Upload
karsen
View
45
Download
0
Embed Size (px)
DESCRIPTION
Course outline. More serious. Tom Head – splicing systems. There is a solid theoretical foundation for splicing as an operation on formal languages. - PowerPoint PPT Presentation
Citation preview
1 Introduction2 Theoretical background
Biochemistry/molecular biology3 Theoretical background computer science4 History of the field5 Splicing systems6 P systems7 Hairpins
8 Detection techniques
9 Micro technology introduction
10 Microchips and fluidics11 Self assembly12 Regulatory networks13 Molecular motors14 DNA nanowires15 Protein computers16 DNA computing - summery17 Presentation of essay and discussion
Course outline
More serious
There is a solid theoretical foundation for splicing as an operation on formal languages.
In biochemical terms, procedures based on splicing may have some advantages, since the DNA is used mostly in its double stranded form, and thus many problems of unintentional annealing may be avoided.
The basic model is a single tube, containing an initial population of dsDNA, several restriction enzymes, and a ligase. Mathematically this is represented as a set of strings (the initial language), a set of cutting operations, and a set of pasting operations.
It has been proved to a Universal Turing Machine.
Tom Head – splicing systems
These are the techniques that are common in the microbiologist's lab and can be used to program a molecular computer. DNA can be: synthezise desired strands can be created separate strands can be sorted and separated by length merge by pouring two test tubes of DNA into one to
perform union extract extract those strands containing a given
pattern melt/anneal breaking/bonding two ssDNA molecules with
complementary sequences amplify use of PCR to make copies of DNA strands cut cut DNA with restriction enzymes rejoin rejoin DNA strands with 'sticky ends' detect confirm presence or absence of DNA
Tom Head – splicing systems
Initial set (finite or infinite) consists of double-stranded DNA molecules
Specific classes of enzymatic activities considered-those of restriction enzymes
Recombinant behavior modeled and associated sets analyzed by new formalism called Splicing Systems
Attention focused on effect of sets of restriction enzymes and a ligase that allow DNA molecules to be cleaved and Re-associated to produce further molecules.
Tom Head – splicing systems
Circular DNA and Splicing Systems
DNA molecules exist not only in linear forms but also in circular forms.
Splicing systems
SPLICING
LINEAR
CIRCULAR
Splicing systems
Linear splicing
…ATTGACCC…
…CAATCAGG…
G|A
AT|C
ligase…ATTG
ACCC…
…CAATCAGG…
…ATTGCAGG…
…CAATACCC…
Splicing in nature
V alphabet
r =u1 u2
u4u3splicing rule u1, u2, u3, u4 V*
(x, y) x, y, z, w V*
x = x1u1u2x2
y = y1u3u4y2
x1, x2, y1, y2 V*
(z, w)r
r
x1u1u4y2 = z
y1u3u2x2 = w
Splicing in DNA computing
= (V, T, A, R)
L() = *(A) T*
if A, R FIN then L() REG
… with permitting context
u1 u2
u4u3
C1
C2
R
if A, R FIN then L() RE
V alphabetT V terminal alphabetA V* set of stringsR splicing rules
C1, C2 V*
Extended H-system
tA
hAa t1hAa t1
hA
hA bs1cAtA
h1a AtA
t1
h1a
hA AtA
hA
h1abs1ct1 h1bs1cAt1
{s1}
{h1, s1}
{hA, s1}
{s1, tA}
1
2
3
4
h1a bs1ct1 hAbs1c t1
h1bs1cA tA h1bs1cAt1
1 2 3
4
h1a
hA AtA
t1
tA
3
Rotation
h1a AtAh1a AtA h1 at1h1 at1
hAa t1hAa t1 hAatA
hA AtA h1 at1
: (x u1u2 y, wu3u4 z)r = u1|u2 $ u3|u4 rule
(x u1 u4 z , wu3 u2 y)
x y w z
xw
z cut
paste
y
sites
Pattern recognition
u1 u2 u3 u4
u1
u2 u3
u4
x u1 zu4 w u3 u2 y
Păun’s linear splicing operation (1996)
Circular splicing
restriction enzyme 1 restriction enzyme 2
ligase enzymes
Circular splicing
Conjugacy relation on A*
w, w A*, w ~ w w = xy, w = yx
Example abaa, baaa, aaab, aaba are conjugates
Ao = A*
o = set of all circular words ow = [w]o , w A*
Circular languages
Circular language C Ao set of equivalence classes
A* A* o
L Cir(L) = {ow | w L} (circularization of L)
CL
C{w A*| ow C}= Lin(C)
(Full linearization of C)
(A linearization of C, i.e. Cir(L)=C )
Circular languages
FAo ={ C Ao | L A*, Cir(L) = C, L FA, FA Chomsky hierarchy}
Definition
Theorem [Head, Păun, Pixton]
C Rego Lin (C) Reg
Circular languages
Păun’s definition
(A= finite alphabet, I Ao initial language)
SCPA = (A, I, R) R A* | A* $ A* | A* rules
ohu1u2 , oku3u4 Ao r = u1 | u2 $ u3 | u4 R
u2hu1 u4ku3 ou2hu1 u4ku3
Circular splicing systems
Definition
A circular splicing language C(SCPA) (i.e. a circular language generated by a splicing system SCPA) is the smallest circular language containing I and closed under the application of the rules in R.
