Contribution of MDR1 gene polymorphisms on IBD predisposition and response to glucocorticoids in IBD in a Chinese population

  • Published on
    14-Mar-2017

  • View
    223

  • Download
    2

Transcript

  • 1

    This article is protected by copyrig1h t. All rights reserved.

    Contribution of MDR1 gene polymorphisms on IBD

    predisposition and response to glucocorticoids in IBD in Chinese

    population1

    Short title: MDR1 SNPs and IBD in Chinese population

    Qing Fan YANG*1

    , Bai Li CHEN1, Qing Sen ZHANG

    1, Zhen Hua ZHU

    1 , Bin HU

    2 ,

    Yao HE1

    , Xiang GAO1, Yi Ming WANG

    2, Pin Jin HU

    1, Min Hu CHEN

    1, Zhi Rong

    ZENG#1

    1: Department of Gastroenterology, the First Affiliated Hospital, Sun

    Yat-sen University, Guangzhou, P.R. China

    2: Department of Medical Genetics, Zhongshan School of Medicine and

    Center for Genome Research, Sun Yat-Sen University, Guangzhou, China

    #: The corresponding author of this study

    Correspondence: Zhirong Zeng, Department of Gastroenterology, the

    First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II road,

    Guangzhou, P.R. China, 510080. Tel: +86 020 8733 2741. Fax: +86 020

    8733 2741. E-mail: zengzhirong@vip.163.com

    The abstract of this study has been accepted as oral presentation in the 1st Annual

    meeting of Asian Organization for Crohn's & Colitis held on 13th to 14th June 2013,

    Tokyo, Japan and also accepted as poster presentation in the Asian Pacific Digestive

    Week 2013/World Congress of Gastroenterology, 21-24 September 2013, Shanghai,

    China.

    This article has been accepted for publication and undergone full peer review but has not been through

    the copyediting, typesetting, pagination and proofreading process, which may lead to differences

    between this version and the Version of Record. Please cite this article as doi:

    10.1111/1751-2980.12205

    Acc

    epte

    d A

    rticl

    e

  • 2

    This article is protected by copyrig1h t. All rights reserved.

    Abstract

    Background: Inflammatory bowel diseases (IBD) are chronic diseases of

    unknown etiology, in which genetic factors contribute to the pathogenesis.

    The cornerstone of conventional treatment is glucocorticoid (GCs) whose

    sensitivity varies from patient to patient. Genes such as Multidrug

    resistance 1 (MDR1), NACHT leucine-rich-repeat protein 1 (NALP1),

    Glucocorticoid receptor (GR) and its co-chaperone FKBP5 participate in

    the anti-inflammatory mechanism of GCs. Variations of these genes are

    related to GCs responseand MDR1 polymorphisms are also associated

    with the susceptibility to IBD in Caucasians. However, whether similar

    relationships exist in Chinese population remains unclear. Thus, the aims

    of this research were to investigate the polymorphisms of these genes

    influence the response to GCs in Chinese IBD patients and the

    relationships between MDR1 and IBD susceptibility.

    Methods: 8 Single-nucleotide polymorphisms (SNPs) were selected and

    genotyped in 156 IBD patients treated with GCs and 223 healthy controls

    by MALDI-TOF MS assay. Patients were defined as GCs responders,

    dependants or resistants after one year follow up.

    Results: The CC genotypes of rs1128503 and rs1045642 in MDR1 gene

    were more frequent in GC dependants compared with the responsive Acc

    epte

    d A

    rticl

    e

  • 3

    This article is protected by copyrig1h t. All rights reserved.

    patients of Crohns Disease (CD) (OR 6.583, 95%CI 1.760-24.628,

    P=0.019 and OR 3.873, 95%CI 1.578-9.506, P=0.009, respectively).

    The G allele of MDR1 rs2032582 was less frequent among CD cases than

    in controls (OR 0.668, 95%CI 0.484-0.921, P=0.014). G allele carriers

    were also less likely to develop non-stricturing and non-penetrating CD

    (OR 0.661, 95% CI 0.462-0. 946, P=0.023) and ileocolonic CD (OR

    0.669, 95%CI 0.472-0.948, P=0.024). There was no significant finding in

    Ulcerative Colitis ( UC).

    ConclusionPolymorphisms of MDR1 associated with GCs response and

    the predisposition to CD in Chinese population. More studies are needed

    to elucidate the functions of MDR1 polymorphisms in IBD and their role

    as genetic markers for GCs response.

    Key words: Inflammatory bowel disease; Single Nucleotide

    Polymorphism; Glucocorticoids; Clinical phenotypes;

    Introduction

    Inflammatory bowel diseases (IBD), including Crohns disease (CD)

    and Ulcerative colitis (UC), are a collection of chronic inflammatory

    diseases characterized by destructive relapsing inflammation of the

    gastrointestinal tract. During the last few decades, the incidence of IBD Acc

    epte

    d A

    rticl

    e

  • 4

    This article is protected by copyrig1h t. All rights reserved.

    has been increasing in previously low morbidity areas, including China [1]

    .

    Glucocorticoids (GCs) are the important and effective treatment of

    moderate to severe IBD, while the sensitivity to which varies between

    individuals. However, it also brings a lot of side effects, ranging from

    mild to life-threatening adversary events [2]

    . According to an investigation

    of our center, 20-30% of IBD patients in our country were GCs dependent,

    2-9% were resistant and approximately 15% of CD patients required

    surgery within one year when the treatment with GCs failed [3]

    . Thus it is

    useful and attractive to search for biomarkers which enable the prediction

    of GCs response to avoid non-effective administering and insensitive IBD

    patients.

