Available online at www.sciencedirect.com

ScienceDirect

Journal of the Chinese Medical Association 81 (2018) 340e347www.jcma-online.com

Original Article

Complete genome sequence of a multi-recombinant echovirus 6 strainisolated from CSF in Ahvaz, Southwestern Iran

Samaneh Abbasi a,b, Manoochehr Makvandi a,b,*, Ali Teimoori a,b, Alireza Samarbaf-Zadeh a,b

a Health Research Institute, Infectious and Tropical Disease Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iranb Department of Virology, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

Received February 13, 2017; accepted June 13, 2017

Abstract

Background: Echovirus 6 (E6), is one of the main enteroviral serotypes, was initially isolated from patients with aseptic meningitis (AM) and is amajor cause of hospitalization among children and adults worldwide.Methods: A cerebrospinal fluid (CSF) sample was collected from patient with clinically suspected aseptic meningitis (AM) in August 2011.Following detection of a virus and subsequent virus serotyping, the whole genome sequence was determined. The sequence of the VP1 region ofthe isolated strain E6 RA/E6/Ahvaz/Iran/2011 showed 79% (>75%) nucleotide and 94% (>85%) amino acid homology with prototype strainD'Amori. The isolated strain was identified as an E6 serotype. A specimen was cultured in a human rhabdomyosarcoma (RD) cell line.Following propagation, the virus was further analyzed using the plaque assay technique, reverse transcription PCR (RT-PCR), rapid amplifi-cation of CDNA ends (RACE), TA cloning, sequencing, phylogenetic analysis, Simplot and boot scanning analyses (ver. 3.5) were applied tofind evidence of recombination in the isolated strain.Results: The isolated Echo6 strain RA/E6/Ahvaz/Iran/2011 has been recorded in GenBank with a partial and complete genome accessionnumbers (KX619440) (KX198605), respectively. The complete genomic sequence was 7435 nt, with a 742 bp 50 UTR, 117 bp 30 UTR, and anopen reading frame (ORF) encoding a polypeptide of 2191 amino acids. The nucleotide analysis of the VP1 and structural genomic regions ofthe isolated strain showed high similarity with strain E6-10887-99 isolated from patient with facial nerve paresis in Russia in 1999. The re-combinations evidence were observed in the isolated strain E6 RA/E6/Ahvaz/Iran/2011 and found to have a high levels of inter-serotypicexchanges in 2C and 3A-3C genomic regions with Echovirus13 and Echovirus14, respectively.Conclusion: Full genome sequence analysis of enteroviral is required to understand the epidemiological pattern and to evaluate the newenterovirus circulating in community.Copyright © 2018, the Chinese Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-NDlicense (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Keywords: Enterovirus B; Iran; Molecular sequence data; RD cells; Recombination

1. Introduction

The new order Picornavirales includes the Picornaviridaefamily, and the Enterovirus (EV) genus is one of the best

Conflicts of interest: The authors declare that they have no conflicts of interest

related to the subject matter or materials discussed in this article.

* Corresponding author. Dr. Manoochehr Makvandi, Department of virology,

Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.

E-mail address: manoochehrmakvandi29@yahoo.com (M. Makvandi).

https://doi.org/10.1016/j.jcma.2017.06.026

1726-4901/Copyright © 2018, the Chinese Medical Association. Published by El

license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

characterized genera in this family.1,2 Human enteroviruses(HEVs) are divided into four species, HEVs A to D, andconsist of more than 110 serotypes.1,3 They are non-enveloped, small icosahedral and single-stranded (þ) senseRNA viruses with a genome about 7.5 kilobases (kb) in length,containing a single open reading frame (ORF) encoding apolyprotein. The coding region is divided into three sub-regions: P1 encodes the structural proteins (VP4, VP2, VP3,and VP1) and the P2 and P3 regions encode non-structuralproteins. In the P2 region, 2A encodes a protease and

sevier Taiwan LLC. This is an open access article under the CC BY-NC-ND

341S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

2Be2C encodes two proteins involved in replication of RNAand inhibition of host cell gene expression. Region P3 contains3A (encodes membrane-anchored factors and an RNA-bindingprotein), 3B (encodes a genome-linked protein called VPg),3C (encodes a viral protease), and 3D (encodes an RNA-dependent RNA polymerase).3,4

