CHARACTERISATION OF DUPLICATED HAEMOGLOBIN GENES IN … · 2017. 6. 9. · CHARACTERISATION OF DUPLICATED HAEMOGLOBIN GENES IN BIVALVES. Mathilde Klein . Bachelor of Medical Laboratory

CHARACTERISATION OF DUPLICATEDHAEMOGLOBIN GENES IN BIVALVES

Mathilde Klein Bachelor of Medical Laboratory Science, QUT

Submitted in fulfilment of the requirements for the degree of

Master of Applied Science (Research)

School of Biomedical Sciences, IHBI

Faculty of Health

Queensland University of Technology

2017

Keywords

Arcoida, Bivalves, Gene duplication, Genomics, Globins, Haemoglobin,

Limoida, Molluscs, Transcriptome

Keywords i

Abstract

Haemoglobins (Hbs) are found in virtually all phyla and are some of the most

investigated proteins in biomedical sciences. These proteins exhibit an extraordinary

diversity of form and function in invertebrate lineages. This provides a unique

opportunity to explore the origin and evolution of Hbs yet little is known about their

distribution, function and evolution in invertebrate lineages. To explore further the

functions and evolution of those Hbs, recent transcriptome data for the Arcid bivalve

Anadara trapezia is investigated here. This species shows the presence of duplicated

Hb encoding genes suggesting that gene duplication may have been more extensive

than previously thought in bivalves. This study tests the hypothesis that these

duplicated genes show patterns of tissue specific expression and evidence of

neofunctionalisation. This is shown here for at least three Hb encoding genes present

in A. trapezia with strong tissue specific expression in haemolymph compared to

other tissues. Furthermore, the expression of these genes remains unaffected by

prolonged air exposure suggesting that neofunctionalisation may confer an

evolutionary advantage to this bivalve. As well as the unique Hbs found in the

bivalve order Arcoida, Hbs are also found in three other bivalve orders: Carditoida,

Solemyoida and Veneroida. These four orders that possess Hbs provide compelling

evidence for the independent evolution of these proteins in multiple bivalve lineages.

To expand data on the distribution of Hbs in bivalves, a transcriptome sequence for

Ctenoides ales in the order Limoida was generated in this project. Interrogation of

the transcriptome shows the presence of at least three globin-like encoding genes

including two Hb-like encoding genes providing preliminary evidence for another

independent origin of Hb in a bivalve lineage. Overall, this study provides novel

insights into the function, evolution and distribution of Hbs in bivalves by

investigating two distantly related species. Results of this study are consistent with

current theories that Hb diversity in bivalves is a result of repeated rounds of gene

duplication providing the raw material for evolution. Investigation of hypoxic

resistance also reinforces that greater expression of Hbs in haemolymph confers a

physiological advantage suggesting that Hb would evolve more often in some

lineages during adaptation to unfavourable environment conditions, particularly

Abstract ii

hypoxia and prolonged air exposure. The finding of Hb-like encoding genes in

another bivalve lineage also supports the evolution of this gene family through

independent evolution and gene duplication, and gives insight into the distribution of

globin genes in bivalves which is still poorly understood. The investigation of Hb

genes in these bivalves also contributes to further understand the role of Hbs and

provides potential novel insights for resistance in hypoxic environments, disease

control and resistance to pollution in aquaculture.

Abstract iii

Table of Contents Keywords .................................................................................................................................. i

Abstract .................................................................................................................................... ii

List of Figures ......................................................................................................................... vi

List of Tables .......................................................................................................................... xi

List of Abbreviations ............................................................................................................. xii

Statement of Original Authorship ......................................................................................... xiii

Acknowledgements ............................................................................................................... xiv

Chapter 1: Introduction ............................................................................................ 1

1.1 Functional and structural diversity within the globin superfamily .................................1 1.1.1 Recently discovered globin genes ....................................................................................... 2 1.1.2 Myoglobins and haemoglobins ........................................................................................... 2

1.2 Evolution of haemoglobins .............................................................................................4 1.2.1 Gene duplication ............................................................................................................... 5 1.2.2 Divergent evolution of duplicated genes .......................................................................... 8 1.2.3 Convergent evolution ........................................................................................................ 9 1.2.4 Invertebrate haemoglobins .............................................................................................. 10

1.3 Bivalve haemoglobins .......................................................................................................12 1.3.1 Haemoglobins in the family Arcidae, Pteriomorphia subclass.......................................... 16

1.4 Aims ..................................................................................................................................19

1.5 Thesis Outline ...............................................................................................................20

Chapter 2: Tissue specificity and neofunctionalisation of haemoglobin genes in Anadara trapezia ....................................................................................................... 22

2.1 Background .......................................................................................................................22

2.2 Material and Methods .......................................................................................................23 2.2.1 Sample acquisition and tissue dissection .......................................................................... 23 2.2.2 RNA extraction and cDNA synthesis ............................................................................... 24 2.2.3 RT–PCR (Real Time PCR) ............................................................................................... 25 2.2.4 Candidate gene validation ................................................................................................. 26 2.2.5 RT-qPCR (Real Time quantitative PCR) for quantification of gene expression .............. 26 2.2.6 RT-qPCR data analysis ..................................................................................................... 27

2.3 Results ...............................................................................................................................28 2.3.1 Haemolymph analysis ....................................................................................................... 28 2.3.2 RT-PCR ............................................................................................................................ 30 2.3.3 Candidate gene validation ................................................................................................. 31 2.3.4 RT-qPCR for quantification of gene expression ............................................................... 31

2.4 Discussion .........................................................................................................................35 2.4.1 Haemolymph characteristics ............................................................................................. 35 2.4.2 Tissue specific expression and neofunctionalisation ......................................................... 36

2.5 Conclusion ........................................................................................................................37

Chapter 3: Functional annotation of the Ctenoides ales transcriptome .............. 39

3.1 Background .......................................................................................................................39

Table of contents iv

3.2 Materials and Methods ......................................................................................................41 3.2.1 Sample collection .............................................................................................................. 41 3.2.2 RNA extraction, library preparation and sequencing ........................................................ 41 3.2.3 Transcriptome assembly and validation ............................................................................ 44 3.2.4 Functional annotation of transcripts and mapping ............................................................ 44 3.2.5 Comparative transcriptomics ............................................................................................ 46 3.2.6 Candidate genes identification .......................................................................................... 47 3.2.7 Primer design and candidate gene validation .................................................................... 47 3.2.8 Phylogenetic analysis of sequences .................................................................................. 48

3.3 Results ...............................................................................................................................48 3.3.1 RNA extraction, library preparation and sequencing ........................................................ 48 3.3.2 Transcriptome assembly and validation ............................................................................ 50 3.3.3 Functional annotation of transcripts and mapping ............................................................ 51 3.3.4 Comparative transcriptomics ............................................................................................ 52 3.3.5 Candidate genes ................................................................................................................ 53 3.3.6 Primer design and candidate gene validation .................................................................... 55 3.3.7 Phylogeny of globins in bivalves ...................................................................................... 56

3.4 Discussion .........................................................................................................................58

3.5 Conclusion ........................................................................................................................60

Chapter 4: General Discussion ............................................................................... 61

4.1 Role of gene duplication in the current diversity of bivalve Hbs ......................................61

4.2 Globin gene evolution in hypoxic environments ..............................................................64

4.3 The importance of globin gene evolution to aquaculture ..................................................66

4.4 Limitations of the study ....................................................................................................67

4.5 Future research ..................................................................................................................67

4.6 Conclusions .......................................................................................................................67

References… ............................................................................................................. 69

Appendices.. .............................................................................................................. 98

Appendix A: Poster presented at the annual Lorne Genome conference 2015 ................... 98

Table of contents v

List of Figures

Figure 1.1. Maximum likelihood tree highlighting relationships between Hbs of jawed (gnathostomes) and jawless (agnathans ) vertebrates. In this phylogeny vertebrate-specific globins are grouped into two distinct clades: (i) Cyclostome Hbs + Cygb + Mb + GbE + GbY, (ii) β-Hbs + α-Hbs (Hoffmann et al., 2010a). ................................................................................................... 5

Figure 1.2. Comparison of chromosomal organization of α and β globin gene clusters in avian and mammalian taxa. The α and β globin genes represented here encode the α and β subunits of a tetrameric haemoglobin (α2β2) (Zhang et al., 2014). .......................... 8

Figure 1.3. This simplified phylogeny represents evolutionary relationships between major metazoan taxa, some lesser known phyla are not included for simplicity or due to unclear relationships. Taxa in which Hbs have been found are boxed in red. This phylogeny illustrates the independent evolution of Hbs through their presence in 11 major phyla shown here : Arthropods, Nematodes, Nemertines, Mollusks, Annelids, Echiurans, Pogonophorans, Phoronids, Playelminthes, Echinoderms and Chordates. Adapted from (Halanych & Passamaneck, 2001). ........... 11

Figure 1.4 Gene structure from two Hbs found in annelid worms (Branchipolynoe spp.). This diagram illustrates the exon-intron structure and domain architecture for the single-domain (top) and tetra domain (bottom) globins found in these species (Projecto-Garcia et al., 2010). ............................................................. 12

Figure 1.5 Phylogenetic classification of class Bivalvia of molluscs. The main bivalve subclasses are represented here in different colours: Protobranchia, Pteriomorpha, Palaeoheterodonta, Archiheterodonta, Anomalodesmata and Imparidenta. This basic phylogeny demonstrates the distribution of Hb (indicated as Hb following species and order name) and Hc (indicated as Hc) among bivalve taxa and the order of the species in which those respiratory pigments are found is indicated in grey brackets: Solemyoida, Nuculanoida, Arcoida, Carditoida and Veneroida. Adapted from (Gonzáles et al., 2015). ............................ 15

Figure 1.6. Quaternary assembly of Homo sapiens and Scapharca inaequivalvis Hbs. (a) HbA refers to adult Hb in H. sapiens; (b) HbII refers to hetero-tetrameric arcid Hb in S.inaequivalis and (c) HbI refers to homo-dimeric arcid Hb in S.inaequivalis. For each Hb structure represented here, haeme groups are shown in red, α (alpha) subunits are shown in dark grey, β (beta) subunits are shown in light grey and E and F helices are shown in blue. This illustrates the diversity of structures found in arcid Hbs with a heterotetramer (b) and a homodimer (c), both found

List of figures vi

in S.inaequivalis. It also shows the back to front assembly of the arcid Hbs with E and F helices arranging on the outside of the molecule compare to human Hb. (Ronda et al., 2013). ................ 17

Figure 2.1 Photograph of an A. trapezia specimen illustrating the anatomical position of all five tissues used to assess tissue specific expression of Hb genes in this study. .................................... 24

Figure 2.2 Summary of haemolymph analysis results. This data was obtained by testing a few microliters of fresh haemolymph using and Abbott i-STAT blood analyser. This was done for all haemolymph samples across two conditions of experiment and two timepoints: water 6 h, air 6 h, water 12 h and air 12 h. A) pH measurements, B) percentage of O2 saturation, C) partial pressure of CO2. Significant differences were assessed through ANOVA testing using the program SPSS with pH values, percentage of O2 saturation values and pCO2 values as dependent variables respectively. Condition was used as a factor for each test and results were considered statistically significant at p < 0.05. Statistically different groups are represented by the symbols (*) and (•) in each graph and error bars represent 2 standard errors around the mean. .............................. 29

Figure 2.3. PCR products amplified from two mantle samples to validate candidate Hb genes. Amplified PCR products obtained here were purified using the Bioline isolate PCR purification kit followed by cloning using the Promega pGEM-T and pGEM-T easy vector systems quick protocol. Samples were then sequenced on the ABI Genetic Analyzer 3500 in duplicate. Each gel of this figure represents one mantle sample. For both gels A (sample 1) and B (sample 2): lane 1 contains 100 bp Hyperladder, lane 2 through to 7 contain amplified products for 2D, AG, BG, HB, HD and 18S genes respectively. ......................................................................................... 31

Figure 2.4. Relative expression ratios of candidate globin genes amplified using RT-qPCR. Candidate genes amplified in each tissue from the bivalve A.trapezia are represented as follows: 2D, AG, BG and HB. Relative quantification analysis was performed using the ∆∆CT method. Relative expression is expressed as a ratio of levels of target sequences to levels of reference sequences with 18S used here as a housekeeping gene. Significant differences were assessed through ANOVA testing using the program SPSS and differences were considered statistically significant at p < 0.05. Significantly different groups are shown here with an asterix (*). Ratio values were used as a dependent variable against tissue type for each gene. Error bars represent 2 standard errors around the mean. ..................... 32

Figure 2.5. Examples of amplification curves obtained for target genes (2D, AG, BG, HB) and housekeeping gene 18S in each tissue type. Target amplification curves are represented in orange (left),

List of figures vii

negative controls in green (left) and reference amplification curves in blue (right). RT-qPCR was performed using a Lightcycler® measuring specific fluorescence at each cycle. All quantitative PCR analyses were repeated in three technical replicates along with negative controls and 18S as a housekeeping gene. ............................................................................. 33

Figure 2.6. Relative expression ratios of candidate globin genes amplified using RT-qPCR. Candidate genes amplified in each tissue from the bivalve A.trapezia are represented as follows: haemolymph, foot, gills, mantle and muscle. Relative quantification analysis was performed using the ∆∆CT method. Relative expression is expressed as a ratio of levels of target sequences to levels of reference sequences with 18S used here as a housekeeping gene. Significant differences were assessed through ANOVA testing using the program SPSS with ratio values as a dependent variable and condition as a factor in each tissue. Differences were considered statistically significant at p < 0.05 and no statistical differences were found here. Error bars represent 2 standard errors around the mean. .............................. 34

Figure 3.1. Workflow overview of functional annotation of the C. ales transcriptome using the Trinotate annotation pipeline. This is a comprehensive annotation suite based on homology searches to known sequence data. Contigs were first used as BASLTx queries against the TrEMBL and Swiss-Prot databases (stringency E-value of 1 x 10-6). TransDecoder was used to generate a predicted proteome then used as a BLASTp query against the TrEMBL and Swiss-Prot databases. SignalP was used to predict the presence and location of signal peptides and Pfam to determine the presence and position of protein domains. All results were uploaded to the SQLite database and an annotation report was generated. Adapted from van der Burg et al. (2016). ............................................................................... 46

Figure 3.2. Whole tissue from one C.ales individual was sampled and used for RNA extraction. This 1.5 % agarose gel electrophoresis shows RNA extracted from four samples (extraction was performed in quadruplicate) from this individual as follows: lane 1 contains 100 bp Hyperladder, lanes 2-5 contain samples 1-4 respectively. The RNA is visible as strong bands in each sample around the 700 bp mark. RNA obtained was then assessed for quantity and integrity and sequencing libraries were prepared. ..................................................................................... 49

Figure 3.3. Bioanalyser results for total RNA quality and quantity. Total RNA samples obtained from whole tissue of one C.ales individual were assessed for quantity and integrity on a Bioanalyzer 2100 RNA nano chip. Results shown here are for two RNA samples labelled here C10 and C11. RNA concentrations are given for each sample............................................ 50

List of figures viii

Figure 3.4. WEGO output for newly generated transcript for C. ales. Web gene Annotation Plotting was used to characterise the transcriptomic data obtained for C. ales. This figure represents the proportion and number of transcripts assigned Gene Ontology (GO) terms in three different gene ontology categories developed to represent common and basic biological information: cellular component (CC), molecular function (MF) and biological process (BP). ...................................................... 52

Figure 3.5. Venn diagram illustrating the number of gene clusters shared and unique between the four bivalve species C. gigas, L. gigantea, A. trapezia and C. ales. Orthologous gene clusters for C. ales, A. trapezia and the two model species L. gigantea and C. gigas are annotated and compared here using the program OrthoVenn. For L. gigantea and C. gigas, the predicted proteomes obtained from the genomes are used and the predicted proteomes from whole organism transcriptomes are used for A. trapezia and C. ales. Ortholog groups shown here were identified by an all-against-all reciprocal BLASTp alignment. ............................................................................................ 53

Figure 3.6. Globin domains identified for three candidate globin genes. The annotated transcriptome obtained for C.ales was interrogated for candidate globin genes here defined as contigs that possess a characteristic globin fold sequence and globin domain. The three contigs found to possess these characteristics are shown above as follows: CalesGl1 (top), CalesGl2 (middle) and CalesGl3 (bottom). For candidate gene 2, the purple circle represents a signal peptide and for candidate gene 3, the blue rectangle represents a transmembrane domain. Both were identified using SMART searches for homologous Pfam domains, signal peptides and internal repeats. ................................................................................... 54

Figure 3.7. Candidate gene products from C. ales transcriptome. Each candidate was amplified using primers as shown in table 3.2 above. Lanes 1 in all gels displayed here are Hyperladder 100 bp. Candidate gene 1 is shown in lane 2 of gel (A); candidate gene 2 is shown in lane 3 of gel (B); candidate gene 3 is shown in lane three of gel (C). All gels are 1.5 % agarose stained with GelRedTM (Biotum). Products of candidate genes seen here were purified using an Ethanol/EDTA precipitation protocol and samples were sequences on ABI Genetic Analyzer 3500 (ThermoFisher). ................................................................................... 55

Figure 3.8. Molecular Phylogenetic analyses by Maximum Likelihood method. Phylogenetic relationships of globin genes were here resolved for the following species: bivalves A. trapezia and C. ales, two mollusc model species L. gigantea and C. gigas, three vertebrate model species H. sapiens, G. gallus and D. rerio. The percentage of trees in which the associated taxa clustered

List of figures ix

together is shown next to the branches. A discrete Gamma distribution was used to model evolutionary rate differences among sites (3 categories (+G, parameter = 5.3023)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 3.8405 % sites). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. ................................................................................................ 57

Figure 3.9. Multiple alignments of globin protein sequences. All mollusc globin protein sequences used in the phylogeny represented in Figure 3.8 were aligned for sequence comparison and to identify residue conservation using the multiple sequence alignment with high accuracy and high throughput MUSCLE in MEGA. Sequences are grouped by species and include A. trapezia, C. ales, C. gigas and L. gigantea. Residues conserved across all sequences and all species are indicated above by an asterix (*). ....................................................................... 58

List of figures x

List of Tables

Table 2.1 List of primers designed to amplify products of candidate globin genes identified in the bivalve species A. trapezia using RT-PCR. All primers were designed to amplify the entire ORF of each gene with product sizes between 350 bp and 619 bp. ................. 26

Table 2.2 List of primers designed to amplify products of globin genes identified in the bivalve species A. trapezia using RT–qPCR and determine their expression levels in different tissues. All primers are designed to amplify products with sizes between 109 bp and 148 bp. (Prentis & Pavasovic, 2014). ............................... 27

Table 2.3 RT- PCR results summary for tissue specific expression. All five genes (2D, AG, BG, HB and HD) have been amplified in six biological replicates for each tissue and each condition. To summarise the results, in this table, a score is given out of 6 (total number of biological replicates) for each candidate gene amplified in each tissue and in each condition. An asterix * represents weak bands obtained on gel electrophoresis for at least 2 biological replicates out of 6 in that group. ............................. 30

Table 3.1 Summary of sequencing and assembly data for the bivalve C. ales. Sequencing libraries were prepared using an Illumina TruSeq® stranded RNA library prep kit and the final cDNA library was sequenced on an Illumina NextSeq500 using 150bp paired-end chemistry. Libraries obtained were then assembled and the table below summarises results obtained. ............................... 51

Table 3.2 Primers designed for validation of three candidate genes identified from the newly generated C. ales transcriptome. Primers were designed using Primer3 software to amplify the entire ORFs and validate the candidate genes identified. Forward and reverse primers were designed for each candidate as shown in the table below. ................................................................ 55

List of tables xi

List of Abbreviations

AA- Amino acid

Angb- Androglobin

BLAST- Basic local alignment search tool

CO- Carbon monoxide

Cyg- Cytoglobin

GbE- Globin E

GbX- Globin X

GbY- Globin Y

Hb- Haemoglobin

LUCA- Last universal common ancestor

NO- Nitric oxide

Mb- Myoglobin

NCBI- National Centre for Biotechnology Information

Ngb- Neuroglobin

ORF- Open reading frame

PCR- Polymerase chain reaction

ROS- Reactive Oxygen Species

List of abbreviations xii

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the

best of my knowledge and belief, the thesis contains no material previously

published or written by another person except where due reference is made.

Signature:

Date: _____June 2017___________

Statement of original authorship xiii

QUT Verified Signature

Acknowledgements

I would firstly like to express my gratitude to my supervisors Dr. Ana Pavasovic

(School of Biomedical Sciences, Queensland University of Technology), Dr. Peter

Prentis (School of Earth, Environmental and Biological Sciences, QUT) and

Professor Louise Hafner (School of Biomedical Sciences, QUT) for their supervision

and guidance throughout my research and writing of this thesis. I would also like to

thank them for their continuous support, patience and encouragement throughout

these challenging two years.

A special thank you to my principal supervisors Dr. Ana Pavasovic and Dr. Peter

Prentis for their flexibility, genuine caring and faith in me along the way.

I would like to thank all my colleagues in the evolutionary and physiological

genomics lab (ePGL), especially Shorash Amin, Hayden Smith, Joachim Surm and

Chloe van de Burg for their ongoing help and support. I would also like to thank

Associate Professor Christopher Collet (School of Biomedical Sciences, QUT) and

Dr. David Hurwood (School of Earth, Environmental and Biological Sciences, QUT)

for reviewing my thesis draft and providing valuable feedback during my final

seminar.

I would like to thank all the staff at the QUT marine lab facility for their helpful

advice regarding care of the marine animals and tanks. I would also like to thank

QUT HPC and QUT MGRF for use of their facilities.

I would like to thank my family for giving me the opportunity to study in Australia

and for their ongoing loving support and encouragement.

Lastly, I would like to thank my partner Tom for his emotional support, endless

patience and encouragement. He has always been a source of strength and has kept

me determined throughout this challenging journey.

Acknowledgements xiv

Chapter 1: Introduction

1.1 Functional and structural diversity within the globin superfamily

The globins are an ancient gene superfamily, thought to have been present in

the last universal common ancestor (LUCA) of the three domains of life (Hoffmann et

al., 2010a). Globin genes encode for small iron metalloproteins, typically ~ 150 amino acids

in length. Globin domains consist of a proximal histidine residue in the F helix for iron

binding and a distal histidine residue on the opposite side of this iron for oxygen binding

(Bashford et al., 1987). Structurally, globin domains consist of eight alpha (α) helical

segments which form the characteristic globin fold in a three-on-three α helical structure with

a central haeme group comprising a proto-porphyrin ring (Perutz, 1979; Blank & Burmester,

2012). It is this haeme prosthetic group that allows globin proteins to reversibly bind oxygen

(O2) and other gaseous ligands (Pesce et al., 2002). For a long time, the metazoan (animal)

globin superfamily was thought to consist of only two globin types, haemoglobin (Hb) and

myoglobin (Mb), but recent research has shown that this superfamily is functionally and

structurally far more diverse than originally thought (Götting & Nikinmaa, 2015).