Circular splicing systems
Head’s definitionSCH = (A, I, T) T A* A* A* triples
Ao (p, x, q ), (u,x,v) T
vkux ohpx vkux q
ohpxq , okuxv
q hpx
SCPI = (A, I, R)
Ao (, ; ), (, ; ) R
oh h
oh , o h
h
Pixton’s definitionR A* A* A* rules
h
Other splicing systems(A= finite alphabet, I Ao initial language)
Characterize
FAo C(Fin, Fin)
C(Reg, Fin)
class of circular languages C= C(SCPA) generated by SCPA with I and R both finite sets.
Problem
Theorem [Păun96]
F{Rego, CFo, REo}
R +add. hyp. (symmetry, reflexivity, self-splicing)
Theorem [Pixton95-96]
R Fin+add. hyp. (symmetry, reflexivity)
C(F, Fin) F
F{Rego, CFo, REo}
C(F, Reg) FC(Rego, Fin)Rego,
Problem
CSo
CFo
Rego
o((aa)*b)
o(aa)* o(an bn)
I= oaa o1, R={aa | 1 $ 1 | aa} I= oab o1, R={a | b $ b | a}
Circular finite splicing languages
Circular automata
J. Kari and L. KariContext-free Recombinations, words, sequences, languages where computer science, biology and linguistics meet, C. Martin-Vide, V. Mitrana (Eds.). Kluwer, the Netherlands.
Finite automata for circular languages
Definition Finite automaton A, circular language K-accepted by A, L( A )o
K , all words wo such that A has a cycle labeled by w
K–Acceptance Circular/linear language accepted by a finite automaton A, defined as L(A) oL(A), L(A) linear language accepted by automaton A defined in the usual way
Definition A circular/linear language L *o is regular if there is a finite automaton A that accepts the circular and linear parts of L, i.e. that accepts L * and L o
Finite automata for circular languages
The following definition is equivalent to a definition given by Pixton:the circular language accepted by a finite automaton is a set of all words that label a loop containing at least one initial and one final state.
DefinitionGiven a finite automaton A, the circular language accepted by A, L(A)o
P is the set of all words ow such that A has a cycle labeled by w that contains at least one final state.
P-acceptance
The circular languages accepted by finite automaton by the following definition coincide with the regular circular languages introduced by Head.
Given a finite automation A, the circular language accepted by A, L( A )o
H is the set of all words ow such that w = u v and v u L( A )
Pixton has shown that if in addition we assume that the family of languages is closed under repetition (i.e., wn is in the language whenever w is)
H – acceptance and P – Acceptance are equivalent
H-acceptance
Advantages of K-acceptance
The same automaton accepts both the linear and circular components of the language
K-acceptance
Counting problem
T. Head, Circular Suggestions for DNA Computing, in: Pattern Formation in Biology, Vision and Dynamics, Eds. A.Carbone, M Gromov and P. Prusinkiewicz, World Scientific,Singapore , 2000, pp. 325-335.
J. Kari, A Cryptosystem Based on Propositional Logic, in: Machines, Languages and Complexity, 5th International Meeting of Young Computer Scientists, Czeckoslovakia, Nov. 14-18, 1988, Eds. J. Dassow and J.Kelemen, LNCS 381, Springer, 1989, pp.210-219.