Human enteroviruses are very contagious; they are typi-cally spread by the fecal-oral route and can also be spread byrespiratory routes and from mother to infant in the peripartumperiod.5 Human enteroviruses infect an estimated billion ormore persons each year worldwide.3,6 More than ninetypercent of enterovirus infections are benign, self-limiting, andasymptomatic; but a fraction of enteroviruses cause severe andlife-threatening illnesses, such as aseptic encephalitis, asepticmeningitis (AM), summer colds, epidemic myalgia, acutemyocarditis, acute flaccid paralysis (AFP), acute hemorrhagicconjunctivitis (AHC), acute childhood viral exanthema, andhand, foot, and mouth disease (HFMD), which are publichealth problems worldwide.5,7,8

Enteroviruses were traditionally typed by neutralizationreaction tests, but the results were often ambiguous. Today,typing is based on the sequence of the VP1 capsid protein andthe typing protocol has been replaced by molecular methodsthat provide a comprehensive genetic characterization of eachenterovirus serotype.8,9 The definitions of enterovirus sero-types are based on nucleotide and amino acid similarities;thus, the same serotype is defined as having >75% nucleotidesimilarity or >85% amino acid sequence similarity in the VP1coding sequence.9 High rates of mutations and recombinationshave been reported among the different enteroviruses sero-types, providing mechanisms for frequent enterovirus evolu-tion.8 The rate of genetic recombination is correlated with theendemicity of virus populations and the repeated or time-correlated cycles of emergence of HEVs.7,10

Currently, no effective medicines, antiviral treatments, orvaccines are available for many of the enteroviral infectionsin the Picornaviridae family.11 In the present study, a cere-brospinal fluid (CSF) sample was collected from a patientwith aseptic meningitis. The aim was to detect the virus, toperform serotyping, and to determine the whole genomesequence. Full genome analysis is necessary for a morecomprehensive understanding of epidemiological eventsinvolving enteroviruses serotypes.7 This is the first descrip-tion of the complete genome sequence of the E6 straincausing AM in Iran.

2. Methods

2.1. Patient and clinical sample

A CSF sample was obtained from a female infant withclinical signs and symptom of AM who was hospitalized at theRazi University Hospital (Ahvaz, Iran) in August 2011. Thesample was delivered to the virology laboratory and storedat �70 �C. First diagnosis showed positive for enterovirusby amplification of the 50 untranslated region (UTR) byReverse transcription polymerase chain reaction (RT-PCR).12

Subsequently, the VP1 RT- PCR amplification assay wasused to identify molecular typing of the isolated strain.9

2.2. Cell culture and plaque assay

2.2.1. Preparation of virus stocksThe CSF sample was inoculated and grown on a human

rhabdomyosarcoma (RD) cell line at 37 �C in a 5% CO2 at-mosphere for 5e6 days. The cells were observed for signs ofcytopathic effects (CPEs) for 24 h. The medium in each wellwas then decanted, the wells were washed twice withphosphate-buffered saline (PBS, Bio-Idea, Iran), and then themedium was replaced with fresh 1x Dulbecco's ModifiedEagle Medium (DMEM; Bio-Idea, Iran) supplemented with10% heat inactivated fetal bovine serum (FBS; Bio-Idea, Iran)and 1% penicillin (100 U/mL)/streptomycin (100 mg/ml)(Pen/strep, Bio-Idea, Iran). Subsequently, when the CPEs wereobserved, suspensions of pure-culture virus were prepared bymultiple freezing (�20 �C) and thawing (37 �C) cycles and afinal vortexing.