The globin gene superfamily includes genes encoding Hbs, neuroglobins (Ngbs),

cytoglobins (Cygbs), globin X (GbX), androglobins (Angbs), Mbs, globin E (GbE) and

globin Y (GbY) among others (Hoffmann et al., 2010a; Storz et al., 2013; Opazo et al.,

2015). This diverse group of genes is thought to have evolved from a common ancestral

gene through repeated rounds of gene and genome duplication, some 1.8 billion years ago

(Efstratiadis et al., 1980; Wajcman et al., 2009). This coincides with the accumulation of O2

levels in the atmosphere, suggesting that those globin genes arose as a mechanism to

scavenge toxic O2, carbon monoxide (CO) and nitric oxide (NO) gases (Hardison, 1996;

Koch & Britton, 2008). The repeated rounds of duplication and functional divergence of

duplicated genes have resulted in a large and diverse group of structurally similar

proteins. In this superfamily, GbX and Ngb are some of the more recently described proteins

(Pesce et al., 2002; Burmester & Hankeln, 2004; Roesner et al., 2005) but are thought to be

the most ancestral globin genes found in metazoans. In fact, GbX and Ngb are the only

globin genes found in early divergent phyla such as Cnidaria and Porifera, and predate the

split of deuterostomes and protostomes (Schwarze et al., 2014).

Chapter 1: Introduction 1

1.1.1 Recently discovered globin genes

Neuroglobin and GbX are both expressed in the nervous system of vertebrates, but

unlike Ngb, which is typically found in the cellular cytoplasm, GbX is a membrane bound

protein (Pesce et al., 2002; Burmester & Hankeln, 2014). The functions of both of these

proteins are still uncertain and they have been the focus of numerous studies to elucidate their

physiological function (Hankeln et al., 2005; Burmester & Hankeln, 2009; Wawrowski et al.,

2011). Nonetheless, initial studies speculate that Ngb and GbX largely play a protective role

in the cell (Brunori & Vallone, 2007; Burmester & Hankeln, 2009; Corti et al., 2016) as well

as being involved in cellular signaling processes (Burmester & Hankeln, 2009; Su et al.,

2014). Globin E, another described vertebrate globin (Kugelstadt et al., 2004), is typically

expressed in eye tissue. Its role is thought to be related to O2 supply of retinal cells, which

are metabolically highly active (Blank et al., 2011). Androglobin is an ancient chimeric gene

with high levels of expression in the testes of vertebrates (Hoogewijs et al., 2011), however,

its function remains unresolved (Burmester & Hankeln, 2014). Yet another recently

discovered globin, Cygb, is expressed in a diverse range of tissues and cell types including

epithelium, fibroblast cell lineages, macrophages, neurons and muscle fibers (Oleksiewicz et

al., 2011; Motoyama et al., 2014). Functions of Cygb appear similarly diverse, with roles in

protection from reactive oxygen species and in nitrous oxide metabolism (Pesce et al., 2002;

Singh et al., 2014).

1.1.2 Myoglobins and haemoglobins

Stemming from their early discovery, Mbs and Hbs are the most extensively studied

globins. Most metazoan species possess only a single copy of the Mb gene except in rare

cases of some fish lineages where an increase in copy number (up to seven) is seen (Koch &

Burmester, 2016). Mbs are small monomeric proteins whose expression is principally

restricted to striated muscle tissue where they play a key role in supplying the mitochondria

of myocytes with O2 during periods of hypoxia, also defined as oxygen deficiency in a biotic

environment (Wittenberg & Wittenberg, 2003). This protein is also reported to play an

important role in the decomposition of nitrous oxide during high cellular metabolic activity

(Flögel et al., 2001). Unlike the other globin proteins, Hb principally transports O2 from

respiratory surfaces to the working tissue within an organism.

Haemoglobins in metazoans have been reported in multiple animal phyla as key

oxygen-transport proteins (Weber, 1980; Mangum, 1992; Hardison, 1996; Hourdez et al,

2 Chapter 1: Introduction

2000). Most frequently Hbs are found in the circulatory system of metazoan species, but can

sometimes be confined to specific tissues, such as in the bivalve Yoldia eightsii where Hb is

expressed in the gill tissue (Dewilde et al., 2003). Outside of vertebrates, Hbs exhibit a

remarkable diversity in structure (Terwilliger, 1998; Weber & Vinogradov, 2001). For

example, Hb proteins can occur as monomers, dimers, tetramers or even in polymeric forms

(Weber, 1980). Circulating Hbs may also be found within erythrocytes (intracellular) or

freely dissolved in fluid tissue such as blood or haemolymph (extracellular) (Ching Ming

Chung & Ellerton, 1980). Extracellular Hbs are extremely diverse in subunit size and

quaternary structure, however, they all share the same globin fold as intracellular Hbs

(Negrisolo et al., 2001). Notable structural variations can often be found in invertebrate

species such as the bivalve mollusc Barbatia reeveana where a very large polymeric Hb of

430 kDa composed of 34 kDa di-domain subunits occurs, each containing two covalently

linked functional units for O2 binding (Grinich & Terwilliger, 1980). Other examples of

structural variation include annelid species, such as Riftia pachyptila and Lumbricus

terrestris, which possess Hbs consisting of 24 and 144 subunits respectively (Royer et al.,

2000; Strand et al., 2004; Flores et al., 2005).

Structural variations in Hbs can be observed even among vertebrate lineages,

where jawless vertebrates (agnathans) have weakly cooperative dimers compared to the

canonical tetrameric Hbs of jawed vertebrates (gnathostomes) (Hoffmann et al., 2010a).

By far the best-studied Hb is the tetrameric form found in humans. Structurally, the human

Hb consists of 4 globin subunits (2 alpha (α) and 2 beta (β)), each with their own haeme

group (Pesce et al., 2002; Storz et al., 2013). α and β chains consist of 141 and 146 amino

acids, respectively and are held together by noncovalent interactions to form a heterotetramer

(Antonini & Chiancone, 1977; Hardison et al.,1997).

The genes that encode the different subunits of Hb proteins are found as clusters in the

human genome. For example, the α globin gene cluster is located on chromosome 16 and

includes seven loci (NC_000016.10; 5’ – zeta – pseudozeta – mu – pseudoalpha1 – alpha2 –

alpha1 – theta – 3’) (Vernimmen, 2014) while the β gene cluster is found on chromosome 11

and is comprised of five loci (NC_000011.10; 5’-epsilon – gammaG – gammaA – delta – beta

– 3’) (Moleirinho et al., 2013). The order in which the genes are found within these clusters,

determines the timeline at which they are expressed during development (Hardison et al.,

1997) with those closest to the locus control region at the 5’end, expressed in early


development and those further away expressed at a later stage (Hanscombe et al., 1991).

This developmental expression has been associated with varying oxygen levels throughout

embryonic and foetal development (Efstratiadis et al., 1980) and demonstrates that oxygen

availability can influence the expression and evolution of Hbs.

1.2 Evolution of haemoglobins

Haemoglobins are among the most extensively studied proteins, yet our understanding of

their evolutionary history is becoming increasingly unclear. A recent phylogenetic analysis of

the vertebrate Hbs by Hoffmann et al., (2010a) suggests that Hbs in gnathostomes and

agnathans have evolved in each lineage independently. It is also likely that these Hb genes

have evolved from different ancestral genes based on the placement of gnathostome and

agnathan Hbs in two distinct clades (Figure 1.1) (Hoffmann et al., 2010a). Findings such as

these are in contrast to the prevailing paradigm that the current vertebrate Hbs have evolved

from an ancestral Mb gene. In invertebrates, the evolution of Hb genes remains even less

clear than in vertebrates, largely due to insufficient genomic resources for the groups that

possess Hbs.

The current paradigm to explain the diversity of vertebrate globin genes largely involves

gene and whole genome duplication events, mutation and natural selection acting to promote

evolutionary innovation in this gene family. Both, the two rounds of whole genome

duplication (2R hypothesis; (Hokamp et al., 2003)) that preceded the evolution of vertebrates

and further tandem duplications provided the raw substrate for the evolution and

diversification in the vertebrate globin genes seen today. Divergent and convergent evolution

have played major roles in the evolution of new functions observed in duplicated vertebrate

globin genes.


Figure 1.1. Maximum likelihood tree highlighting relationships between Hbs of jawed (gnathostomes) and

jawless (agnathans ) vertebrates. In this phylogeny vertebrate-specific globins are grouped into two distinct

clades: (i) Cyclostome Hbs + Cygb + Mb + GbE + GbY, (ii) β-Hbs + α-Hbs (Hoffmann et al., 2010a).

1.2.1 Gene duplication

The role of both gene duplication and whole-genome duplication is now widely

accepted as a key driver of evolution as it is the most frequent mechanism responsible for

the generation of genes with new functions (Ohno et al., 1968; Cañestro et al., 2013). It is

through the accumulation of mutations and repeated rounds of duplication of existing genes

that new functions are acquired (Zhang, 2003). Both whole-genome and gene duplication

have promoted evolutionary innovation and led to the current diversity within the Hb gene

family (Storz et al., 2013). Gene duplication can occur through five mechanisms: (i) the


unequal crossing-over between two sister chromatids of one chromosome or (ii) between

two homologous chromosomes during replication, (iii) regional redundant duplication of

DNA molecules (segmental duplication), (iv) polyploidization or (v) retrotransposition

(Ohno et al., 1968 ; Zhang, 2003). Unequal crossing over events can also be explained as

recombination between DNA sequences at different sites on sister chromatids or

homologous chromosomes. This results in a decrease in gene copy number on one

chromosome or one chromatid and an increase on the other (Roeder, 1983). The variations

in globin gene copy numbers have often been associated with this type of recombination

(Goossens et al., 1980; Higgs et al., 1980; Trent et al., 1981; Roeder, 1983; Hurles, 2004).

Vertebrate Hb gene clusters, described previously, provide classic examples of evolution

through gene duplication. In 1961, Ingram suggested that polyploidization initiated two

duplication events from Mb to the primordial Hb α gene which then produced the Hb β-like

gene. While this is an overly simplistic explanation for the diversity found within the globin

gene family, it provided an early plausible hypothesis that gene duplication was a major

driver of the evolution of the vertebrate globin gene family.

Gene duplication is known to have four possible outcomes (Zhang, 2003; Cañestro

et al., 2013). One possible outcome is dosage repetition, where limited sequence evolution

is seen, and gene function is conserved (Zhang, 2003; Cañestro et al., 2013). Another

outcome following a duplication event may be pseudogenisation of one duplicated copy

through the accumulation of mutations creating a non-functional gene (pseudogene) (Force

et al., 1999; Zhang, 2003; Bischof et al., 2006). This may result in a duplicate transcribed

into RNA but not translated. Neofunctionalisation represents another possible outcome of

gene duplication whereby accumulation of mutations in one of the copies may lead to new

functions (Innan & Kondrashov, 2010). Lastly, subfunctionalisation is a sub-category of

neofunctionalisation where the function remains the same but changes in regulatory

elements that control expression of the gene may lead to different copies of the duplicate

being expressed in different tissues (Lynch & Force, 2000; Huerta-Cepas et al., 2011).

Neofunctionalisation and subfunctionalisation are largely the result of divergent selection

acting on newly formed duplicates. Mutations in DNA coding regions will lead to changes

in the amino acid sequence and affect protein-protein interactions which are the foundation

of cellular molecular function therefore giving rise to new functions for those proteins

(Wray et al., 2003).


In vertebrates, repeated rounds of gene and whole genome duplication events have

led to copy number variation across the eight different classes of globin genes, as listed in

section 1.1. For example, in fish Mb copy number variation can range from none (ice

fishes: Chaenocephalus aceratus, Pseudochaenichthys georgianus and stickleback:

Gasterosteus aculeatus) (Sidell & O’Brien, 2006; Hoffmann et al., 2011) to seven copies

(lungfish: Protopterus annectens) (Koch et al., 2016). Pseudogenisation has led to attrition

in some of these globin classes in certain vertebrate lineages. Specifically, the GbY is

absent in birds, marsupials and placental mammals, while it is present in monotremes and

most other vertebrate lineages with the exception of lampreys and ray-finned fishes

(Burmester & Hankeln, 2014). Similarly, this process of gene loss is responsible for the

absence of Mb in a number of amphibian species (e.g., anurans (frogs)) (Maeda & Fitch,

1982; Fuchs et al., 2006). In the vertebrates, the formation of the α globin gene cluster is a

consequence of tandem duplication leading to functional copy number variation, such as two

in green anole (Anolis carolinensis) (Hoffmann et al., 2010b), three in chicken (Gallus

gallus) (Reitman et al., 1993) and four in platypus (Ornithorhynchus anatinus) (Opazo et

al., 2008). A recent systematic analysis of 22 avian and 22 mammalian genomes revealed a

significant conservation in copy number within the avian α globin gene cluster (2-3 copies)

but substantial variation among the surveyed mammalian lineages (2-8 copies)(Figure 1.2)

(Zhang et al., 2014). In addition to this duplication of α globin genes within the mammalian

lineages, there is strong evidence to suggest that mutations which have accumulated in some

duplicated copies may have led to the evolution of novel functions (He & Zhang, 2005).

This process of neofunctionalisation is often a result of divergent natural selection acting on

new genetic variation in duplicated gene copies.


Figure 1.2. Comparison of chromosomal organization of α and β globin gene clusters in avian and mammalian

taxa. The α and β globin genes represented here encode the α and β subunits of a tetrameric haemoglobin (α2β2)

(Zhang et al., 2014).

1.2.2 Divergent evolution of duplicated genes

Divergent evolution of duplicated genes is the process in which genes of a similar

function diverge from each other following duplication from a common ancestral gene

(Bikard et al., 2009). An example of divergent evolution in the globin superfamily is

s een in a number of vertebrate Hb proteins that undertake slightly different but similar

functions. These Hb proteins are encoded by genes which have evolved from the same

ancestral gene but exhibit differences in their ontogenetic timing of expression and

functional properties, such as affinity for oxygen (Gribaldo et al., 2003). In fact, the

differences in O2 scavenging and O2 transport roles of embryonic Hb versus adult Hb are

attributable to amino acid replacements (non-synonymous mutations) in the zeta/epsilon and

beta/alpha genes expressed in the embryonic and adult individual, respectively (Goodman et

al., 1987). Another example of divergent evolution driving evolutionary innovation in Hb

proteins can be seen in the avian lineage. In this instance, adult birds express two

functionally distinct Hb isoforms, HbA and HbD (Grispo et al., 2012). While the β globin

chains in both isoforms are identical, two functionally distinct α chains, one encoded by the

alphaA globin gene and the other by the alphaD globin gene are found in the HbA and HbD


isoforms, respectively. The alphaA and alphaD globin genes share a common ancestral gene,

but possess amino acid replacements that substantially alter O2 affinity in the presence of

allosteric modulators (Storz et al., 2015). Other examples of divergent evolution include the

expression differences found in GbX paralogs (orthologous genes, which have diversified

through duplication within the species) in the elephant shark (Callorhinchus milii) (Opazo et

al., 2015). In this example, GbX1 is expressed across a wide range of tissues, while the

expression of GbX2 is primarily restricted to the gonads. Taken together these examples

highlight the process of divergent evolution operating on non-synonymous mutations in

duplicated globin genes, but does not, however, explain the independent evolution of Hb in a

number of metazoan lineages such as vertebrates, bivalves and annelids (Wray et al., 1996).

1.2.3 Convergent evolution

Convergent evolution is the independent evolution of the same function or

phenotype in different lineages from different ancestral genes (Hoffmann et al., 2010b).

As a consequence, it can lead to analogous molecules with similar functions in unrelated

lineages (Hoffmann et al., 2010b; Burmester & Hankeln, 2014; Opazo et al., 2015). Such

adaptive phenotypic convergence appearing in unrelated taxa is partly attributed to similar

selection pressures operating on duplicated genes and this process is thought to be

widespread in nature (Parker et al., 2013). An important example of convergent evolution

is observed in the independent evolution of electric organs in numerous fish species, where

the myogenic electric organ produces electrical currents for the purposes of communication

and is believed to have evolved multiple times (Gallant et al., 2014). Similarly,

echolocation in Cetacea (whales and dolphins) and Chiroptera (bats) has also been attributed

to phenotypic convergence (Liu et al., 2010). Genome-wide analysis of cetaceans and two

different bat lineages (Yinpterochiroptera and Yangochiroptera) have shown extensive

convergent changes in nearly 200 loci containing coding sequences involved in echolocation

(Parker et al., 2013). Functionally different Hb proteins occurring within erythrocytes of

agnathan (jawless) and gnathostome (jawed) vertebrates present another example of

convergence (Hoffman et al., 2010a). In these two disparate lineages, phylogenetic

analyses have determined that the Hbs have not evolved from orthologous genes and are

structurally distinct, reflected in a weakly cooperative dimeric Hb form produced in

agnathans and a cooperative tetrameric Hb form found in gnathostomes (Figure 1.1)

(Hoffmann et al., 2010a; Schwarze et al., 2014). In addition to evidence of convergent


evolution of Hb among vertebrates, evidence of convergence between vertebrate and

invertebrate Hb proteins is also observed. A specific example is the repeated evolution of

intracellular tetrameric Hb in some bivalve mollusc species and vertebrates (O’Gower &

Nicol, 1968). In invertebrates, a variety of Hbs and Mbs have also been observed (Weber

& Vinogradov, 2001) and are believed to be the result of globin proteins emerging several

times convergently from different ancestral globin genes (Blank & Burmester, 2012;

Schwarze et al., 2014).

1.2.4 Invertebrate haemoglobins

From primary sequence to secondary, tertiary and quaternary structures, a large

diversity exists among invertebrate Hbs. This variability is thought to represent

specialization of Hb molecules to the wide range of environments they inhabit (Terwilliger,

1998; Weber & Vinogradov, 2001; Alyakrinskaya, 2002; Gow et al., 2005). Structurally,

invertebrate Hbs also retain the globin fold (Gow et al., 2005) and exhibit a crystal structure

that consists of at least six α-helices (Weber & Vinogradov, 2001). Haemoglobin in

invertebrates has evolved independently at least 11 times (Figure 1.3) (Weber & Vinogradov,

2001), however, it is likely that this number may increase as more data becomes available for

many understudied invertebrate lineages.


Figure 1.3. This simplified phylogeny represents evolutionary relationships between major metazoan taxa, some

lesser known phyla are not included for simplicity or due to unclear relationships. Taxa in which Hbs have been

found are boxed in red. This phylogeny illustrates the independent evolution of Hbs through their presence in

11 major phyla shown here : Arthropods, Nematodes, Nemertines, Mollusks, Annelids, Echiurans,

Pogonophorans, Phoronids, Playelminthes, Echinoderms and Chordates. Adapted from (Halanych &

Passamaneck, 2001).

The diversity in Hb proteins is a result of sequence diversity seen in genes encoding

invertebrate Hbs. Within invertebrates; nematodes, annelids, arthropods and molluscs all

possess genes encoding Hb proteins with more than a single functional globin domain which

has resulted in a diversity of functional proteins (Natarajan et al., 2015). The brine shrimp

(Artemia), for instance, expresses two functional Hb genes (an α and β subunit type), each of

which consists of nine tandem globin domains. The association of the polypeptide chains

encoded by these two genes results in the expression of three Hb proteins; a hetero-dimer (Hb

II) and two homodimers (HbI and HbIII) (Manning et al., 1990). Structurally, HbII is

characterised by α and β subunit types, while HbI and HbIII are composed of α and β subunit

types, respectively (Manning et al., 1990). Interestingly, in addition to possessing multi-

domain Hbs, production of multiple types of Hbs appears common among invertebrates. For

example, in the annelid worms (Branchipolynoe symmytilida and B. seepensis) a single

domain globin gene (SD) encodes a 137 amino acid Hb protein, while a tetradomain gene

(TD) encodes a Hb protein of 552 amino acids (Projecto-Garcia et al., 2010). Figure 1.4


illustrates the exon-intron structure and domain architecture of the two Hbs from

Branchipolynoe spp. Similarly, in nematodes, there is a diversity of globins including single-

domain and di-domain Hbs (Projecto-Garcia et al., 2015). It is notable that despite this

diversity, the di-domain globin genes appear to have a restricted distribution only in two

parasitic species (Ascaris suum and Pseudoterranova decipiens) (Darawshe et al., 1987;

Dixon et al., 1991). These di-domain globin genes from nematodes encode a large polymeric

multi-domain Hb (octamer consisting of eight two domain subunits). Overall, based on the

observed diversity, invertebrate Hbs have been classified into four distinct groups according

to their gene and protein subunit structures. These include single domain, single-subunit

Hbs; two-domain, multi-subunit Hbs; multi-domain, multi-subunit Hbs and single-domain,

multi-subunit Hbs (Vinogradov, 1985).

Figure 1.4 Gene structure from two Hbs found in annelid worms (Branchipolynoe spp.). This diagram

illustrates the exon-intron structure and domain architecture for the single-domain (top) and tetra domain

(bottom) globins found in these species (Projecto-Garcia et al., 2010).

1.3 Bivalve haemoglobins

Similar to the diversification patterns seen in other invertebrate lineages, bivalve

molluscs show strikingly diverse patterns of Hb distribution and evolution. This is of interest

as bivalves typically do not possess a functional respiratory pigment and those that do were

previously thought to utilise a copper-based respiratory pigment known as haemocyanin (Hc),

with Hb expression considered rare (O’Gower & Nicol, 1968; Terwilliger, 1998). Species

that contain Hc are restricted to the earliest branching lineage of bivalves and it has been

suggested that Hc is the ancestral oxygen-transport protein in class Bivalvia. It has been

shown, however, that Hb is more widely distributed in bivalve molluscs than previously


thought (Manwell, 1963; Smith, 1967; Terwilliger, 1998; Alyakrinskaya, 2002; Wajcman et

al., 2009).

Currently, four independent origins of Hbs have been hypothesised in bivalves

(Figure 1.5). The first instance is thought to have occurred in the primitive bivalve lineage

containing Solemya velum, which possesses several different types of Hbs expressed

predominately in gill tissue (Dando, 1985; Doeller et al., 1988; Torres-Mercado et al., 2003).

In Lucina pectinata, also found in this lineage, three Hbs are expressed; HbI which is a

sulphide reactive protein and HbII and III, which are O2 reactive globins (Montes-Rodriguez

et al., 2016). A second instance has occurred in the bivalve family Arcidae where species

contain multiple forms of Hb in circulating erythrocytes (Mangum, 1997) represented in

Figure 1.5 by Arca noae. Haemoglobin diversity of Arcidae will be discussed in more detail

in the following section as it constitutes one of the questions addressed by this thesis. The

third independent origin of bivalve Hb is found in the deep-sea clam genus Calyptogena.

Species within this genus generally present with two homo-dimeric Hb proteins (HbI and

HbII) in erythrocytes but C. nautilei possess two monomeric Hbs (HbIII and HbIV) which

show low sequence identity to HbI and HbII (Kawano et al., 2003). The fourth instance is an

extracellular Hb found in the heterodont clams Cardita borealis and C. floridana (Manwell,

1963; Terwilliger et al., 1978). Figure 1.5 depicts the basic bivalve phylogeny with the

distribution of Hc and Hb among its taxa. While these four cases listed above provide

compelling evidence for the independent evolution of Hb in multiple bivalve lineages, it is

not known whether Hb has evolved in other lineages where O2 transport proteins have not

been examined.

