DNA Polymorphisms and Human Identification 1 Molecular Diagnostics

DNA Polymorphisms and Human Identification

11

Molecular DiagnosticsMolecular Diagnostics

Polymorphism

A DNA polymorphism is a sequence difference compared to a reference standard that is present in at least 1–2% of a population. Polymorphisms can be single bases or

thousands of bases. Polymorphisms may or may not have phenotypic

effects.

22 Molecular DiagnosticsMolecular Diagnostics

Polymorphic DNA Sequences

Polymorphisms are found throughout the genome.

If the location of a polymorphic sequence is known, it can serve as a landmark or marker for locating other genes or genetics regions.

Each polymorphic marker has different versions or alleles.


Types of Useful Polymorphismsand Laboratory Methods


RFLP Typing

Restriction fragment sizes are altered by changes in or between enzyme recognition sites.


RFLP Typing

The presence of RFLP is inferred from changes in fragment sizes.


RFLP Typing77 Molecular DiagnosticsMolecular Diagnostics

RFLP and Parentage Testing

RFLP genotypes are inherited. For each locus, one allele is inherited from each

parent.

Southern blot band patterns


RFLP and Parentage Testing

Who is the alleged father?

Of the two alleged fathers shown, only one could supply the fragments not supplied by the mother.


Evidence Testing by RFLP

Which suspect—S1 or S2—was at the crime scene? (V = victim, E = crime scene evidence, M = molecular weight

standard)

M S1 S2 V E M M S1 S2 V E M M S1 S2 V E M

Locus 1 Locus 2 Locus 3


Short Tandem Repeat Polymorphisms (STR)

STR are repeats of nucleotide sequences. AAAAAA… - mononucleotide ATATAT… - dinucleotide TAGTAGTAG… - trinucleotide TAGTTAGTTAGT… - tetranucleotide TAGGCTAGGCTAGGC… - pentanucleotide

Different alleles contain different numbers of repeats. TTCTTCTTCTTC - four repeat allele TTCTTCTTCTTCTTC - five repeat allele


Short Tandem Repeat Polymorphisms

STR alleles can be analyzed by fragment size (Southern blot).

GTTCTAGCGGCCGTGGCAGCTAGCTAGCTAGCTGCTGGGCCGTGGCAAGATCGCCGGCACCG TCGATCGATCGATCGACGACCCGGCACC

One repeat unit

tandem repeat

Restriction site

Allele 1

GTTCTAGCGGCCGTGGCAGCTAGCTAGCTGCTGGGCCGTGGCAAGATCGCCGGCACCG TCGATCGATCGACGACCCGGCACC

Allele 2

AlleleM 1 2 M



STR alleles can also be analyzed by amplicon size (PCR).



Allelic ladders are standards representing all alleles observed in a population.

(Allelic ladder)

11 repeats

5 repeats

Genotype: 7,9 Genotype: 6,8



Multiple loci are genotyped in the same reaction using multiplex PCR.

Allelic ladders must not overlap in the same reaction.


Short Tandem Repeat Polymorphisms by Multiplex PCR

FGA

TPOX

D8S1179

vWA

PentaE

D18S51

D2S11

THO1

D3S1358


STR Nomenclature

The International Society for Forensic Genetics recommended nomenclature for STR loci in 1997: STRs within genes are designated according to the gene name

(no phenotypic effect with respect to these genes): TH01 is in intron 1 of the human tyrosine hydroxylase gene on

chromosome 11 Non–gene associated STRs are designated by the D#S#

system: D stands for DNA The following number designates the chromosome where the STR

is located (1-22, X or Y). S refers to a unique segment, followed by a number registered in

the International Genome Database (GDB).

Gender Identification:Amelogenin Locus, HUMAMEL

The amelogenin locus is not an STR (but along with STR).

The HUMAMEL gene codes for amelogenin-like protein. located on the X (Xp22.1–22.3) and Y chromosomes required for embryonic development and tooth maturation

Polymorphism is located in the second intron of the amelogenin gene: X allele = 212 bp Y allele = 218 bp (longer)


Females (X, X)Homozygous (1 band)

Females (X, X)Homozygous (1 band)

Males (X, Y)Heterozygous (2 bands)

Males (X, Y)Heterozygous (2 bands)

Analysis of STR PCR Test Results:

STR genotypes are analyzed using gel or capillary gel electrophoresis.

Genotype: 7,9

11 repeats

5 repeats11 repeats 5 repeats

(Allelic ladder)


Identity testing by STR-PCR

Genetic concordance: is a term used where all locus genotypes (alleles) from two sources are the same. Concordance is interpreted as

inclusion of a single individual as the donor of both genotypes.

Two samples are considered different if at least one locus genotype differs (exclusion).

A matching genotype is not necessarily an absolute determination of identity of an individual.A matching genotype is not necessarily an absolute determination of identity of an individual.