2.2.2. Double layer agar plaque assayPure virus was isolated using a plaque assay on double

layer agar (DLA). A 150 ml volume of tenfold serially dilutedvirus particles (10�4 to 10�8 dilutions) was seeded, along witha negative control, into 6-well plates (SigmaeAldrich) con-taining confluent monolayers of RD cells (1 � 105 cells/cm2).After absorption of the viruses at 37 �C for 1 h, 3 ml of 2xDMEM (Bio-Idea, Iran) was mixed with an equal volume of1.5% purified cell culture grade agar (SigmaeAldrich, cat NO1296) supplemented with 1% heat inactivated fetal bovineserum (FBS, Bio-Idea, Iran), overlaid as a monolayer in the 6-well plates (SigmaeAldrich), and incubated overnight at37 �C in 5% CO2. Another 3 ml of 2x DMEM containing 1.5%agar was overlaid onto the 6-well plate and stained with 0.01%neutral red (SigmaeAldrich, cat. NO. 4638). The plate wassealed with aluminum foil to protect it from light and incu-bated overnight at 37 �C in 5% CO2. Three plaques werepicked up and passaged three times in a 25 cm2 flask con-taining confluent RD cells. Incubation was continued untilCPEs were observed, and the culture was then stored at�70 �C for further study.13

2.3. RNA extraction, RT-PCR, and rapid amplification ofcDNA ends (RACE)

Viral RNA was extracted from cell culture supernatantusing a QIAamp viral RNA minikit (Qiagen, Westburg, TheNetherlands) according to the manufacturer's instructions.In this study, whole genome sequences were obtained bydesigning some primers according to 16 conserved regionsof several complete genome strains of E6 retrieved fromGenBank (Table 1). All primers were synthesized by Met-abion (Martinsried, Germany). First, the cDNAwas preparedusing a RevertAid First Strand cDNA Synthesis Thermo Kit(cat. NO. K1622) according to the manufacturer's in-structions. The RT-PCR was then carried out for conserved

Table 1

Primers used for determining the nucleotide sequence of strain E6 RA/E6/Ahvaz/Iran/2011.

Primer Position Polarity Sequence (50 e30)