One lineage, in particular, that has not been extensively examined for the presence of

Hb proteins are the members of the family Limidae. This is significant as there is some

evidence to indicate that some species in this family may also possess Hb proteins. This

evidence, however, is principally restricted to a single report of this observation (Rawat,

2010) with no molecular or biochemical studies reported to date. It is plausible to

hypothesise that Limidae indeed possess Hb proteins based on their high metabolic rate

associated with the ability to swim and the red pigmentation of their tissues (Baldwin & Lee,

1978; Harper & Skelton, 1993; Mikkelsen & Bieler, 2003). If present, Hb could represent an

important physiological advantage for a more efficient oxygen delivery system to respiring

tissues during swimming. Consequently, if Hb were found in Limidae, then this would


constitute a fifth independent origin of Hb in bivalve molluscs. This represents a key

knowledge gap which will be addressed in this thesis.


Figure 1.5 Phylogenetic classification of class Bivalvia of molluscs. The main bivalve subclasses are

represented here in different colours: Protobranchia, Pteriomorpha, Palaeoheterodonta, Archiheterodonta,

Anomalodesmata and Imparidenta. This basic phylogeny demonstrates the distribution of Hb (indicated as Hb

following species and order name) and Hc (indicated as Hc) among bivalve taxa and the order of the species in

which those respiratory pigments are found is indicated in grey brackets: Solemyoida, Nuculanoida, Arcoida,

Carditoida and Veneroida. Adapted from (Gonzáles et al., 2015).


1.3.1 Haemoglobins in the family Arcidae, Pteriomorphia subclass

The bivalve family Arcidae, also referred to as the blood clams, are unusual in

comparison to most bivalve species as they possess haemolymph which has a deep red

coloration attributed to its circulating erythrocytes (Mangum, 1998). These erythrocytes

contain multiple Hbs; which are often dimeric (~ 32 kDa) and tetrameric (~ 65 kDa) (Como &

Thompson, 1980b; Furuta & Kajita, 1983; Suzuki et al., 2000), with the exception of a 430 kDa

polymeric Hb found in some members of the Barbatia genus, such as B. reeveana and B. lima

(Grinich & Terwilliger, 1980; Suzuki & Arita, 1995). Dimeric Hbs in the Arcidae exhibit further

structural complexity and can be homo-dimeric or hetero-dimeric (Furuta & Kajita, 1983; Mann

et al., 1986; Suzuki et al., 1992). In some species, such as blood cockles (Anadara trapezia and

Scapharca inaequivalvis), multiple homo-dimeric Hbs have been found circulating in

erythrocytes at the same time (O’Gower & Nicol, 1968; Fisher et al., 1984; Ronda et al., 2013).

The tetrameric Hbs in Arcidae are formed from two different subunits in an alpha2beta2

(α2β2) arrangement, analogous to the vertebrate Hb (Ronda et al., 2013). The α and β globin

chains in these species range from ~ 145 to 165 amino acids in length (Mann et al., 1986; Suzuki

et al., 1996). Both the dimeric and tetrameric Hbs show different pairing of their helices to the

canonical arrangement seen in vertebrate Hbs (Ronda et al., 2013). Specifically, the E and F

helices show subunit pairing, with the G and H helices on the outside of the quaternary structure,

creating a back-to-front formation when compared to vertebrate Hb (Vinogradov, 1985). Figure

1.6 illustrates the comparison of the E and F helical arrangement of the human and S.

inaequivalvis Hb. This back-to-front structural arrangement is common to all invertebrate Hbs

for which crystal structures have been resolved (Royer et al., 2005). This structural variation is

also considered to provide evidence to suggest that arcid Hb proteins are a result of convergent

evolution with vertebrate (Royer et al., 2005).


Figure 1.6. Quaternary assembly of Homo sapiens and Scapharca inaequivalvis Hbs. (a) HbA refers to adult Hb

in H. sapiens; (b) HbII refers to hetero-tetrameric arcid Hb in S.inaequivalis and (c) HbI refers to homo-dimeric

arcid Hb in S.inaequivalis. For each Hb structure represented here, haeme groups are shown in red, α (alpha)

subunits are shown in dark grey, β (beta) subunits are shown in light grey and E and F helices are shown in blue.

This illustrates the diversity of structures found in arcid Hbs with a heterotetramer (b) and a homodimer (c),

both found in S.inaequivalis. It also shows the back to front assembly of the arcid Hbs with E and F helices

arranging on the outside of the molecule compare to human Hb. (Ronda et al., 2013).

Based on the current literature, protein sequences have been more extensively studied in

comparison to the underlying genetic variation. Currently, most of the information regarding the

genes encoding Hb proteins in Arcidae has been generated in studies which utilised small scale

cDNA sequencing (Suzuki & Arita, 1995; Piro et al., 1996; Suzuki et al., 2000). This

sequencing has demonstrated that the majority of species examined most frequently have two to

three Hb encoding genes. For example, Tegillarca granosa contains three different Hb genes; α

and β encoding genes of the tetrameric Hb and a minor globin gene encoding the homo-dimeric

Hb (Bao et al., 2013a). S.inaequivalvis also expresses three homologous Hb genes (α, β and

minor) (Piro et al., 1996; Piro et al., 1998). Interestingly, these three genes have the same

exon/intron structure seen in vertebrate Hb genes, consisting of three exons and two introns (Piro

et al., 1996). Unlike in the previous two examples, B. lima expresses four distinct Hb genes

which encode a minor homo-dimeric globin (delta (δ)), a hetero-tetramer (α and β) and a

polymeric globin (2D) (Suzuki et al., 1996). The 2D gene is a di-domain globin and is thought

to have resulted from a duplication of delta gene, producing two consecutive domains within

a gene due to the loss of a stop codon (Suzuki et al., 1996). While these studies capture some of

the diversity of Arcidae Hb genes, they are principally based on previous protein evidence. There

Homo sapiens HbA Scapharca inaequivalis HbII Scapharca inaequivalis HbI


is a need for a systematic evaluation of diversity at the sequence level of all expressed Hb genes

in this group of organisms.

In arcid bivalves, there is preliminary evidence to suggest that some duplicated Hb

encoding genes may have taken on new functions. For example, in T. granosa molecular

analysis has revealed that some Hb encoding genes may play a role in immune response to

bacterial pathogens (Bao et al., 2013b). In this instance, single nucleotide polymorphisms

identified in α and β Hb encoding genes (HbIIA and HbIIB) showed an association with

resistance to pathogenic bacteria Vibrio parahaemolyticus (Bao et al., 2013b). In addition to

this example of neofunctionalisation, there is also some evidence that duplicated Hb genes in

some bivalves show tissue specific expression (Burmester et al., 2000), although, this has

only been reported for species outside of the Arcidae. Some authors speculate that the

diversity of globin genes in Arcidae may have contributed to the capacity of these organisms

to persist in anoxic or intertidal environments (Terwilliger et al., 1978; Alyakrinskaya, 2002).

While these studies are few and speculative, further investigation is needed to determine the

extent of gene duplication within a single species and if the duplicated genes have undergone

neofunctionalisation. Assessment of expression levels of Hb genes across different tissues

under experimental perturbations (e.g., hypoxic versus normoxic abiotic stress) would allow

identification and quantification of potentially new function in these genes.

A.trapezia was the first arcid species to have its Hb proteins isolated and characterised.

Early work by Nicol & O’Gower (1967) identified the presence of multiple circulating Hbs

including a tetrameric (HbI) with an α2β2 configuration and two homo-dimeric Hbs (HbIIa

and HbIIb). The homo-dimeric forms appear to be allelic variants of the same gene as they are

in Hardy-Weinberg equilibrium within populations (O’Gower & Nicol, 1968; Como &

Thompson, 1980b; Mann et al., 1986). One of the genes that encodes the β subunit of the

tetrameric Hb (HbI) has been fully characterised (At & Eo, 1984), however, the complete gene

sequence for the two homo-dimeric variants and the α subunit of the tetramer have not.

Interestingly, another Hb gene encoding a minor Hb, possibly seen as a ghost band by

O’Gower & Nicol (1968), has been characterised fully in A. trapezia (Titchen et al., 1991).

Based on this protein and DNA evidence, it appears that, at least, four different Hb genes are

present in this species. Despite this significant early work on Hb in A. trapezia, there have

been numerous inconsistencies regarding the nomenclature of the Hb proteins, and

corresponding genes (if at all characterised). In addition to this limitation, it remains unsure


whether the DNA and protein sequences reported for A. trapezia represent the complete

repertoire of Hb encoding genes in this species. This makes inferences about the evolution of

Hb in bivalves difficult and highlights the need for a systematic evaluation of the Hb genes in

A. trapezia and arcids in general. Significantly, even less is known about the functional

diversification of this gene family demonstrating the requirement for further functional

genomic interrogation of Hb genes in the Arcidae. This paucity of information represents a

key knowledge gap which will be addressed in this thesis.

1.4 Aims

The overarching aim of this study is to expand our understanding of the evolution of

haemoglobin (Hb) encoding genes, one of the most important gene families in the metazoan

tree of life. Specifically, this thesis aims to address the lack of information regarding the

distribution of Hb genes in bivalves and investigate potential evidence of

neofunctionalisation in duplicated Hb genes of Arcidae bivalves. In order to address these

aims, the thesis will consist of two main objectives each with its own hypothesis. These

include:

• Objective 1

o H1 – Duplicated Hb genes in Anadara trapezia, a member of the Arcidae

family, show tissue specific expression patterns and therefore evidence of

neofunctionalisation.

This hypothesis will be tested by interrogating the recently published whole

organism transcriptome of A. trapezia for all expressed copies of Hb genes and their

expression measured across multiple tissues using quantitative Polymerase Chain Reaction

(qPCR) techniques.

• Objective 2

o H1 – Bivalve Ctenoides ales, a member of the Limidae family, expresses Hb

encoding genes and therefore provides evidence of a fifth independent origin

of Hb in bivalve molluscs.

The hypothesis in objective 2 will be tested by sequencing the expressed portion of

the C. ales’ genome for presence of Hb encoding genes. Whole organism transcriptome will


be generated, sequenced utilizing high throughput sequencing techniques and

bioinformatically interrogated for evidence of Hb expression.

1.5 Thesis Outline

Thesis presented here includes four main chapters, consisting of an introductory literature

review (chapter 1), followed by two studies each described within their individual chapter

(chapters 2 and 3). Final section of the thesis is the general discussion (chapter 4).

• Chapter 1

The first chapter is a literature review which highlights the current understanding of

vertebrate and invertebrate haemoglobins (Hb), focusing on their vast structural diversity and

evolution. This section also explores evolution by gene duplication and discusses divergent

and convergent evolution. In addition, it focuses on invertebrate Hbs and more specifically

bivalves in light of the topic for this study.

• Chapter 2

This is the first data chapter which addresses Objective 1. It provides an overview of

duplicated Hb genes in Arcidae bivalves and highlights the knowledge gap in our

understanding of the evolutionary innovation through neofunctionalisation of these genes.

The chapter provides detailed methodological information on the measurement of tissue

specific expression of candidate Hb genes in A. trapezia and interpretation of the results.

Findings of this study are interpreted in detail in discussion.

• Chapter 3

Second data chapter which addresses Objective 2, describes the interrogation of the

transcriptome of C. ales for presence of Hb encoding genes. Methodology section in this

chapter concerns the isolation, sequencing and bioinformatics interrogation of the C. ales

transcriptome. Results present the detailed outcomes of this interrogation and describe the

transcriptional profile this species as well as the relevant candidate genes, followed by

detailed discussion.


• Chapter 4

In the fourth chapter, the overall outcomes of the project are discussed in context of the

current body of work relating to evolution of bivalve Hbs. Interrogation of the results is

extended to encompass a discussion on the limitations of the study and potential applications

of the outcomes reported in this thesis.


Chapter 2: Tissue specificity and neofunctionalisation of haemoglobin

genes in Anadara trapezia

2.1 Background

Haemoglobins (Hbs) are among the best studied proteins in vertebrates but little is

known about their distribution, function and evolution in invertebrate lineages

(Alyakrinskaya, 2002; Bao et al., 2013a). A number of invertebrate lineages have

independently evolved circulating Hbs as a mechanism to transport O2 for cellular respiration

(Mangum et al., 1975). Invertebrate lineages that have independently evolved circulating

Hbs include some arthropods, some annelids and the Arcid bivalves (Terwilliger, 1998;

Weber & Vinogradov, 2001; Wajcman et al., 2009).

The Arcid bivalves are an interesting group of intertidal mollusc species known as

blood clams. This group displays a diversity of Hb proteins with monomeric, dimeric,

tetrameric and polymeric protein forms (Terwilliger, 1980; Royer et al., 1985; Weber &

Vinogradov, 2001). In fact, the presence of multiple Hb proteins in circulating erythrocytes

was first observed in the Australian blood clam, Anadara trapezia by Nicol & O’Gower

(1967). This study revealed the presence of at least three distinct proteins in this species, two

homodimers and one tetramer, while protein sequencing indicated that at least two

duplication events produced these proteins (Suzuki et al., 1996). Having such a variety of Hb

genes may allow these organisms to survive in the intertidal zone and endure long periods

submerged or exposed to air. A clinal pattern of allele frequencies has also been observed for

the homo-dimer Hb gene in A. trapezia, which the authors hypothesised was associated with

changes in environmental variables including temperature and salinity (O’Gower & Nicol,

1968).

The large number and variation in blood clam Hb proteins is thought to be the result

of repeated rounds of gene duplications but the exact function of these diverse Hb proteins

remains unclear. Current data suggests that blood clam Hbs evolved from an ancestral

mollusc globin gene which, following the divergence of the blood clam ancestor underwent

repeated rounds of lineage specific gene duplication in different blood clam lineages (Riggs,

1991). More recent transcriptome data for A. trapezia (Prentis & Pavasovic, 2014) has

22 Chapter 2: Tissue specificity of haemoglobin genes in Anadara trapezia

identified seven full length and genetically distinct Hb genes in this single species and

indicates that gene duplication may have been more extensive than previously reported.

The Hbs used in this study are HbI, a tetramer made up of α and β subunits encoded

by the genes AG (alpha globin) and BG (beta globin); HbII, a homo-dimer molecule encoded

by the HD gene, a hetero-dimer Hb encoded by the gene HB and a putative dimer Hb

encoded by the gene 2D. These genes were used for this study as they encode structurally

distinct proteins including a homo-dimeric and tetrameric Hb proteins. It is postulated that

these different Hbs may show distinct patterns of tissue specific or environment specific gene

expression. Consequently, differences in their patterns of expression were tested across five

tissues, that could be dissected distinctly and where Hbs where most likely to play a role,

(haemolymph, foot, gills, mantle and muscle) in four different experimental treatments to

determine if they showed tissue specific or environment specific gene expression.

2.2 Material and Methods

2.2.1 Sample acquisition and tissue dissection

Anadara trapezia specimens were collected from the intertidal zone in Wynnum,

Queensland, Australia (27°26'08.7"S 153°10'25.0"E) and transferred to holding tanks at

QUT Marine Lab facility until required for experimentation. All animals were collected

under the general fisheries permit number 166312. Ethics approval was not required since

the specimens do not qualify as animals as described by the Queensland Animal Care and

Protection Act 2001 (ACPA). Water conditions during the acclimation period of bivalves

were as follows: water salinity 30-35 ppt, pH 7.9-8.1, temperature 20-25 °C and ammonia

levels (< 0.1 mg/L). A 12 h light/dark cycle was also maintained in the tanks and the animals

were kept unfed for one week prior to the start of the experiment.

To best capture the variation in Hb expression, tissues were extracted from

individual animals submerged in seawater, as well as animals undergoing aerial exposure in

a moist tank (as experienced during periods of regular and prolonged low-tide).

Consequently, animals used for tissue dissection consisted of 12 individuals collected at six

hours (n = 6), six control animals submerged in water and six animals from a moist tank.

This was repeated at 12 hours (n = 6 for both treatments). In total, 24 A. trapezia individuals

had following five specific tissues removed and used for analysis: haemolymph, mantle,

muscle, gills and foot (Figure 2.1). A few microlitres of fresh haemolymph from each animal

Chapter 2: Tissue specificity of haemoglobin genes in Anadara trapezia 23

was used to conduct analysis to measure pH, pCO2 and sO2 % using Abbott i-STAT blood

analysers. Haemolymph samples were spun at 10,000 rpm for 3 min, supernatant removed

and RNA was extracted immediately. Tissue samples were snap frozen in liquid N2.

Figure 2.1 Photograph of an A. trapezia specimen illustrating the anatomical position of all five tissues used to

assess tissue specific expression of Hb genes in this study.

2.2.2 RNA extraction and cDNA synthesis

RNA was extracted from each tissue separately using Mollusc RNA extraction kit

from Omega Biotek, following its longest protocol. Specifically, tissues were ground in

liquid N2 and the fine powder obtained was transferred into 1.5 mL microcentrifuge tubes.

These were rapidly brought to a fume hood and 350 µL of MRL buffer provided in the kit

was added and vortexed. Three hundred and fifty µL of a 24:1 solution of

chloroform:isopropanol freshly made were then added to each tube, vortexed mix and placed

in a centrifuge for 2 min at 10,000 x g. The upper aqueous phase of each tube was carefully

removed and transferred to clean 1.5 mL microcentrifuge tubes. One volume of isopropanol

was added to each tube with the upper aqueous phase, vortexed and immediately centrifuged

for 2 min at 10,000 x g. Supernatant was carefully aspirated and tubes were briefly inverted

over a paper towel to remove any residual liquid. RB buffer (100 µL) provided in the kit was

then added to each tube, vortexed to re-suspend the pellets and briefly incubated in water

baths at 65 °C to elute RNA. Another 350 µL of RB buffer and 100 µL of 100 % EtOH was


added to each tube and vortexed. The entire samples were then transferred into a HiBind®

RNA (Omega Biotek) mini column inside a 2 mL collection tube for washing and elution.

Samples were first centrifuged for 1 min at 10, 000 x g and filtrates were discarded. Five

hundred µL of RNA Wash Buffer I provided in the kit was added to the mini column and

tubes were centrifuged for 1 min at 10,000 x g. Filtrates were discarded and 500 µL of Wash

Buffer II provided in the kit was added to the mini columns and centrifuged for 1 min at

10,000 x g. Filtrates were discarded and another wash step was done with Wash Buffer II.

All samples were then centrifuged for 2 min at max speed to dry the columns. These were

then transferred to clean 1.5 mL microcentrifuge tubes for elution. Fifty µL of DEPC

(Diethylpyrocarbonate) water provided in the kit was added to each tube and samples were

centrifuged for 2 min at maximum speed and eluted RNA samples were stored at -70 °C.

cDNA synthesis was performed using the SensiFASTTM cDNA Synthesis Kit (Bioline)

following the manufacturer’s protocol. cDNA synthesis was performed in a total volume of

50 µL (20 µL water, 20 µL total RNA, 8 µL 5xTransAmp buffer and 2 µL reverse

transcriptase) with the following cycling conditions: 1 cycle at 25 °C for 10 min, 1 cycle at

42 °C for 60 min, 1 cycle at 85 °C for 5 min and a hold step at 4 °C. The cDNA was used for

all PCR reactions in downstream analysis.

2.2.3 RT–PCR (Real Time PCR)

Five candidate globin genes: putative dimer (2D), α chain (AG), homo-dimer (HB),

hetero-dimer (HD) and β chain (BG) previously identified were amplified in each sample by

using primers designed to amplify the entire Open reading frame (ORF) based on

transcriptomic data from A. trapezia (Prentis & Pavasovic, 2014) (Table 2.1). Polymerase

chain reaction amplification was then performed to determine the presence or absence of

each of the five genes in the different tissue samples using the following conditions: initial

denaturation for 3 min at 94 °C and 30 cycles of 30 sec at 94 °C, 30 sec at 52 °C and 1 min at

72 °C followed by one cycle of 5 min at 72 °C and a hold step at 4 °C. Amplicons were

separated by electrophoresis on a 1.5 % agarose gel and stained with GelRedTM (Biotum).

The intensity of PCR products was determined using an image analysis program assisted by a

gel documentation system (Chemidoc XRS, Bio-Rad). Some of these PCR products were

also used for candidate gene validation through sequencing.


Table 2.1 List of primers designed to amplify products of candidate globin genes identified in the bivalve

species A. trapezia using RT-PCR. All primers were designed to amplify the entire ORF of each gene with

product sizes between 350 bp and 619 bp (Prentis & Pavasovic, 2014).

Gene Primer Name Primer Sequence Product size (bp)

AG (Alpha chain) AGORF CGAGTCCGATTTATTGCTGA 545 AGORR TGTCAAACGAGACAGGTCCA

BG (Beta chain) BGORF TAATGCAGCCTGGACAACAG 501 BGORR TTTGTTGTAGACGCCCTTTG

HB (Homo-dimer) HBORF TTGTCACCTCCAGTCTGTCG 618 HBORR ACGCTACCCTGGTGATTGTC

2D (Putative dimer) 2DORF CGAAACCCAAGTCCATCAT 506 2DORR ATCCCTCACAGAGTGCTGCT

HD (Hetero-dimer)

HDORF ATCTGACGGAAGCAGACG 515 HDORR CGCGAGGTAGTGATATCGAA

2.2.4 Candidate gene validation

Amplicons from two samples were purified using the Bioline isolate PCR purification

kit followed by cloning using the pGEM®-T and pGEM®-T Easy (Promega) vector systems

quick protocol. Duplicate samples for each gene in each biological replicate were selected and

sequenced on the ABI Genetic Analyzer 3500 (ThermoFisher). Sequences obtained were

imported into the Geneious® software version 8.1.6 for visualization and comparison to the de

novo assembled contigs from the A. trapezia annotation report using a pairwise global

alignment. Sequences were aligned to the contig they were designed from to determine

percentage nucleotide similarity.

2.2.5 RT-qPCR (Real Time quantitative PCR) for quantification of gene expression

RT-qPCR was performed on each sample using the One-Step Real Time PCR kit

(Roche) and short primers designed based on past analysis of transcriptomic data from A.

trapezia (Prentis & Pavasovic, 2014) (Table 2.2). These reactions were performed using the

Lightcycler®480 real-time PCR system (Roche), measuring specific fluorescence at each

cycle and quantifying the initial levels of mRNA for each Hb gene in each tissue. The PCR


reactions were performed using the following conditions: 1 cycle of 5 min at 95 °C and 45

cycles of 10 sec at 95 °C, 10 sec at 60 °C and 10 sec at 72 °C. All quantitative PCR

analyses were repeated in three technical replicates to determine the validity of results

along with negative controls for each gene in each sample and 18S as a house keeping control

gene.

Table 2.2 List of primers designed to amplify products of globin genes identified in the bivalve species A.

trapezia using RT–qPCR and determine their expression levels in different tissues. All primers are designed to

amplify products with sizes between 109 bp and 148 bp. (Prentis & Pavasovic, 2014).