    Recent studies from some populations have confirmed that single

    nucleotide polymorphisms (SNPs) of MDR1 (drug transporter

    P-glycoprotein encoding gene), NR3C1 (glucocorticoid receptor and

    encoding gene), FKBP5 (encoding FK506-binding protein, the

    co-chaperone of glucocorticoid receptor), and the pro-inflammatory

    cytokine activator NALP1 (NACHT domain, LRR domain, and pyrin

    domain-containing protein 1) are associated with the steroid response in

    IBD patients [3,4,5,6]

    , Hence it is safe to infer that they are potential

    genetic predictors of GCs responsiveness in IBD. Mechanism studies

    have revealed that the weakened function of glucocorticoid receptor

    (GR-), abnormal activity of FKBP5, overexpression of P-glycoprotein Acc

    epte

    d A

    rticl

    e

  • 5

    This article is protected by copyrig1h t. All rights reserved.

    (p-gp), and constitutive activation of some inflammatory factors such as

    IL-1, regulated by NALP1, may inhibit the anti-inflammatory function

    of glucocorticoid. It has indicated close connections between these genes

    and GCs response[8,9,10]

    . Since the relationship between genes mentioned

    above and GCs therapeutic effect in Chinese population remains unclear,

    we selected 8 SNPs from these genes to investigate whether they are

    associated with the sensitivity to steroid in IBD patients in our population.

    As mentioned before, SNPs of MDR1 gene has a relationship with the

    susceptibility to IBD in some populations [11, 12]

    , so we also assessed the

    role of these SNPs in the predisposition to IBD and in affecting clinical

    phenotypes of IBD in Chinese population.

    MATERIALS AND METHODS

    Patients and controls

    156 IBD patients (CD: n=117, UC: n=39) were included from our IBD

    outpatient Clinic and 223 healthy individuals were included as control

    from general physical examination in our hospital Patients enrolled were

    diagnosed clinically between 2005 and 2010 according to previously

    established international diagnosis criteria [13]

    and followed up for at

    least 1 year to confirm diagnosis. This study included all consecutive

    patients who used steroid for the first time. They were prescribed with oral

    GCs for at least 30 days and had a minimum of one year follow-up. Acc

    epte

    d A

    rticl

    e

  • 6

    This article is protected by copyrig1h t. All rights reserved.

    Patients were initially administered prednisone about 40-60mg/d, and the

    doses were subsequently tapered every one or two weeks. We separated

    patients into different groups according to the effect of the first course GC

    therapy. Patients who maintained complete or partial remission after GCs

    withdrawal were defined as GC responders; while patients who were

    either i) unable to reduce steroids below the equivalent of prednisolone 10

    mg/day within 3 months of starting steroids, without recurrent active

    disease, or ii) who have a relapse within 3 months of stopping steroids

    were defined as GC dependants; GC resistants were patients who did not

    respond after short time therapy (30 days) of GCs [14]

    .Clinical

    classification of all patients was assessed according to Montreal

    classification of IBD [15]

    . All subjects were given written informed consent

    and this study was approved by the ethic committee of the First Affiliated

    Hospital of Sun Yat-sen University.

    Genotyping of polymorphism

    Blood samples of IBD patients and healthy controls were collected.

    Genomic DNA was extracted from peripheral blood leukocytes using the

    TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China). The

    polymorphisms were genotyped by Beijing Genomics Institute (BGI,

    Shenzhen, China) using MALDI-TOF MS assay (MassArray,

    Sequenom, Inc., San Diego, CA, USA). Primers for Polymerase chain

    reaction (PCR) were designed (Table-1). Details are available from the Acc

    epte

    d A

    rticl

    e

  • 7

    This article is protected by copyrig1h t. All rights reserved.

    authors on request. Twenty randomly selected DNA samples were

    sequenced to validate the genotyping results by MALDI-TOF MS.

    Results of the MALDI-TOF MS method corresponded with the results of

    sequencing.

    Statistical analysis

    All the analyses were carried out by SPSS 13.0 software (SPSS Inc.,

    Chicago, Ill., USA). Hardy-Weinberg equilibrium was assessed using the

    X2 test. Single factor analysis and subsequent logistic regression model

    were used to analyze relationship between genotype and GCs response as

    well as relationships between genotypes and disease phenotypes.

    Pearson-X2 test was used to analyze differences in allele and genotype

    distribution between cases and controls. Odds ratio (OR) and 95%

    confidence interval (CI) were carried out by adjusting age and sex. The

    criterion for significant difference was two-side probability 0.05). All genotypes of the selected Acc

    epte

    d A

    rticl

    e

  • 8

    This article is protected by copyrig1h t. All rights reserved.

    SNPs were consistent with Hardy-Weinberg equilibrium (P>0.05) in both

    case and control groups except that SNP rs1045642 was disequilibrium in

    the control group (p=0.04) and hence was excluded when performing

    genotype and disease susceptibility analyses. Among the included 117

    CD patients, 83 patients were GC responders83/117, 70.9%, 29 GC

    dependants29/117, 24.8%, and 55/117, 4.2% were considered

    resistants. Among the 39 UC patients, we identified 22 GC responders

    22/39, 56.4%, 17 GC dependants17/29, 43.6%, and none of them

    considered as resistant. Detailed demographic characteristics of the CD

    and UC patients are summarized in Table 2 and 3.

