ORIGINAL ARTICLE

Cytotoxicity and Antioxidative Effects of Herbal and FruitExtracts In Vitro

Katerina Tomankova & Hana Kolarova & Klara Pizova & Svatopluk Binder &

Petr Konecny & Eva Kriegova & Lukas Malina & Jana Horakova &

Jakub Malohlava & Kristina Kejlova & Dagmar Jirova

Received: 5 November 2013 /Accepted: 2 June 2014# Springer Science+Business Media New York 2014

Abstract Many studies have been carried out on bioactivitiesof individual herbs/fruits using in cosmetics or as a dietproducts, however, no collective study on their comparativeantioxidant activities against oxidative damage or on cytotox-icity effect has been reported. The aim of this work was studythe cytotoxicity and antioxidative activity of eight extractswith hypothetical antioxidative influence in vitro. To furtherelucidate of a possible role of herbals/fruits extracts on cellprotection was used on the healthy and UV-A damagedmousefibroblast cells. The cell viability was detect using MTTassay.Kinetic production of reactive oxygen species, identificationof cell death, cell cycle and gene expression C-FOS weremeasured. Intracellular and mitochondrial transmembrane po-tential was evaluate with JC-1 fluorescence probe. Cometassay was employed to detect the UV-A induced DNA dam-age. The results indicated that using the extracts decreasedROS production. It can lead to greatly enhance and promotethe viability of cells. As the most effective antioxidant in

quenching of the ROS, in cell viability and DNA presentationwas determined Prunella Vulgaris. However, one of them(Wheat Germ Oil) caused increased production of ROS andlow cell viability.

Keywords Herbal extract . Fruit extract . Antioxidant .

Reactive oxygen species . Ultraviolet light

Abbreviations(ROS) reactive oxygen species(MMP) mitochondrial membrane potential(UV) ultraviolet(UV-A) ultraviolet A(DMEM) Dulbecco’s modified Eagle’s medium(FBS) fetal bovine sefum(PI) propidium iodide(PS) phosphatidylserine(C) Catechin(EC) Epicatechin(GC) Gallocatechin(EGC) Epigallocatechin(ECG) Epicatechin-3-gallate(EGCG) Epigallocatechin-3-gallateIC50 50 % inhibition concentration(DPPH) 2,2-diphenyl-1-picrylhydrazyl(LDL) Low-density lipoprotein(NMDA) N-methyl D-aspartate

Introduction

Producers of health supplements claim that their herbal/fruitextracts prevent cell damage caused by toxins like heavy metals,gases and UV radiation [1] due to a phlethora of biologicalactivities in vitro and in vivo. These include antioxidant and

K. Tomankova (*) :H. Kolarova :K. Pizova : S. Binder :L. Malina : J. Horakova : J. MalohlavaDepartment of Medical Biophysics, Faculty of Medicine andDentistry, Palacky University in Olomouc, Hnevotinska 3, 77515 Olomouc, Czech Republice-mail: katerina.tomankova@upol.cz

P. KonecnyInstitute of TranslationMedicine, Faculty of Medicine and Dentistry,Palacky University in Olomouc, Hnevotinska 3, 775 15 Olomouc,Czech Republic

E. KriegovaDepartment of Immunology, Faculty of Medicine and Dentistry,Palacky University in Olomouc, Hnevotinska 3, 775 15 Olomouc,Czech Republic

K. Kejlova :D. JirovaNational Institute of Public Health, Srobarova 48, 100 42 Prague,Czech Republic

Food BiophysicsDOI 10.1007/s11483-014-9349-0

anti-inflammatory effects. Herbal medicine, also called“phytomedicine” is, the use of the medicinal properties of plants,plant parts or plant derived substances to combat infections,diseases and/or enhance overall health. Herbal supplements thatstrengthen the immune system can be classified as adaptogens,immuno stimulants or both. Adaptogens increase resistance tostressors, physical, chemical or biological, where immuno stim-ulants activate the nonspecific or innate defense mechanismsagainst viral, bacterial or cellular [2]. All living organisms haveendogenous defense systems against oxidative damage such aslipid peroxidation and DNA damage and inhibition of cell com-munication due to reactive oxygen spicier (ROS). There are twomain antioxidant defense mechanisms: the antioxidant defensewith enzymes such as superoxide dismutase (SOD) which catal-yses the dismutation of superoxide anions to hydrogen peroxide;catalase (CAT) which converts hydrogen peroxide (H2O2) intomolecular oxygen and water: antioxidant defense with non-enzymatic components, such as polyphenols, ascorbic acid, andcarotenoids [3].

Ultraviolet (UV) light has beneficial health effects like vita-min D3 formation or in combination with drugs can be used inthe treatment of certain skin diseases [4]. However it can haveadverse biological effects, at least in part, by generating reactiveoxygen species and free radicals that promote carcinogenesis[5] UV-A radiation which represents 96 % of the total solar UVradiation reaching the earth’s surface, triggers signals whichaffect skin cells, causing oxidative stress resulting in a numberof pathologies. Ultraviolet light including the wavelengths 280to 400 nm is the most damaging radiation to human skin.Following sun exposure, photo allergy and photo toxicity arethe two main drug-photosensitivity reactions [6].

It is thought that the effects of UV-A on cell componentsresult from a photodynamic action producing reactive oxygenintermediates that can indirectly affect a variety of cellulartargets [7]. Free radicals are continuously produced withinliving cells as a result of multiple biochemical and physiolog-ical processes [8]. Anti-oxidants are substances which offerprotection against peroxidation of membrane lipids, modifica-tion of proteins or enzyme reactions, stimulation of pro-inflammatory cytokine release [9] and interfere with free radi-cals, reduce oxidative stress, and stop low-density lipoproteinsfrom being oxidised. Many antioxidants act like quenchers ofROS and free radicals. In normal physiology, there is a dynamicequilibrium between ROS activity and the antioxidant defensecapacity. However, when the equilibrium shifts in favour ofROS, either by reduction in antioxidant defenses or increase inROS production or activity, oxidative stress occurs [10].