Gene Primer Name Primer Sequence Product size (bp)

AG (Alpha chain) AGF TGATGACCCATCCAGATTGA 117

AGR TTCAGGGTCTCCTTCATTGG

BG (Beta chain) BGF TGTCGAGAGCATCGATGAAG 109

BGR AAATTCGCTCGTCTTGGAGA

HB (Homo-dimer) HBF GCTGTCAACCACATCACCAG 139

HBR CCTGGACAACGCCTACAAGT

2D (Putative dimer) 2DF ATCCGACCCATGGAATAACA 114

2DR CGTGCAACATCTTCCAAGTC

HD (Hetero-dimer) HDF AAGGGACATGCCACAACATT 148

HDR CTCCGAGTGCCTGAAATTCT

18S 18F CGGCGACGTATCTTTCAAAT 136

18R CTTGGATGTGGTAGCCGTTT

2.2.6 RT-qPCR data analysis

RT-qPCR data was exported and viewed in the Lightcycler96 software associated with

the instrument. Relative quantification analysis was performed using the analysis function of

the Lightcycler96 software based on the ∆∆CT method. In this method, the housekeeping

gene provides a basis for comparing levels of target sequences to levels of reference

sequences and the final result is expressed as a relative ratio. These relative ratio values were

exported into Microsoft Excel version 14.0 to be converted to a format compatible with the

program SPSS (Statistical Package for the Social Science) used for statistical analysis. In this

program, significance of results was assessed through ANOVA testing followed by Tukey’s

post-hoc test and differences were considered significant at p < 0.05. Firstly, to assess levels

of target genes in each tissue, ratio values were used as a dependent variable against tissue

type for each gene. Secondly, significant differences in expression among conditions (water

or air 6 hours and 12 hours) were assessed in the same way with ratio values as a dependent


variable and condition as factor. Due to very low relative ratio values, the following formula

was applied to each value and plotted in SPSS: (-1/log (relative ratio)).

2.3 Results

2.3.1 Haemolymph analysis

Haemolymph analysis results obtained from iSTAT are summarised in Figure 2.2.

Haemolymph pH measurements ranged from 6.7 to 7.2 across the treatment groups with

significant differences among samples exposed to air for 12 h and samples in water for 6 h

and 12 h. Oxygen saturation measurements ranged from 24 to 89 % with significant

differences (p < 0.05) between the two time points of aerial exposure at 6 h and 12 h. Figure

2.2 shows a drop of nearly 30 % for oxygen bound to Hb molecules among samples kept in

water for 6 h and samples exposed to air for 6 h. Measurements for pCO2 ranged from 8.9 to

20.9. Values in water 6 h, air 6 h and water 12 h were relatively consistent across treatments,

however, measurements for samples exposed to air for 12 h fluctuated significantly with

values between 10.4 and 20.9. Similar values were observed for samples in water for 6 h and

in water for 12 h, but there is a slight increase in pCO2 in samples exposed to air for 6 h and a

large increase samples exposed to air for 12 h, showing a gradual build-up of CO2 in the

haemolymph of those animals.


Figure 2.2 Summary of haemolymph analysis results. This data was obtained by testing a few microliters of

fresh haemolymph using and Abbott i-STAT blood analyser. This was done for all haemolymph samples across

two conditions of experiment and two timepoints: water 6 h, air 6 h, water 12 h and air 12 h. A) pH

measurements, B) percentage of O2 saturation, C) partial pressure of CO2. Significant differences were assessed

through ANOVA testing using the program SPSS with pH values, percentage of O2 saturation values and pCO2

values as dependent variables respectively. Condition was used as a factor for each test and results were

considered statistically significant at p < 0.05. Statistically different groups are represented by the symbols (*)

and (•) in each graph and error bars represent 2 standard errors around the mean.

A

C

B

• •

•

*

*

A B

C Variation of partial pressure of CO2 across conditions

Mea

n pC

O2

Variation of sO2 % across conditions

C

Mea

n sO

2 %

Mea

n pH

Variation of pH across conditions

*

*

• •

• •


2.3.2 RT-PCR

RT-PCR results are summarised in Table 2.3. Results for the HD gene have been

removed here as it could not be validated. In haemolymph, all genes were amplified in all

samples. For foot samples, BG and HB were amplified in all samples, AG was amplified in

23 out of 24 samples, 2D was amplified in 14 out of 24 samples. Low amplification results

for foot samples overall may be due to low yields of RNA obtained for this tissues. In gill

samples, 2D, AG and BG were amplified in at least 21 out of 24 samples and HB was

amplified in 20 samples. In mantle, all five genes were amplified in at least 22 out of 24

samples. In muscle samples, AG, BG and HB were amplified in all 24 samples and 2D in 21

samples. Overall, all four genes tested here are found in all tissues but their expression was

significantly higher in the haemolymph while in the other tissues tested their expression was

minor. Inconsistencies with RT-qPCR results in section 2.3.4 may be due to RNA

degradation in some of those samples or failed amplifications during RT-PCR.

Table 2.3 RT- PCR results summary for tissue specific expression. All five genes (2D, AG, BG, HB and HD)

have been amplified in six biological replicates for each tissue and each condition. To summarise the results, in

this table, a score is given out of 6 (total number of biological replicates) for each candidate gene amplified in

each tissue and in each condition. An asterix * represents weak bands obtained on gel electrophoresis for at

least 2 biological replicates out of 6 in that group.

Tissue

Candidate globin genes

Water 6 h Air 6 h Water 12 h Air 12 h

Haemolymph

2D 6 6 6 6 AG 6 6 6 6 BG 6 6 6 6 HB 6 6 6 6

Foot

2D 4 4 5 1 AG 6 5 6* 6 BG 6 6 6 6 HB 6 6 6 6

Gills

2D 6 6 6 5 AG 5 6 5 5 BG 5 6 5 5 HB 5* 6* 4* 5*

Mantle

2D 5 6* 5 6 AG 6 6 5 6 BG 6 6 5 6 HB 6 6 5 6

Muscle

2D 6 6 6 4 AG 6 6 6 6 BG 6 6 6 6 HB 6 6 6 6


2.3.3 Candidate gene validation

Figure 2.3 shows PCR products for all candidate genes used in sequencing for

validation. Following Sanger sequencing, alignments of amplified sequences showed 100 %

similarity with the original candidate ORFs for 2D, AG, BG and HB, while HD did not show

the correct sequence and therefore was not validated.

Figure 2.3. PCR products amplified from two mantle samples to validate candidate Hb genes. Amplified PCR

products obtained here were purified using the Bioline isolate PCR purification kit followed by cloning using

the Promega pGEM-T and pGEM-T easy vector systems quick protocol. Samples were then sequenced on

the ABI Genetic Analyzer 3500 in duplicate. Each gel of this figure represents one mantle sample. For both

gels A (sample 1) and B (sample 2): lane 1 contains 100 bp Hyperladder, lane 2 through to 7 contain amplified

products for 2D, AG, BG, HB, HD and 18S genes respectively.

2.3.4 RT-qPCR for quantification of gene expression

RT-qPCR results revealed that 2D, AG and BG had significantly higher expression

levels (p < 0.05) in haemolymph compared to other tissues (Figure 2.4). In the case of HB,

there were no significant differences (p > 0.05) in expression levels across tissues with

overall lower expression than the other genes tested. These results are consistent with

amplification curves for target genes and for the housekeeping gene 18S as shown in Figure

2.5. In haemolymph, fluorescence is first detected in cycle 12 and this first cluster represents

amplification curves for 2D, AG and BG. The second cluster of amplification curves begins

at cycle 32 and represents HB expression. This difference is also observed across all tissues

in relative expression of 2D, AG and BG compared to HB as seen in Figure 2.4.

Amplification curves for foot, mantle and muscle follow a similar pattern with fluorescence

detected at cycle 20 for 2D, AG, BG (first cluster) and at cycle 26 for HB (second cluster).

The housekeeping gene 18S used in all PCR runs was consistently detected at cycle 8, across

A B


all tissues. Relative expression levels showed no significant differences between air or water

exposed samples (Figure 2.6).

Figure 2.4. Relative expression ratios of candidate globin genes amplified using RT-qPCR. Candidate genes

amplified in each tissue from the bivalve A.trapezia are represented as follows: 2D, AG, BG and HB. Relative

quantification analysis was performed using the ∆∆CT method. Relative expression is expressed as a ratio of

levels of target sequences to levels of reference sequences with 18S used here as a housekeeping gene.

Significant differences were assessed through ANOVA testing using the program SPSS and differences were

considered statistically significant at p < 0.05. Significantly different groups are shown here with an asterix (*).

Ratio values were used as a dependent variable against tissue type for each gene. Error bars represent 2

standard errors around the mean.

Relative expression of 2D across tissues Relative expression of AG across tissues

p < 0.05

Relative expression of BG across tissues Relative expression of HB across tissues

p < 0.05

p < 0.05


Figure 2.5. Examples of amplification curves obtained for target genes (2D, AG, BG, HB) and housekeeping

gene 18S in each tissue type. Target amplification curves are represented in orange (left), negative controls in

green (left) and reference amplification curves in blue (right). RT-qPCR was performed using a Lightcycler®

measuring specific fluorescence at each cycle. All quantitative PCR analyses were repeated in three technical

replicates along with negative controls and 18S as a housekeeping gene.

0.350 0.300 0.250 0.200 0.150 0.100 0.050

0.350 0.300 0.250 0.200 0.150 0.100 0 050

Fluo

resc

ence

Fluo

resc

ence

5 10 15 20 25 30 35 40 45 Cycle

5 10 15 20 25 30 35 40 45 Cycle

0.360

0.300

0.240

0.180

0.120

0.060

Fluo

resc

ence

5 10 15 20 25 30 35 40 45 Cycle

Fluo

resc

ence

0.600

0.500

0.400

0.300

0.200

0.100

5 10 15 20 25 30 35 40 45 Cycle

5 10 15 20 25 30 35 40 45 Cycle

Fluo

resc

ence

0.500

0.400

0.300

0.200

0.100

Fluo

resc

ence

0.720 0.600 0.480 0.360 0.240 0.120

5 10 15 20 25 30 35 40 45 Cycle

5 10 15 20 25 30 35 40 45 Cycle

Fluo

resc

ence

0.700 0.600 0.500 0.400 0.300 0.200 0.100

Fluo

resc

ence

5 10 15 20 25 30 35 40 45 Cycle

Fluo

resc

ence

0.600

0.500

0.400

0.300

0.200

0.100

5 10 15 20 25 30 35 40 45 Cycle

Fluo

resc

ence

0.720 0.600 0.480 0.360 0.240 0.120

0.500

0.400

0.300

0.200

0.100

5 10 15 20 25 30 35 40 45 Cycle

Haemolymph

Foot

Gills

Mantle

Muscle


Figure 2.6. Relative expression of candidate globin genes in A. trapezia amplified using RT-qPCR. Relative

quantification analysis was performed using the ∆∆CT method. Relative expression is shown as a ratio of levels

of target sequences to 18S sequences, used here as a housekeeping gene. Significant differences (p < 0.05) were

assessed through ANOVA testing using SPSS with ratio values as dependent variable, condition as factor in

each tissue. No statistical differences were found here. Error bars represent 2 standard errors around the mean.

Relative expression of all genes across conditions in haemolymph

Rela

tive

expr

essi

on

2.50

2.00

1.50

1.00

0.50

0.00

2.50

2.00

1.50

1.00

0.50

0.00

Rela

tive

expr

essi

on

2.50

2.00

1.50

1.00

0.50

0.00

Rela

tive

expr

essi

on

2.50

2.00

1.50

1.00

0.50

0.00

Rela

tive

expr

essi

on

2.50

2.00

1.50

1.00

0.50

0.00

Rela

tive

expr

essi

on

2D AG BG HB

Gene

2D AG BG HB

2D AG BG HB

2D AG BG HB

2D AG BG HB

Gene

Gene

Gene

Gene

Relative expression of all genes across conditions in foot

Relative expression of all genes across conditions in gills Relative expression of all genes across conditions in mantle

Relative expression of all genes across conditions in muscle

Water 6h Air 6h Water 12h Air 12h Condition

Water 6h Air 6h Water 12h Air 12h Condition

Water 6h Air 6h Water 12h Air 12h Condition Water 6h Air 6h Water 12h Air 12h

Water 6h Air 6h Water 12h Air 12h

Condition

Condition


2.4 Discussion

In this study, the expression of Hb encoding genes was examined (2D, AG, BG and

HB) across different tissues and environmental conditions, in A. trapezia, in order to

determine if these genes show patterns of expression consistent with neofunctionalisation.

Based on these findings, three Hb encoding genes appear to be predominantly expressed in

the haemolymph. This pattern was observed to be consistent across the two environmental

conditions tested (submersion and aerial exposure). Physico-chemical properties of the

haemolymph, however, indicated that major physiological changes are occurring in the

haemolymph without major changes in expression of Hb genes.

2.4.1 Haemolymph characteristics

Haemolymph analysis was performed in order to gain insights on the state of Hb

molecules and gas exchange throughout the experiment. pH values remained constant in

animals kept in water for 6 h and 12 h. However, animals exposed to air for 6 h (pH= 7.2)

showed a slight drop in pH and a significant drop was observed in animals exposed to air for

12 h (pH= 6.9). This finding is consistent with observations in another bivalve species

(Crassostrea gigas) (Michaelidis et al., 2005). This is an interesting physiological response

as C. gigas does not have a circulating respiratory pigment and this therefore suggests that

these changes may be independent of Hb in the haemolymph. The drop in pH and increase in

pCO2 in animals exposed to air for 6 h was not statistically significant (p > 0.05), however,

this may be due to the fact that A. trapezia is typically exposed to six hours (high to low) tide

cycles. Consequently, the animals may still be consuming their oxygen stores and relying on

aerobic metabolism (Booth et al., 1984).

The observed significant decline in pH is consistent with the increase in pCO2 in

animals under prolonged aerial exposure (12 h), and may be explained by a shift of the

organism from aerobic metabolism to anaerobic metabolism, an adaptation to hypoxia

widespread among bivalves (Brooks et al., 1991; De Zwann et al., 1993). This is well

supported in literature on marine bivalves, where a large number of studies have shown that

hypoxia causes pCO2 to rise in the haemolymph due to the accumulation of CO2 as an

anaerobic by-product, leading to acidification of body fluids and a drop in pH levels

(Crenshaw & Neff, 1969; Jokumsen & Fyhn, 1982; De Zwann et al., 1983; Booth et al.,


1984; Michaelidis et al., 2005; Shumway & Parsons, 2011). This gradual switch from

aerobic to partial or complete anaerobic metabolism upon prolonged air exposure is

documented in bivalves such as the deep-sea clam (Calyptogena magnifica) (Hourdez &

Lallier, 2006) and the sea mussel (Mytilus edulis). Another study on the intertidal lugworm

Arenicola marina (Booth et al., 1984; Toulmond & Tchernigovtzeff, 1984; Wang &

Widdows, 1991), which is known for its ability to rapidly acclimate to restricted O2

availability in its habitat, reinforces this finding and reports that acidosis was also found to be

coupled with a rise in pCO2 as a result of decreased gas exchange during low tide (Toulmond

& Tchernigovtzeff, 1984). Moreover, from results in this study, globins present in the

haemolymph of A. trapezia do not seem to show a Bohr effect unlike Hbs found in teleost

fish species (Souza & Bonilla-Rodiguez, 2007; Witeska, 2013). The saturation of oxygen

appears independent of pH as a significant drop in pH is coupled with a significant increase

in sO2 % for animals exposed to air for 12 h. This is consistent with previous studies on Hb

containing bivalves such as Barbatia reeveeana (Grinich & Terwilliger, 1980), Cardita

floridana (Manwell, 1963) and Anadara broughtonii (Furuta & Kajita, 1983) for which no

Bohr effect was observed.

2.4.2 Tissue specific expression and neofunctionalisation

It is now widely accepted that invertebrate Hbs are understudied, particularly in

reference to their evolution, distribution and functions (Alyakrinskaya, 2002; Bao et al.,

2013a). In an attempt to address this knowledge gap, a quantitative investigation of Hb

encoding genes was performed across five different tissues in A. trapezia individuals

undergoing aerial exposure. A. trapezia is particularly suited to examine neofunctionalisation

of Hb genes as it expresses multiple different Hb genes (Como & Thompson, 1980b) and is

commonly under abiotic stress due to aerial exposure during tidal cycles (Davenport &

Wong, 1986). A. trapezia, like most bivalves, possesses an open circulatory system where

surface areas for O2 uptake are composed of a pair of gills and mantle tissue anchored to the

shell (Herreid, 1980).

While strong patterns of differential expression across tissues were observed, there was

no evidence to support any changes in expression differences across environmental

conditions. This may indicate that these genes have similar functions under environmental

stress. Alternatively, the aerial exposure in this experiment mimics a tidal cycle at 6 h and a


prolonged period of 12 h, the absence of significant differences (p > 0.05) in expression

levels of Hb encoding genes during air exposure may indicate that multiple Hbs maximise O2

binding and supply during times of hypoxia (Projecto-Garcia et al., 2015).

All Hb encoding genes were expressed across all tissues but the genes encoding AG,

BG and 2D had significantly higher expression in haemolymph than foot, gills, mantle and

muscle (p < 0.05). Other authors have used patterns of tissue specific expression of

duplicated genes to infer that they have undergone neofunctionalisation (e.g., Na/K- ATPase

in fish in electrical organs) (Norman et al., 2011; Gallant et al., 2014). Consequently, results

in this study would indicate that at least three of the candidate genes investigated (AG, BG

and 2D) have potentially undergone neofunctionalisation based on their expression patterns.

Although it may be expected that Hb genes have a higher expression in haemolymph, most of

closely related bivalve lineages to Arcidae do not possess circulating erythrocytes (Sullivan,

1961; Read, 1966). This indicates that these genes have undergone altered expression

patterns following duplication from an ancestral globin gene. This may have been influenced

by their challenging living environment in intertidal zones where they are regularly exposed

to changing oxygen availabilities.

While Hb genes were expressed across multiple tissues, the expression levels may

have been somewhat influenced by the permeability of tissues to haemolymph. For example,

the gills are highly permeable to haemolymph because they are made up of folded and

ciliated epithelium to maximise surface area for gas exchange (Widdows et al., 1979).

Similarly, mantle tissue is rich in capillaries where oxygenated haemolymph is distributed to

the rest of the tissues for O2 delivery (Weber, 1980). Muscle and foot tissue also depend on

haemolymph for O2 supply and consequently the lower expression patterns seen across all

tissues apart from haemolymph may be the result of the residual haemolymph content within

them.

2.5 Conclusion

Overall, air exposure for 6 hours mimicking the duration of a low tide does not

change the haemolymph pH in A. trapezia whereas prolonged air exposure causes acidosis in

the haemolymph. This drop in pH on prolonged air exposure coincides with a rise in pCO2

and therefore indicates that the organism may be switching to anaerobic metabolism in order

to deal with this stress. In terms of expression of Hb encoding genes, the multiple Hbs


expressed in this species are present in all tissues but their expression is significantly higher

in haemolymph than in foot, gills, mantle and muscle. For at least three of these Hb encoding

genes, this contributes to the theory that they have undergone neofunctionalisation through

gene duplication. In this case, the unfavourable O2 conditions of the intertidal environment

these bivalves live in may have been a driver for this selective adaptation.


Chapter 3: Functional annotation of the Ctenoides ales transcriptome

3.1 Background

Respiratory pigments, or oxygen-transport proteins, within the bivalve lineage show a

patchy distribution, as well as extensive variation in both form and function across species in

which they are expressed (Terwilliger, 1980; Booth et al., 1984; Morse et al., 1986; Mangum

et al., 1987; Weber & Vinogradov, 2001). The majority of bivalves do not have a functional

respiratory pigment and rely on filtration of highly oxygenated water over the gills, to meet

their respiratory demands (Angelini et al., 1998). Those bivalve species that do possess a

respiratory pigment usually express haemocyanin (Hc) (Terwilliger et al., 1988), a complex

copper – based protein that reversibly binds O2. In rare cases, however, bivalves utilise a type

of haemoglobin (Hb), as seen in orders Arcoida, Carditoida, Solemyoida and Veneroida

(Manwell, 1963; Terwilliger et al., 1978; Dando et al., 1985; Doeller et al., 1988; Suzuki et

al., 2000). Based on the current phylogenetic reconstruction of the bivalve species by

González et al. (2015), it appears that the earliest lineages possess Hc as the primary

respiratory pigment. Based on this observation, and the fact that almost all gastropods (sister

lineage to bivalves) possess Hc (Linzen et al., 1985), it is likely that Hc is the ancestral

oxygen-transport protein in Bivalvia. Unlike Hc, Hb is thought to have evolved from

ancestral globin genes on multiple occasions within bivalves.

Currently, four independent origins of Hbs have been hypothesised in bivalve

molluscs. The first instance is thought to have occurred in the primitive bivalve lineage

containing Solemya velum in the order Solemyoida. In addition to circulating hemocyanins,

this species contains several tissue Hbs, predominantly localised in the gills (Dando et al.,

1985; Doeller et al., 1988). The second independent origin of Hbs was reported in the bivalve

family Arcidae in the order Arcoida, where evidence suggests that all species investigated

contain multiple Hbs in circulating red blood cells (Mangum, 1997). The diversity of Hbs in

this group consists of monomeric, homo-dimeric, hetero-dimeric, tetrameric and polymeric

proteins (Terwilliger, 1980). The third reported origin of bivalve Hb is found in the deep-sea

clam genus, Calyptogena in the order Veneroida. In this genus, species such as C. kaikoi

contain two types of homo-dimeric Hb proteins, where one is found in erythrocytes and the

other is restricted to abductor muscle tissue (Suzuki et al., 2000). The fourth instance is an

extracellular Hb found in the heterodont clams, Cardita borealis and Cardita floridana in the

Chapter 3: Functional annotation of the Ctenoides ales transcriptome 39

order Carditoida (Manwell, 1963; Terwilliger et al., 1978). While these four cases provide

compelling evidence for the independent evolution of Hb in multiple bivalve lineages it is not

known whether Hb has evolved in other lineages where oxygen-transport proteins have not

been examined.

Interestingly, there is some sparse evidence to suggest that members of the family

Limidae may also possess Hb proteins. This is largely restricted to one textbook publication

(Rawat, 2010) with no molecular or biochemical studies having been reported. It is plausible

to hypothesise that Limidae indeed possess Hb proteins based on their high metabolic rate

associated with the ability to swim and the red pigmentation of their tissues (Harper &

Skelton, 1993; Mikkelsen & Bieler, 2003). If present, Hb could represent an important

physiological advantage for a more efficient O2 delivery system to respiring tissues during

swimming. Consequently, if Hb were found in Limidae, then this would constitute a fifth

independent origin of Hb in bivalve molluscs.

An efficient approach to determine if Hbs are present in a given species is to sequence

the entire expressed portion of their genome, as it has successfully been performed in the

blood clams, Tegillarca granosa (Bao & Lin, 2010) and A. trapezia (Prentis & Pavasovic,

2014). Research into the presence of Hb in the family Limidae has lagged principally due to a

lack of genomic and proteomic resources developed for species from this bivalve family.

Here, the transcriptome sequencing, assembly and annotation for C. ales, a non-model bivalve

mollusc from the family Limidae is described, for which no transcriptome data currently

exists. The aim of the present study is to test the hypothesis that Hb genes, that encode for a

functional Hb protein, are present in this species and this would therefore likely constitute a

fifth independent origin of Hb in bivalves, as these proteins have only been found in the

bivalve orders Arcoida, Carditoida, Solemyoida and Veneroida. The newly generated

transcriptome will also greatly increase the genomic resources for C. ales and provide an

initial candidate gene list for further genetic research.