    Frequency distribution of the selected SNPs between steroid respond

    and dependent IBD patients

    The number of resistant patients is insufficient (only 5), so these

    patients were not included in the statistical analysis. The genotype

    frequency of polymorphism rs1128503 (C1236T) and rs1045642

    (C3435T) in the MDR1 gene distributed significantly differently between

    GCs respond and dependent IBD patients (P=0.027 and 0.023

    respectively, Table 4). These SNPs were further found only associated

    with the steroid effect of CD patients but not with UC patients (Table 5).

    As reported in Table 5, genotype frequency distribution of SNP

    rs1128503 (C1236T) and rs1045642 (C3435T) were obviously different Acc

    epte

    d A

    rticl

    e

  • 9

    This article is protected by copyrig1h t. All rights reserved.

    between the responders and dependants of CD patients. The wild

    genotype CC of rs1128503 (C1236T) and rs1045642 (C3435T) were both

    more frequent in GCs dependants with CD than in the responders

    [adjusted P=0.019 and 0.009OR(95%CI) 6.583 (1.760-24.628) and

    3.873 (1.578-9.506) , respectively], so CC genotype of the two SNPs may

    be risk factors for GCs dependence. We further performed haplotype

    analysis and found the frequencies of C3435/C1236/T2677 and

    T3435/T1236/T2677 haplotypes of the three SNPs was much different

    between steroid responders and dependants with CD. Haplotype analysis

    revealed that carriers of C3435/C1236/T2677 haplotype had a

    significantly higher risk of having CD (p=0.004), while carriers of

    T3435/T1236/T2677 had a significantly reduced risk of having CD

    (P=0.006, OR (95%CI) 0.383(0.189-0.775)). No significant association

    was found between haplotypes of MDR1 SNPs and UC. Besides, the

    other 6 SNPs and their haplotypes analysis failed to show any

    significant association with GCs effects (P >0.05).

    Frequency distribution of the selected polymorphisms in IBD

    patients and controls

    The secondary aim of our research was to assess whether SNPs of

    MDR1 contribute to IBD susceptibility and phenotypes by case-control

    study. However, since rs1045642 was not in HardyWeinberg equilibrium

    in the control group, we did not analyze it. As shown in Table-6, the two Acc

    epte

    d A

    rticl

    e

  • 10

    This article is protected by copyrig1h t. All rights reserved.

    polymorphisms selected from MDR1 gene were distributed significantly

    differently between IBD cases and controls (P

  • 11

    This article is protected by copyrig1h t. All rights reserved.

    anti-inflammatory reaction in target cells. Once diffusing into cells, GCs

    binds to its receptor GR- and subsequently transported into the nucleus

    together to inhibit the transcriptional regulation of many

    pro-inflammatory cytokines and finally reduced their production[8]

    . The

    aberrant activity of GR, for example, declined expression of GR- or

    increased expression of GR- which doesnt bind to GCs will undermine

    the mediation function of GCs [16]

    . Moreover, the inactivated GR- is

    bound to the heat-shock protein (HSP) complex and immunophilin

    FK506-binding proteins FKBP5. Once after binding to GCs, GR-

    becomes activated, and being released from HSP and FKBP5. The

    increasing expression of these chaperones such as FKBP5 can modify

    GR- activity by reducing its affinity to GCs, which also lead to

    weakened GCs function[17]

    . On the other hand, some other molecules also

    modulate GCs function. For example, the MDR1 coding protein

    P-glycoprotein (P-gp) is a drug transporter which promotes the outflow of

    glucocorticoid from target cells. In that case, the overexpression of P-gp

    may hinder the effect of GCs by reducing the concentration of GCs in the

    cytoplasm. In addition, pro-inflammatory factors, such as TNF-, IL-1

    will interference the activity of GCs[18]

    ; Some of these pro-inflammatory

    cytokines must be activated by caspase-1 which needs the help of NALP1

    to convert it from inactive precursor [8, 9]

    . Therefore, NALP1 participates

    in the mediating of GCs function indirectly by affecting the activation of Acc

    epte

    d A

    rticl

    e

  • 12

    This article is protected by copyrig1h t. All rights reserved.

    pro-inflammatory factors. On the genetic aspect, some researchers found

    SNPs of MDR1, NR3C1, FKBP5 and NALP1 also associated with GCs

    responsiveness [3, 4, 5, 6]

    , which strengthens the role of these genes in GCs

    function meditation. In this study, we mainly tried to identify the

    relationships between SNPs of these genes and GCs therapy response in

    our Chinese population.

    Our results suggested SNPs of NR3C1, FKBP5 and NALP1 did not

    relate to the GCs therapy response in IBD patients in Chinese population.