405AHCDNAR 393e405 Antisense TGAGGCGTCCCAT

293AH5S1 293e313 Sense CTCCGCACAACCCCAGTGTAG

239AH5A1 219e239 Antisense GGGTAACGAACACTTTCTCCT

317AH5S2 317e334 Sense AGGTCGATGAGTCACCGC

211AH5A2 191e211 Antisense CGTGAGCAGCTTATTGATACT

311AH2F 311e334 Sense TAGATCAGGCYGATGAGTCACCGC

812AH2R 793e812 Antisense GGGAATTTCCACCACCACCC

166AHRAS5F1 166e186 Sense CAAGCACTTCTGTTTCCCCGGa

601AHRAS5R1 582e601 Antisense ATTGTCACCATAAGCAGCCAa

466AHRAS5F2 447e466 Sense TCCTCCGGCCCCTGAATGCGa

1136AH7F 1136e1156 Sense ATTCTACACGCTGGATTCAGT

2582AH7R 2563e2582 Antisense ACTAGGTACCACTTGCGATG

2411AHVP1F1 2411e2430 Sense GCRTGCAATGAYTTCTCWGTb

3408AHVP1R1 3389e3408 Antisense GCICCIGAYTGITGICCRAAb

3257AH4F 3257e3275 Sense GTTACCACGTCCCGAACCC

4410AH4R 4390e4410 Antisense GCATACTGGTTCAATACGGCA

4312AH51F 4312e4332 Sense GCTCACTATTGCAGGAAATACGC

5873AH51R 5853e5873 Antisense TCCTCCCACATGTATCCCCAA

4228AH52F 4228e4247 Sense GGAGAGTCAAATTGCCACCA

5846AH52R 5826e5846 Antisense TGCCTGTAGACATGAGCACCC

4923AH53F 4923e4944 Sense AGGCCATCCAATTTATAGACAG

5874AH53R 5854e5874 Antisense TTGCCACCAATATGTATTCCA

4770AH54F 4770e4788 Sense CCCTCGCTAGAAGGTTCCA

5849AH54R 5830e5849 Antisense CTTTGCCTGTAGACATGAGC

5791AH3F 5791e5813 Sense CAGTGYGGIGGIGTICTCATGTCc

6522AH3R 6497e6522 Antisense AGRTTGCCAAAYGTYTGYCTCATTGCc

6522AH6F 6522e6542 Sense CTCAATGACTCGGTGGCAAT

7420AH6R 7399e7420 Antisense CGAATGCGGAGAATTTACCCC

Olido dT-3'siteAdaptor Antisense CTGATCTAGAGGTACCGGATCCTTTTTTTTTTTTTTTTTT

3'siteAdaptor Antisense CTGATCTAGAGGTACCGGATCC

a These primers were described by Zoll et al.12

b These primers were described by Oberste et al.9

c These primers were described by Lukashev et al.14

342 S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

regions of the sample. Rapid amplification of CDNAends (RACE) was carried out for both the 50 and 30 endsof the isolated RA/E6/Ahvaz/Iran/2011. The 50 ends weresequenced using a 50 RACE kit (50 Core Set, Takara, Japan,cat. NO. 6122) with primers 405AHCDNAR, 293AH5S1,239AH5A1, 317AH5S2, and 211AH5A2, according tothe manufacturer's instructions. The entire 30 ends weresequenced using a 30 Full RACE Core Set kit (Takara, Japan,cat. NO 6121) with an oligo dT-3'site adaptor, a 3'siteadaptor, and 6522AH6F primers, according to the manu-facturer's instructions.

2.4. TA cloning

All the PCR products were extracted from the agarose geland cleaned up before ligation using a purification kit (HighPure PCR Product Purification Kit, Roche Life Sciences).Subsequently, all the PCR products were cloned into a plasmid(pTZ57R/T) using a TA cloning kit (InsTAclone PCR CloningKit, Thermo Fisher Scientific). The cloned plasmids weretransformed into E. coli DH5a and then amplified in LBmedia. The plasmids carrying PCR products were then puri-fied using a plasmid DNA extraction kit (Yekta Tajhiz Azma(YTA), Iran).

2.5. Sequencing

The purified plasmids carrying the PCR products wereanalyzed by agarose gel electrophoresis (CinnaGen, Iran). ThePCR products of different regions of strain RA/E6/Ahvaz/Iran/2011 were sequenced in both directions. Potentially ambig-uous nucleotides were avoided by using the analyzer (Mac-rogen Europe, Inc.) followed by Sanger sequencing. Thesequence assembly was performed manually.

2.6. Typing with VP1

The VP1 sequence was compared with sequences retrievedfrom GenBank using the online nucleotide BLAST [NationalCenter for Biotechnology Information (NCBI)] (http://www.ncbi.nlm.nih.gov/BLAST/). The sequence of VP1 was identi-fied as Echovirus 6 (E6) with 79% nucleotide similarity to theprototype strain D'Amori.9,15

2.7. Nucleotide sequence accession numbers

The partial and complete nucleotide sequences of the RA/E6/Ahvaz/Iran/2011 strain were recorded in GenBank withaccession numbers KX198605 and KX619440, respectively.

Fig. 1A and B. The Phylogenetic analysis constructed from VP1 and P1 regions of strain E6 RA/E6/Ahvaz/Iran/2011 with other prototype strains of HEV-B.

The trees were constructed using the neighbor-joining algorithm (NJ) with maximum likelihood (MCL) distance materix. Numbers at the nodes represent the

percentage of 1000 bootstrap. The bootstrap support �70 values are shown.