40 Chapter 3: Functional annotation of the Ctenoides ales transcriptome

3.2 Materials and Methods

3.2.1 Sample collection

C. ales specimens were obtained from Cairns Marine Pty Ltd, Australia and kept in

holding tanks at the Marine Facility (QUT) , until required for experimentation. This

experiment required no ethics approval as the specimens do not qualify as animals as

described by the Queensland Animal Care and Protection Act 2001 (ACPA). Water

conditions were salinity at 30 - 35 ppt, pH 7.9 - 8.1, temperature 20 – 25 °C and ammonia

levels < 0.1 mg/L. A 12h light/dark cycle was maintained. Animals were fed every three days

with phyto-blast containing a wide range of aquaculture marine phytoplankton (Continuum

Aquatics).

3.2.2 RNA extraction, library preparation and sequencing

One individual tissue sample was used and divided into four for RNA extraction, as

per previously optimised TRIzol/chloroform RNA extraction protocol for mollusc species

(Prentis & Pavasovic, 2014). Specifically the protocol consisted of following steps: 1.0 mL

of Trizol reagent was added to the 1.5 mL microcentrifuge tubes containing tissue and each

tube was vortexed to mix for 5 min. The samples were then incubated at room temperature

for 2 min. Chloroform (0.2 mL) was added to each tube and vortexed for 20 – 30 sec,

followed by a 5 min incubation at room temperature. Samples were spun at 12,000 g for 15

min and the aqueous clear phase in each tube was collected carefully without disturbing the

other layers, and placed in four new 1.5 mL microcentrifuge tubes. Following this,

isopropanol (0.5 mL) was added to each tube of newly collected solution and vortexed for

approximately 10 sec. Sodium chloride (1.2 M, 100 µL) was added to each tube, followed by

a 10 min incubation at room temperature. Samples were then spun at 12,000 g for 15 min and

supernatant removed from each tube without disturbing the pellets. Ethanol (70%, 200 µL)

was then added to each tube to wash the pellets, followed by centrifugation at 12,000 g for 10

min and removal of supernatant. The pellets were then allowed to air dry for 10 min before

being eluted in 50 µL of RNase free water. The RNA was then visualised on a 1.5 % agarose

gel. The quantity and integrity of total RNA was validated on a Bioanalyzer 2100 RNA Nano

chip (Agilent Technologies).

Sequencing libraries were prepared from 20 µg of total RNA using a TruSeq®

stranded RNA library prep kit (Illumina), as per manufacturer’s low sample (LS) protocol.

This consisted of selective purification of mRNA using oligo(dT) magnetic beads and


subsequent selection of 200 – 700 bp fragments. Specifically, total RNA was diluted with

nuclease-free ultra-pure water to a final volume of 50 µL in a 96 - well 0.3 mL PCR plate

provided in the kit and labelled with a RNA Purification beads (RPB) code. After being

brought to room temperature, the tube containing the RNA Purification Beads was vortexed to

resuspend the oligo-dT beads. 50 µL of RNA Purification Beads was added to each well of

the RBP plate to bind the polyA RNA to the oligo-dT magnetic beads. Each well was then

mixed thoroughly by pipetting the entire volume up and down six times followed by sealing

of the plate with a Microseal adhesive seal provided. The RBP plate was then placed in a

thermal cycler on a cycle of 65 °C for 5 min and 4 °C hold to denature the RNA and facilitate

binding of the polyA RNA to the beads. After being taken out of the cycler, the RBP plate

was incubated at room temperature for 5 min to allow the RNA to bind to the beads. The

adhesive seal was then removed and the plate was placed on the magnetic stand at room

temperature for 5 min to separate the polyA RNA bound beads from the solution.

Supernatant from each well was then removed, discarded and the plate was taken off the

magnetic stand. Beads were washed by adding 200 µL of Bead Washing Buffer provided in

each well to remove unbound RNA. Wells were mixed thoroughly by pipetting up and down

six times. The RBP was again placed on the magnetic stand for 5 min at room temperature.

After being thawed, the Elution Buffer solution provided was centrifuged at 6,000 g for 5 sec.

Supernatant from each well was removed after incubation and discarded as it contained most

of the ribosomal RNA and other non-messenger RNA. The RBP plate was removed from the

magnetic stand and 50 µL of Elution Buffer was added to each well and mixed thoroughly by

pipetting up and down six times. The RBP plate was sealed and placed in the thermal cycler

on a cycle of 80 °C for 2 min and 25 °C hold to elute the mRNA from the beads. This step

releases both the mRNA and any contaminant rRNA that may have bound to the beads non-

specifically. The plate was removed from the thermal cycler and unsealed. After thawing,

the Bead Binding Buffer provided was centrifuged at 600g for 5 sec. Bead Binding Buffer

(50 µL) was added to each well of the RBP plate to allow mRNA to specifically rebind the

beads as well as reducing the amount of rRNA that is bound non-specifically. Each well was

mixed. The RBP plate was then incubated at room temperature for 5 min and then placed on

the magnetic stand where supernatant was removed and discarded. The plate was removed

from the stand and the beads were washed by adding 200 µL of Bead Washing Buffer in each

well and mixing. The plate was placed on the magnetic stand at room temperature for 5 min

and supernatant was removed and discarded to avoid any residual rRNA and other

contaminants. The plate was removed from the magnetic stand and 19.5 µL of Fragment,


Prime, Finish Mix provided were added and mixed thoroughly with the RNA to serve as a

first strand cDNA synthesis reaction buffer as they contain random hexamers. The plate was

sealed and placed in the thermal cycler on a cycle of 80 °C for 8 mins and 4 °C hold. The

RBP plate was then removed from the thermal cycler and centrifuged briefly. Complementary

DNA synthesis was then carried out on enriched mRNA samples as follows: the RBP plate

was placed on the magnetic stand at room temperature for 5 min and 17 µL of supernatant in

each well was transferred to the corresponding well on a new 0.3 mL PCR plate labelled with

a cDNA Plate (CDP) barcode. After thawing, the First Strand Synthesis Act D mix was

centrifuged at 6,000 g for 5 sec. SuperScript II (50 µL) was added to the First Strand

Synthesis Act D tube. Eight µL of this mix was added to each well of the CDP plate and

mixed thoroughly. The CDP plate was sealed and centrifuged briefly before being transferred

to the thermal cycler on a cycle 25 °C for 10 min, 42 °C for 15 min, 70 °C for 15 min and

hold at 4 °C. The CDP plate was then taken out of the thermal cycler and unsealed. Five µL

of Resuspension Buffer was added to each well followed by 20 µL of thawed and centrifuged

Second Strand Marking Master Mix provided. Each well was thoroughly mixed and the plate

sealed. The CDP plate was placed in the thermal cycler and incubated at 16 °C for one hour.

It was then removed from the cycler and unsealed. Well-mixed AMPure XP beads (90 µL)

provided was added to each well now containing 50 µL of double stranded cDNA and this

was mixed by pipetting the entire volume up and down ten times. The CDP plate was then

incubated at room temperature for 15 min before being placed on the magnetic stand for 5

min. 135 µL of supernatant was removed and discarded from each well. Freshly made 80 %

EtOH (200 µL) was then added to each well without disturbing the beads and the plate was

incubated at room temperature for 30 sec before removing and discarding all of the

supernatant from each well. This EtOH wash step was repeated one more time before leaving

the CDP plate to dry at room temperature for 15 min. The CDP plate was then removed from

the stand and 17.5 µL of thawed and centrifuged Resuspension Buffer provided was added to

each well and mixed. The plate was incubated at room temperature for 2 min and placed on

the magnetic stand for 5 min. Fifteen µL of supernatant from each well was then transferred

from the CDP plate to a new 96 well 0.3 mL PCR plate labelled with an Adapter Ligation

Plate (ALP) barcode.

Purified fragments were poly-A tailed, ligated to Illumina paired-end adapters, and

size selected by gel purification. Finally, PCR was used to enrich the DNA fragments with

the following conditions: one cycle at 98 °C for 30 sec, 15 cycles of 98 °C for 10 sec, 60 °C


for 30 sec, 72 °C for 30 sec, one cycle at 72 °C for 5 min and hold at 4 °C. The final cDNA

library was sequenced on an Illumina NextSeq500 using 150 bp paired-end chemistry.

3.2.3 Transcriptome assembly and validation

Following sequencing, the libraries were concatenated into two separate files based on

read direction (-left all_R1_reads.fastq and –right all_R2_reads.fastq). Quality control was

then performed on both files to validate the quality of the raw reads prior to assembly. This

was done using the FastQC program which provides summary statistics for read quality,

length and GC content (Andrews, 2010). Low quality reads (sequences with > 1 % N bases

and/or greater than 1 % Q < 20) were discarded and only reads with quality scores above Q20

and less than 1 % ambiguity were used for downstream analysis. These remaining reads were

assembled into contigs ≥ 200 bp using the Trinity short read de novo assembler (version 2.0.6)

(Grabherr et al., 2011). Assembled contiguous sequences (contigs) were filtered for

redundancy and chimeric transcripts using the program CD-HIT (Cluster Database at High

Identity with Tolerance), version 4.6.1 (Huang et al., 2010) and sequences with > 95 %

similarity were clustered into a single contig. At this point, the C. ales transcriptome

assembly was evaluated for completeness using CEGMA (Core Eukaryotic Genes Mapping

Approach) to determine the presence of a group of 248 highly conserved core eukaryotic

genes.

3.2.4 Functional annotation of transcripts and mapping

The transcriptome assembly was functionally annotated using sequence based searches

implemented in the Trinotate annotation pipeline (Haas et al., 2013), which is a

comprehensive annotation suite designed specifically for de novo assembled transcriptomes of

model or non-model organisms. Trinotate generates functional annotation based on

homology searches to known sequence data, protein domain identification and protein signal

peptide/transmembrane domain predictions before integrating the analysis of transcripts into a

SQLite database to obtain an annotation report as described below and as summarised in

Figure 3.1. Firstly, contigs were used as BLASTx queries against the TrEMBL and Swiss-

Prot databases with a stringency E-value of 1 x 10-6. Both of these databases are a collection

of core data on proteins such as the amino acid sequence, the protein name or description, the

taxonomic data, the citation information and as much annotation information as possible.


They are used concurrently as TrEMBL is computationally analysed while Swiss-Prot is

manually annotated based on literature and curated computational analysis. Gene ontology

terms were assigned to contigs that received BLAST hits that also contained functional

information. In order to characterise the transcriptomic data obtained, these terms were

analysed using WEGO (Web gene Annotation Plotting) (Ye et al., 2006). TransDecoder

v.2.0.1 (Haas et al., 2013) was used to generate a predicted proteome for the transcriptome

assembly based on the longest open reading frame (ORF) in each transcript. The predicted

proteome was then used as a BLASTp query against the TrEMBL and Swiss-Prot databases.

SignalP 4.1 was used to predict the presence and location of signal peptide cleavage sites in

coding sequences. Pfam domains were assigned using the Hidden Markov Model-based

sequence alignment tool (HMMER) to determine the presence and position of domains within

each predicted proteome. The analyses obtained for all transcripts were then uploaded to the

SQLite database and an annotation report was generated. Trinity output consisted of sequence

clusters identified as genes through BLASTx searches against the TrEMBL and Swiss-Prot

databases.


Figure 3.1. Workflow overview of functional annotation of the C. ales transcriptome using the Trinotate

annotation pipeline. This is a comprehensive annotation suite based on homology searches to known sequence

data. Contigs were first used as BASLTx queries against the TrEMBL and Swiss-Prot databases (stringency E-

value of 1 x 10-6). TransDecoder was used to generate a predicted proteome then used as a BLASTp query

against the TrEMBL and Swiss-Prot databases. SignalP was used to predict the presence and location of signal

peptides and Pfam to determine the presence and position of protein domains. All results were uploaded to the

SQLite database and an annotation report was generated. Adapted from van der Burg et al. (2016).

3.2.5 Comparative transcriptomics

In order to further validate the newly generated transcriptome, orthologous gene clusters

for C. ales, A. trapezia and the two model species Lottia gigantea and Crassostrea gigas were

compared and annotated using the program OrthoVenn (Wang et al., 2015). The predicted

proteomes from the genome of L. gigantea and C. gigas were used and compared to the

predicted proteome from the whole organism transcriptome of A. trapezia and C. ales.

Ortholog groups were identified by an all-against-all or reciprocal BLASTp alignment.


3.2.6 Candidate genes identification

The annotated transcriptome was interrogated for candidate globin genes, here defined

as contigs that possess a characteristic globin fold sequence and globin domain as identified in

the Trinotate pipeline through BLASTp and Pfam. Candidate contigs identified were

analysed through ORF finder (Stothard, 2000) to determine open reading frames. Coding

regions were translated into protein sequences using the translating tool ExPAsy (Gasteiger et

al., 2003) and used as BLASTp queries against the NR database at NCBI. Relevant

conserved domains were identified using SMART searches for homologous Pfam domains

(Finn et al., 2014), signal peptides and internal repeats.

3.2.7 Primer design and candidate gene validation

Primers for the candidate sequences were designed using Primer3 software, to

amplify the entire ORFs (open reading frames) of the candidate genes: contigs c97022_g1_i3

(CalesGl1), c89016_g1_i4 (CalesGl2) and c97010_g2_i1 (CalesGl3) and used for validation.

This was done with the following PCR protocol: 12.5 µL of MyFi® 2x, 8.5 µL of H2O, 1 µL

of forward primer, 1 µL of reverse primer, 2 µL of MgCl2 and 1 µL of template to a total

volume of 26 µL. Different conventional PCR amplification conditions were used for each

candidate gene. For contig c97022_g1_i3: one cycle at 94 °C for 3 min, 30 cycles at 94 °C 30

sec, 54 °C 30 sec, 72 °C 1 min, one cycle at 72 °C for 5 min and a 4 °C hold. For contig

c89016_g1_i4: one cycle at 94 °C for 3 min, 30 cycles at 94 °C 30 sec, 50 °C 45 sec, 72 °C 1

min, one cycle at 72 °C for 5 min and a 4 °C hold. For contig c97010_g2_i1: one cycle at 94 °C

for 3 min, 30 cycles at 94 °C 30 sec, 48 °C 1 min, 72 °C 1 min, one cycle at 72 °C for 5 min and

a 4 °C hold. Amplified products were size-separated by electrophoresis on 1.5 % agarose gels

stained with GelRedTM (Biotum) alongside a 100 bp Hyperladder (Bioline). The intensity of

PCR products was determined using an image analysis program assisted by a gel

documentation system (Chemidoc XRS, Bio-Rad). PCR products were then purified using an

Ethanol/EDTA precipitation protocol as follows: 5 µL of 125 mM EDTA disod ium salt (pH

8.0) was added to each PCR tube, vortexed and spun briefly. Ethanol (100 %, 60 µL) was

added and tubes were left to incubate at room temperature for 15 min. Tubes were then spun

in a centrifuge at 13,000 g for 20 min and the supernatant was carefully aspirated and

discarded. Freshly made 80 % ethanol (350 µL) was then added and tubes were spun at

13,000 g for 5 min before the supernatant was aspirated and discarded. Pellets in the tubes


were then left to dry at room temperature for 1 hr covered with aluminium foil. Samples were

sequenced on the ABI Genetic Analyzer 3500 (ThermoFisher). Sequence chromatograms

were visualised using Geneious® software version 8.1.6 and sequences were re-aligned to

candidate ORFs that primers were designed from.

3.2.8 Phylogenetic analysis of sequences

Phylogenetic relationships of globin genes in this study and model bivalve species were

resolved using maximum likelihood analysis in MEGA version 6.0 (Tamura et al., 2013).

This software conducts manual and automatic sequence alignments to infer molecular

relationships and build phylogenetic trees (Tamura et al., 2013). Firstly, the globin gene

sequences were isolated from the genomes of the two bivalve model species C. gigas and L.

gigantea by using a custom BLAST against haemoglobins, neuroglobins, globin-X,

cytoglobins and myoglobins in the three vertebrate model species: Homo sapiens (human),

Gallus gallus (chicken) and Danio rerio (zebra fish). For C. gigas, 12 globin genes were

found and 10 for L. gigantea. Globin gene sequences were isolated from the transcriptome of

A. trapezia. All sequences were further validated using Pfam searches to ensure the presence

of a globin domain. Alignments were performed using MUSCLE (Edgar, 2004) protein plug

in with default settings in MEGA and a best-fit model test was performed resulting in

LG+G+I (Tamura et al., 2013). This LG gamma distributed (G) with invariant sites (I) model

was therefore used with three discrete gamma categories to construct a maximum-likelihood

tree using the bootstrap method with 500 bootstrap replications. All bivalve globin protein

sequences used in the phylogeny were also aligned for comparison and to identify residue

conservation using the multiple sequence alignment with high accuracy and high throughput

MUSCLE in MEGA version 6.0.

3.3 Results

3.3.1 RNA extraction, library preparation and sequencing

Total RNA extraction, performed in quadruplicate, for C. ales is visualised in Figure

3.2, where all four samples showed strong bands around 700 bp, which represent ribosomal

RNA. Bioanalyzer results (Figure 3.3) confirm these findings with high concentration and


yields for both samples submitted. Transcriptome sequencing of mRNA from C. ales on

Illumina NextSeq 500 resulted in 55,592,966 150 bp paired-end reads and a GC content of

36.53 %. This slightly low GC content may be due to shortness of sequences and instability

of mRNA.

Figure 3.2. Whole tissue from one C.ales individual was sampled and used for RNA extraction. This 1.5 %

agarose gel electrophoresis shows RNA extracted from four samples (extraction was performed in quadruplicate)

from this individual as follows: lane 1 contains 100 bp Hyperladder, lanes 2-5 contain samples 1-4 respectively.

The RNA is visible as strong bands in each sample around the 700 bp mark. RNA obtained was then assessed

for quantity and integrity and sequencing libraries were prepared.


Figure 3.3. Bioanalyser results for total RNA quality and quantity. Total RNA samples obtained from whole

tissue of one C.ales individual were assessed for quantity and integrity on a Bioanalyzer 2100 RNA nano chip.

Results shown here are for two RNA samples labelled here C10 and C11. RNA concentrations are given for

each sample.

3.3.2 Transcriptome assembly and validation

Assembly of this data resulted in 182,908 contigs (≥ 200 bp). The mean contig length

was 357 bp, with an N50 of 1,167 bp. Assembly statistics are presented in Table 3.1.


Table 3.1 Summary of sequencing and assembly data for the bivalve C. ales. Sequencing libraries were

prepared using an Illumina TruSeq® stranded RNA library prep kit and the final cDNA library was sequenced on

an Illumina NextSeq500 using 150 bp paired-end chemistry. Libraries obtained were then assembled and the

table below summarises results obtained.

3.3.3 Functional annotation of transcripts and mapping

Overall, 22,903 (12.5 %) transcripts received significant BLASTx hits and 19,788 (10.8

%) BLASTp hits against the Swissprot database. Against the TrEMBL database of predicted

proteins, 34,098 (18.6 %) transcripts received significant BLASTx hits and 26,344 (14.4 %)

BLASTp hits. Gene ontology (GO) terms were assigned to 30,315 transcripts (Figure 3.4).

The most frequently assigned GO terms were cellular process (20,887), biological regulation

(11,020) and metabolic process (15,717) for the broad biological process category. For the

cellular component category, most GO terms were assigned to cell and cell part (23,916),

followed by organelle (16,087). In the molecular function category, GO terms were most

commonly assigned to binding (19,803) and catalytic activity (12,179).

Assembly statistic

Total assembled reads 127,196,743

Total trinity ‘genes’ 160,227

Total contigs 182,908

Mean contig length (bp) 357

Average contig 695.41

N50 1,167


Figure 3.4. WEGO output for newly generated transcript for C. ales. Web gene Annotation Plotting was used

to characterise the transcriptomic data obtained for C. ales. This figure represents the proportion and number of

transcripts assigned Gene Ontology (GO) terms in three different gene ontology categories developed to

represent common and basic biological information: cellular component, molecular function and biological

process.

3.3.4 Comparative transcriptomics

A comparative analysis was conducted across the four mollusc transcriptomes

including the two model species C. gigas and L. gigantea, as well as the bivalves A. trapezia

and C. ales. Orthologous clusters conserved among the four molluscs and those unique to

each species are represented in the Venn diagram in Figure 3.5. Overall, 6,743 clusters were

shared by all four species, which represents 55.5 % of the total number of clusters for C.

gigas, 58.1 % for L. gigantea, 53.2 % for A. trapezia and 38.8 % for C. ales. The

transcriptome with the lowest number of unique clusters was L. gigantea with 918, while C.

ales had the highest number of 4,355. A. trapezia shared the most orthologous clusters with

C. ales (1,607).

Cellular component Molecular function Biological process

Perc

ent o

f gen

es

Num

ber o

f gen

es


Figure 3.5. Venn diagram illustrating the number of gene clusters shared and unique between the four bivalve

species C. gigas, L. gigantea, A. trapezia and C. ales. For L. gigantea and C. gigas, the predicted proteomes

obtained from the genomes are used and the predicted proteomes from whole organism transcriptomes are used

for A. trapezia and C. ales. Ortholog groups shown here were identified by an all-against-all reciprocal BLASTp

alignment.

3.3.5 Candidate genes

Contigs identified as globins were extracted from the Trinotate annotation report

(c97022_g1_i3; c89016_g1_i4; c97010_g2_i1). Contig c97022_g1_i3 (CalesGl1) was found

to be 1,930 bp in length, consisting of an ORF of 498 bp encoding a polypeptide of 165 amino

acids. Analysis of the predicted protein sequence identified a globin domain (Figure 3.6) with

40 % sequence identity to a Ngb-like gene in the bivalve C. gigas. Contig c89016_g1_i4


(CalesGl2) was 715 bp in length, consisting of an ORF of 585 bp encoding a polypeptide of

194 amino acids. The predicted amino acid sequence of this contig consisted of a signal

peptide and a globin domain (Figure 3.6). It had 36 % protein identity to a Hb gene found in

the crab Carcinus maenas. Contig c97010_g2_i1 (CalesGl3) was found to be 1,835 bp in

length consisting of an ORF of 1,107 bp encoding a polypeptide chain of 368 amino acids.

The predicted amino acid sequence of this contig was found to encode a transmembrane

domain and two globin domains (Figure 3.6), with 38 % sequence identity to the HbI gene

found in the bivalve T. granosa.

bp

Figure 3.6. Globin domains identified for three candidate globin genes. The annotated transcriptome obtained

for C.ales was interrogated for candidate globin genes here defined as contigs that possess a characteristic globin

fold sequence and globin domain. The three contigs found to possess these characteristics are shown above as

follows: CalesGl1 (top), CalesGl2 (middle) and CalesGl3 (bottom). For candidate gene 2, the purple circle

represents a signal peptide and for candidate gene 3, the blue rectangle represents a transmembrane domain.

Both were identified using SMART searches for homologous Pfam domains, signal peptides and internal

repeats.

CalesGl1

CalesGl2

CalesGl3


3.3.6 Primer design and candidate gene validation

Forward and reverse primers were designed based on the longest ORF for each of the

three candidate genes for validation (Table 3.2). PCR reactions were optimised for each

primer from each candidate gene and sequences successfully amplified (Figure 3.7).

Alignments of chromatograms obtained from Sanger sequencing and original candidate ORFs

were successful and all three genes were validated at > 97 %.

Table 3.2 Primers designed for validation of three candidate genes identified from the newly generated C. ales

transcriptome. Primers were designed using Primer3 software to amplify the entire ORFs and validate the

candidate genes identified. Forward and reverse primers were designed for each candidate as shown in the table

below.