    The mutated genotype of NR3C1 rs41423247 (OR 0.15, 95% CI 0.03 to

    0.68, p=0.0075) was reported to be in association with GC

    hypersensitivity in IBD patients in Italian population [3, 4]

    . NR3C1

    polymorphism rs7701443 (OR 3.43; 95% CI: 1.796.57; P= 0.042) and

    rs860457 (OR 3.43; 95% CI: 1.796.57; P< 0.001) were also related at

    the allelic level to corticosteroid resistance in pediatric-onset CD in

    Canada population [5]

    . The variation of FKBP5 rs4713916 significantly

    associated with resistance to GC treatment in CD in Italian population

    (responder 17% versus resistant 35%; P=0.0043) [6]

    .Furthermore, NALP1

    involved in some autoimmune disease [7]

    and the variant allele of its

    polymorphism rs12150220 was less frequent in the GC responsive IBD

    patients in Italian population(P=0.02)[4]

    . But here we found these SNPs

    dont affect GCs therapy responsiveness in Chinese patients with IBD,

    which may be due to two reasons. Firstly, as the contribution of genetic Acc

    epte

    d A

    rticl

    e

  • 13

    This article is protected by copyrig1h t. All rights reserved.

    polymorphism differs significantly between ethnicities, it could partially

    explain our result. Secondly, former studies suggested some SNPs were

    related to GCs resistance [5,6], while we did not analyze the relationship

    between GCs resistance and SNPs because it enrolledonly 5 patients.

    The exclusion of this group from statistics inevitably risked selection

    bias. As mentioned before, 2-9% of IBD patients who used steroid in our

    country were GCs resistant [3]

    , which was much lower than the dependent

    or response rate. Moreover, we only enrolled patients who used steroid

    for the first time, which further reduced the number of resistant patients

    included. Because of these limitations, it calls for further studies with

    larger sample size to further elucidate the relationship between genotype

    and phenotype

    Despite the fact that, there was no interaction found between SNPs

    and NR3C1, FKBP5, NALP1 and GCs efficacy, we did find two SNPs

    from MDR1 gene which were positively associated with GCs effect in

    IBD patients. The wild genotype CC of rs1128503 (C1236T) and

    rs1045642 (C3435T) might lead to the lower sensitivity to GCs and

    should be regarded as risk factors for the GCs dependent in CD in

    Chinese population. In the previous studies, Krupoves A et al collected

    260 pediatric CD patients in Canada population and found rs1045642

    (C3435T) did not correlate to GCs sensitivity [19]

    . This contrast result

    reminded us the influence of polymorphisms might vary depending on the Acc

    epte

    d A

    rticl

    e

  • 14

    This article is protected by copyrig1h t. All rights reserved.

    age, ethnicity and environment. In mechanism researches, no report is

    about how SNP C1236T impact on MDR1 or P-gp functions so far.

    Nevertheless, S. Hoffmeyer et al observed a significant correlation of

    polymorphism rs1045642 (C3435T) with expression levels and function

    of MDR1. The homozygous CC carriers had two-fold higher MDR1 and

    P-gp expression levels [20]

    . In consistent with S. Hoffmeyer et al, Hitzl

    M et al found individuals of the 3435 CC genotype had significantly

    higher MDR1 activity measured by rhodamine efflux in CD56+ natural

    killer cells than those of TT genotype [21]

    .These studies indicated that

    C3435T CC genotype might cause more GCs transporting out of the

    cytoplasm and GCs less responsiveness, which were in accord to our

    results. On the contrary, some other studies found the function of MDR1

    and P-gp were independent of rs1045642 (C3435T) [22, 23]

    . Though the

    associations of these SNPs with GCs effect are contradictory in different

    populations and the mechanism is still unclear, our result strongly

    demonstrated that MDR1 SNP played a critical role of in GCs effect in

    Chinese IBD patients.

    MDR1 gene is located in chromosome 7q21.1, which has been

    identified as a locus of susceptibility for IBD [24]

    , thus we also evaluated

    the relationship between MDR1 polymorphisms and IBD in this research.

    We discovered that the G allele of MDR1 rs2032582 (G2677T/A) was

    less frequent among CD cases in comparison to controls (OR: 0.668, Acc

    epte

    d A

    rticl

    e

  • 15

    This article is protected by copyrig1h t. All rights reserved.

    95%CI 0.484-0.921, P=0.014), Furthermore, the genotype-phenotype

    analysis revealed the G allele of MDR1 rs2032582 (G2677T/A) was

    protective from ileocolonic CD and non-stricturing and non-penetrating

    CD. However, no significant association between the other MDR1

    polymorphisms and the susceptibility to IBD was found, nor was there

    any other association with subphenotypes of IBD. In consistent with our

    result, Brant et al [25]

    found rs2032582 (G2677T/A) had an obviously

    association with CD in North American cohort. Whereas Potocnik et al [26]

    and Huebner C [27] found a connection with UC and no association was

    observed in studies of Ho et al [28]

    , Ardizzone S [29]

    and Palmieri et al [30]

    .

    Because of HardyWeinberg disequilibrium, we did not analyze MDR1

    C3435T association with IBD in Chinese population, though a lot of

    studies from different populations found obviously interactions between

    MDR1 C3435T and UC or CD [12]

    . Heterozygous carriers for the variants

    C1236T showed a lower risk of developing ulcerative colitis (odds ratio

    0.63, 95% confidence interval 0.42-0.93, P = 0.03; ) as compared with

    homozygotes[31]

    , while we did not find any association between C1236T

    and UC, which might be partially attributed to the small size of the

    involved UC patients. P-gp expresses in the epithelial cells and plays a

    role in decreasing the absorption of endogenous and exogenous toxins in

    the GI tract [32]

    . The mechanism is unknown how the G allele of SNP

    rs2032582 (G2677T/A) plays a protective role in IBD; Kim RB et al [33] A

    ccep

    ted

    Arti

    cle

  • 16

    This article is protected by copyrig1h t. All rights reserved.

    found nonsynonymous SNP rs2032582 could alter transport function of

    P-gp; The G allele of SNP rs2032582 enhanced the transport ability of

    P-gp; So SNP rs2032582 (G2677T/A) may affect the development of IBD

    by influencing P-gp function.