The present studywas carried out to determine the protectiveeffects and potential cytotoxicity of eight herbal extracts onmouse fibroblasts against free radicals using a battery of in vitromethods included cell viability, kinetic production of reactiveoxygen species, determined the type of cell death, changes onmitochondrial membrane potential and genotoxicity.

Materials, Methods and Procedures

Tested Herbal/Fruit Extracts

For evaluating antioxidative activity we used the followingextracts at concentration 0–10 000 μg/ml (see Table 1):

The Chemical Composition of Extracts

Green Tea hydroglycolic extract of the leaves of green tea“Thea sinensis Sims”, whose Plant/Extract ratio is 1/2 andsolvent medium is water/propylene glycol (20:80).Polyphenols (5–27 %) are the most abundant constituents.Within this group, catechins are the most important. Sixdifferent types of catechins have been identified in tea: cate-chin (c), epicatechin (ec): 3.4–8.4 %, gallocatechin (gc), epi-gallocatechin (egc): 1.4–12.1 %, epicatechin-3-gallate (ecg):8.7–16.7 %, epigallocatechin-3-gallate (egcg): 31.2–52.8 %.Besides catechins, polyphenols also include catechin tannins(gallotannic acid 0.75 %), phenolic acids (chlorogenic, caffeicand ga l l i c ) , p roan thocyan id in s (p rocyan id in s ,prodelphinidins) and flavonoids (quercitin, caempherol,myricetin, rutin, apigenin and luteolin) [1].

Silymarin hydroalcoholic standardized extract of Lady’sThistle. Titred 1.2–2.5 % silymarin. Silymarin is a mixture ofseveral structural isomers of the flavanolignan group (silybin,silycristin and silydianin, isosilybin, isosilycristin,dehydrosilybin, dehydroisosilybin, 2,3-dehydrosilycristin) [1].

Pronalen Sensitive Skin standardised extract of Lady’s Thistleand Tulsi containing 0.3–0.5 % of ailymarin and 0.01–0.05 %of ursolic acid. By gas chromatography can be detected over20 components: eugenol (50 %), β-caryophyllene (30 %), β-elemene (6 %), ursolic acid, apigenin, luteolin, 7-O-glucuronide, luteolin-7-O-glucuronide, orientin (luteolin 8-C-glucoside), vicenin-2 (apigenin 6,8-C-diglucoside),galuteolin (luteolin 5-O-glucoside), cirsilineol (5,4’-dihy-droxy-6,7,3’-trimetoxyflavone) and lipid fraction [1].

Wheat Germ Oil wheat germ oil mainly contains lipids andliposoluble vitamins. Wheat lipids (triglycerides, lecithins,sterids) content of wheat flour varies between 1.5 and 2.5 %.A portion of these (25 %) is composed of lipids linked to thestarch of wheat flour, consisting of non-polar lipids (6 %),glycolipids (5 %) and phospholipids (89 %). The remaining75 % of the lipids are not linked to starch and consist of thesame components in different proportions: non-polar lipids(59%), glycolipids (26%) and phospholipids (15%). Themostabundant fatty acid is linoleic acid (55 %), followed by oleicand palmitic acids. Palmitic acid 11–17 %, stearic acid 0.6–3.6%, oleic acid 14–25%, linoleic acid 49–59%, linolenic acid4–10 %. The oils produced from cereal germ are the main

Food Biophysics

source of liposoluble vitamin tocopherols (Vit E]. Wheat germoil was obtained by cold pressing of wheat germs [1].

Pronalen Bio-Protect standardised hydrosoluble plant com-plex of ginseng, apple, peach, wheat and barley containingtotal ginsenosides 0.2–0.7 %, Pectins 0.2–0.5 % and Inositolhexaphosphate 1.0–3.0 % [1].

Pronalen Bio-Protect, Pronalen Sensitive Skin, PronalenSilymarin HSC and Green Tea Extract are obtained by liquidextraction without specification of chemicals by Provital compa-ny. All extracts were concentrated by evaporating of solvent [1].

Bilberry known as one of the richest sources of anthocyanins[11] and to have a profile of 15 major forms combiningcyanidin 15 %, delphinidin 29 %, petunidin 12 %, peonidin7 % and malvidin 49 % with galactose, glucose and arabinose[12]. Other components are (-)-Epicatechin 1.11 %, Myricetin0.82 %, Quercetin 3.11 %.

Blue Honeysuckle contains 20 % of phenolic acids, flavo-noids and anthocyanins 77% of non-condensed anthocyanins,cyanidin-3-glucoside dominate [13]. Other compounds areChlorogenic acid [14]. Rutin Caffeic acid, Quercetin andMyricetin. The extraction process of frozen berries was de-scribed in more detail in the CZ patent 29 28 34 (13) [13].

Prunella Vulgaris The plant’s active chemical constituents areoleanolic acid, betulinic acid, ursolic acid, triterpenoids, fla-vonoids, 2a, 3a-dihydroxyurs-12-en-28-oic and 2a, 3a-ursolicacids, D-camphor, D-fenchone, cyanidin, delphinidin,hyperoside, manganese, lauric acid, rosmarinic acid, myristicacid, rutin, linoleic acid, beta-sitosterol, lupeol and tannins.Prunella Vulgaris was was extracted with 30 % EtOH. TheEtOH extract was concentrated in vacuo and dried [15].