Figure 3.7. Candidate gene products from C. ales transcriptome. Each candidate was amplified using primers as

shown in table 3.2 above. Lanes 1 in all gels shown here are Hyperladder 100 bp. Candidate gene 1 is shown in

lane 2 of gel (A); candidate gene 2 is shown in lane 3 of gel (B); candidate gene 3 is shown in lane 3 of gel (C).

All gels are 1.5 % agarose stained with GelRedTM (Biotum). Products of candidate genes seen here were purified

using an Ethanol/EDTA precipitation protocol and samples were sequences on ABI Genetic Analyzer 3500

(ThermoFisher). Lanes 2 and 4 of gel (B) and lane 2 of gel (C) are candidate gene products prior to PCR

reactions being optimised.

Primer name Primer sequence 5’-3’ Contig Annealing T° Product size

CalesGl1_F AGA AGC GCA GGC AGA AGA AA c97022_g1_i3 55° 670

CalesGl1_R TGT GAA TCA ACG CAT TGC ACA

CalesGl2_F ATC AGT CGA CTG GTG CAT AG c89016_g1_i4 55° 670

CalesGl2_R TGC ATG TAC AGA ATA AAG GCA

CalesGl3_F GCA CAC AGC TAC ACT CTT GT c97010_g2_i1 55° 1400

CalesGl3_R TGC GTA GAT CGG AGT AGA GA

B A C


3.3.7 Phylogeny of globins in bivalves

The phylogenetic relationships of globins in the four mollusc species (L. gigantea, C.

gigas, A. trapezia and C. ales) and three model vertebrate species (D. rerio, G. gallus and H.

sapiens) are represented in Figure 3.8. In this maximum-likelihood tree, there are three

weakly supported major clades (A, B and C). Clade C contained Hb and other related globin

(all globins apart from Ngb and GbX) genes from the three vertebrate model species. Clades

A and B both contained globin genes for L. gigantea, C. gigas, C. ales and A. trapezia. Clade

A, although poorly supported, contained globin genes from L. gigantea, A. trapezia and C.

gigas, C. ales and vertebrate GbX but no genes encoding molluscan Hb proteins. Clade B is

strongly supported and contains all known Hb genes in A. trapezia. All bivalve globin protein

sequences used for phylogeny were also aligned using MUSCLE in MEGA. Results are

shown from position 260-331 where residues are conserved across all 30 bivalve globins. In

position 271, a phenylalanine residue and in positions 295 and 328, two histidine residues are

conserved across all 30 globins from the four different bivalve species (Figure 3.9).


Figure 3.8. Molecular Phylogenetic analyses by Maximum Likelihood method. Phylogenetic relationships of

globin genes were here resolved for the following species: bivalves A. trapezia and C. ales, two mollusc model

species L. gigantea and C. gigas, three vertebrate model species H. sapiens, G. gallus and D. rerio. The

percentage of trees in which the associated taxa clustered together is shown next to the branches. A discrete

Gamma distribution was used to model evolutionary rate differences among sites (3 categories (+G, parameter =

5.3023)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 3.8405 % sites).

The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.

L. gigantea globin-like 6 C. gigas neuroglobin-like

L. gigantea globin-like 5

C. gigas cytoglobin-2-like X1

A. trapezia neuroglobin NG

D. rerio GbX

C. gigas cytoglobin-2-like X3


C. ales neuroglobin-like CalesGl1

D. rerio neuroglobin G. gallus neuroglobin

C. gigas globin-like

C. gigas cytoglobin-1

C. gigas cytoglobin-1-like

C. gigas neuroglobin (2)

C. gigas haemoglobin-1-like



C. gigas neuroglobin

H. sapiens neuroglobin



C. gigas neuroglobin-1

L. gigantea globin-like 3 L. gigantea globin-like 4

L. gigantea globin-like 9 C. gigas globin-like X1

A. trapezia heterodimer HB A. trapezia dimer 2D

A. trapezia homodimer HD A. trapezia beta globin BG

A. trapezia alpha globin AG H. sapiens cytoglobin D. rerio cytoglobin 2 G. gallus cytoglobin

D. rerio cytoglobin 1 G. gallus myoglobin

H. sapiens myoglobin D. rerio myoglobin

G. gallus globin E G. gallus HbA H. sapiens HbA D. rerio HbA

D. rerio HbB G. gallus HbB

H. sapiens HbB

C. ales haemoglobin-like CalesGl2 C. ales haemoglobin 1-like CalesGl3


Figure 3.9. Multiple alignments of globin protein sequences. All mollusc globin protein sequences used in the

phylogeny represented in Figure 3.8 were aligned for sequence comparison and to identify residue conservation

using the multiple sequence alignment with high accuracy and high throughput MUSCLE in MEGA. Sequences

are grouped by species and include A. trapezia, C. ales, C. gigas and L. gigantea. Residues conserved across all

sequences and all species are indicated above by an asterix (*).

3.4 Discussion

In this study, the transcriptome of C. ales, a bivalve mollusc, three full length globin

genes were identified. All predicted proteins of the candidate genes showed the two histidines

as well as the phenylalanine residues characteristic of globin proteins (Bashford et al., 1987).

This indicates that the proteins encoded by the globin genes identified here are capable of the

formation of the hydrophobic pocket with a haeme group (Royer et al., 2001). The sequence

similarity of the proteins, however, were highly divergent, with candidate gene one being

most similar to vertebrate Ngb genes and a Ngb-like gene from C. gigas, while candidate

genes two and three were most similar to Hb encoding genes from A. trapezia.

Of most interest here, is that two globin genes from C. ales are sister to the known Hb

encoding genes from A. trapezia. The finding that candidate genes CalesGl2 and CalesGl3

were most similar to genes encoding Hb proteins may indicate that these genes in C. ales

represent a fifth independent origin of Hb in Bivalvia. Currently, Hb has been identified in

species from Arcoida, Veneroida, Carditoida and Solemyoida orders in Bivalvia. It remains

to be determined if Hb encoding genes show patterns of molecular convergence as seen in


genes underlying convergently evolved phenotypic traits in echo-locating animals (Parker et

al., 2013) and marine mammals (Foote et al., 2015). The repeated evolution of Hb proteins in

bivalves indicates that when these mutations arise in ancestral globin genes they are strongly

selected for. To fully support a fifth independent origin of Hb in Bivalvia will require

functional protein work which was outside the scope of the current project.

Candidate gene CalesGl3 is of particular interest as this gene had multiple globin

domains in a single globin gene. Previously, di-domain Hbs in bivalve molluscs have only

been found in Barbatia reeveana and Barbatia lima from order Arcoida (Naito et al., 1991;

Suzuki et al., 1996). The sporadic occurrence of a multi-domain globin in another bivalve

class suggests that the di-domain globin gene identified in C. ales has evolved independently

of those in order Arcoida. Multi-domain globin genes have been identified in other animal

phyla including Annelida (Branchipolynoe symmytilida and Barbatia seepensis (Projecto-

Garcia et al., 2010), and Arthropoda (Artemia; (Jellie et al., 1996)). This indicates that multi-

domain globin genes may arise relatively frequently, but this idea remains to be tested. In B.

reeveana the di-domain gene was generated through incomplete gene duplication which

resulted from unequal crossing over during meiosis (Naito et al., 1991). It would not be

surprising if a similar mechanism generated the di-domain globin gene found in C. ales. In

fact, both gene duplication and adaptive evolution have been implicated in the origin and

diversity of many multi-domain proteins (Vogel et al., 2005) reinforcing the hypothesis of

evolution by incomplete duplication in this case.

Candidate gene CalesGl1 was identified as a Ngb-like gene and was found in a weakly

supported clade with vertebrate genes encoding Ngb proteins. It was not surprising to find

Ngb-like genes in bivalves as these genes were present in the common ancestor of

Eumetazoans (Cnidaria + Bilateria) (Roesner et al., 2005). The presence of only a single

copy of Ngb-like gene in both C. ales and A. trapezia was unexpected as most invertebrate

lineages often have more than one Ngb-like gene (i.e., C. gigas has 6 copies (UniProt

accession numbers: K1QVD6, K1Q9R1, K1QT48, K1QF07, K1RX51, K1R7G1). The low

number observed in C. ales and A. trapezia could be associated with low levels of gene

expression of Ngb-like genes (Schindelmeiser et al., 1979; Burmester & Hankeln, 2004) and

the use of transcriptome sequencing to identify these genes in both species investigated.

Vertebrate Ngbs are monomeric proteins involved in various physiological functions

including oxygen supply, storage, and interactions with mitochondria in nerve cells (Roesner

et al., 2005; Watanabe et al., 2012), but a number of functions of these proteins remain


uncharacterised. The predicted proteins identified here, when fully characterised, may help to

better understand the function of neuroglobin-like proteins outside of vertebrate species.

3.5 Conclusion

These data provide the most comprehensive transcriptomic resource currently

available for the bivalve mollusc C. ales. In this transcriptome, there are at least three genes

encoding globin-like proteins. Candidate genes CalesGl2 and CalesGl3 are likely to encode

Hb proteins based on sequence data characteristics and similarities with existing sequences.

Candidate gene CalesGl3 in particular contains two globin domains in a single globin gene

which has only been found in another two bivalve species in a different lineage. In addition

to this, sequence similarities of candidate globin genes identified here to Hb encoding genes

in other bivalves further contributes to the theory of a common bivalve ancestor and

independent evolution of Hbs in bivalve lineages. These results provide preliminary evidence

for a possible fifth independent origin of Hbs in Bivalvia.


Chapter 4: General Discussion

Haemoglobin genes are highly diverse and have evolved independently in multiple

metazoan lineages (Hardison, 1996; Mangum, 1998; Weber & Vinogradov, 2001; Hofmann et

al., 2010a; Hoffmann et al., 2012). This diversity is particularly evident in invertebrates

where Hbs show exceptional variation in their form, function and structural arrangement

(Weber, 1980; Terwilliger, 1998; Weber & Vinogradov, 2001; Alyakrinskaya, 2002;

Hoffmann et al., 2012). Such variability is reinforced by the patchy distribution of Hbs across

invertebrate groups. Bivalve molluscs for example, represent one such group, where Hbs

have evolved independently across multiple lineages (Manwell, 1963; Terwilliger et al., 1978;

Dando et al., 1985; Doeller et al., 1988; Suzuki et al., 2000). This has been shown to be the

result of gene duplication and can be correlated to species living in environments with low or

fluctuating oxygen availabilities. Knowledge on the sequence, role and evolution of Hbs is

not only important for phylogenomics but is also crucial for the bivalve farming industry.

Despite this, only a limited number of studies have examined the full range of Hb genes, or

functionally characterised their expression in bivalves (Terwilliger et al., 1983; Angelini et

al., 1998; Hourdez & Weber, 2005; Decker et al., 2014). To better understand the evolution

and expression of Hbs in bivalves, an investigation of Hb genes in two distantly related

species of bivalves is performed here. Firstly, by quantifying patterns of tissue specific Hb

gene expression in A. trapezia under submerged and aerially exposed treatments. This

provided insights into the function and role of Hb encoding genes in this species. Secondly,

by generating a new high-quality transcriptome resource for C. ales, the globin gene

repertoire in this species was examined and a fifth independent origin of Hb in bivalve

molluscs potentially identified.

4.1 Role of gene duplication in the current diversity of bivalve Hbs

The current diversity of Hb genes in bivalves has been hypothesised to be a result of

repeated rounds of gene duplication driving evolution. One of the mechanisms responsible

for this duplication has been demonstrated, by some authors, to be unequal crossing-over

during meiosis (Naito et al., 1991; Dewilde et al., 1999; Kato et al., 2001). For example, the

two-domain Hb (2D) from the blood clam B. lima is thought to have evolved from an unequal

crossing over event between two ancestral globin genes and the loss of a stop codon (Suzuki

Chapter 4: General discussion 61

et al., 1996). Duplication through unequal crossing over is best illustrated in datasets in this

study by the di-domain globin gene found in C. ales. This di-domain gene has most likely

evolved as a result of unequal crossing over that led to the deletion of a stop codon in a single

domain gene, generating an extended open reading frame with two globin domains.

Interestingly, most Arcidae species studied to date do not possess this di-domain gene.

Therefore, as C. ales, a member of the family Limidae and B. lima, a member of the Arcidae,

both have a di-domain globin gene, it is likely that this gene may have arisen independently in

both species.

The presence of at least five globin genes that encode Hb proteins in A. trapezia,

which form a single clade in the globin phylogeny for bivalves, supports the hypothesis that

extensive duplication has played an important role in the evolution of this gene family. In

arcid bivalves most species have more than a single Hb gene (Como & Thompson, 1980b;

Mangum, 1997), however, A. trapezia is the first species examined to have more than four Hb

genes. For example, three Hb genes have been identified in T. granosa and S. inaequivalvis,

while B. reeveana has four distinct Hb genes (Ikeda-Saito et al., 1983; Petruzelli et al., 1985;

Terwilliger, 1998; Royer et al., 2001; Bao & Lin, 2010). This indicates that either extensive

lineage specific duplication has occurred independently in the species of this family, or that

duplication events occurred in the common ancestor of the family Arcidae.

Investigation of expression patterns of globin genes in A. trapezia highlighted strong

tissue specific expression with some genes being predominantly expressed in erythrocytes.

Often tissue or developmental specific expression in duplicated genes is associated with

changes in the regulatory elements of these genes (Sankaran et al., 2008), which has led to

higher expression in certain tissues or developmental times. This has been demonstrated in

mammals as recently duplicated genes that shared regulatory sequences were more likely to

be co-expressed than duplicated genes that do not share regulatory sequences (Lan &

Pritchard, 2016). It remains to be determined whether divergence in regulatory sequences are

responsible for the tissue specific expression observed in A. trapezia globin genes encoding

Hb proteins, but this study is the first to show tissue specific expression. This indicates that

globin genes may have undergone neofunctionalisation following duplication in A. trapezia to

be dominantly expressed in haemocytes. This data together with data from C. ales shows that

duplication and subsequent divergence have played a dominant role in globin gene evolution

in bivalve molluscs.

62 Chapter 4: General discussion

Neofunctionalisation is the evolution of new functions in duplicated genes and has

been well demonstrated in vertebrate Hb genes (Aguileta et al., 2004; Hoffmann & Storz,

2007; Opazo et al., 2008). The pattern observed in results from chapter 2 of this study is

consistent with neofunctionalisation of clade B globin genes in A. trapezia, as two of these

genes (AG and BG) encode a tetrameric Hb (Como & Thompson, 1980a), while another gene

(HB) in this clade encodes a dimeric Hb (Petruzelli et al., 1985). Two of these three genes

(AG and BG), are dominantly expressed in haemocytes and as these cells are a novel

phenotypic trait in Arcidae, this expression pattern is indicative of neofunctionalisation.

Multiple examples exist that support the idea that neofunctionalisation of gene duplicates has

played an important role in the generation of novel phenotypic traits (Birchler & Veitia, 2010;

Kaessmann, 2010; Osborn et al., 2003). Of these, a well-known example is that of a

neofunctionalised copy of an elastin gene which contributed to the evolution of the bulbus

arteriosus, a novel organ found in the heart of teleost fish (Moriyama et al., 2016). While it is

tempting to speculate that neofunctionalised Hb genes may contribute to evolutionary novelty

in Arcid bivalve erythrocytes, the extensive duplication of globin genes encoding Hb proteins

may be associated with escape from adaptive conflict (Des Marais & Rausher, 2008; Storz et

al., 2008) if Hb proteins undertake multiple roles within this cell type.

Globin and Hb genes from many species have been demonstrated to encode

multifunctional proteins that serve not only in O2 transport, but also play a role in immune

function and contribute to disease phenotypes with haemocytes recognised as the immune

effectors (Bao et al., 2013b; Vinogradov & Moens, 2008; Weatherall, 2001; Donaghy,

2009). For example, a duplicated gene encoding a dimeric Hb from the arcid bivalve T.

granosa, was upregulated following an immune challenge with V. parahaemolyticus (Bao et

al., 2013b). This study demonstrates that the duplicated Hb genes of arcid bivalves may

have multifunctional roles in both O2 transport and the innate immune system response.

Such acquisition of new roles in pre-existing genes requires changes in the regulatory

elements of these genes as well as through coding regions. This is also necessary as these

genes adapt to different living conditions such as hypoxic environments. For example,

globin diversity in vesicomyid clams is believed to be a result of monomers modulation to

accommodate for oxygen levels in their surrounding environment. This is hypothesised to

be the result of structural genetic diversity in populations or changes in globin gene

transcription according to environmental changes (Carney et al., 2007). Based on findings in

this study for the bivalve A. trapezia, we can argue that it is most likely not a result of


changes in the transcription of globin genes, at least for animals exposed to air for up to 12

hours as expression levels of globins did not significantly change. Consequently, the

extensive duplication of Hb encoding globin genes in A. trapezia may allow natural selection

to drive specialization of different members of this multifunctional gene family. Further

functional studies will be required to determine if this idea is correct.

4.2 Globin gene evolution in hypoxic environments

The variability in functional properties of bivalve Hbs are thought to be associated with

the wide range of environmental conditions that these organisms encounter in their habitat

(O’Gower & Nicol, 1968; Terwilliger et al., 1978; Alyakrinskaya, 2002). Among these

environmental conditions, one of the most common stresses affecting bivalves is hypoxia

(Widdows et al., 1979; Weber, 1980; Booth et al., 1984; Burnett, 1997; Gobler et al., 2014).

It develops in organisms where the depletion of oxygen through respiration is faster than its

replenishment and some bivalve species show better tolerance and survival rates than others

when subject to extended periods of hypoxia (Officer et al., 1984; Rabalais et al., 2010). One

of the reasons for this is their ability to close their shells therefore avoiding oxygen depletion

and switching from aerobic metabolism to anaerobic metabolism (Brooks et al., 1991; De

Zwann et al., 1993). The present study showed that this may also be an adaptive feature in

the blood clam A. trapezia.

Furthermore, the evolution of circulating Hbs in bivalve lineages has been hypothesised

to allow for maximised O2 binding and transport during times of hypoxia (Projecto-Garcia et

al., 2015), since both Hbs and Hcs occur in bivalve species that experience periodic hypoxia

(Morse et al., 1986; Mangum et al., 1987; Terwilliger et al., 1988; Riggs, 1991; Weber &

Vinogradov, 2001; Projecto-Garcia et al., 2015). The presence of multiple Hb proteins in

bivalve species is also a common observation and has been linked to many organisms that

synthesise multiple oxygen carriers with different oxygen affinities to meet physiological

demands (Mangum, 1997; Weber & Vinogradov, 2001; Projecto-Garcia et al., 2015). For

example, the clam C. magnifica is found lodged into rock fissures outside hydrothermal vents

and exposed to both deep-sea water and vent fluid meaning that it is frequently subject to

chronic hypoxia (Berg, 1980). This species possesses an intracellular Hb with high O2

affinity for carrying and transport required for its sustainability in such a challenging

environment (Terwilliger et al., 1983; Scott & Fisher, 1995; Hourdez & Weber, 2005). The


deep-sea clams C. kaikoi, Calyptogena soyoae and Calyptogena tsubasa all possess two

homo-dimeric Hbs with more than 90 % identity, of which, HbI and HbII in C. kaikoi have

been found to be involved in O2 storage under low O2 conditions in the deep sea rather than

O2 transport (Kawano et al., 2003; Suzuki et al., 2000). Arcid bivalves are also frequently

found in habitats with low levels of O2 such as intertidal zones or deep-sea waters and often

experience prolonged periods of hypoxia (Arp et al., 1984; Abele-Oeschger & Oeschger,

1995; Terwilliger, 1998; Weber & Vinogradov, 2001). This is the case with the intertidal

bivalve A. trapezia used in this study but also with other arcid bivalves such as Anadara

kagoshimensis. As with A. trapezia, this species is found in sandy-muddy areas of the Indo-

Pacific region and possesses haemoglobin-containing erythrocytes (Golovina et al., 2016).

Compared to other bivalve species in the same habitat, A. kagoshimensis has also shown

better tolerance to hypoxia and this has been attributed to the presence of Hbs (Holden et al.,

1994). The multiple Hbs in these bivalves may be produced simultaneously and may have

different functions such as O2 carrying or storage, or can be produced sequentially to follow

changing conditions (Terwilliger, 1998). Different Hb structures confers them these different

functions and thus their potential resistance to hypoxia in the habitats where the bivalves

settle (Decker et al., 2016). Overall, the presence of Hbs seems to play a role in adaptation of

bivalves to hypoxia. Therefore, mutations that confer the evolution of such complex

respiratory pigments such as Hb are likely selected for.

Since all blood clams seem to have originated from a common ancestor, globin

structural variations and levels of expression is thought to have been influenced directly by

the environmental conditions these clam species are subjected to and specifically oxygen

concentration and availability (Kawano et al., 2003). The evidence from this study reinforces

that greater expression of Hbs in haemolymph confers a physiological advantage in tolerating

hypoxia. It is shown here by expression levels obtained for the blood clam A. trapezia.

Given the hypoxic nature of the intertidal environment where this bivalve is found, it is

almost certain that a duplication event was driven by the need for oxygen availability during

low tides. This is also consistent with the finding of Hb-like genes that may encode Hb

proteins in C.ales as this species lives in the tropical waters of the Indo-Pacific area at depths

between 30 – 35 m (and sometimes up to 50 m) where both depth and temperature reduce the

solubility of O2 creating a hypoxic environment (Garcia et al., 2005; Karstensen et al., 2008).

Nonetheless, the idea that Hb has evolved more often in lineages that live in hypoxic

environments requires further analysis before it can be supported.


4.3 The importance of globin gene evolution to aquaculture

Aquaculture is one of the fastest growing food-producing sectors and accounts for nearly 50

% of world consumption. The major groups currently produced in aquacultureinclude finfish,

crustaceans and molluscs. Culture of molluscs contributed approximately 20 % of total

aquaculture production in 2014 and this amount has been steadily increasing in recent years.

Bivalve molluscs of the family Arcidae includea number of major fishery and aquaculture

species such as T. granosa, S. inaequivalis, S. broughtonii and A. trapezia (Donaghy et al.,

2009; Bao et al., 2013b). Besides their importance as food sources, bivalve molluscs are

frequently used as indicators of pollution and overall health of ecosystems. Some of the

major issues encountered in clam farming are disease outbreaks, low survival rates due to

environmental pollution and slow growth rates (Alkarkhi et al., 2008; Vuddhakul et al.,

2006). Haemocytes found in bivalve molluscs have been shown to be involved in various

biological functions (Donaghy et al., 2009) such as immune defence against bacteria and

viruses (Bao et al., 2013b) but also detoxification. In fact, the role of haemoglobin in

haemocytes goes beyond supporting aerobic metabolism and in some species SNPs in specific

Hb genes have been observed to correlate with disease resistence. Hbs in bivalves have been

shown to be a source of antibacterial activity but are also responsible for eliminating harmful

reactive oxygen species (ROS) and Nitric Oxide (NO) which may be present in polluted

environments. Investigation of the haemoglobin genes in these bivalves as well as their

expression under environmental stress as it is done in this study for A.trapezia contributes to

our understanding of the functions of Hbs and haemocytes which may provide new

perspectives for disease control and resistance to pollution in cultures.