343S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

Table 2

Nucleotide and amino acid sequence identities between the E6 RA/E6/Ahvaz/

344 S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

2.8. Multiple sequence alignment and phylogeneticanalysis

Iran/2011 strain, strain prototype D'Amori and strain E6-10887-99.

Genomic region Nucleotide sequence

identity (%)

Amino acid sequence

identity (%)

Base D'Amori 10887e99 Residue D'Amori 10887e99

50UTR 742 89% 89%

P1 79% 87%

VP4 207 83% 88% 69 99% 97%

VP2 783 79% 87% 261 97% 98%

VP3 714 78% 86% 238 97% 99%

VP1 867 79% 89% 289 94% 99%

P2 81% 85%

2A 450 80% 87% 150 94% 97%

2B 297 78% 84% 99 98% 98%

2C 987 82% 84% 329 97% 96%

P3 79% 86%

3A 267 81% 80% 89 94% 94%

3B 66 77% 86% 22 91% 91%

3C 549 79% 83% 183 96% 97%

3D 1386 79% 88% 462 95% 97%

Multiple sequence alignment (MSA) was carried out usingonline Clustal Omega software from the EMBL-EBI website(European Molecular Biology Laboratory-European Bioinfor-matics Institute) (http://www.ebi.ac.uk/Tools/msa/clustalo/).Phylogenetic trees were constructed by the neighbor-joining(NJ) method with maximum composite likelihood (MCL)distances method and 1000-replication bootstrap test, using theMEGA software (version 6). In addition to the transitions/transversions, bootscanning and Simplot (version 3.5.1) wereused to analyze and find evidence for recombinant regions inthis isolated strain.

3. Results

RA/E6/Ahvaz/Iran/2011 strain was isolated from CSFsample of a patient with clinically suspected AM in Ahvazcity, Iran in August 2011. Sequencing of the VP1 genomicregion revealed that the isolated strain belongs to the E6serotype with 79% (>75%) nucleotide identity and 94%(>85%) amino acid identity with the E6 prototype strain D0

Amori.9 The new isolated strain was 7435 nt in length, with a742 bp 50 UTR, 117 bp 30 UTR, and an open reading frame(ORF) encoding a polypeptide of 2191 amino acids. Thephylogenetic trees of VP1-VP4 and P1 regions of the isolatedstrain with other prototype strains of HEV-B showed the iso-lated strain was clustered with its prototype strain D0 Amori(data for VP4-VP2-VP3 not shown) (Fig. 1A and B). The VP1and complete genome sequences of the isolated strain, showed89% and 86% nucleotide similarity with the isolated strain E6-10887-99 (AY896760) from a patient with facial nerve paresisin Russia in 1999, respectively.16

In this study, the nucleotide and amino acid sequences ofthe different genomic regions of the isolated strain werecompared with the prototype strain D0 Amori and strain E6-10887-99 (Table 2). The nucleotide sequence of 50 UTR re-gion showed highest nucleotide similarity with D0 Amori andE6-10887-99 strains (89%). The nucleotide sequence of P1region displayed higher sequence identity to strain E6-10887-99 (87%) than to strain D0 Amori (79%). In the P2 and P3genomic regions, the nucleotide sequence identity to D0 Amoriand E6-10887-99 strains, were ranged from 77% to 88%. Thehighest level of nucleotide divergence was observed betweenthe isolated strain and those of D'Amori, E6-10887-99 strainsin 3B (77%) and 3A (80%) regions, respectively. The aminoacid sequences of the isolated strain were highly conservedwith homology identity of 94%e99% in structural and 91%e98% in non-structural regions with D0 Amori and E6-10887-99strains.

In order to investigate recombination phenomenon, theanalysis of phylogenetic trees of the different genomic regionsof the isolated strain (data not shown), bootscaning and sim-ilarity plot were carried out with other strains of HEV-B.