Materials and Instruments

The NIH3T3 cell line (Mouse fibroblast cell) was used as bio-logical material. The chemicals used included Dulbecco’sModified Eagle Medium (DMEM), phosphate buffered saline

(PBS, pH 7.4 own preparation), 5-(and-6)-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA,Invitrogen Co., USA), thiazolyl Blue tetrazolium bromide(MTT, Sigma Aldrich), Annexin FITC Apoptosis Detection Kit(Sigma Aldrich), 5,5’ ,6,6’-Tetrachloro-1,1’ ,3,3’-tetraethylbenzimidazolocarbocyanine iodide, 5,5’,6,6’-Tetrachloro-1,1’,3,3’-tetraethyl-imidacarbocyanine iodide(C25H27Cl4IN4, JC-1, Sigma Aldrich) dimethyl sulfoxide(DMSO, Sigma Aldrich), HMP agarose (Serva, Biotech, CzechRepublic), LMP agarose (Qbiogene, Genetica, Czech Republic),Trypsin-EDTA (Sigma), Ethanol (Sigma), fetal bovine serum(FBS, Sigma Aldrich), NaCl (Tamda, Czech Republic), EDTA(ethylenediaminetetraaceticacid, Lachema, Czech Republic),Tris (tris(hydroxymethyl) aminomethane, Sigma Aldrich),Triton X-100 (Serva), NaOH (Sigma Aldrich), SYBR Green(Invitrogen Co, USA). Anti-phospho-histone H3 (Millipore),Alexa Fluor 488 goat anti-rabbit IgG (Molecular probes),Propidium Iodide (Sigma), Ribonucleasa A (Sigma). TotalRNA Purification Kit (Norgen, Canada), Protector RNaseInhibitor (Roche Applied Science, USA), Transcriptor HighFidelity cDNA Synthesis Kit (Roche Applied Science, USA),PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, RocheApplied Science, USA), PSMB2-50 primers (Metabion,Germany), Fluorescently labelled Locked Nucleic Acid probe#50 (Universal ProbeLibrary, Roche Applied Science, USA),TaqMan® Gene Expression Assay (Human FOS, LifeTechnologies, Czech Republic s.r.o.). Reference gene and humanuniversal reference RNA (Stratagene, La Jolla, USA). Forcytometer measurement were used cytometric tubes (BDFalcon). Measurements were carried out on the multi-detectionmicroplate reader Synergy HT (BioTek, USA), transmissionmicroscope Olympus IX81 with DSU unit (Olympus, Japan),We used 96 well plates (P-Lab, Czech Republic) for cell linecultivation, centrifugal machine (Biotech, Czech Republic), glasscover slips (P-lab, Czech Republic), electrophoretic tank (Bio-RAD, Czech Republic), UV light source bank of four Phillipstubes TL-D 18/08 (320–400 nm). UV-Ameter (Type No. 37, Dr.Honle, Germany), Phototox Version 2.0 software (ZEBET,Germany), Comet Score (Tritek Corp). Gene expression analysiswas carried out on a Mastercycler pro (Eppendorf, Germany),

Table 1 Herbal/fruit extractSample Commercial name Herb/Fruit Conc. (μg/ml)

1 Green tea Camellia Sinensis 1,000

2 Silymarin HSC Silybum Marianum 1,000

3 Pronalen sensitive skin Ocimum Sanctum, Silybum Marianum 1,000

4 Wheat germ oil Triticum Vulgare 1,000

5 Pronalon Bio-protect Hordeum Vulgare, Panax Ginseng, PrunusPersica, Pyrus Malus, Triticum Vulgare

10 000

6 Bilberry Vaccinium Myrtillus L. 10

7 Blue honeysuckle Lonicera Caerulea L. 10

8 – Prunella Vulgaris 10

Food Biophysics

RotorGene Q (Quiagen, Netherlands). The gene analysis wasdoneessed using Rotor Gene software Q Series v.2.0.2, Quiagen.The UV light source also used in the ECVAM validation studyon 3 T3 NRU PT (SOL 500, Dr. Honle, Germany), was a dopedmercury-metal halide lamp which simulates the spectral distribu-tion of natural sunlight (emission spectrum in the range of 280–700 nm) (EC, 2008). A spectrum almost devoid of UVB(<320 nm) was achieved by filtering with 50 % transmission atthe wavelength of 335 nm (Filter H1, Dr. Honle, Germany).Phosphorylation of histoneH3was carried out on flow cytometerCalibur (GMI) and processed using Modfit SW.

Sample Preparation

104 NIH3T3 cells were incubated in a thermobox at 37 °C and5 % CO2 for 24 h in 96-well plates with fresh DMEM. Cellswere incubated for 1 h with extracts in thermobox and thenirradiated by ultraviolet radiation for 50 min with UV-A lightintensity 1.7 mW/cm2 (total dose 5 J/cm2). The emitted energywas measured before each experiment with a calibrated UV-Ameter. Test plates without irradiation were kept 50 min in thedark at room temperature. After treatment, the plates wereincubated for 6 h, 16 h (cell cycle, gene analysis) 24 h (MTT)in a thermobox at 37 °C and 5 % CO2. All assays wereperformed in triplicate.

MTT Viability/Phototoxicity Test

Extracts were added at concentrations 0–10 000 μg/ml. Thecytotoxic/phototoxic effect and IC50 on NIH3T3 cells wasdetermined using the MTT assay. We replaced DMEM byPBS prior to starting the MTT measurements, added 20 μl of20 mMMTT (dissolved in PBS) and incubated the cells for 3 hat 37 °C and 5 % CO2. The MTT solution was carefullyremoved and 100 μl DMSO were added in order to solubilizethe violet formazan crystals. The absorbance of the resultingsolution was measured in 96-well microplate reader SynergyHTat 570 nm and 690 nm. The cell viability of the samples wasdetermined as percentage of control cell viability (100×averageof test group/average of control group). Data were calculatedusing the Phototox v. 5 software for determination of IC50.

