View
232
Download
0
Tags:
Embed Size (px)
Citation preview
DNA Polymorphisms and Human Identification
11
Molecular DiagnosticsMolecular Diagnostics
Polymorphism
A DNA polymorphism is a sequence difference compared to a reference standard that is present in at least 1–2% of a population. Polymorphisms can be single bases or
thousands of bases. Polymorphisms may or may not have phenotypic
effects.
22 Molecular DiagnosticsMolecular Diagnostics
Polymorphic DNA Sequences
Polymorphisms are found throughout the genome.
If the location of a polymorphic sequence is known, it can serve as a landmark or marker for locating other genes or genetics regions.
Each polymorphic marker has different versions or alleles.
33 Molecular DiagnosticsMolecular Diagnostics
Types of Useful Polymorphismsand Laboratory Methods
44 Molecular DiagnosticsMolecular Diagnostics
RFLP Typing
Restriction fragment sizes are altered by changes in or between enzyme recognition sites.
55 Molecular DiagnosticsMolecular Diagnostics
RFLP Typing
The presence of RFLP is inferred from changes in fragment sizes.
66 Molecular DiagnosticsMolecular Diagnostics
RFLP Typing77 Molecular DiagnosticsMolecular Diagnostics
RFLP and Parentage Testing
RFLP genotypes are inherited. For each locus, one allele is inherited from each
parent.
Southern blot band patterns
88 Molecular DiagnosticsMolecular Diagnostics
RFLP and Parentage Testing
Who is the alleged father?
Of the two alleged fathers shown, only one could supply the fragments not supplied by the mother.
99 Molecular DiagnosticsMolecular Diagnostics
Evidence Testing by RFLP
Which suspect—S1 or S2—was at the crime scene? (V = victim, E = crime scene evidence, M = molecular weight
standard)
M S1 S2 V E M M S1 S2 V E M M S1 S2 V E M
Locus 1 Locus 2 Locus 3
1010 Molecular DiagnosticsMolecular Diagnostics
Short Tandem Repeat Polymorphisms (STR)
STR are repeats of nucleotide sequences. AAAAAA… - mononucleotide ATATAT… - dinucleotide TAGTAGTAG… - trinucleotide TAGTTAGTTAGT… - tetranucleotide TAGGCTAGGCTAGGC… - pentanucleotide
Different alleles contain different numbers of repeats. TTCTTCTTCTTC - four repeat allele TTCTTCTTCTTCTTC - five repeat allele
1111 Molecular DiagnosticsMolecular Diagnostics
Short Tandem Repeat Polymorphisms
STR alleles can be analyzed by fragment size (Southern blot).
GTTCTAGCGGCCGTGGCAGCTAGCTAGCTAGCTGCTGGGCCGTGGCAAGATCGCCGGCACCG TCGATCGATCGATCGACGACCCGGCACC
One repeat unit
tandem repeat
Restriction site
Allele 1
GTTCTAGCGGCCGTGGCAGCTAGCTAGCTGCTGGGCCGTGGCAAGATCGCCGGCACCG TCGATCGATCGACGACCCGGCACC
Allele 2
AlleleM 1 2 M
1212 Molecular DiagnosticsMolecular Diagnostics
Short Tandem Repeat Polymorphisms
STR alleles can also be analyzed by amplicon size (PCR).
1313 Molecular DiagnosticsMolecular Diagnostics
Short Tandem Repeat Polymorphisms
Allelic ladders are standards representing all alleles observed in a population.
(Allelic ladder)
11 repeats
5 repeats
Genotype: 7,9 Genotype: 6,8
1414 Molecular DiagnosticsMolecular Diagnostics
Short Tandem Repeat Polymorphisms
Multiple loci are genotyped in the same reaction using multiplex PCR.
Allelic ladders must not overlap in the same reaction.