Regarding 50 UTR region, phylogenetic tree showed the iso-lated strain clustered with other strains of HEV-B specious(cluster II)5 with very low bootstrap support. The P1 genomicregion, was found very closed to strain E6-10887-99 with 87%similarity. The analysis of 2A region showed robust bootstrapsupport, and clustered with strain E6-10887-99. The 2C cod-ing region was clearly related with several Echovirus 13 (E13)strains isolated in japan in 2002. The P3 coding region withstrong bootstrap values was clustered with Echovirus 14 (E14)strain P968/2013 (KP289441), Coxsackievirus B3 (CBV3)strain 18219-02 (AY896763), Enterovirus 85 (EV85) strainHTPS-MKLH04F/XJ/CHN/2011 (JX898907) and E6-10887-99. Simplot analysis of the complete genome of E6 strainRA/E6/Ahvaz/Iran/2011 was carried out. The structural cod-ing region of the isolated strain, displayed highest degree ofidentity with strain E6-10887-99. The sequence similarity inVP1-2A junction region was dropped. It is obvious thatrecombination event with E13 strain 2002-240-SF has beenoccurred in the 2C genomic region which was isolated fromAM patient in Japan.17 In addition, the other recombinationphenomenon have been taken place in the 3A to 3C genomicregions of isolated strain with E14 strain P968/2013 obtainedfrom HFMD patient in China.18 (Fig. 2A) The analysis ofbootscaning graph in 30 half of 2C and 3A-3C genomic regionsof the isolated strain exhibited more than 95% similarity withE13 and E14 strains, respectively (Fig. 2B).

4. Discussion

In this study, the full genome sequence of a novel recom-binant Echovirus 6 (strain E6 RA/E6/Ahvaz/Iran/2011) wasanalyzed which isolated from CSF sample of a patient withclinically suspected AM (headache, fever, vomiting, nausea,neck stiffness) in 2011. This is a first report in completegenome sequence of the isolated E6 strain in Iran. These

Fig. 2. The similarity plot and bootscanning analysis of strain E6 RA/E6/Ahvaz/Iran/2011. A e The similarity plot analysis was conducted using a window

size of 200 nt and 20 bp step size with strain E6 RA/E6/Ahvaz/Iran/2011 as a query. B e Bootscan analysis was conducted for the strain E6 RA/E6/Ahvaz/

Iran/2011 using a window size of 500 bp and 20 bp step size with genetic distance model of the Kirmura 2-parameter. The arbitrary recombinant threshold

was 70%.

345S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

finding might provide a clue for further comprehensive un-derstanding of other E6 strains.

An outbreak of E6 in pediatric with AM have been reportedin many regions of the world.15 The constructed phylogenetictrees for VP1 and P1 regions of isolated strain and prototype

strains of other HEV-B serotypes showed the isolated strainclustered with prototype strain D0 Amori. The sequence of thedifferent regions of the isolated strain showed significant dif-ference with prototype strain D0 Amori, isolated in the UnitedStates in 1995,19 and lower difference with the E6-10887-99

346 S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

strain.These findings indicate that the newly E6 strains iso-lated from different regions were closed to each other than tothe corresponding prototype strain.16

The nucleotide identity score for VP1 region (89%) withcomplete genome (86%) of the isolated strain in compare withstrain E6-10887-99, indicating a simultaneous co-infection ofthe E6 strain with other enterovirus serotypes, which mayresult in entero-serotypic recombination. The genetic re-combinations among polioviruses and in other enterovirusesare well-documented.5,14,20 A lack of proofreading in theRNA-dependent RNA polymerase (RdRp) gene of the HEVsmay lead to occurrence of mutations during RNA synthe-sis.21,22 The rate of nucleotide substitutions among the en-teroviruses vary from 1 to 2% per year.23

The constructed phylogenetic trees in non-structural re-gions of the isolated strain showed the significant difference ascompare with structural region, indicating the evidence ofrecombinations in this regions (data not shown). The results ofSimplot analysis have been observed drop abruptly in simi-larities of non-structural regions (P2 and P3) compare withstructural region strain E6 RA/E6/Ahvaz/Iran/2011 and otherserotype of HEV-B (Fig. 2A). These findings strongly supportthe occurrence of inter-typic recombination events. Highlevels of inter-serotypic were determined by bootscaninganalysis and the role of 2C and 3A-3C genomic regions as thehot spots in recombination events have been observed withE13 and E14 strains respectively.

