acid - RNARibonucleic Acid - RNA

• RNA is similar in structure to DNA.RNA is similar in structure to DNA.

• RNA is single stranded as opposed to RNA is single stranded as opposed to double stranded (DNA)double stranded (DNA)

• RNA has a ribose sugar as opposed to RNA has a ribose sugar as opposed to a deoxyribose sugar (DNA) see figure.a deoxyribose sugar (DNA) see figure.

• The base pairs are A,C,G,and UThe base pairs are A,C,G,and U– Uracil replaces Thymine.Uracil replaces Thymine.

The Double HelixThe Double Helix

• The spiral shape of DNA is called a The spiral shape of DNA is called a double helix. It basically resembles a double helix. It basically resembles a twisted ladder.twisted ladder.

• The uniqueness of a strand of DNA is The uniqueness of a strand of DNA is due to the order of the base pairs.due to the order of the base pairs.

• Every time a cell reproduces, it must Every time a cell reproduces, it must make an exact copy of its DNA. make an exact copy of its DNA.

ReplicationReplication

• The process in which DNA is copied.The process in which DNA is copied.• Replication must be perfect, the method of Replication must be perfect, the method of

replication is described as being replication is described as being semi-semi-conservativeconservative. .

• semi-conservativesemi-conservative- each new strand of - each new strand of DNA is composed of half original and half DNA is composed of half original and half new material.new material.

• Opposed to having one completely new Opposed to having one completely new strand of DNA and one completely original strand of DNA and one completely original strand of DNAstrand of DNA

ChargaffChargaff’’s Rules Rule

• The amount of purines = the amount of The amount of purines = the amount of pyrimadines.pyrimadines.

• Therefore, in each species the amount of Therefore, in each species the amount of A=T and the amount of C=G.A=T and the amount of C=G.

• The amount of A,T, C and G in DNA varies The amount of A,T, C and G in DNA varies from species to species.from species to species.

• Both of these aspects of ChargaffBoth of these aspects of Chargaff’’s rule s rule helped to determine and understand the helped to determine and understand the process of replicationprocess of replication

DNA Replication-the processDNA Replication-the process• Replication is Replication is

similar to unzipping similar to unzipping a zipper.a zipper.

• An enzyme breaks An enzyme breaks the hydrogen bonds the hydrogen bonds between the base between the base pairs.pairs.

• Then as the Then as the molecule unzips, molecule unzips, free nucleotides free nucleotides pair up with each of pair up with each of the strands.the strands.

Steps in ReplicationSteps in Replication• 1. Unwinding- The old strand of 1. Unwinding- The old strand of

parent DNA is unwound and parent DNA is unwound and unzipped.unzipped.– HelicaseHelicase- enzyme that unwinds - enzyme that unwinds

DNA.DNA.

• 2. Complementary base pairing- 2. Complementary base pairing- A pair with T and C with G. A pair with T and C with G. – An An RNA primerRNA primer is added to initiate is added to initiate

the process.the process.– DNA polymeraseDNA polymerase adds the base adds the base

pairs, and removes the RNA primer. pairs, and removes the RNA primer.

Replication (continued)Replication (continued)• 3. Proofreading the strand- Most 3. Proofreading the strand- Most

mistakes in pairings, and even mistakes in pairings, and even some insertion of the wrong base some insertion of the wrong base pair or a deletion are corrected pair or a deletion are corrected in the final step.in the final step.– Polymerase is the enzyme that is Polymerase is the enzyme that is

involved in this process.involved in this process.

• 4. The phosphate groups attach 4. The phosphate groups attach to the next ribose group with the to the next ribose group with the help of the enzyme help of the enzyme LigaseLigase. .

ItIt’’s not THAT simples not THAT simple• During the replication process, During the replication process,

nucleotides are joined in a 5nucleotides are joined in a 5 ’’ to 3 to 3’’ direction. (See drawing)direction. (See drawing)

• Only one strand of DNA runs in a Only one strand of DNA runs in a 55 ’’to3to3’’ direction. direction.

• In order for replication to occur In order for replication to occur quickly both strands must be quickly both strands must be copied at once.copied at once.

• This is accomplished by having a This is accomplished by having a leading and lagging strand. leading and lagging strand.

Leading StrandLeading Strand

• As the molecule unzips the new DNA As the molecule unzips the new DNA is synthesized going in the 5is synthesized going in the 5’’ to 3 to 3’’ direction heading toward the direction heading toward the replication fork.replication fork.

Lagging StrandLagging Strand

• The second strand works slower. It The second strand works slower. It also must go in the 5-3 direction, but also must go in the 5-3 direction, but it goes away from the replication it goes away from the replication fork. Thus, leaving gaps of unpaired fork. Thus, leaving gaps of unpaired nucleotides. nucleotides.