Measurement of Reactive Oxygen Species Production

ROS were quenched by antioxidants in concentrations of 0(control group) and IC50. Immediately after UV-A irradiation,the ROS kinetic production was determined using CM-H2DCFDA fluorescence probes and microplate readerSynergy HT. Time of CM-H2DCFDA probe incubation was30 min. Excitation wavelength of 485 nm and emission wave-length of 548 nmwere used. The time course of. Time of CM-H2DCFDA probe incubation was 10 min. Results are present-ed like linear regression coefficient. Values showed

production of ROS in each minute of measurement.Regression coefficient was calculated using function SLOPEin MS Excel 2010 from linear part of curves.

Mitochondrial Membrane Potential Assay ΔΨm

Mitochondrial membrane potential change (MMP) was mon-itored by the fluorescent cationic voltage-dependent dye JC-1.NIH3T3 cells were loaded in PBS media with JC-1 (5 μg/ml,dissolved in DMSO), for 20 min at 37 °C, 5 % CO2 and thenwashed by PBS twice. Results were expressed as ration of thefluorescence retained within the cells in green Excitationwavelength of 485 nm and emission wavelength of 548 nmwere used and in red spectra Excitation wavelength of 520 nmand emission wavelength of 590 nm were used.

Comet Assay

We used the methods from our previous study [16]. Briefly,microscope slides were first precoated with 1 % HMP agarose.The cells were trypsinized, rinsed by DMEM with 10 % FBS,centrifuged (6 min, 1,000 rpm). A quantity of 85 μl of 1 %LMP agarose was added to cell suspension and 85 μl of thiswas added to the microscope with agarose gel. The microscopeslides were immersed in a lysis buffer for 1 h, then placed in anelectrophoretic tank and dipped into a cool electrophoresissolution for 40 min. Electrophoresis was run at 0.8 V/cm and380 mA for 20 min. After neutralisation in buffer (0.4 M Tris,pH=7.5), the samples were then stained by SYBR Green andimmediately scored by SW Comet Score.

Cell Cycle, Phosphorylation of Histone H3 and ApoptosisDetermination

The cell cycle was monitored using the protocol of phosphor-ylation of Histone 3. Briefly, cells after treatment weretrypsined using 0.25 % Trypsin-EDTA, rinsed by DMEMwith 10 % FBS and centrifuged (5 min, 2,500 rpm). Cellsuspension was fixed by cold 70 % ethanol and stored in afreezer for future. Fixed cells were rinsed by PBS+1 % FBSand centrifuged (5 min, 2,500 rpm). Then we added 1 ml PBS+0.25 % TritonX-100 for 15 min on ice, rinsed and centri-fuged. 100 μl of primary antibody Anti-phospho-histone H3was added for 1 h at room temperature, rinsed and centrifuged.100 μl of secondary antibody Alexa Fluor 488 goat anti-rabbitIgG was incubated for 30 min in dark, rinsed and centrifuged.Propidium iodide and Ribonucleasa Awas added to the 700 μlof cell suspension.

Gene Expression Analysis

Total RNAwas isolated from cells 16 h after treatment usingTotal RNA Purification Kit according to the manufacturer’s

Food Biophysics

protocol. All samples were treated with Protector RNaseInhibitor. Total RNA was converted to double-strandedcDNA using the Transcriptor High Fidelity cDNA SynthesisKit in a 20 μl reaction volume according to the manufacturer’sprotocol. Reverse transcription was performed on Mastercyclerpro (Eppendorf, Germany). Template primer mix was incubat-ed for 10 min at 65 °C and final reaction (13 μl of template mixwith 7 μl of reverse transcription mix) was incubated 60 min at50 °C and than 5 min at 85 °C. PCR mixes were prepared asfollows: 5 μl of cDNA was added to 20 μl PCR-Mix withPSMB2-50 primers and Fluorescently labelled Locked NucleicAcid probe #50 or with TaqMan® Gene Expression. The finalconcentrations of each component: 900 nM of each sense andantisense primers and 100 nM probe 3.5 mMMgCl2; 200 μMeach dNTPs, 1U FastStart Taq DNA Polymerase, 1×PCRreaction Buffer. cDNA was stored at −20 ◦C before furtheruse. After initial denaturation (one cycle at 94 ◦C for 15 min),40 cycles amplification (94 ◦C for 45 s, 60 ◦C for 30 s) wereperformed on RotorGene Q (Quiagen, Netherlands). Theprimer sequences, probes and amplicon sizes for investigatedgenes are listed in Table 2. Relative expression was calculatedusing second derivative as follows: expression = averageamplification (CTtcalibrator-CTtsample). The PSMB2 gene wasused as a reference gene and human universal referenceRNAwas used as calibrator (in triplicate) at concentration of1.25 ng/reaction.

Statistical Analysis

The results were processed using software SPSS v 15 (SPSSInc. Chicago, USA) andMedCalc v. 12.4.0.0. The data are theresults of three independent experiments. ROS was analysedfor each concentration, and each sample was measured usingthe regression coefficient and 95%CI (confidence interval) asthe regression coefficient describes the change in the mea-sured values versus time (independent variable = time). Thedifference between samples and control was assessed bycomparing the 95 % CI for the regression coefficients. Todescribe the viability and mitochondrial membrane changesdepending on the concentration of each sample, was used theregression analysis, the regression coefficient was calculatedand 95 % CI for the regression coefficient (independent var-iable = concentrations of 0–10 000 mg/ml). Differences be-tween samples were assessed comparing the 95 % confidence

intervals for the regression coefficients. Comet samples werecompared with a control group using the Mann–Whitney Utest with Bonferroni correction for multiple comparisons. Thenormality of data was tested using the Shapiro-Wilk test. Testswere made at the level of significance 0.05. The assay of cellcycle, apoptois and Histone-H3 were compared with a controlgroup and between UV- and UV + in the proportion ofapoptotic cells using Fisher’s exact test with Bonferroni cor-rection for multiple comparisons and analysis of adjustedresiduals (cell cycle).