    In conclusion, for the first time we demonstrated MDR1

    polymorphisms C1236T and C3435T were associated with GCs

    sensitivity in Chinese patients with CD; the G2677T/A polymorphism

    correlated to susceptibility to CD and phenotypes of CD. Therefore

    MDR1 polymorphism may be a potential genetic marker of GCs response

    in IBD patients in Chinese population. Studies with more individuals are

    required to further identify the findings Especially in UC patients, the

    study should be repeated again. In this study, we had only enrolled 39 UC

    patients which was partially due to the relatively low prevalence of IBD

    and a lower using rate of steroid in UC than CD. Moreover, functional

    studies are also needed to assess the role of these SNPs in modulating

    GCs therapy responsiveness and the pathogenesis of IBD.

    Acknowledgement

    This project was sponsored by Natural Science Foundation of Guangdong

    Province, China (No.10151008901000223) and Clinical Key Technology

    Program Grant from Ministry of Health of China (No.020426902). Acc

    epte

    d A

    rticl

    e

  • 17

    This article is protected by copyrig1h t. All rights reserved.

    Contribution of authors and Conflict of interest

    Prof. Zingrong Zeng, Minhu Chen and Pinjin Hu helped to design the

    project; Prof. Yiming Wang and Bin Hu provided a good lab for us to

    perform the experiment; Prof. Xiang Gao and Yao He helped us to collect

    subjects sample and to inform the patients of this subjects; Doctor

    Qingsen Zhang and Zhenhua Zhu helped to analyze the results and

    perform part of the experiment. Prof. Baili Chen and doctor Qingfan Yang

    participated in all parts of this experiment and wrote the manuscript.

    There is no conflict of interest among authors.

    Reference

    1. Zeng Z, Zhu Z, Yang Y, et al. Incidence and clinical characteristics of Inflammatory Bowel

    Disease in a developed region of Guangdong province, China: A Prospective

    Population-Based Study. J Gastroenterol Hepatol. 2013 Feb 22.

    2. Rutgeerts PJ: Review article: Review article: the limitations of corticosteroid therapy in

    Crohn's disease. Aliment Pharmacol Ther. 2001 Oct; 15(10):1515-25.

    3. Baili Chen, Yujun Chen, Xiang Gao, Yao He, Yinglian Xiao, Minhu Chen, Pinjin Hu; The

    natural history of first course of corticosteroid therapy for 235 patients with inflammatory

    bowel disease. Chinese Journal of Gastorenterology and Hepatology; 2013, 22(1):66-67. Acc

    epte

    d A

    rticl

    e

  • 18

    This article is protected by copyrig1h t. All rights reserved.

    4. De Iudicibus S, Stocco G, Martelossi S, et al. Association of BclI polymorphism of the

    glucocorticoid receptor gene locus with response to glucocorticoids in inflammatory bowel

    disease. Gut .2007 Sep; 56(9): 1319-20.

    5. De Iudicibus S, Stocco G, Martelossi S, et al. Genetic predictors of glucocorticoid response

    in pediatric patients with inflammatory bowel disease. J Clin Gastroenterol. 2011 Jan;

    45(1):e1-7.

    6. Krupoves A, Mack D, Deslandres C, et al. Variation in the glucocorticoid receptor gene

    (NR3C1) may be associated with GCs dependent and resistance in children with Crohns

    disease. Pharmacogenet Genomics. 2011 Aug; 21(8):454-60.

    7. MalteseP, Palma L, Sfara C, et al. Glucocorticoid resistance in Crohns disease and ulcerative

    colitis: an association study investigating GR and FKBP5 gene polymorphisns.

    Pharmacogenomics J. 2012 Oct; 12(5): 432-8.

    8. Farrell RJ, Kelleher D. Glucocorticoid resistance in inflammatory bowel disease. J

    Endocrinol. 2003 Sep; 178(3):339-46.

    9. Hur SJ, Kang SH, Jung HS, et al. Review of natural products actions on cytokines in

    inflammatory bowel disease. Nutr Res. 2012 Nov; 32(11): 801-16.

    10. Church LD, Cook GP, McDermott MF. Primer: inflammasomes and interleukin 1beta in

    inflammatory disorders. Nat Clin Pract Rheumatol. 2008 Jan; 4(1):34-42.

    11. Ardizzone S, Maconi G, Bianchi V, et al. Multidrug resistance 1 gene polymorphism and

    susceptibility to inflammatory bowel disease. 2007 May; 13(5): 516-23.

    Acc

    epte

    d A

    rticl

    e

  • 19

    This article is protected by copyrig1h t. All rights reserved.

    12. Zintzaras E. Is there evidence to claim or deny association between variants of the multidrug

    resistance gene (MDR1 or ABCB1) and inflammatory bowel disease? Inflamm Bowel Dis.

    2012 Mar; 18(3): 562-72.

    13. Lennard-Jones JE. Classification of inflammatory bowel disease. Scand J Gastroenterol

    Suppl. 1989; 170:2-6; discussion 16-9.