Rani Siromoney, Bireswar Das, DNA Algorithm for Breaking a Propositional Logic Based Cryptosystem, Bulletin of the EATCS, Number 79, February 2003, pp.170-176.
Sources
Introducing CUT-DELETE-EXPAND-LIGATE (C-D-E-L) model
Combine features in Divide-Delete-Drop (D-D-D) (Leiden) and CUT-EXPAND-LIGATE (C-E-L) (Binghamton) to form CUT-DELETE-EXPAND-LIGATE (C-D-E-L) modelThis enables us to get an aqueous solution to 3SAT which is a counting problem and known to be in IP.
3SAT Defined as follows:Instance: F a propositional formula of form F = C1 C2 …Cm where Ci are clauses and i = 1, 2, …, m.Each Ci is of the form ( li1 li2 li3) where li j , j = 1, 2, 3 are literals from the set of variables {x1 , x2 , … , xn}Question What is the number of truth assignments that satisfy F?
C-D-E-L model
Standard double stranded DNA cloning plasmid are commercially available.
A plasmid is a circular molecule approximately 3 kb. It contains a sub-segment, MCS (multiple cloning site) of approximately 175 base pairs that can be removed using a pair of restriction enzyme sites that flank the segment.
The MCS contains pair-wise disjoint sites at which restriction enzymes act such that each produces a 5’ overhang.
Data register molecule
In C-D-E-L, a segment of the plasmid used is of the form
…c1s1c1…c2s2c2…cnsnncn…
Where ci are called sites, such that no other subsequence of plasmid matches with this sequence and si are called stations and i=1,…,n
In D-D-D, lengths of stations are required to be the same
However in C-D-E-L, lengths of stations all different which is fundamental in solving #3SAT
Bio-molecular operations used in C-D-E-L are similar to the operations in C-E-L
C-D-E-L model
x1 , … , xn the variables in F, x1 , … , xn their negations si station associated with xi
si station associatd with si
ci site associated with station si
ci site associated with station si
vi length of station associated with xi, i=1, …, n vn+j length of station associated with literal xj , j=1,…, n Choose stations in such a way that the sequence [ v1 , … , v2n ] satisfies the property k vi < vk+1 , k = 1, … , 2n-1 i=1i.e. an Super-increasing (Easy) Knapsack Sequence From sum, sub-sequence efficiently recovered.
Design
Solution in Cn is analyzed by gel separation
If more than one solution is present, they will be of different lengths, thus will form separate bands
By counting number of bands we count the number of satisfying assignments.
Furthermore, from lengths of satisfying assignment ,exact assignment is read.
This can be done since stations have lengths from easy knapsack sequence any subsequence of an easy knapsack sequence has different sum from the sums of other subsequences.
Solution
C-D-E-L model
Thus solution to 3–SAT viz. finding the number of satisfying assignments is effectively done. Moreover, reading the truth assignments is a great advantage to break the cryptosystem based on propositional logic
Solution
Advantage over previous method of attack
In the cryptanalytic attack proposed earlier, modifying D-D-D, it was required to execute the DNA algorithm for each bit in the crypto-text
But in the present method proposed, using C-D-E-L (combining features of C-C-C and C-E-L ) apply 3-SAT on P and read any satisfying assignment from the final solution
This gives an equivalent public key, which amounts to breaking the cryptosystem
Advantage
H-system Lipton[94-95a-95b] Formalization and generalization of Adleman’s approach to other NP-complete problems.
Ex H-system Circular H-system Sticker system P-system
Splicing systems so far
For computational strength Turing Equivalence Expansion Finiteness & Regularity More Operator Formalization
To confirm homogeneity HPP solving & AGL
Splicing systems so far
Molecular application
Separating and fusing DNA strands Lengthening of DNA Shortening DNA Cutting DNA Multiplying DNA
Operations of DNA molecules
Denaturation separating the single strands without breaking them
weaker hydrogen than phosphodiester bonding heat DNA (85° - 90° C)
Renaturation slowly cooling down annealing of matching, separated strands
Separating and fusing DNA strands
Machinery for Nucleotide Manipulation Enzymes are proteins that catalyze chemical reactions.