Results

The MTT viability test is presented in Table 3. in the form ofIC50 24 h after treatments. Sample 3 (Pronalen SensitiveSkin), 6 (Bilberry) and 7 (Blue Honeysuckle) showed a shiftto higher value of IC50 after irradiation. This fact suggestspotential antioxidant efficiency against UV-A irradiation. Thecorrelation coefficient was determined by linear regression(data not shown) in a concentration-dependence of 0–10000 mg/ml and shown significant increase in toxic effects ofsample 4 (Wheat germ oil) in both groups (UV+, UV-).Conversely, samples 2 (Silymarin HSC), 5 (Pronalon Bio-Protect) and 7 (Blue Honeysuckle) showed significant in-crease in cell viability.

The effect of the extracts on ROS formation in NIH3T3cells was continuously monitored during the 10 min afterincubation in the dark (UV-) and immediately after irradiationby UV-A in a dose of 5 J/cm2. The correlation coefficient ofROS production determined the rate of the peroxy radicalH2O2, hydroxyl radical HO-, hypochlorous acid HOCl andperoxyl radical COO-). The rate of ROS was calculated usinga linear regression analysis. A summary of the values for theIC50 concentration of extracts (see Table 3, UV-) is presentedin Fig. 1. The data show significant increase in ROS produc-tion between control and sample 4 (Wheat Germ Oil) in thenon irradiated group, which it can exhibit potential toxiceffect. On the other hand, sample 6 (Bilberry), 7 (BlueHoneysuckle) and 8 (Prunella Vulgaris) show significantdecrease in ROS production in the irradiated group. Theseresults suggest the great potential of the antioxidativecapacity of these three extracts against the products ofUV-A irradiation.

Table 2 Used primers

Gene GenBank*

accession nbAmpliconsize (bp)

Sense, antisenseprimers/Assay ID

Manufact.

FOS = FBJ murine osteosarcomaviral oncogene homolog

NM_005252.3 77 Hs00170630_m1 AB

PSMB2 = proteasome (prosome,macropain) subunit, beta type, 2

NM_002794.3 77 5’gtgagagggcagtggaactc 3’5’gaaggttggcagattcagga 3’

Roche

Food Biophysics

The MMP assay was used to evaluate the ΔΨm changesin cells 6 h after treatments (Fig. 2). The linear regressionof formation of red agregare or green monomer is expressedthe amount created in concentration-dependent of 0–10000 mg/ml. The points show the negative significance; starsshow the positive significance in comparison with other ex-tracts. The higher values in the red aggregate, the greater thedamage. Sample 4 (Wheat GermOil) showed significantly thehighest value in the red aggregate. On the other hand, sample1 (Green Tea) showed the significantly the smallest value. Thesmaller the values in the green monomer, the greater damageof the cell. The data show significant decrease in the greenmonomer in samples 1 (Green Tea), 3 (Pronalen SensitiveSkin), 6 (Bilberry) and 8 (Prunella Vulgaris). In groups UV+,were not determined any significant changes in potentialapoptotic processes. In summary, these results suggest mito-chondrial membrane depolarisation in the early stage of thecell death process in sample 4 (Wheat Germ Oil).

Comet assay determined the fragmentation of DNA 6 hafter treatments (Fig. 3). In group UV- in a concentration ofIC50, the Mann–Whitney U test with Bonferroni correctionshowed significantly higher % of DNA in the Tail in samples1 (Green Tea), 2 (Silymarin HSC), 3 (Pronalen SensitiveSkin), 5 (Pronalon Bio-Protect) and 8 (Prunella Vulgaris). Ingroup UV + there were no significant changes in comparisonwith the control group.

Cell cycle determination 16 h after treatment showed increas-ing cell number in phase G0/G1 of all tested antioxidants ingroup UV- and decreasing in phase S and G2/M. On the otherhand, in group UV-A there was a significant decrease in numberof cells in phase G0/G1 in samples 1 (Green Tea), 5 (PronalonBio-Protect) and 6 (Bilberry) (Fig. 4). Samples 1 (Green Tea), 5(Pronalon Bio-Protect), 7 (Blue Honeysuckle) and 8 (PrunellaVulgaris) showed greater number of cells in the S phase incomparison with the relevant control group. The cells in groupUV- showed significant decrease in phosphorylation of HistoneH3 in comparisonwith the control group and significant decreasein comparison with group UV-A for each tested antioxidant(Fig. 5). Significant decrease in number of apoptotic cells wasound for sample 6 (Bilberry) in group UV- and samples 2(Silymarin HSC), 3 (Pronalen Sensitive Skin), 4 (Wheat GermOil), 7 (Blue Honeysuckle) and 8 (Prunella Vulgaris) in groupUV-A in comparison with relevant control group. Significantlylower number of apoptotic cells after UV-A exposure as shownby samples 1 (Green Tea) and 3 (Pronalen Sensitive Skin) incomparison with non-irradiated samples (Fig. 6).