    14. Van Assche G, Dignass A, Panes J, et al; The second European evidence-based Consensus

    on the diagnosis and managemeng of Crohns disease: Definitions and diagnosis. J Crohns

    Colitis. 2010 Feb;4(1):7-27.

    15. Silverberg MS, Satsangi J, Ahmad T, Arnott ID, Bernstein CN, Brant SR, et al. Toward an

    integrated clinical, molecular and serological classification of inflammatory bowel disease:

    Report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J

    Gastroenterol. 2005 Sep; 19 Suppl A:5-36.

    16. Vazquez-Tello A, Halwani R, Hamid Q, et al. Glucocorticoid Receptor-Beta Up-Regulation

    and GCs Resistance Induction by IL-17 and IL-23 Cytokine Stimulation in Peripheral

    Mononuclear Cells. J Clin Immunol. 2013 Feb; 33(2):466-78.

    17. Wochnik GM, Regg J, Abel GA, et al. FK506-binding proteins 51 and 52 differentially

    regulate dynein interaction and nuclear translocation of the glucocorticoid receptor in

    mammalian cells. J Biol Chem. 2005 Feb 11; 280(6):4609-16.

    18. Goleva E, Hauk PJ, Hall CF, et al. Corticocorticoid-resistant asthma is associated with

    classical antimicrobial activation of airway macrophages. J Allergy Clin Immunol. 2008 Sep;

    122(3):550-9.e3. Acc

    epte

    d A

    rticl

    e

  • 20

    This article is protected by copyrig1h t. All rights reserved.

    19. Krupoves A, Mack D, Seidman E, et al. Associations between variants in the ABCB1

    (MDR1) gene and corticosteroid dependence in children with Crohn's disease. Inflamm

    Bowel Dis. 2011 Nov; 17(11):2308-17.

    20. Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmoller J, Johne A, Cascorbi I,

    Gerloff T, Roots I, Eichelbaum M, Brinkmann U. Functional polymorphisms of the human

    multidrug-resistance gene: multiple sequence variations and correlation of one allele with

    P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci U S A 2000; 97:

    3473-3478.

    21. Hitzl M, Drescher S, van der Kuip H, et al. The C3435T mutation in the human MDR1 gene

    is associated with altered efflux of the P-glycoprotein substrate rhodamine 123 from CD56+

    natural killer cells. Pharmacogenetics. 2001 Jun; 11(4):293-8.

    22. Siegmund W, Ludwig K, Giessmann T, et al. The effects of the human MDR1 genotype on

    the expression of duodenal P-glycoprotein and disposition of the probe drug talinolol. Clin

    Pharmacol Ther. 2002 Nov; 72(5):572-83.

    23. Oselin K, Nowakowski-Gashaw I, Mrozikiewicz PM, et al. Quantitative determination of

    MDR1 mRNA expression in peripheral blood lymphocytes: a possible role of genetic

    polymorphisms in the MDR1 gene. Eur J Clin Invest. 2003 Mar; 33(3):261-7.

    24. Satsangi J, Parkes M, Louis E, et al. Two stage genome-wide search in inflammatory bowel

    disease provides evidence for susceptibility loci on chromosomes 3, 7 and 12. Nat Genet.

    1996 Oct; 14(2): 199-202. Acc

    epte

    d A

    rticl

    e

  • 21

    This article is protected by copyrig1h t. All rights reserved.

    25. Brant SR, Panhuysen CI, Nicolae D, et al. MDR1 Ala893 polymorphism is associated with

    inflammatory bowel disease. Am J Hum Genet. 2003 Dec; 73(6):1282-92.

    26. Potocnik U, Ferkolj I, Glavac D, et al. Polymorphisms in multidrug resistance 1 (MDR1)

    gene are associated with refractory Crohn disease and ulcerative colitis. Genes Immun. 2004

    Nov; 5(7):530-9.

    27. Huebner C, Browning BL, Petermann I,et al. Genetic analysis of MDR1 and inflammatory

    bowel disease reveals protective effect of heterozygous variants for ulcerative colitis.

    Inflamm Bowel Dis. 2009 Dec; 15(12):1784-93.

    28. Ho GT, Nimmo ER, Tenesa A, et al. Allelic variations of the multidrug resistance gene

    determine susceptibility and disease behavior in ulcerative colitis. Gastroenterology. 2005

    Feb; 128(2):228-96.

    29. Ardizzone S, Maconi G, Bianchi V, et al. Multidrug resistance 1 gene polymorphism and

    susceptibility to inflammatory bowel disease. Inflamm Bowel Dis. 2007 May; 13(5):516-23.

    30. Palmieri O, Latiano A, Valvano R, et al. Multidrug resistance 1 gene polymorphisms are not

    associated with inflammatory bowel disease and response to therapy in Italian patients.

    Aliment Pharmacol Ther. 2005 Dec; 22(11-12):1129-38.

    31. Huebner C, Browning BL, Petermann I, et al. Genetic analysis of MDR1 and inflammatory

    bowel disease reveals protective effect of heterozygous variants for ulcerative colitis.

    Inflamm Bowel Dis. 2009 Dec; 15(12):1784-93.

    32. Fricker G, Drewe J, Huwyler J, et al. Relevance of p-glycoprotein for the enteral absorption

    of cyclosporin A: in vitro-in vivo correlation. Br J Pharmacol. 1996 Aug; 118(7):1841-7. Acc

    epte

    d A

    rticl

    e

  • 22

    This article is protected by copyrig1h t. All rights reserved.