• Okazaki FragmentsOkazaki Fragments- Pieces of - Pieces of replicated DNA found on the lagging replicated DNA found on the lagging strand. Responsible for speeding up strand. Responsible for speeding up the rate of replication.the rate of replication.

DNA Replication- the figureDNA Replication- the figure

Polymerase Chain Reaction Polymerase Chain Reaction (PCR)(PCR)

• Technique used to produce several Technique used to produce several identical copies of DNA using the identical copies of DNA using the enzyme polymerase.enzyme polymerase.

• See See Seven Daughters of EveSeven Daughters of Eve

Variability in DNAVariability in DNA

• DNA can vary as a result of mutations and DNA can vary as a result of mutations and ““jumping genesjumping genes”” called transposons. called transposons.

• TransposonsTransposons- moveable genetic elements. - moveable genetic elements. These are sections that control or These are sections that control or suppress the expression of information.suppress the expression of information.

• Because transposons have the ability to Because transposons have the ability to move from one part of the chromosome to move from one part of the chromosome to another they can extremely alter the another they can extremely alter the phenotype.phenotype.

Transposons cause:Transposons cause:• Localized mutations. These are Localized mutations. These are

mutations that may occur in some mutations that may occur in some cells but not others.cells but not others.

• Are a source of chromosomal Are a source of chromosomal mutations.mutations. translocation, translocation, deletion and inversionsdeletion and inversions

• Can leave a copy of themselves Can leave a copy of themselves before they jump. before they jump. duplication. duplication.

• Have been shown to be the basis of Have been shown to be the basis of bacterial resistance to antibiotics.bacterial resistance to antibiotics.

Variability (cont.)- Variability (cont.)- MUTATIONMUTATION• Mutations in the base pair sequenceMutations in the base pair sequence– MutagenMutagen- environmental substance - environmental substance

that causes mutations.that causes mutations.

• Types of mutationsTypes of mutations– Frameshift mutationsFrameshift mutations- An insertion or - An insertion or

deletion of a nucleotide which results deletion of a nucleotide which results in the changing of the genetic code.in the changing of the genetic code.

– Point mutationPoint mutation- Change in a specific - Change in a specific nucleotide which alters the codon. nucleotide which alters the codon. See See page 247 for info on mutations and sickle cell page 247 for info on mutations and sickle cell anemia.anemia.

Chapter 16- Gene Chapter 16- Gene expressionexpression• We have already discussed similarities/ We have already discussed similarities/

differences of DNA and RNA. differences of DNA and RNA.

• What is the location and function of What is the location and function of DNA?DNA?

• What is the location and function of the What is the location and function of the ribosomes?ribosomes?

• Does anyone see a problem?Does anyone see a problem?

Location: nucleus, function: “directions” for protein synthesis

Location: cytoplasm, function: protein production

Directions for the product are NOT at the factory!

The MessengerThe Messenger

• We must have a messenger to carry We must have a messenger to carry the the ““infoinfo”” of DNA to the factory of DNA to the factory”” (ribosome)(ribosome)

• DNA DNA mRNA mRNA ribo. ribo.protein protein

Transcription Translation

The Central Dogma of The Central Dogma of Molecular BiologyMolecular Biology

• The sequence of nucleotides in DNA The sequence of nucleotides in DNA codes for a sequence of nucleotides codes for a sequence of nucleotides in RNA which directs the order of in RNA which directs the order of Amino Acids in a polypeptide Amino Acids in a polypeptide (protein).(protein).

The playersThe players

• First the three types of RNAFirst the three types of RNA– Messenger RNA (mRNA)Messenger RNA (mRNA)- takes a - takes a

message from DNA in the nucleus to the message from DNA in the nucleus to the ribosome in the cytoplasm.ribosome in the cytoplasm.

– Ribosomal RNA (rRNA)Ribosomal RNA (rRNA)- along with some - along with some proteins, makes up the ribosome which proteins, makes up the ribosome which synthesizes polypeptides (proteins).synthesizes polypeptides (proteins).

– Transfer RNA (tRNA)Transfer RNA (tRNA)- brings Amino Acids - brings Amino Acids to the ribosome.to the ribosome.

The processes- The GameThe processes- The Gamedondon’’t be a hatert be a hater

• TranscriptionTranscription- Process where a DNA - Process where a DNA strand serves as a template for the strand serves as a template for the information on mRNA.information on mRNA.