We evaluated the effect of UV-A radiation and treatmentwith various antioxidants on C-FOS expression in NIH3T3cells. We found C-FOS down regulation after UVexposure inboth control and all tested antioxidants (Fig. 7).We also foundthat all antioxidants inhibited C-FOS expression compared tonon irradiated control. In the case of UV-A exposed samples,the results varied. Samples 2 (Silymarin HSC), 3 (PronalenSensitive Skin) and 4 (Wheat Germ Oil) showed decreased C-FOS expression in comparison with the UV-A control. Theeffect of UV radiation may be cell type specific. ApparentlyUV exposed cells were unable o express he C-FOS gene dueto damage and hence the effect of antioxidants was not asmarked as in the case of the UV- samples. However, the testedantioxidant were able to protect against surrounding oxidativestress.C-FOS is an immediate-early, stress response gene. Fosprotein can dimerize with proteins of the jun-family and,together with the activating transcription factor, form thetranscription factor complex AP-1 (activator protein 1), whichbinds to a commonDNA site. AP-1 has a function in the stressresponse, differentiation, cell proliferation and cell survival bysignal transduction of growth factors in the cytoplasm to the

Table 3 IC50 of extracts in non-irradiated group and after UV-Airradiation

Sample IC50 mg/ml UV- IC50 mg/ml UV+

1 4.415 3.957

2 6.907 5.449

3 1.0411 4.55

4 0.7 0.361

5 20.48 12.6095

6 0.26345 0.286495

7 0.27885 0.34685

8 0.3465 0.31628

Fig. 1 Correlation coefficient of kinetic production of reactive oxygenspecies in concentration of IC50 UV- group. Time of UV-A irradiationwas 50 min with light intensity of 1.7 mW/cm2 (total dose 5 J/cm2). The

linear regression of ROS rate expressed the ROS amount created at eachmin. Point show the negative significance; stars show the positive signif-icance in comparison with control group

Food Biophysics

nucleus via the MAP-kinases signalling pathway. AP-1 maymodulate stress-induced apoptosis either positively or nega-tively, depending on the microenvironment and the cell type inwhich the stress stimulus is induced [17].

Discussion

It is noteworthy that, due to the great depth of penetration ofUV-A of the skin (more than 1 mm), this radiation can affectnot only the keratinocytes but also the fibroblasts locat-ed in the superficial dermis. Thus, fibroblasts are apotential target of UV-A radiation [7]. For this reason,we chose the NIH3T3 fibroblast cells as a model for theeffects of the selected herbal extract.

The potential value of antioxidants has prompted investi-gators to search for natural compounds with potent antioxida-tive activity but low cytotoxicity [18]. Interestingly, manyherbs are known to contain large amounts of phenolic antiox-idants other than the well-known vitamin C, vitamin E, andcarotenoids. Phenolic antioxidants in herbs are mainly com-posed of phenolic acids, flavonoids and catechins [3].Phenolic compounds which are widely distributed in plantssuppress inflammation and oxidative stress. Some of themhave the ability to quench lipid peroxidation, prevent DNAoxidative damage, and scavenge reactive oxygen species(ROS), such as superoxide, hydrogen peroxide, and hydroxylradicals [3, 14, 19, 20]. However, there are few comparativestudies on phenolic content, antioxidant activities against

oxidative stress, and the bioactivities of herbs and largercomparative studies on cytotoxicity are lacking.

Ramachandran et al., examined the protective effect ofursolic acid (included in Pronalen Sensitive Skin andP. Vulgaris) against UV-B induced lipid peroxidation, oxida-tive stress and DNA damage [21]. Lee et al., found that ursolicacid inhibits UV-A radiation induced oxidative damage inhuman keratinocytes [22].

Berries of blue honeysuckle are widely harvested and usedin folk medicine in northern Russia, China, Japan [9], andScandinavia [12]. A recent study has revealed that the poly-phenolic fraction of blue honeysuckle fruits effectively scav-enges DPPH and superoxide radical [13] and protects againstlipid peroxidation and LDL oxidation in vitro [23]. The pro-tective effect of the berry fractions seems to be mediatedthrough direct elimination of reactive oxygen/nitrogen spe-cies. It reduces DNA damage, activity of caspase-3 and -9 andexpression of IL-6 may also reflect their antioxidant activity[24]. Berries contain several groups of phenolics includingflavonoids, anthocyanins and phenolic acids with low molec-ular weight. These compounds have been reported to havemultiple biological activities. In particular they have beenidentified as strong antioxidants with the potential to protectagainst oxidative damage [24]. Tsai et al., characterizedtwelve herbs including honeysuckle and green tea. Total anti-oxidant and antibacterial activity of phenolic constituents ofmethanolic extracts was determined. They reported that al-though honeysuckle had the highest amount of chlorogenicacid, it showed only moderate antioxidant activity with noinhibitory effects on the growth of S. mutans. Honeysuckle

Fig. 2 Correlation coefficient of kinetic production of mitochondrialmembrane potential changes. Time of UV-A irradiation was 50 min withlight intensity 1.7 mW/cm2 (total dose 5 J/cm2). The linear regression offormation of red agregare or green monomer expressed the amount

created in dependence of concentration. Points show the negative signif-icance; stars show the positive significance in comparison with otherextracts. The higher values in the red aggregate the higher damage. Thesmaler values in the green monomer the higher damage

Fig. 3 % DNA in Taildeterminated by Comet assay inconcentration of IC50 UV- andUVad + group. Time of UV-Airradiation was 50 min with lightintensity 1.7 mW/cm2 (total dose5 J/cm2)

Food Biophysics

and green tea showed less inhibitory activity againstS. sanguinis than the other herbs. The methanolic extractsfrom honeysuckle and green tea possess antimicrobial activityagainst S. sanguinis alone [14].