Enzymes are very specific. Enzymes speed up chemical reactions extremely efficiently (speedup: 1012)
Nature has created a multitude of enzymes that are useful in processing DNA.
Enzymes
DNA polymerase enzymes add nucleotides to a DNA molecule
Requirements single-stranded template primer, bonded to the template 3´-hydroxyl end available for extension
Note: Terminal transferase needs no primer.
Lengthening DNA
DNA nucleases are enzymes that degrade DNA.
DNA exonucleases cleave (remove) nucleotides one at a time from the ends of the strands
Example: Exonuclease III 3´-nuclease degrading in 3´-5´direction
Shortening DNA
DNA nucleases are enzymes that degrade DNA.
DNA exonucleases cleave (remove) nucleotides one at a time from the ends of the strands
Example: Bal31 removes nucleotides from both strands
Shortening DNA
DNA nucleases are enzymes that degrade DNA.
DNA endonucleases destroy internal phosphodiester bonds Example: S1 cuts only single strands or within single strand sections
Restriction endonucleases much more specific cut only double strands at a specific set of sites (EcoRI)
Cutting DNA
Amplification of a „small“ amount of a specific DNA fragment, lost in a huge amount of other pieces.
„Needle in a haystack“ Solution: PCR = Polymerase Chain Reaction devised by Karl Mullis in 1985 Nobel Prize a very efficient molecular copy machine
Multiplying DNA
Start with a solution containing the following ingredients:
the target DNA molecule
primers (synthetic oligo-nucleotides), complementary to the terminal sections
polymerase, heat resistant nucleotides
PCR - initialisation
Solution heated close to boiling temperature.
Hydrogen bonds between the double strands are separated into single strand molecules.
PCR – denaturation
The solution is cooled down (to about 55° C).
Primers anneal to their complementary borders.
PCR - priming
The solution is heated again (to about 72° C).
Polymerase will extend the primers, using nucleotides available in the solution.
Two complete strands of the target DNA molecule are produced.
PCR - extension
2n copies after n steps
PCR – copying
Measuring the Length of DNA Molecules
DNA molecules are negatively charged.
Placed in an electric field, they will move towards the positive electrode.
The negative charge is proportional to the length of the DNA molecule.
The force needed to move the molecule is proportional to its length.
A gel makes the molecules move at different speeds.
DNA molecules are invisible, and must be marked (ethidium bromide, radioactive)
Gel electrophoresis
Gel electrophoresis
reading the exact sequence of nucleotides comprising a given DNA molecule
based on the polymerase action of extending a primed single stranded template
nucleotide analogues chemically modified e.g., replace 3´-hydroxyl group (3´-OH) by 3´-hydrogen atom (3´-H)
dideoxynucleotides: - ddA, ddT, ddC, ddG Sanger method, dideoxy enzymatic method
Sequencing
Objective We want to sequence a single stranded molecule a.
Preparation We extend a at the 3´ end by a short (20 bp) sequence g, which will act as the W-C complement for the primer compl(g). l Usually, the primer is labelled (radioactively, or marked fluorescently)
This results in a molecule b´= 3´- ga.
Sequencing
5' ATTAGACGTCCGTGCAATGC 3'
3'ACGTTACG 5'
Sequencing
4 tubes are prepared Tube A, Tube T, Tube C, Tube G Each of them contains b molecules primers, compl(g) polymerase nucleotides A, T, C, and G. Tube A contains a limited amount of ddA. Tube T contains a limited amount of ddT. Tube C contains a limited amount of ddC. Tube G contains a limited amount of ddG.
Sequencing
Structure of ddTTP
Termination with ddTTP
Reaction in Tube A
The polymerase enzyme extends the primer of b´, using the nucleotides present in Tube A: ddA, A, T, C, G.
using only A, T, C, G: b´ is extended to the full duplex.
using ddA rather than A: complementing will end at the position of the ddA nucleotide.
Sequencing
Sequencing
Sequencing - stopping
Tube C GCCTGCAGATTA C CGGAC CGGACGTC
Tube G GCCTGCAGATTA CG CGG CGGACG
Sequencing -results
Tube A GCCTGCAGATTA CGGA CGGACGTCTA CGGACGTCTAA
Tube T GCCTGCAGATTA CGGACGT CGGACGTCT CGGACGTCTAAT
Sequencing – reading the results