• TranslationTranslation- Process where the - Process where the sequence of codons in mRNA sequence of codons in mRNA determines the sequence of Amino determines the sequence of Amino Acids in a polypeptide.Acids in a polypeptide.– CodonCodon- three nucleotides in DNA or RNA - three nucleotides in DNA or RNA

which codes for a particular amino acid or which codes for a particular amino acid or termination of translation. See fig 17.4 pg termination of translation. See fig 17.4 pg 329329

TranscriptionTranscription

• DNA DNA TAC TGC CTG GCC ACTTAC TGC CTG GCC ACT

• When rewritten as RNAWhen rewritten as RNA

• RNARNA AUG ACG GAC CGG UGA AUG ACG GAC CGG UGA

The Code: the languageThe Code: the languageTranslation-decoding the RNATranslation-decoding the RNA

• AUGACGGACCGGUGAAUGACGGACCGGUGA

• AUG- methionineAUG- methionine

• ACG- threonineACG- threonine

• GAC- aspartateGAC- aspartate

• CGG- arginineCGG- arginine

• UGA- stopUGA- stop

Transcription- the detailsTranscription- the details

• Transcription is started by the Transcription is started by the promoter region.promoter region.

• When RNA is produced it is often When RNA is produced it is often shorter than the template strand of shorter than the template strand of DNA.DNA.

• mRNA is processed and so that only mRNA is processed and so that only particular sections of DNA end up in particular sections of DNA end up in the mature segment of mRNA.the mature segment of mRNA.

TranscriptionTranscription• Only one strand of DNA is the Only one strand of DNA is the

template for mRNA production. It is template for mRNA production. It is called the called the template strandtemplate strand..

• The template strand contains the The template strand contains the promoter region. There can be promoter region. There can be multiple promoter regions on one multiple promoter regions on one strand. As a result, RNA production strand. As a result, RNA production can occur at multiple sites on a DNA can occur at multiple sites on a DNA strand.strand.

• The strand that is not used for mRNA The strand that is not used for mRNA production is called the production is called the inactive inactive strandstrand..

The Processing of mRNAThe Processing of mRNAIntrons-Portions of primary mRNA which are removed from mRNA.

Introns can be thought of as DNA which does not bind to RNA. Whatever proteins are coded for by the bases on these sections of DNA will NOT be produced.

The presence of introns suggests that there is more DNA than is necessary. The role of introns is still under investigation.

Exons- Portions of DNA which bind to RNA. Whatever traits these segments code for will be expressed.

mRNAmRNA

• mRNA that still contains introns is mRNA that still contains introns is called called primary mRNAprimary mRNA..

• A complex of special protiens called A complex of special protiens called spliceosomesspliceosomes remove the introns, remove the introns, leaving behind just the exons on a leaving behind just the exons on a strand of mRNA.strand of mRNA.

• The The mature mRNAmature mRNA leaves the nucleus leaves the nucleus through a pore in the nuclear through a pore in the nuclear membrane.membrane.

Translation requires three Translation requires three stepssteps• 1. Initiation- A small ribosomal unit 1. Initiation- A small ribosomal unit

attaches to the start codon (AUG). The attaches to the start codon (AUG). The first tRNA called the initiator tRNA first tRNA called the initiator tRNA pairs with the codon. Then a large pairs with the codon. Then a large ribosomal unit attaches and ribosomal unit attaches and translation begins.translation begins.– AnticodonAnticodon- A group of three bases on the - A group of three bases on the

tRNA that is the compliment to the three tRNA that is the compliment to the three bases of the codon on the strand of bases of the codon on the strand of mature mRNA. mature mRNA.

Structure of tRNA- note the Structure of tRNA- note the anticodonanticodon

Translation step 2: Chain Translation step 2: Chain elongationelongation

• Amino acids are added in a long chain to Amino acids are added in a long chain to form a peptide. form a peptide.

• Elongation occurs when the tRNA moves Elongation occurs when the tRNA moves from one site on the ribosome to another. from one site on the ribosome to another. (see figure 16.10).(see figure 16.10).

• The amino acids brought in by previous The amino acids brought in by previous tRNA is added to the current tRNA. Thus tRNA is added to the current tRNA. Thus extending the chain of amino acids in a extending the chain of amino acids in a specific order as specified by the mRNA.specific order as specified by the mRNA.

Chain elongationChain elongation

Step 3. Chain terminationStep 3. Chain termination

• The stop codon does not code for a The stop codon does not code for a particular amino acid and causes particular amino acid and causes peptide production to cease.peptide production to cease.

• The tRNA is cleaved and the peptide The tRNA is cleaved and the peptide leaves the ribosome.leaves the ribosome.

Transcription and Transcription and TranslationTranslation