Several studies have evaluated the anticarcinogenic ef-fects of green tea. Epigallocatechin-3-gallate (EGCG), oneof major polyphenolic constituents present in green tea,reverses UV-induced sun damage. EGCG in green tea is apromising agent for melanoma chemoprevention - low incost, easy to administer with negligible toxicity [5]. Greentea polyphenols can resulted in significant protectionagainst UV-induced skin carcinogenesis in tumor incidence[25]. Yoo at al., analyzed the contents of total phenolics andflavonoids in 17 selected herbs including green tea. Itsantioxidant and anticancer activities were measured bytheir abilities to scavenge free radical and to protect cellviability [3]. Although several skin care products alreadyinclude green tea extract, standardization of the quality orquantity of the compounds are not set down, and tests onhumans are still lacking. Tsai et al., reported that a cup ofgreen tea, with 4.32 mg/ml of methanolic extract did notcompletely inhibit the growth of S. mutans up to 8 mg/ml.

Green tea is a good scavenger - 94.5 % in comparison withHoneysuckle - 45.2 % [14].

Neurons are most susceptible to oxidative stress. Intactanthocyanins (included in berries) reach the brain withinminutes of their introduction into the stomach. Oboh et al.,reported that aqueous extract of green tea had a significantlyhigher inhibitory effect on lipid peroxidation in the rat’s brainthan sour tea (Hibiscus sabdariffa) [19].

Ng et al., investigated the properties of several compoundsisolated from the Chinese medicinal plant Aster tataricus. Thegreatest effect was shown by quercetin (included in berries)and kaempferol (included in berries and green tea). Thesewere the most outstanding in their antioxidant activity al-though, they had some prooxidant activity. Electron spinresonance spectrometry has revealed that quercetin directlyreacts with superoxide anions to form stable radicals, thusaccounting for the superoxide scavenging activites of thephenolic compound [20].

Vitamin E and its various chemical forms, such as α-tocopherol and α-tocopherol acetate, have been shown tohave antioxidant and photoprotective properties [26]. It isconsidered a universal participant in antioxidant defense

Fig. 4 Number of cells inspecific part of cell cycle inconcentration of IC50 in groupUV- and after UV-A irradiation(UV+). Time of UV-A irradiationwas 50 min with light intensity1.7 mW/cm2 (total dose 5 J/cm2).Positive (*) and negative (.)significance were determinedusing analysis of adjustedresiduals

Fig. 5 Number of cells with phosphorylation of Histone-H3 in concen-tration of IC50 in group UV- and after UV-A irradiation (UV+). Time ofUV-A irradiation was 50 min with light intensity 1.7 mW/cm2 (total dose

5 J/cm2). Positive (*) and negative (.) significance were determined usingFisher’s exact test with Bonferroni correction for multiple comparisons

Food Biophysics

reactions in biological membranes since it acts at all steps ofmembrane oxidative damage and works as a first line ofdefense against peroxidation of polyunsaturated fatty acids.It is is a chain-breaking antioxidant that prevents the peroxi-dation of lipids, and it might also stabilize biological mem-branes by restricting the mobility of their components [8].Despite the growing understanding of the role of vitamin Eas an oxidant protector in food and biological systems, itsmechanism of action is not completely understood [5]. Theantioxidant properties of vitamin E are demonstrated throughits role as a free radical scavenger that protects cell membranesfrom peroxidation. Animal studies seem to support the rolethat vitamin E may have in decreasing photocarcinogenesis inthe skin. Some results suggests that dietary vitamin E supple-mentation may not offer a clinically significantphotoprotective benefit. For example, a case–control studyin Washington State demonstrated an inverse relation-ship between vitamin E intake and the incidence ofmelanoma [26] and oral supplementation does not re-duce UV radiation-induced oxidative stress [5]. Ourin vitro results support this theory.

P. vulgaris ethylacetate fraction is able to minimise oxida-tive stress in cardiomyocytes intoxicated by doxorubicin. Themechanism of the cardioprotective effects of the extract ismost probably linked with the antioxidant capacity due to itshigh content of phenolic acids [15]. Prunella vulgarisinhibited rat erythrocyte hemolysis and lipid peroxidation inrat kidney and brain homogenates [18], and can in a suitableconcentration of extract, enhance the cellar immunologicalfunction in rats from up-regulation at the level of genetic

transcription [27]. Psotova et al. determined, that P. vulgarisand Rosmarinic acid may offer protection against UVA-induced oxidative stress and may be beneficial as a supple-ment in photoprotective dermatological preparations [28].0.1 % and 1.0 % of P. vulgaris extract can significantlyenhance immune response and also reduce fish mortality afterchallenge with U. marinum. Thus, it can be concluded thatP. vulgaris extract possibility can be used as animmunostimulant to enhance immune responses and diseaseresistance in cultured fish species [29].

Our preliminary study revealed that Silymarin can protectnon-tumorous cells against photodynamic therapy [30].Skottova et al., tested the effects of phenolic-rich extracts fromthe plants Silybum marianum and Prunella vulgaris on bloodand liver antioxidant status and lipoprotein metabolism ofheditary hypertriglyceridemic rats. Administration ofsilymarin or PVE as 1 % dietary supplements in diet did notinfluence lipid levels in plasma or liver but both extractscaused decrease in plasma very low density lipoprotein(VLDL)-cholesterol levels [31]. Another study on Silymarinsuggested that these flavonolignans suppress UV-A causedoxidative stress and may be useful in the treatment of UVA-induced skin damage [4].