A microvariant allele (15.2) migrates between the full-length allelesA microvariant allele (15.2) migrates between the full-length alleles

Child and parent are not necessarily in complete Genetic concordance Mutational events may generate a

new allele in the offspring, and this difference may not rule out paternity.

Parentage Testing by STR-PCR


ChildChild

MotherMother

FatherFather

Locus Child Mother 1 2 D3S1358 16/17 16 17 17 vWA 14/18 16/18 14/15 16/17 FGA 21/24 20/21 24 24 TH01 6 6/9.3 6/9 6/7 TPOX 10/11 10/11 8/11 8/9 CSF1PO 11/12 12 11 11/13 D5S818 11/13 10/11 13 9/13 D13S317 9/12 9 12/13 11/12

Which alleged father’s genotype has the paternal alleles?

Which alleged father’s genotype has the paternal alleles?

Short Tandem Repeat Polymorphisms: Y-STR

The Y chromosome is inherited in a block without recombination (Y chromosome cannot exchange information)

STR on the Y chromosome are inherited paternally as a haplotype. Series of linked alleles always inherited together Thus, marker alleles on the Y chromosome are inherited from

generation to generation in a single block. Y haplotypes are used for exclusion and paternal

lineage analysis. Except for rare mutation events, every male member of a

family (brothers, uncles, cousins, and grandparents) will have the same Y-chromosome haplotype.


Engraftment Testing Using DNA Polymorphisms

Allogeneic donor and recipient immune compatibility is tested prior to the transplant by HLA typing.

Sequence polymorphisms (alleles) in the HLA locus are compared with those of the recipient to determine which donor would be most tolerated by the recipient immune system.

Donors may be known or related to the patient or anonymous unrelated contributors (matched unrelated donor).

Recipient receives his or her own

purged cells

Recipient receives donor cells

Recipient receives donor cells

A recipient with donor marrow is a chimera.A recipient with donor marrow is a chimera.

Chimerism Testing Using STR

There are two parts to chimerism testing: pretransplant informative analysis and post-transplant engraftment analysis donor cells can be monitored by following donor

polymorphisms in the recipient blood and bone marrowBefore transplant

Donor Recipient

After transplant

Complete (Full) Mixed Graft failure


Chimerism Testing Using STR:Informative Analysis

STR are scanned to find informative loci (donor alleles differ from recipient alleles). Noninformative loci: the donor and the recipient have the

same alleles. Donor-informative loci: donor and recipient share one allele,

and the donor has a unique allele. Recipient informative loci: the unique allele is in the recipient

Full chimerism: only the donor alleles are detected in the recipient

Mixed chimerism: a mixture of donor and recipient alleles are present

Graft failure: only recipient alleles are detectable


Which loci are informative?2626 Molecular DiagnosticsMolecular Diagnostics

GF: graft failureMC: mixed chimerismFC: full chimerism

GF: graft failureMC: mixed chimerismFC: full chimerism

vWA TH01 Amel TPOX CSF1PO

Chimerism Testing Using STR:Engraftment Analysis

Using informative loci, peak areas are determined in fluorescence units or from densitometry scans of gel bands. A(R) = area under recipient-specific peaks A(D) = area under donor-specific peaks

A(D) A(R)

A(R) + A(D)


% Recipient DNA = A(R) + A(D)

A(R)× 100

% Recipient DNA = A(R) + A(D)

A(R)× 100

Chimerism Analysis of Cellular Subsets

Cell subsets (T cells, granulocytes, NK cells, etc.) engraft with different kinetics.

Analysis of cellular subsets provides a more detailed description of the engrafting cell population.

Analysis of cellular subsets also increases the sensitivity of the engraftment assay.



T cells (CD3), NK cells (CD56), granulocytes, myeloid cells (CD13, CD33), myelomonocytic cells (CD14), B cells (CD19), stem cells (CD34)

Methods Flow cytometric sorting Immunomagnetic cell sorting Immunohistochemistry + XY FISH


R D T G

R = Recipient allelesD = Donor allelesT = T-cell subset (mostly recipient)G = Granulocyte subset (mostly donor)


Detection of different levels of engraftment in cellular subsets is split chimerism.


Single Nucleotide Polymorphisms (SNP)

Single-nucleotide differences between DNA sequences.

One SNP occurs approximately every 1,250 base pairs in human DNA.

SNPs are detected by sequencing, melt curve analysis, or other methods.

99% have no biological effect;60,000 are within genes.


5′ AGTCTG 5′ AG(T/A)CTG 5′ AGACTG

T/T T/A A/A

SNP Detection by Sequencing


SNP Haplotypes

SNPs are inherited in blocks or haplotypes. Sections of DNA along

chromosomes can be inherited as a unit or block of sequence

No recombination occurs within the block.

All the SNPs on that block comprise a haplotype.

SNPs can be used for mapping genes, human identification, chimerism analysis, and many other applications.


Documents

DNA Polymorphisms and Human Identification 1 Molecular Diagnostics