Aquaculture production systems are often classified into three general types: extensive ponds,

intensive ponds and intensive recirculating tank and raceway systems (Ebeling, 2006). There

is also a tendency of many aquaculture enterprises to intensify production using

superintensive systems, for example, super intensive culture using Atlantic salmon and

rainbow trout. Currently, dissolved oxygen is the most important limiting factor to increase

production in intensive systems. The study of haemoglobin gene expression under stress in A.

trapezia and the transcriptome generated for C. ales may be used in future studies looking at

dealing with this major issue. In particular, examining haemoglobin gene expression under

different oxygen concentrations will provide much needed data about how molluscs cope with

low dissolved oxygen in culture.


Other bivalves such as scallops are also used for farming. For example, in the scallop family

Pectinidae, only about 10 species are currently cultured from the 400 living species present in

this family (Shumway & Parsons, 2011). New sequence data for species is the ultimate

resource for the introduction new species in cultures or the addition of genetic material to

existing species to increase their diversity and their performance in cultures (Guo, 2009). The

transcriptome generated in this study for the scallop C. ales and the haemoglobin-like genes

described can therefore be used as potential molecular markers for bivalve selection and

breeding to improve aquaculture production. Overall, research based on trancriptomics and

proteomics proves valuable as it increases genetic data to study molecular traits of interest for

cultured species and especially evaluate their disease susceptibility and resistance to

environmental stresses.

4.4 Limitations of the study

Despite some limitations in the two studies conducted as part of this Masters thesis,

the findings about the evolution and expression of Hb genes in bivalve molluscs are valid.

One major limitation of the study is the use of transcriptome sequences for the identification

of Hb genes in both A. trapezia and C. ales instead of full genome sequences. Consequently,

the presence of only six and three full-length globin transcripts in A. trapezia and C. ales,

respectively may be an underestimation of the actual number of Hb genes in these species and

should be viewed with some caution. Many functional genes are not captured by

transcriptome sequencing because they are only expressed at specific developmental stages, in

certain tissues or at very low levels (Yagil et al., 2005). Thus this is a limitation of using

transcriptome sequencing in isolation to identify the number of different genes within gene

families in a species. Complete genome sequencing was not feasible in the current study due

to the time restrictions and financial constraint.

4.5 Future research

Data presented here for A. trapezia provides insight into the multiple functions of Hbs,

possible future studies could consist of further validating Hb genes. This could include

whether Hbs are translated into proteins or whether some might be pseudogenes. Data

presented here for C. ales provide the most comprehensive transcriptomic resource currently

available for this species and therefore allows for numerous gene families to be examined


detail. Overall this resource should lay an important foundation for future genetic or genomic

studies in this species. In future studies, complete genome sequences could also improve the

detection of the entire complement of globin genes for these two bivalve species.

4.6 Conclusions

Overall, the evolution of Hbs in bivalves is intriguing due to the great diversity of

proteins found across lineages both in structure and function. This study looked at the blood

clam A. trapezia which possesses five duplicated Hb encoding genes and determined that

expression levels of those five genes are much higher in haemolymph than in foot, gills,

mantle or muscle therefore validating the first hypothesis of this project that they have

undergone neofunctionalisation through gene duplication. Furthermore, the expression of

those genes was not affected by short-term or long-term hypoxia; therefore it can be

concluded that the neofunctionalisation acquired through gene duplication of existing Hb

encoding genes may provide some evolutionary advantage for this bivalve species. Findings

on the sensitivity and reaction of A. trapezia to hypoxia may also be a valuable indicator of

the potential for bivalve populations to survive in challenging environments.

Additionally, next generation sequencing was used to obtain the expressed portion of

the genome and present the first transcriptome for the species C. ales. Three globin-like

encoding genes were found in the newly generated transcriptome for this bivalve species. The

presence of a di-domain globin in particular represents the first in bivalves since the findings

of a di-domain in B. lima and B. reeveana in the Arcoida order. This suggests that multi-

domain globin genes may arise repeatedly through incomplete gene duplication. Although

more investigation is required on the three candidate genes identified here, preliminary

findings in this study support a fifth independent origin of Hb in bivalves and contribute to

validate the second hypothesis of this project.


References

Abele-Oeschger, D., & Oeschger, R. (1995). Hypoxia-induced autoxidation of haemoglobin

in the benthic invertebrates Arenicola marina (Polychaeta) and Astarte borealis (Bivalvia)

and the possible effects of sulphide. Journal of Experimental Marine Biology and

Ecology, 187(1), 63–80. https://doi.org/10.1016/0022-0981(94)00172-A

Aguileta, G., Bielawski, J. P., & Yang, Z. (2004). Gene conversion and functional divergence

in the β-globin gene family. Journal of Molecular Evolution, 59(2), 177–189.

https://doi.org/10.1007/s00239-004-2612-0

Alkarkhi, F. A., Ismail, N., & Easa, A. M. (2008). Assessment of arsenic and heavy metal

contents in cockles (Anadara granosa) using multivariate statistical techniques. Journal

of hazardous materials, 150(3), 783-789. https://doi.org/10.1016/j.jhazmat.2007.05.035

Alyakrinskaya, I. O. (2002). Physiological and biochemical adaptations to respiration of

haemoglobin-containing hydrobionts. Biology Bulletin of the Russian Academy of

Sciences, 29(3), 268–283. https://doi.org/10.1023/A:1015438615417

Andrews, S. (2010). FastQC: A quality control tool for high throughput sequence data.

Angelini, E., Salvato, B., Muro, P. D., & Beltramini, M. (1998). Respiratory pigments of

Yoldia eightsi, an Antarctic bivalve. Marine Biology, 131(1), 15–23.

https://doi.org/10.1007/s002270050291

Antonini, E., & Chiancone, E. (1977). Assembly of multisubunit respiratory proteins. Annual

Review of Biophysics and Bioengineering, 6(1), 239–271.

https://doi.org/10.1146/annurev.bb.06.060177.001323

Arp, A. J., Childress, J. J., & Fisher, C. R. (1984). Metabolic and blood gas transport

characteristics of the hydrothermal vent bivalve Calyptogena magnifica. Physiological

Zoology, 57(6), 648–662. https://doi.org/%7B%7Barticle.doi%7D%7D

References 69

At, G., & Eo, T. (1984). Amino acid sequence of the beta-chain of the tetrameric

haemoglobin of the bivalve mollusc, Anadara trapezia. Australian Journal of Biological

Sciences, 38(3), 221–236. https://doi.org/10.1071/BI9800653

Baldwin, J., & Lee, A. K. (1978). Contributions of aerobic and anaerobic energy production

during swimming in the bivalve mollusc Limaria fragilis (family Limidae). Journal of

Comparative Physiology, 129(4), 361–364. https://doi.org/10.1007/BF00686994

Bao, Y. B., Wang, Q., Guo, X. M., & Lin, Z. H. (2013a). Structure and immune expression

analysis of haemoglobin genes from the blood clam Tegillarca granosa. Genetics and

Molecular Research, 12(3), 3110–3123. http://dx.doi.org/10.4238/2013.February.28.5

Bao, Y., Li, P., Dong, Y., Xiang, R., Gu, L., Yao, H., …& Lin, Z. (2013b). Polymorphism of

the multiple haemoglobins in blood clam Tegillarca granosa and its association with

disease resistance to Vibrio parahaemolyticus. Fish & Shellfish Immunology, 34(5), 1320–

1324. https://doi.org/10.1016/j.fsi.2013.02.022

Bao, Y., & Lin, Z. (2010). Generation, annotation, and analysis of ESTs from hemocyte of

the bloody clam, Tegillarca granosa. Fish & Shellfish Immunology, 29(5), 740–746.

https://doi.org/10.1016/j.fsi.2010.07.009

Bashford, D., Chothia, C., & Lesk, A. M. (1987). Determinants of a protein fold. Journal of

Molecular Biology, 196(1), 199–216. https://doi.org/10.1016/0022-2836(87)90521-3

Berg Jr, C. J. (1980). Description of living specimens of Calyptogena magnifica Boss and

Turner with notes on their distribution and ecology. Appendix 1. The giant white clam

from the Galapagos Rift, Calyptogena magnifica species novum. Malacologia, 20, 183–

185.

Bikard, D., Patel, D., Metté, C. L., Giorgi, V., Camilleri, C., Bennett, M. J., & Loudet, O.

(2009). Divergent Evolution of Duplicate Genes Leads to Genetic Incompatibilities Within

70 References

Arabidopsis thaliana. Science, 323(5914), 623–626.

https://doi.org/10.1126/science.1165917

Birchler, J. A., & Veitia, R. A. (2010). The gene balance hypothesis: implications for gene

regulation, quantitative traits and evolution. New Phytologist, 186(1), 54–62.

https://doi.org/10.1111/j.1469-8137.2009.03087.x

Bischof, J. M., Chiang, A. P., Scheetz, T. E., Stone, E. M., Casavant, T. L., Sheffield, V. C.,

& Braun, T. A. (2006). Genome-wide identification of pseudogenes capable of disease-

causing gene conversion. Human Mutation, 27(6), 545–552.

https://doi.org/10.1002/humu.20335

Blank, M., & Burmester, T. (2012). Widespread occurrence of N-terminal acylation in animal

globins and possible origin of respiratory globins from a membrane-bound ancestor.

Molecular Biology and Evolution, 23(11), 3553–3561.

https://doi.org/10.1093/molbev/mss164

Blank, M., Kiger, L., Thielebein, A., Gerlach, F., Hankeln, T., Marden, M. C., & Burmester,

T. (2011). Oxygen supply from the bird’s eye perspective globin E is a respiratory protein

in the chicken retina. Journal of Biological Chemistry, 286(30), 26507–26515.

https://doi.org/10.1074/jbc.M111.224634

Booth, C. E., McDonald, D. G., & Walsh, P. J. (1984). Acid-base balance in the sea mussel,

Mytilus edulis. I. Effects of hypoxia and air-exposure on haemolymph acid-base status.

Marine Biology Letters, 5, 347–358.

Brooks, S. P. J., Zwaan, A. de, Thillart, G. van den, Cattani, O., Cortesi, P., & Storey, K. B.

(1991). Differential survival of Venus gallina and Scapharca inaequivalvis during anoxic

stress: Covalent modification of phosphofructokinase and glycogen phosphorylase during

anoxia. Journal of Comparative Physiology , 161(2), 207–212.

https://doi.org/10.1007/BF00262885

References 71

Brunori, M., & Vallone, B. (2007). Neuroglobin, seven years after. Cellular and Molecular

Life Sciences, 64(10), 1259. https://doi.org/10.1007/s00018-007-7090-2

Burmester, T., & Hankeln, T. (2014). Function and evolution of vertebrate globins. Acta

Physiologica, 211(3), 501–514. https://doi.org/10.1111/apha.12312

Burmester, T., & Hankeln, T. (2009). What is the function of neuroglobin? Journal of

Experimental Biology, 212(10), 1423–1428. https://doi.org/10.1242/jeb.000729

Burmester, T., & Hankeln, T. (2004). Neuroglobin: A Respiratory Protein of the Nervous

System. Physiology, 19(3), 110–113. https://doi.org/10.1152/nips.01513.2003

Burmester, T., Weich, B., Reinhardt, S., & Hankeln, T. (2000). A vertebrate globin expressed

in the brain. Nature, 407(6803), 520–523. https://doi.org/10.1038/35035093

Burnett, L. E. (1997). The challenges of living in hypoxic and hypercapnic aquatic

environments. American Zoologist, 37(6), 633–640. https://doi.org/10.1093/icb/37.6.633

Cañestro, C., Albalat, R., Irimia, M., & Garcia-Fernàndez, J. (2013). Impact of gene gains,

losses and duplication modes on the origin and diversification of vertebrates. Seminars in

Cell & Developmental Biology, 24(2), 83–94.

https://doi.org/10.1016/j.semcdb.2012.12.008

Carney, S. L., Flores, J. F., Orobona, K. M., Butterfield, D. A., Fisher, C. R., & Schaeffer, S.

W. (2007). Environmental differences in haemoglobin gene expression in the

hydrothermal vent tubeworm, Ridgeia piscesae. Comparative Biochemistry and

Physiology Part B: Biochemistry and Molecular Biology, 146(3), 326-337.

https://doi.org/10.1016/j.cbpb.2006.11.002

Ching Ming Chung, M., & Ellerton, H. D. (1980). The physico-chemical and functional

properties of extracellular respiratory haemoglobins and chlorocruorins. Progress in

Biophysics and Molecular Biology, 35, 53–102. https://doi.org/10.1016/0079-

6107(80)90003-6

72 References

Como, P. F., & Thompson, E. O. P. (1980a). Amino acid sequence of the α-chain of the

tetrameric haemoglobin of the bivalve mollusc Anadara trapezia. Australian Journal of

Biological Sciences, 33(6), 653–664. https://doi.org/10.1071/BI9800653

Como, P. F., & Thompson, E. O. P. (1980b). Multiple haemoglobins of the bivalve mollusc

Anadara trapezia. Australian Journal of Biological Sciences, 33(6), 643–652.

https://doi.org/10.1071/BI9800643

Corti, P., Xue, J., Tejero, J., Wajih, N., Sun, M., Stolz, D. B., … & Gladwin, M. T. (2016).

Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood

cells. Proceedings of the National Academy of Sciences, 113(30), 8538–8543.

https://doi.org/10.1073/pnas.1522670113

Crenshaw, M. A., & Neff, J. M. (1969). Decalcification at the mantle-shell interface in

molluscs. American Zoologist, 9(3), 881–885. https://doi.org/10.1093/icb/9.3.881

Dando, P. R., Southward, A. J., Southward, E. C., Terwilliger, N. B., & Terwilliger, R. C.

(1985). Sulphur-oxidising bacteria and haemoglobin in gills of the bivalve mollusc Myrtea

spinifera. Retrieved from http://agris.fao.org/agris-

search/search.do?recordID=AV20120126232

Darawshe, S., Tsafadyah, Y., & Daniel, E. (1987). Quaternary structure of erythrocruorin

from the nematode Ascaris suum. Evidence for unsaturated haem-binding sites.

Biochemical Journal, 242(3), 689–694. https://doi.org/10.1042/bj2420689

Davenport, J., & Wong, T. M. (1986). Responses of the blood cockle Anadara granosa (L.)

(Bivalvia: Arcidae) to salinity, hypoxia and aerial exposure. Aquaculture, 56(2), 151–162.

https://doi.org/10.1016/0044-8486(86)90024-4

De Zwaan, A., Cattan, O., & Putzer, V. M. (1993). Sulfide and cyanide induced mortality and

anaerobic metabolism in the arcid blood clam Scapharca inaequivalvis. Comparative

References 73

Biochemistry and Physiology Part C: Comparative Pharmacology, 105(1), 49–54.

https://doi.org/10.1016/0742-8413(93)90056-Q

Decker, C., Zorn, N., Le Bruchec, J., Caprais, J. C., Potier, N., Leize-Wagner, E., ... &

Andersen, A. C. (2016). Can the haemoglobin characteristics of vesicomyid clam species

influence their distribution in deep-sea sulfide-rich sediments? A case study in the Angola

Basin. Deep Sea Research Part II: Topical Studies in Oceanography.

http://dx.doi.org/10.1016/j.dsr2.2016.11.009

Decker, C., Zorn, N., Potier, N., Leize-Wagner, E., Lallier, F. H., Olu, K., & Andersen, A. C.

(2014). Globin’s structure and function in vesicomyid bivalves from the gulf of guinea

cold seeps as an adaptation to life in reduced sediments. Physiological and Biochemical

Zoology: Ecological and Evolutionary Approaches, 87(6), 855–869.

https://doi.org/10.1086/678131

Des Marais, D. L., & Rausher, M. D. (2008). Escape from adaptive conflict after duplication

in an anthocyanin pathway gene. Nature, 454(7205), 762–765.

https://doi.org/10.1038/nature07092

Dewilde, S., Angelini, E., Kiger, L., Marden, M., Beltramini, M., Salvato, B., & Moens, L.

(2003). Structure and function of the globin and globin gene from the Antarctic mollusc

Yoldia eightsi. Biochemical Journal, 370, 245–253. https://doi.org/10.1042/bj20020727

Dewilde, S., Hauwaert, M.-. L., Peeters, K., Vanfleteren, J., & Moens, L. (1999). Daphnia

pulex didomain haemoglobin: structure and evolution of polymeric haemoglobins and

their coding genes. Molecular Biology Evolution, 16.

https://doi.org/10.1093/oxfordjournals.molbev.a026211

Dixon, B., Walker, B., Kimmins, W., & Pohajdak, B. (1991). Isolation and sequencing of a

cDNA for an unusual haemoglobin from the parasitic nematode Pseudoterranova

74 References

decipiens. Proceedings of the National Academy of Sciences, 88(13), 5655–5659.

https://doi.org/10.1073/pnas.88.13.5655

Doeller, J. E., Kraus, D. W., Colacino, J. M., & Wittenberg, J. B. (1988). Gill Haemoglobin

May Deliver Sulfide to Bacterial Symbionts of Solemya velum (Bivalvia, Mollusca). The

Biological Bulletin, 175(3), 388–396. https://doi.org/%7B%7Barticle.doi%7D%7D

Donaghy, L., Lambert, C., Choi, K. S., & Soudant, P. (2009). Hemocytes of the carpet shell

clam (Ruditapes decussatus) and the Manila clam (Ruditapes philippinarum): current

knowledge and future prospects. Aquaculture, 297(1), 10-24.

Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research, 32(5), 1792–1797.

https://doi.org/10.1093/nar/gkh340

Efstratiadis, A., Posakony, J. W., Maniatis, T., Lawn, R. M., O’Connell, C., Spritz, R. A., …

& Blechl, A.E. (1980). The structure and evolution of the human β-globin gene family.

Cell, 21(3), 653–668. https://doi.org/10.1016/0092-8674(80)90429-8

Ekblom, R., & Galindo, J. (2011). Applications of next generation sequencing in molecular

ecology of non-model organisms. Heredity, 107(1), 1–15.

https://doi.org/10.1038/hdy.2010.152

FAO. (2009). Fisheries & Aquaculture - Fishery statistical collections - global aquaculture

production. Retrieved August 23, 2016, from http://www.fao.org/fishery/statistics/global-

aquaculture-production/en

Finn, R. D., Miller, B. L., Clements, J., & Bateman, A. (2014). iPfam: a database of protein

family and domain interactions found in the Protein Data Bank. Nucleic Acids Research,

42(D1), D364–D373. https://doi.org/10.1093/nar/gkt1210

References 75

Fisher, A., Comly, M., Do, R., Temarkin, L., Ghazanfari, A. F., & Mukherjee, A. B. (1984).

Two pools of β-endorphin-like immunoreactivity in blood: plasma and erythrocytes. Life

Sciences, 34(19), 1839–1846. https://doi.org/10.1016/0024-3205(84)90677-5

Flögel, U., Merx, M. W., Gödecke, A., Decking, U. K. M., & Schrader, J. (2001).

Myoglobin: A scavenger of bioactive NO. Proceedings of the National Academy of

Sciences, 98(2), 735–740. https://doi.org/10.1073/pnas.98.2.735

Flores, J. F., Fisher, C. R., Carney, S. L., Green, B. N., Freytag, J. K., Schaeffer, S. W., &

Royer, W. E. (2005). Sulfide binding is mediated by zinc ions discovered in the crystal

structure of a hydrothermal vent tubeworm haemoglobin. Proceedings of the National

Academy of Sciences of the United States of America, 102(8), 2713–2718.


Foote, A. D., Liu, Y., Thomas, G. W. C., Vinař, T., Alföldi, J., Deng, J., … & Gibbs, R. A.

(2015). Convergent evolution of the genomes of marine mammals. Nature Genetics, 47(3),

272–275. https://doi.org/10.1038/ng.3198

Force, A., Lynch, M., Pickett, F. B., Amores, A., Yan, Y., & Postlethwait, J. (1999).

Preservation of Duplicate Genes by Complementary, Degenerative Mutations. Genetics,

151(4), 1531–1545.

Fuchs, C., Burmester, T., & Hankeln, T. (2006). The amphibian globin gene repertoire as

revealed by the Xenopus genome. Cytogenetic and Genome Research, 112(3–4), 296–306.

Furuta, H., & Kajita, A. (1983). Dimeric haemoglobin of the bivalve mollusc Anadara

broughtonii: complete amino acid sequence of the globin chain. Biochemistry, 22(4), 917–

922. https://doi.org/10.1021/bi00273a032

Gallant, J. R., Traeger, L. L., Volkening, J. D., Moffett, H., Chen, P.-H., Novina, C. D., … &

Sussman, M. R. (2014). Genomic basis for the convergent evolution of electric organs.

Science, 344(6191), 1522–1525. https://doi.org/10.1126/science.1254432

76 References

Garcia, H. E., Boyer, T. P., Levitus, S., Locarnini, R. A., & Antonov, J. (2005). On the

variability of dissolved oxygen and apparent oxygen utilization content for the upper

world ocean: 1955 to 1998. Geophysical Research Letters, 32(9).

https://doi.org/10.1029/2004GL022286

Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R. D., & Bairoch, A. (2003).

ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic

Acids Research, 31(13), 3784–3788.

Gobler, C. J., DePasquale, E. L., Griffith, A. W., & Baumann, H. (2014). Hypoxia and

acidification have additive and synergistic negative effects on the growth, survival, and

metamorphosis of early life stage bivalves. PLoS one, 9(1), e83648.

https://doi.org/10.1371/journal.pone.0083648

Golovina, I. V., Gostyukhina, O. L., & Andreyenko, T. I. (2016). Specific metabolic features

in tissues of the ark clam Anadara kagoshimensis. Russian Journal of Biological

Invasions, 7(2), 137-145.

González, V. L., Andrade, S. C. S., Bieler, R., Collins, T. M., Dunn, C. W., Mikkelsen, P. M.,

Taylor, J.D., & Giribet, G. (2015). A phylogenetic backbone for Bivalvia: an RNA-seq

approach. Proceedings of the Royal Society B, 282(1801), 20142332.

https://doi.org/10.1098/rspb.2014.2332

Goodman, M., Czelusniak, J., Koop, B. F., Tagle, D. A., & Slightom, J. L. (1987). Globins: A

case study in molecular phylogeny. Cold Spring Harbor Symposia on Quantitative

Biology, 52, 875–890. https://doi.org/10.1101/SQB.1987.052.01.096

Goossens, M., Dozy, A. M., Embury, S. H., Zachariades, Z., Hadjiminas, M. G.,

Stamatoyannopoulos, G., & Kan, Y. W. (1980). Triplicated alpha-globin loci in humans.

Proceedings of the National Academy of Sciences, 77(1), 518–521.

References 77

Götting, M., & Nikinmaa, M. (2015). More than haemoglobin – the unexpected diversity of

globins in vertebrate red blood cells. Physiological Reports, 3(2), e12284.

https://doi.org/10.14814/phy2.12284

Gow, A. J., Payson, A. P., & Bonaventura, J. (2005). Invertebrate haemoglobins and nitric

oxide: How heme pocket structure controls reactivity. Journal of Inorganic Biochemistry,

99(4), 903–911. https://doi.org/10.1016/j.jinorgbio.2004.12.001

Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I., … &

Regev, A. (2011). Full-length transcriptome assembly from RNA-Seq data without a

reference genome. Nature Biotechnology, 29(7), 644–652.

https://doi.org/10.1038/nbt.1883

Gribaldo, S., Casane, D., Lopez, P., & Philippe, H. (2003). Functional divergence prediction

from evolutionary analysis: A case study of vertebrate haemoglobin. Molecular Biology

and Evolution, 20(11), 1754–1759. https://doi.org/10.1093/molbev/msg171

Grinich, N. P., & Terwilliger, R. C. (1980). The quarternary structure of an unusual high-

molecular-weight intracellular haemoglobin from the bivalve mollusc Barbatia reeveana.