Conclusion

Chemoprevention through diet and dietary supplements willcontinue to be a hotly debated topic for many years. It will benecessary to test various antioxidants and compare them under

Fig. 6 Number of apoptotic cell in concentration of IC50 in group UV-and after UV-A irradiation (UV+). Time of UV-A irradiation was 50 minwith light intensity 1.7 mW/cm2 (total dose 5 J/cm2). Positive (*) and

negative (.) significance were determined using Fisher’s exact test withBonferroni correction for multiple comparisons

Fig. 7 Fold change of C-FOSexpression 16 h after treatment onNIH3T3 cells treated with variousantioxidants combined withoutUV- (light grey columns) or withUV-A radiation (dark greycolumns). Data represents meanand standard error from twoindependent measurements

Food Biophysics

the same conditions. The effectivenes of antioxidants can beevaluated by in vitro tests. We conclude that antioxidants 2(Silymarin HSC) and 8 (Prunella Vulgaris) have the potentialto protect the cell from genotoxic damage, due to a lowervalue DNA in tail. Effective prevention against ROS produc-tion were shown by antioxidants 6 (Bilberry), 7 (BlueHoneysuckle) and 8 (Prunella Vulgaris). After irradiation, insamples 2 (Silymarin HSC), 3 (Pronalen Sensitive Skin), 4(Wheat Germ Oil), 7 (Blue Honeysuckle) and 8 (PrunellaVulgaris), we observed the effect decreasing the number ofapoptotic cell. Like the best antioxidant was determinedPrunella Vulgaris.

Acknowledgments This work was supported by the Grant ProjectLF_2014_003, IGA MZCR NT 14060-3/2013. Thanks to JanaZapletalova for statistic analysis.

References

1. Provital Group, product information 486300G: Green tea,4115000G: Pronalen Silymarin HSC, 7570000G: Pronalen sensitiveskin, 1230000G: Wheat Germ Oil, 7520000G: Pronalen Bio-Protect

2. C.A. Williams, E.D. Lamprecht, Vet. J. 178, 21 (2008)3. K.M. Yoo, C.H. Lee, H. Lee, B.K.Moon, C.Y. Lee, FoodChem. 106,

929 (2008)4. A. Svobodova, A. Zdarilova, D. Walterova, J. Vostalova, J. Derm.

Sci. 48, 213 (2007)5. J.D. Jensen, G.J.Wing, R.P. Dellavalle, Clin. Dermatol. 28, 644 (2010)6. D. Lelievre, P. Justine, F. Christiaens, N. Bonaventure, J. Coutet, L.

Marrot, J. Cotovio, Toxicol. Vitro 21, 977 (2007)7. Y.T. Han, Z.W. Han, G.Y. Yu, Y.J. Wang, R.Y. Cui, C.B. Wang,

Pharm. Res. 49, 265 (2004)8. M. Lúcio, C. Nunes, D. Gaspar, H. Ferreira, J.L.F.C. Lima, S. Reis,

Food Biophys. 4, 312 (2009)

9. A. Zdarilova, A. Rajnochova-Svobodova, K. Chytilova, V. Simanek,J. Ulrichova, Food Chem. Toxicol. 48, 1555 (2009)

10. I.L.C. Chapple, J.B. Matthews, Periodontology 43, 160 (2007). 200011. M. Philpott, C.C. Lim, L.R. Ferguson, Int. J. Mol. Sci. 10, 1081

(2009)12. A.K. Lätti, K.R. Riihinen, L. Jaakola, Phytochem. 72, 810 (2011)13. I. Palikova, J. Heinrich, P. Bednar, P. Marhol, V. Kren, L. Cvak, K.

Valentova, F. Ruzicka, V. Hola, M. Kolar, V. Simanek, J. Ulrichova,J. Agric. Food Chem. 56, 11883 (2008)

14. T.H. Tsai, T.H. Tsai, Y.C. Chien, C.W. Lee, P.J. Tsai, Food Chem.110, 859 (2008)

15. J. Psotova, S. Chlopcikova, P. Miketova, V. Simanek, Fitoterapia 76,556 (2005)

16. K. Tomankova, K. Kejlova, S. Binder, A. Daskova, J. Zapletalova, H.Bendova, H. Kolarova, D. Jirova, Toxicol. Vitro 25, 1242 (2011)

17. R. Sanovic, B. Krammer, S. Grumboeck, T. Verwanger, Int. J. Oncol.35, 921 (2009)

18. F. Liu, T.B. Ng, Life Sci. 66, 725 (2000)19. G. Oboh, J.B.T. Rocha, Food Biophys. 3, 382 (2008)20. T.B. Ng, F. Liu, Y. Lu, C.H.K. Cheng, Z. Wang, Comput. Biochem.

Phys. C 136, 109 (2003)21. S. Ramachandran, N.R. Prasad, Chem-Biol Interact. 176, 99 (2008)22. Y.S. Lee, D.Q. Jin, S.M. Beak, E.S. Lee, J.A. Kim, Eur. J. Pharmacol.

476, 173 (2003)23. I. Palikova, K. Valentova, I. Oborna, J. Ulrichova, J. Agric. Food

Chem. 57, 6584 (2009)24. A. Svobodova, A. Zdarilova, J. Vostalova, J. Dermatol. Sci. 56, 196

(2009)25. S.K. Katiyar, C.A. Elmets, Int. J. Oncol. 18, 1307 (2001)26. C.S. Kirkpatrick, E. White, J.A. Lee, Am. J. Epidemiol. 139, 869

(1994)27. L. Jun, Q. Rui, Y. Song, Y. Mei, J. Med. Coll. PLA 26, 230 (2011)28. J. Psotova, A. Svobodova, H. Kolarova, D. Walterova, J. Photoch.

Photobio. B 84, 167 (2006)29. R. Harikrishnan, J.S. Kim, M.C. Kim, C. Balasundaram, M.S. Heo,

Aquaculture 318, 61 (2011)30. K. Tomankova, H. Kolarova, P. Kolar, K. Kejlova, D. Jirova, Toxicol.

Vitro 23, 1465 (2009)31. N. Skottova, L. Kazdova, O. Oliyarnyk, R. Vecera, L. Sobolova, J.

Ulrichova, Pharm. Res. 50, 123 (2004)

Food Biophysics