1515 Molecular DiagnosticsMolecular Diagnostics
Short Tandem Repeat Polymorphisms by Multiplex PCR
FGA
TPOX
D8S1179
vWA
PentaE
D18S51
D2S11
THO1
D3S1358
1616 Molecular DiagnosticsMolecular Diagnostics
STR Nomenclature
The International Society for Forensic Genetics recommended nomenclature for STR loci in 1997: STRs within genes are designated according to the gene name
(no phenotypic effect with respect to these genes): TH01 is in intron 1 of the human tyrosine hydroxylase gene on
chromosome 11 Non–gene associated STRs are designated by the D#S#
system: D stands for DNA The following number designates the chromosome where the STR
is located (1-22, X or Y). S refers to a unique segment, followed by a number registered in
the International Genome Database (GDB).
Gender Identification:Amelogenin Locus, HUMAMEL
The amelogenin locus is not an STR (but along with STR).
The HUMAMEL gene codes for amelogenin-like protein. located on the X (Xp22.1–22.3) and Y chromosomes required for embryonic development and tooth maturation
Polymorphism is located in the second intron of the amelogenin gene: X allele = 212 bp Y allele = 218 bp (longer)
1818 Molecular DiagnosticsMolecular Diagnostics
Females (X, X)Homozygous (1 band)
Females (X, X)Homozygous (1 band)
Males (X, Y)Heterozygous (2 bands)
Males (X, Y)Heterozygous (2 bands)
Analysis of STR PCR Test Results:
STR genotypes are analyzed using gel or capillary gel electrophoresis.
Genotype: 7,9
11 repeats
5 repeats11 repeats 5 repeats
(Allelic ladder)
1919 Molecular DiagnosticsMolecular Diagnostics
Identity testing by STR-PCR
Genetic concordance: is a term used where all locus genotypes (alleles) from two sources are the same. Concordance is interpreted as
inclusion of a single individual as the donor of both genotypes.
Two samples are considered different if at least one locus genotype differs (exclusion).
A matching genotype is not necessarily an absolute determination of identity of an individual.A matching genotype is not necessarily an absolute determination of identity of an individual.
A microvariant allele (15.2) migrates between the full-length allelesA microvariant allele (15.2) migrates between the full-length alleles
Child and parent are not necessarily in complete Genetic concordance Mutational events may generate a
new allele in the offspring, and this difference may not rule out paternity.
Parentage Testing by STR-PCR
2121 Molecular DiagnosticsMolecular Diagnostics
ChildChild
MotherMother
FatherFather
Locus Child Mother 1 2 D3S1358 16/17 16 17 17 vWA 14/18 16/18 14/15 16/17 FGA 21/24 20/21 24 24 TH01 6 6/9.3 6/9 6/7 TPOX 10/11 10/11 8/11 8/9 CSF1PO 11/12 12 11 11/13 D5S818 11/13 10/11 13 9/13 D13S317 9/12 9 12/13 11/12
Which alleged father’s genotype has the paternal alleles?
Which alleged father’s genotype has the paternal alleles?
Short Tandem Repeat Polymorphisms: Y-STR
The Y chromosome is inherited in a block without recombination (Y chromosome cannot exchange information)
STR on the Y chromosome are inherited paternally as a haplotype. Series of linked alleles always inherited together Thus, marker alleles on the Y chromosome are inherited from
generation to generation in a single block. Y haplotypes are used for exclusion and paternal
lineage analysis. Except for rare mutation events, every male member of a
family (brothers, uncles, cousins, and grandparents) will have the same Y-chromosome haplotype.
2222 Molecular DiagnosticsMolecular Diagnostics
Engraftment Testing Using DNA Polymorphisms
Allogeneic donor and recipient immune compatibility is tested prior to the transplant by HLA typing.
Sequence polymorphisms (alleles) in the HLA locus are compared with those of the recipient to determine which donor would be most tolerated by the recipient immune system.