The identification of enteroviruses serotypes are based onstructural sequences region,16 whereas the virulence of theenteroviruses rely on non-structural sequences.24 Thusdiagnosis of the enteroviruses based only on the structuralregion may not be sufficient to understand the pathogenicityof enteroviruses.7 Finally, viral recombination, followinggenetic exchanges can give rise to new recombinant viruseswith increased virulence which may result in devastatingoutbreaks with burden diseases in community.25,26 Fullgenome sequence analysis of enteroviral strains is thereforerequired to understand the epidemiological patterns and alsoto evaluate the evidence of new circulating recombinantstrains enteroviruses.

Acknowledgments

This study was conducted as a doctoral thesis, with regis-tration number 93131, in the Health Research Institute, In-fectious and Tropical Diseases Research Center, AhvazJundishapur University of Medical Science, Ahvaz, Iran. Theauthors thank the Director of Infectious and Tropical DiseaseResearch Center, Ahvaz Jundishapur University of MedicalSciences, for the financial support to carry out this project.

References

1. Tao Z, Cui N, Liu G, Chen P, Xu A, Song L, et al. Complete genome

sequence of an enterovirus 80 strain isolated in China. J Virol 2012;86:

13129e30.

2. Le Gall O, Christian P, Fauquet CM, King AM, Knowles NJ,

Nakashima N, et al. Picornavirales, a proposed order of positive-sense

single-stranded RNA viruses with a pseudo-T ¼ 3 virion architecture.

Arch Virol 2008;153:715e27.

3. Knipe D, Howley P, Griffin D. Enteroviruses: polioviruses, coxack-

ieviruses, echoviruses, and newer enteroviruses. Fields virology. Phila-

delphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007.

4. Knowles N, Hovi T, Hyypi€a T. Picornaviridae. In: King AMQ, Adams MJ,

Carstens EB, Lefkowitz EJ, editors. Virus taxonomy: classification and

nomenclature of viruses: ninth report of the International Committee on

Taxonomy of Viruses. San Diego, CA: Elsevier; 2011. p. 855e80.

5. Santti J, Hyypi€a T, Kinnunen L, Salminen M. Evidence of recombination

among enteroviruses. J Virol 1999;73:8741e9.

6. Attoh J, Obodai E, Adiku T, Odoom JK. Prevalence of human enterovi-

ruses among apparently healthy nursery school children in Accra. Pan Afr

Med J 2014;18:66.

7. Miyoshi M, Komagome R, Ishida S, Nagano H, Takahashi K, Okano M.

Genomic characterization of echovirus 6 causing aseptic meningitis in

Hokkaido, Japan: a novel cluster in the nonstructural protein coding re-

gion of human enterovirus B. Arch Virol 2013;158:775e84.

8. Tao Z, Wang H, Li Y, Xu A, Zhang Y, Song L, et al. Cocirculation of two

transmission lineages of echovirus 6 in Jinan, China, as revealed by

environmental surveillance and sequence analysis. Appl Environ Micro-

biol 2011;77:3786e92.

9. Oberste MS, Maher K, Kilpatrick DR, Pallansch MA. Molecular evolution

of the human enteroviruses: correlation of serotype with VP1 sequence

and application to picornavirus classification. J Virol 1999;73:1941e8.