    33. Kim RB, Leake BF, Choo EF, et al. Identification of functionally variant MDR1 alleles

    among European Americans and African Americans. Clin Pharmacol Ther. 2001 Aug;

    70(2):189-99.

    Financial Support

    The project was supported by research grants of Natural science

    foundation of Guangdong province in China (Program number

    S2013010016835)

    Acc

    epte

    d A

    rticl

    e

  • 23

    This article is protected by copyrig1h t. All rights reserved.

    Table-1 Selected SNPs and their primers

    Genes and SNPs Primers Type

    MDR1

    rs2032582

    (G2267T/A)

    1st-PCR Primer 5ACGTTGGATGGAAAATGTTGTCTGGACAAGC3

    2nd-PCR Primer 5ACGTTGGATGCATATTTAGTTTGACTCACC3 CNS

    rs1128503 (C1236T) 1st-PCR Primer 5ACGTTGGATGGTTTTTTTCTCACTCGTCCTG3

    2nd-PCR Primer 5ACGTTGGATGTCTGCCCACTCTGCACCTT3

    CS

    rs1045642 (C3435T) 1st-PCR Primer 5 ACGTTGGATGTATGGAGACAACAGCCGGGT 3

    2nd-PCR Primer 5 ACGTTGGATGAAGGCATGTATGTTGGCCTC 3

    CS

    NR3C1

    rs41423247

    1st-PCR Primer 5ACGTTGGATGACCATGTTGACACCAATTCC3

    2nd-PCR Primer 5ACGTTGGATGACAGGGTTCTTGCCATAAAG3

    NC

    rs7701443 1st-PCR Primer 5 ACGTTGGATGTGTCTCCATTTCCTCCAGAG 3

    2nd-PCR Primer 5 ACGTTGGATGTGTTAGGCCCCAGTATAAGG 3

    NC

    rs860457 1st-PCR Primer 5ACGTTGGATGAGGTGACCTTCCTCTTGTTC3

    2nd-PCR Primer 5ACGTTGGATGTAGGTTGCAGAGTCAGTCAC3

    NC

    FKBP5

    rs4713916 1st-PCR Primer 5ACGTTGGATGTATCTGGCAACCCTAACCTC3

    2nd-PCR Primer 5ACGTTGGATGCCTAACGAGATAGTGAGGAG3

    NC

    NALP1

    rs12150220 1st-PCR Primer 5ACGTTGGATGCTTGGAGACTCATGGTCTGG3

    2nd-PCR Primer 5ACGTTGGATGTTTCATTCCCCCCAGAAATC3

    CNS

    Abbreviation: CNS, coding nonsynonymous; CS, coding synonymous; NC, noncoding;

    Acc

    epte

    d A

    rticl

    e

  • 24

    This article is protected by copyrig1h t. All rights reserved.

    Table-2 Demographic characteristic of CD Patientsn=117

    Responders

    n=83

    Dependants

    (n=29)

    Resisters

    (n=5)

    Gender

    Male

    Female

    5060.2%

    3339.8%

    1862.1%

    1137.9%

    3

    2

    Age at onset

    Xs

    25.011.8

    35.712.2

    Age at diagnosis

    17

    17-40

    40

    13(15.7%)

    59(71.1%)

    11(13.3%)

    2(6.9%)

    24(82.8%)

    3(10.3%)

    Family history

    Yes

    No

    11.2%

    8298.8%

    13.4%

    2896.6%

    Smoking

    Yes

    No

    Not available

    1416.9%

    6679.5%

    3(3.6%)

    13.4%

    2896.6%

    Appendectomy

    Yes

    No

    Not available

    89.6%

    74 89.2%

    11.2%

    26.9%

    2689.7%

    13.4%

    Location

    L1

    L2

    L3

    L4

    78.4%

    89.6%

    6375.9%

    56.0%

    13.4%

    724.1%

    1965.5%

    26.9%

    Behavior

    B1

    B2

    B3

    5667.5%

    1518.1%

    1214.5%

    2379.3%

    517.2%

    13.4%

    Acc

    epte

    d A

    rticl

    e

  • 25

    This article is protected by copyrig1h t. All rights reserved.

    Abbreviation: L1: Terminal ileum; L2: colon; L3: ileocolon, L4: upper GI; B1: non-stricturing,

    non-penetrating; B2: structuring; B3: penetrating

    Table-3 Demographic characteristic of UC Patientsn=39

    Corticosteroid responders

    n=22

    Corticosteroid dependants

    (n=17)

    Corticosteroid resisters

    (n=0)

    Gender

    Male

    Female

    1672.7%

    627.3%

    1058.8%

    741.2%

    Age at onset

    Xs

    36.115.2

    27.69.0

    Age at diagnosis

    Xs

    38.014.8

    29.89.7

    Family history

    Yes

    No

    00%

    22100%

    00%

    17100%

    Smoking

    Yes

    No

    Not available

    313.6%

    1672.7%

    3(13.6%)

    311.6%

    1376.5%

    1 (5.9%)

    Appendectomy

    Yes

    No

    Not available

    1463.6%

    00%

    836.4%

    211.8%

    1482.4%

    15.9%

    Location

    E1

    E2

    E3

    1045.5%

    1(4.5%)

    11(50%)

    1(5.9%)

    3(17.6%)

    13(76.5%)

    Abbreviation: E1: ulcerative proctitis; E2: left-sided UC; E3: extensive UC.