Donors may be known or related to the patient or anonymous unrelated contributors (matched unrelated donor).
Recipient receives his or her own
purged cells
Recipient receives donor cells
Recipient receives donor cells
A recipient with donor marrow is a chimera.A recipient with donor marrow is a chimera.
Chimerism Testing Using STR
There are two parts to chimerism testing: pretransplant informative analysis and post-transplant engraftment analysis donor cells can be monitored by following donor
polymorphisms in the recipient blood and bone marrowBefore transplant
Donor Recipient
After transplant
Complete (Full) Mixed Graft failure
2424 Molecular DiagnosticsMolecular Diagnostics
Chimerism Testing Using STR:Informative Analysis
STR are scanned to find informative loci (donor alleles differ from recipient alleles). Noninformative loci: the donor and the recipient have the
same alleles. Donor-informative loci: donor and recipient share one allele,
and the donor has a unique allele. Recipient informative loci: the unique allele is in the recipient
Full chimerism: only the donor alleles are detected in the recipient
Mixed chimerism: a mixture of donor and recipient alleles are present
Graft failure: only recipient alleles are detectable
2525 Molecular DiagnosticsMolecular Diagnostics
Which loci are informative?2626 Molecular DiagnosticsMolecular Diagnostics
GF: graft failureMC: mixed chimerismFC: full chimerism
GF: graft failureMC: mixed chimerismFC: full chimerism
vWA TH01 Amel TPOX CSF1PO
Chimerism Testing Using STR:Engraftment Analysis
Using informative loci, peak areas are determined in fluorescence units or from densitometry scans of gel bands. A(R) = area under recipient-specific peaks A(D) = area under donor-specific peaks
A(D) A(R)
A(R) + A(D)
2727 Molecular DiagnosticsMolecular Diagnostics
% Recipient DNA = A(R) + A(D)
A(R)× 100
% Recipient DNA = A(R) + A(D)
A(R)× 100
Chimerism Analysis of Cellular Subsets
Cell subsets (T cells, granulocytes, NK cells, etc.) engraft with different kinetics.
Analysis of cellular subsets provides a more detailed description of the engrafting cell population.
Analysis of cellular subsets also increases the sensitivity of the engraftment assay.
2828 Molecular DiagnosticsMolecular Diagnostics
Chimerism Analysis of Cellular Subsets
T cells (CD3), NK cells (CD56), granulocytes, myeloid cells (CD13, CD33), myelomonocytic cells (CD14), B cells (CD19), stem cells (CD34)
Methods Flow cytometric sorting Immunomagnetic cell sorting Immunohistochemistry + XY FISH
2929 Molecular DiagnosticsMolecular Diagnostics
R D T G
R = Recipient allelesD = Donor allelesT = T-cell subset (mostly recipient)G = Granulocyte subset (mostly donor)
Chimerism Analysis of Cellular Subsets
Detection of different levels of engraftment in cellular subsets is split chimerism.
3030 Molecular DiagnosticsMolecular Diagnostics
Single Nucleotide Polymorphisms (SNP)
Single-nucleotide differences between DNA sequences.
One SNP occurs approximately every 1,250 base pairs in human DNA.
SNPs are detected by sequencing, melt curve analysis, or other methods.
99% have no biological effect;60,000 are within genes.
3131 Molecular DiagnosticsMolecular Diagnostics
5′ AGTCTG 5′ AG(T/A)CTG 5′ AGACTG
T/T T/A A/A
SNP Detection by Sequencing
3232 Molecular DiagnosticsMolecular Diagnostics
SNP Haplotypes
SNPs are inherited in blocks or haplotypes. Sections of DNA along
chromosomes can be inherited as a unit or block of sequence
No recombination occurs within the block.
All the SNPs on that block comprise a haplotype.
SNPs can be used for mapping genes, human identification, chimerism analysis, and many other applications.
3333 Molecular DiagnosticsMolecular Diagnostics