10. Leitch EM, Cabrerizo M, Cardosa J, Harvala H, Ivanova O, Kroes A, et al.

Evolutionary dynamics and temporal/geographical correlates of recom-

bination in the human enterovirus echovirus types 9, 11, and 30. J Virol

2010;84:9292e300.

11. Ho BC, Yang PC, Yu SL. MicroRNA and pathogenesis of enterovirus

infection. Viruses 2016;8:11.

12. Zoll G, Melchers W, Kopecka H, Jambroes G, Van der Poel H, Galama J.

General primer-mediated polymerase chain reaction for detection of en-

teroviruses: application for diagnostic routine and persistent infections.

J Clin Microbiol 1992;30:160e5.

13. Moc�e-Llivina L, Lucena F, Jofre J. Double-layer plaque assay for quan-

tification of enteroviruses. Appl Environ Microbiol 2004;70:2801e5.

14. Lukashev AN, Lashkevich VA, Ivanova OE, Koroleva GA,

Hinkkanen AE, Ilonen J. Recombination in circulating enteroviruses.

J Virol 2003;77:10423e31.

15. Mao N, Zhao L, Zhu Z, Chen X, Zhou S, Zhang Y, et al. An aseptic

meningitis outbreak caused by echovirus 6 in Anhui province, China.

J Med Virol 2010;82:441e5.

16. Lukashev AN, Lashkevich VA, Ivanova OE, Koroleva GA,

Hinkkanen AE, Ilonen J. Recombination in circulating human enterovirus

B: independent evolution of structural and non-structural genome regions.

J Gen Virol 2005;86(Pt 12):3281e90.

17. Iwai M, Yoshida H, Obara M, Horimoto E, Nakamura K, Takizawa T,

et al. Widespread circulation of echovirus type 13 demonstrated by

increased seroprevalence in Toyama, Japan, between 2000 and 2003. Clin

Vaccine Immunol 2010;17:764e70.

18. Guo WP, Lin XD, Chen YP, Liu Q, Wang W, Wang CQ, et al. Fourteen

types of co-circulating recombinant enterovirus were associated with

hand, foot, and mouth disease in children from Wenzhou, China. J Clin

Virol 2015;70:29e38.

19. Melnick JL. Application of tissue culture methods to epidemiological

studies of poliomyelitis. Am J Public Health Nation's Health 1954;44:

571e80.

20. Oprisan G, Combiescu M, Guillot S, Caro V, Combiescu A, Delpeyroux F,

et al. Natural genetic recombination between co-circulating heterotypic

enteroviruses. J Gen Virol 2002;83:2193e200.

21. Domingo E, Holland J. RNAvirus mutations and fitness for survival. Annu

Rev Microbiol 1997;51:151e78.

22. Drake JW. Rates of spontaneous mutation among RNA viruses. Proc Natl

Acad Sci U S A 1993;90:4171e5.

23. Gavrilin GV, Cherkasova EA, Lipskaya GY, Kew OM, Agol VI. Evolution

of circulating wild poliovirus and of vaccine-derived poliovirus in an

immunodeficient patient: a unifying model. J Virol 2000;74:7381e90.

347S. Abbasi et al. / Journal of the Chinese Medical Association 81 (2018) 340e347

24. Bedard KM, Semler BL. Regulation of picornavirus gene expression.

Microb Infect 2004;6:702e13.

25. Kyriakopoulou Z, Pliaka V, Tsakogiannis D, Ruether IG, Komiotis D,

Gartzonika C, et al. Genome analysis of two type 6 echovirus (E6) strains

recovered from sewage specimens in Greece in 2006. Virus Gene 2012;44:

207e16.

26. Jegouic S, Joffret M-L, Blanchard C, Riquet FB, Perret C, Pelletier I, et al.

Recombination between polioviruses and co-circulating Coxsackie A vi-

ruses: role in the emergence of pathogenic vaccine-derived polioviruses.

PLoS Pathog 2009;5, e1000412.