    Acc

    epte

    d A

    rticl

    e

  • 26

    This article is protected by copyrig1h t. All rights reserved.

    Table-4 Comparison of the SNP frequency distribution between steroid

    respond and dependent IBD patients

    SNP Corticosteroid responders VS. dependants

    P-value

    MDR1

    rs2032582

    rs 1128503

    rs1045642

    0.294

    0.027

    0.023

    NR3C1

    rs41423247

    rs7701443

    rs860457

    0.685

    0.804

    0.724

    KBP5

    rs4713916 0.666

    NALP1

    rs12150220

    0.101

    Acc

    epte

    d A

    rticl

    e

  • 27

    This article is protected by copyrig1h t. All rights reserved.

    Table-5 SNP frequency in the steroid dependent or respond patients

    with CD

    SNP Corticosteroid responders Corticosteroid dependants Ajusted P-value OR (95%CI)

    Genotypes Genotypes

    WT (%) HET (%) MUT (%) WT (%) HET (%) MUT (%) ( H+M vs W)

    MDR1

    rs2032582 GG 17(21) GT 32(39.5) TT 21(25.9) 11(40.7) GT 7(25.9) TT 3(11.1) 0.177

    TA 11(13.6) AA 0 TA 5(18.5) AA 1(3.7)

    rs 1128503 4(4.8) 35(42.2) 44(53) 7(25.0) 12(42.9) 9(32.1) 0.019 6.583 (1.760-24.628)

    rs1045642 21(25.6) 45(54.9) 16(19.5) 16(57.1) 9(32.2) 3(10.7) 0.009 3.873 (1.578-9.506)

    NR3C1

    rs41423247 4959 3137.3 33.7 15(51.7) 13(44.8) 1(3.5) 0.714

    rs7701443 29(34.9) 40(48.2) 14(16.9) 10(34.5) 14(48.3) 5(17.2) 0.841

    rs860457 71(85.5) 11(13.3) 1(1.2) 24(82.8) 5(17.2) 0 0.974

    KBP5

    rs4713916 47(56.6) 27(32.6) 9(10.8) 16(59.2) 9(33.3) 2(7.4) 0.941

    ALP1

    rs12150220 7896 54 0 29(100) 0 0 0.999

    Abbreviation: WT, wild type homozygote; HET, heterozygote; MUT, mutant homozygote.

    Acc

    epte

    d A

    rticl

    e

  • 28

    This article is protected by copyrig1h t. All rights reserved.

    Table-6 SNP frequency distribution among CD, UC and Controls

    SNP CD

    n (%)

    UC

    n (%)

    Control

    n (%)

    IBD (UC+CD) vs Control

    Wt+Het vs Mut

    P-value

    CD vs Control

    Wt+Het vs Mut

    Adjusted P-value

    UC vs Control

    Wt+Het vs Mut

    Adjusted P-value

    MDR1

    rs2032582

    WT(%) 28(25.9) 10(25.6) 86(38.9) 0.006 0.014 0.205

    HET(%) 55(50.9) 23(59.0) 112(50.7) OR=0.668 (95%CI 0.484-0.921)

    MUT(%) 25(23.1) 6(15.4) 23(10.4)

    rs 1128503

    WT(%) 11(9.9) 13(33.3) 35(15.7) 0.058 0.137 0.128

    HET(%) 47(42.3) 24(61.5) 101(45.3)

    MUT(%) 53(47.7) 2(5.1) 87(39.0)

    rs1045642

    WT(%) 37(33.6) 15(38.5) 90(40.4)

    HET(%) 54(49.1) 19(48.7) 114(51.1)

    MUT(%) 19(17.3) 5(12.8) 19(8.5)

    NS: No Significance; WT, wild type homozygote; HET, heterozygote; MUT, mutant homozygote.

    Acc

    epte

    d A

    rticl

    e

  • 29

    This article is protected by copyrig1h t. All rights reserved.

    Table-7 Correlation between MDR1 Polymorphisms and selected

    phenotypic characteristics in CD patients

    Disease

    phenotypes

    rs2032582

    Genotypes

    P-val

    ue

    OR(95%CI)

    WT(%) HET(%) MUT(%) (WT+HET

    vs MUT)

    Location

    L1 112.5 675.0 112.5 0.746 -----

    L2 5 (38.5) 5(38.5) 3(23.1) 0.944 -----

    L3 18(22.5) 42(52.5) 20(25) 0.024 0.669

    (0.472-0.948)

    L4 4(57.1) 2(28.6) 1(14.3) 0.873 -----

    Behavior

    B1 21(27.3) 38(48.1) 18(22.8) 0.023 0.661

    (0.462-0.946 )

    B2 3(16.7) 10(55.6) 5(27.8) 0.128 -----

    B3 4(30.8) 7(53.8) 2(15.4) 0.699 -----

    Abbreviation: L1: Terminal ileum; L2: colon; L3: ileocolon, L4: upper GI; B1: non-stricturing,

    non-penetrating; B2: structuring; B3: penetrating; WT, wild type homozygote; HET, heterozygote;

    MUT, mutant homozygote.

    Acc

    epte

    d A

    rticl

    e

Recommended

View more >