Biochemical Journal, 189(1), 1–8. https://doi.org/10.1042/bj1890001

Grispo, M. T., Natarajan, C., Projecto-Garcia, J., Moriyama, H., Weber, R. E., & Storz, J. F.

(2012). Gene duplication and the evolution of haemoglobin isoform differentiation in

birds. Journal of Biological Chemistry, 287(45), 37647–37658.

https://doi.org/10.1074/jbc.M112.375600

Guo, X. (2009). Use and exchange of genetic resources in molluscan aquaculture. Reviews in

Aquaculture, 1(3–4), 251–259. https://doi.org/10.1111/j.1753-5131.2009.01014.x

Haas, B. J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P. D., Bowden, J.,… &

Regev, A. (2013). De novo transcript sequence reconstruction from RNA-seq using the

78 References

Trinity platform for reference generation and analysis. Nature Protocols, 8(8), 1494–1512.

https://doi.org/10.1038/nprot.2013.084

Halanych, K. M., & Passamaneck, Y. (2001). A brief review of metazoan phylogeny and

future prospects in hox-research. American Zoologist, 41(3), 629–639.

https://doi.org/10.1093/icb/41.3.629

Hankeln, T., Ebner, B., Fuchs, C., Gerlach, F., Haberkamp, M., Laufs, T. L., …& Burmester,

T. (2005). Neuroglobin and cytoglobin in search of their role in the vertebrate globin

family. Journal of Inorganic Biochemistry, 99(1), 110–119.

https://doi.org/10.1016/j.jinorgbio.2004.11.009

Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, D., Dillon, N., & Grosveld,

F. (1991). Importance of globin gene order for correct developmental expression. Genes &

Development, 5(8), 1387–1394. https://doi.org/10.1101/gad.5.8.1387

Hardison, R., Slightom, J. L., Gumucio, D. L., Goodman, M., Stojanovic, N., & Miller, W.

(1997). Locus control regions of mammalian β-globin gene clusters: combining

phylogenetic analyses and experimental results to gain functional insights. Gene, 205(1–

2), 73–94. https://doi.org/10.1016/S0378-1119(97)00474-5

Hardison, R. (1996). A brief history of haemoglobins: plant, animal, protist, and bacteria.

Proceedings of the National Academy of Sciences of the United States of America, 93(12),

5675.

Harper, E. M., & Skelton, P. W. (1993). The Mesozoic marine revolution and epifaunal

bivalves. Scripta Geologica, Special, (2), 127–153.

He, X., & Zhang, J. (2005). Rapid subfunctionalization accompanied by prolonged and

substantial neofunctionalization in duplicate gene evolution. Genetics, 169(2), 1157–1164.

https://doi.org/10.1534/genetics.104.037051

References 79

Herreid, C. F. (1980). Hypoxia in invertebrates. Comparative Biochemistry and Physiology

Part A: Physiology, 67(3), 311–320. https://doi.org/10.1016/S0300-9629(80)80002-8

Higgs, D. R., Old, J. M., Pressley, L., Clegg, J. B., & Weatherall, D. J. (1980). A novel

[alpha]-globin gene arrangement in man. Nature, 284(5757), 632–635.

https://doi.org/10.1038/284632a0

Hoffmann, F. G., Opazo, J. C., Hoogewijs, D., Hankeln, T., Ebner, B., Vinogradov, S. N., …

& Storz, J. F. (2012). Evolution of the globin gene family in deuterostomes: lineage-

specific patterns of diversification and attrition. Molecular Biology and Evolution, 29(7),

1735–1745. https://doi.org/10.1093/molbev/mss018

Hoffmann, F. G., Opazo, J. C., & Storz, J. F. (2011). Differential loss and retention of

cytoglobin, myoglobin, and globin-E during the radiation of vertebrates. Genome Biology

and Evolution, 3, 588–600. https://doi.org/10.1093/gbe/evr055

Hoffmann, F. G., Opazo, J. C., & Storz, J. F. (2010a). Gene cooption and convergent

evolution of oxygen transport haemoglobins in jawed and jawless vertebrates. Proceedings

of the National Academy of Sciences, 107(32), 14274–14279.


Hoffmann, F. G., Storz, J. F., Gorr, T. A., & Opazo, J. C. (2010b). Lineage-specific patterns

of functional diversification in the α- and β-globin gene families of tetrapod vertebrates.


https://doi.org/10.1093/molbev/msp325

Hoffmann, F. G., & Storz, J. F. (2007). The αD-globin gene originated via duplication of an

embryonic α-like globin gene in the ancestor of tetrapod vertebrates. Molecular Biology

and Evolution, 24(9), 1982–1990. https://doi.org/10.1093/molbev/msm127

Hokamp, K., McLysaght, A., & Wolfe, K. H. (2003). The 2R hypothesis and the human

genome sequence. In A. Meyer & Y. V. de Peer (Eds.), Genome Evolution (pp. 95–110).

80 References

Springer Netherlands. Retrieved from http://link.springer.com/chapter/10.1007/978-94-

010-0263-9_10

Holden, J. A., Pipe, R. K., Quaglia, A., & Ciani, G. (1994). Blood cells of the arcid clam,

Scapharca inaequivalvis. Journal of the Marine Biological Association of the United

Kingdom, 74(02), 287-299.

Hoogewijs, D., Ebner, B., Germani, F., Hoffmann, F. G., Fabrizius, A., Moens, L., … &

Hankeln, T. (2011). Androglobin: A chimeric globin in metazoans that is preferentially

expressed in mammalian testes. Molecular Biology and Evolution, 29(4), 1105-1114.

https://doi.org/10.1093/molbev/msr246

Hourdez, S., & Lallier, F. H. (2006). Adaptations to hypoxia in hydrothermal-vent and cold-

seep invertebrates. Reviews in Environmental Science and Bio/Technology, 6(1–3), 143–

159. https://doi.org/10.1007/s11157-006-9110-3

Hourdez, S., & Weber, R. E. (2005). Molecular and functional adaptations in deep-sea

haemoglobins. Journal of Inorganic Biochemistry, 99(1), 130–141.

https://doi.org/10.1016/j.jinorgbio.2004.09.017

Hourdez, S., Lamontagne, J., Peterson, P., Weber, R. E., & Fisher, C. R. (2000).

Haemoglobin from a deep-sea hydrothermal-vent copepod. The Biological Bulletin,

199(2), 95–99.

Huang, Y., Niu, B., Gao, Y., Fu, L., & Li, W. (2010). CD-HIT Suite: a web server for

clustering and comparing biological sequences. Bioinformatics, 26(5), 680–682.

https://doi.org/10.1093/bioinformatics/btq003

Huerta-Cepas, J., Dopazo, J., Huynen, M. A., & Gabaldon, T. (2011). Evidence for short-time

divergence and long-time conservation of tissue-specific expression after gene duplication.

Briefings in Bioinformatics, 12(5), 442–448. https://doi.org/10.1093/bib/bbr022

References 81

Hurles, M. (2004). Gene duplication: the genomic trade in spare parts. PLoS Biology, 2(7),

e206. https://doi.org/10.1371/journal.pbio.0020206

Ikeda-Saito, M., Yonetani, T., Chiancone, E., Ascoli, F., Verzili, D., & Antonini, E. (1983).

Thermodynamic properties of oxygen equilibria of dimeric and tetrameric haemoglobins

from Scapharca inaequivalvis. Journal of Molecular Biology, 170(4), 1009–1018.

https://doi.org/10.1016/S0022-2836(83)80200-9

Ingram, V. M. (1961). Gene evolution and the haemoglobins. Nature, 189(4766), 704-708.

Innan, H., & Kondrashov, F. (2010). The evolution of gene duplications: classifying and

distinguishing between models. Nature Reviews Genetics, 11(2), 97–108.

https://doi.org/10.1038/nrg2689

Jellie, A. M., Tate, W. P., & Trotman, C. N. A. (1996). Evolutionary history of introns in a

multidomain globin gene. Journal of Molecular Evolution, 42(6), 641–647.

https://doi.org/10.1007/BF02338797

Jokumsen, A., & Fyhn, H. J. (1982). The influence of aerial exposure upon respiratory and

osmotic properties of haemolymph from two intertidal mussels, Mytilus edulis L. and

Modiolus modiolus L. Journal of Experimental Marine Biology and Ecology, 61(2), 189–

203. https://doi.org/10.1016/0022-0981(82)90008-9

Kaessmann, H. (2010). Origins, evolution, and phenotypic impact of new genes. Genome

Research, 20(10), 1313–1326. https://doi.org/10.1101/gr.101386.109

Karstensen, J., Stramma, L., & Visbeck, M. (2008). Oxygen minimum zones in the eastern

tropical Atlantic and Pacific oceans. Progress in Oceanography, 77(4), 331–350.

https://doi.org/10.1016/j.pocean.2007.05.009

Kato, K., Tokishita, S., Mandokoro, Y., Kimura, S., Ohta, T., Kobayashi, M., & Yamagata,

H. (2001). Two-domain haemoglobin gene of the water flea Moina macrocopa:

82 References

duplication in the ancestral Cladocera, diversification, and loss of a bridge intron. Gene,

273(1), 41–50. https://doi.org/10.1016/S0378-1119(01)00569-8

Kawano, K., Iwasaki, N., & Suzuki, T. (2003). Notable diversity in haemoglobin expression

patterns among species of the deep-sea clam, Calyptogena. Cellular and Molecular Life

Sciences CMLS, 60(9), 1952–1956. https://doi.org/10.1007/s00018-003-3184-7

Koch, J., & Burmester, T. (2016). Membrane-bound globin X protects the cell from reactive

oxygen species. Biochemical and Biophysical Research Communications, 469(2), 275–

280. https://doi.org/10.1016/j.bbrc.2015.11.105

Koch, J., Lüdemann, J., Spies, R., Last, M., Amemiya, C. T., & Burmester, T. (2016).

Unusual diversity of myoglobin genes in the lungfish. Molecular Biology and Evolution,

msw159. https://doi.org/10.1093/molbev/msw159

Koch, L. G., & Britton, S. L. (2008). Aerobic metabolism underlies complexity and capacity.

The Journal of Physiology, 586(1), 83–95. https://doi.org/10.1113/jphysiol.2007.144709

Kugelstadt, D., Haberkamp, M., Hankeln, T., & Burmester, T. (2004). Neuroglobin,

cytoglobin, and a novel, eye-specific globin from chicken. Biochemical and Biophysical

Research Communications, 325(3), 719–725. https://doi.org/10.1016/j.bbrc.2004.10.080

Lan, X., & Pritchard, J. K. (2016). Coregulation of tandem duplicate genes slows evolution of

subfunctionalization in mammals. Science, 352(6288), 1009–1013.

https://doi.org/10.1126/science.aad8411

Linzen, B., Soeter, N. M., Riggs, A. F., Schneider, H. J., Schartau, W., & Moore, M. D.

(1985). The structure of arthropod hemocyanins. Science, 229(4713), 519–524.


Liu, Y., Cotton, J. A., Shen, B., Han, X., Rossiter, S. J., & Zhang, S. (2010). Convergent

sequence evolution between echolocating bats and dolphins. Current Biology, 20(2), R53–

R54. https://doi.org/10.1016/j.cub.2009.11.058

References 83

Lynch, M., & Force, A. (2000). The probability of duplicate gene preservation by

subfunctionalization. Genetics, 154(1), 459–473.

Maeda, N., & Fitch, W. M. (1982). Frog heart monomeric haemoglobin. In Methods in

Protein Sequence Analysis (Eds), (pp. 569–570). Humana Press. Retrieved from

http://link.springer.com/chapter/10.1007/978-1-4612-5832-2_63

Mangum, C. P. (1998). Major Events in the Evolution of the Oxygen Carriers. American

Zoologist, 38(1), 1–13.

Mangum, C. P. (1997). Introduction The Red Blood Cell Haemoglobins Distribution and

localization Molecular structure. (Vol. 2).

Mangum, C. P. (1992). Respiratory function of the red blood cell haemoglobins of six animal

phyla. In C. P. Mangum (Eds.), Blood and Tissue Oxygen Carriers (pp. 117–149). Berlin,

Heidelberg: Springer Berlin Heidelberg. Retrieved from http://dx.doi.org/10.1007/978-3-

642-76418-9_5

Mangum, C. P., Scott, J. L., Miller, K. I., Holde, K. E. V., & Morse, M. P. (1987). Bivalve

hemocyanin: structural, functional, and phylogenetic relationships. The Biological

Bulletin, 173(1), 205–221.

Mangum, C. P., Woodin, B. R., Bonaventura, C., Sullivan, B., & Bonaventura, J. (1975). The

role of coelomic and vascular haemoglobin in the annelid family Terebellidae.

Comparative Biochemistry and Physiology Part A: Physiology, 51(2), 281–294.

https://doi.org/10.1016/0300-9629(75)90372-2

Mann, R. G., Fisher, W. K., Gilbert, A. T., & Thompson, E. O. P. (1986). Genetic variation

of the dimeric haemoglobin of the bivalve mollusc Anadara trapezia. Australian Journal

of Biological Sciences, 39(2), 109–116.

Manning, A. M., Trotman, C. N. A., & Tate, W. P. (1990). Evolution of a polymeric globin in

the brine shrimp Artemia. Nature, 348(6302), 653–656. https://doi.org/10.1038/348653a0

84 References

Manwell, C. (1963). The chemistry and biology of haemoglobin in some marine clams—I.

Distribution of the pigment and properties of the oxygen equilibrium. Comparative

Biochemistry and Physiology, 8(3), 209–218. https://doi.org/10.1016/0010-

406X(63)90125-7

Michaelidis, B., Haas, D., & Grieshaber, M. K. (2005). Extracellular and intracellular acid‐

base status with regard to the energy metabolism in the oyster Crassostrea gigas during

exposure to air. Physiological and Biochemical Zoology: Ecological and Evolutionary

Approaches, 78(3), 373–383. https://doi.org/10.1086/430223

Mikkelsen, P. M., & Bieler, R. (2003). Systematic revision of the western Atlantic file clams,

Lima and Ctenoides (Bivalvia : Limoida : Limidae). Invertebrate Systematics, 17(5), 667–

710.

Moleirinho, A., Seixas, S., Lopes, A. M., Bento, C., Prata, M. J., & Amorim, A. (2013).

Evolutionary constraints in the β-globin cluster: The signature of purifying selection at the

δ-globin (HBD) locus and its role in developmental gene regulation. Genome Biology and

Evolution, 5(3), 559–571. https://doi.org/10.1093/gbe/evt029

Montes-Rodríguez, I. M., Rivera, L. E., López-Garriga, J., & Cadilla, C. L. (2016).

Characterization and expression of the Lucina pectinata oxygen and sulfide binding

haemoglobin genes. PLoS one, 11(1), e0147977.


Moriyama, Y., Ito, F., Takeda, H., Yano, T., Okabe, M., Kuraku, S., ... & Koshiba-Takeuchi,

K. (2016). Evolution of the fish heart by sub/neofunctionalization of an elastin

gene. Nature communications, 7.

Morse, M. P., Meyhofer, E., Otto, J. J., & Kuzirian, A. M. (1986). Hemocyanin respiratory

pigment in bivalve mollusks. Science, 231(4743), 1302–1304.


References 85

Motoyama, H., Komiya, T., Thuy, L. T. T., Tamori, A., Enomoto, M., Morikawa, H., … &

Kawada, N. (2014). Cytoglobin is expressed in hepatic stellate cells, but not in

myofibroblasts, in normal and fibrotic human liver. Laboratory Investigation, 94(2), 192–

207. https://doi.org/10.1038/labinvest.2013.135

Naito, Y., Riggs, C. K., Vandergon, T. L., & Riggs, A. F. (1991). Origin of a “bridge” intron

in the gene for two domain globin. Proceedings of the National Academy of Sciences of

the USA, 88(15). https://doi.org/10.1073/pnas.88.15.6672

Natarajan, C., Projecto-Garcia, J., Moriyama, H., Weber, R. E., Muñoz-Fuentes, V., Green,

A. J., … & Storz, J. F. (2015). Convergent Evolution of Haemoglobin Function in High-

Altitude Andean Waterfowl Involves Limited Parallelism at the Molecular Sequence

Level. PLoS Genetics, 11(12), e1005681. https://doi.org/10.1371/journal.pgen.1005681

Negrisolo, E., Pallavicini, A., Barbato, R., Dewilde, S., Ghiretti-Magaldi, A., Moens, L., &

Lanfranchi, G. (2001). The evolution of extracellular haemoglobins of annelids,

vestimentiferans, and pogonophorans. Journal of Biological Chemistry, 276(28), 26391–

26397. https://doi.org/10.1074/jbc.M100557200

Nicol, P. I., & O’Gower, A. K. (1967). Haemoglobin variation in Anadara trapezia. Nature,

216, 684. https://doi.org/10.1038/216684a0

Norman, J. D., Danzmann, R. G., Glebe, B., & Ferguson, M. M. (2011). The genetic basis of

salinity tolerance traits in Arctic charr (Salvelinus alpinus). BMC Genetics, 12(1), 81.

https://doi.org/10.1186/1471-2156-12-81

Officer, C. B., Biggs, R. B., Taft, J. L., Cronin, L. E., Tyler, M. A., & Boynton, W. R. (1984).

Chesapeake Bay anoxia: origin, development, and significance. Science, 223(6).

O’Gower, A., & Nicol, P. I. (1968). A latitudinal cline of haemoglobins in a bivalve mollusc.

Heredity, 23(4), 485–491.

86 References

Ohno, S., Wolf, U., & Atkin, N. B. (1968). Evolution from Fish to Mammals by Gene

Duplication. Hereditas, 59(1), 169–187. https://doi.org/10.1111/j.1601-

5223.1968.tb02169.x

Oleksiewicz, U., Liloglou, T., Field, J. K., & Xinarianos, G. (2011). Cytoglobin: biochemical,

functional and clinical perspective of the newest member of the globin family. Cellular

and Molecular Life Sciences, 68(23), 3869–3883. https://doi.org/10.1007/s00018-011-

0764-9

Opazo, J. C., Lee, A. P., Hoffmann, F. G., Toloza-Villalobos, J., Burmester, T., Venkatesh,

B., & Storz, J. F. (2015). Ancient duplications and expression divergence in the globin

gene superfamily of vertebrates: Insights from the elephant shark genome and

transcriptome. Molecular Biology and Evolution, 32(7), 1684-1694.

https://doi.org/10.1093/molbev/msv054

Opazo, J. C., Hoffmann, F. G., & Storz, J. F. (2008). Genomic evidence for independent

origins of β-like globin genes in monotremes and therian mammals. Proceedings of the

National Academy of Sciences, 105(5), 1590–1595.


Osborn, T. C., Pires, J.C., Birchler, J. A., Auger, D. L., Chen, Z.J., Lee, H.-S., …

Martienssen, R.A. (2003). Understanding mechanisms of novel gene expression in

polyploids. Trends in Genetics, 19(3), 141–147. https://doi.org/10.1016/S0168-

9525(03)00015-5

Parker, J., Tsagkogeorga, G., Cotton, J. A., Liu, Y., Provero, P., Stupka, E., & Rossiter, S. J.

(2013). Genome-wide signatures of convergent evolution in echolocating mammals.

Nature, 502(7470), 228–231. https://doi.org/10.1038/nature12511

Perutz, M., F. (1979). Regulation of oxygen affinity of haemoglobin: influence of structure of

the globin on the heme iron. Annual review of biochemistry, 48(1), 327–386.

References 87

Pesce, A., Bolognesi, M., Bocedi, A., Ascenzi, P., Dewilde, S., Moens, L., … & Burmester,

T. (2002). Neuroglobin and cytoglobin. EMBO reports, 3(12), 1146–1151.

Petruzzelli, R., Goffredo, B. M., Barra, D., Bossa, F., Boffi, A., Verzili, D., … & Chiancone,

E. (1985). Amino acid sequence of the cooperative homodimeric haemoglobin from the

mollusc Scapharca inaequivalvis and topology of the intersubunit contacts. FEBS Letters,

184(2), 328–332. https://doi.org/10.1016/0014-5793(85)80632-3

Piro, M. C., Gambacurta, A., Basili, P., & Ascoli, F. (1998). The exon/intron organization of

the globin gene of Scapharca inaequivalvis homodimeric haemoglobin: unusual intron

homology with other bivalve mollusc globin genes. Gene, 221(1), 45–49.

https://doi.org/10.1016/S0378-1119(98)00442-9

Piro, M. C., Gambacurta, A., & Ascoli, F. (1996). Scapharca inaequivalvis tetrameric

haemoglobin α and β chains: cDNA sequencing and genomic organization. Journal of

Molecular Evolution, 43(6), 594–601. https://doi.org/10.1007/BF02202107

Prentis, P. J., & Pavasovic, A. (2014). The Anadara trapezia transcriptome: A resource for

molluscan physiological genomics. Marine Genomics, 18, 113–115.

https://doi.org/10.1016/j.margen.2014.08.004

Projecto-Garcia, J., Jollivet, D., Mary, J., Lallier, F. H., Schaeffer, S. W., & Hourdez, S.

(2015). Selective forces acting during multi-domain protein evolution: the case of multi-

domain globins. SpringerPlus, 4(1), 1–14. https://doi.org/10.1186/s40064-015-1124-2

Projecto-Garcia, J., Zorn, N., Jollivet, D., Schaeffer, S. W., Lallier, F. H., & Hourdez, S.

(2010). Origin and evolution of the unique tetra-domain haemoglobin from the

hydrothermal vent scale worm branchipolynoe. Molecular Biology and Evolution, 27(1),

143–152. https://doi.org/10.1093/molbev/msp218

88 References

Rabalais, N. N., Diaz, R. J., Levin, L. A., Turner, R. E., Gilbert, D., & Zhang, J. (2010).

Dynamics and distribution of natural and human-caused hypoxia. Biogeosciences, 7(2),

585-619.

Rawat, R. (2010). Anatomy of Mollusca. Mittal Publications.

Read, K. R. (1966). Molluscan haemoglobin and myoglobin. Academic Press New York,

(Vol. 2).

Reitman, M., Grasso, J. A., Blumenthal, R., & Lewit, P. (1993). Primary sequence, evolution,

and repetitive elements of the Gallus gallus (chicken) β-globin cluster. Genomics, 18(3),

616–626. https://doi.org/10.1016/S0888-7543(05)80364-7

Riggs, A. F. (1991). Aspects of the origin and Evolution of Non-Vertebrate Haemoglobins.

American Zoologist, 31(3), 535–545. https://doi.org/10.1093/icb/31.3.535

Roeder, G. S. (1983). Unequal crossing-over between yeast transposable elements. Molecular

and General Genetics MGG, 190(1), 117–121.

Roesner, A., Fuchs, C., Hankeln, T., & Burmester, T. (2005). A globin gene of ancient

evolutionary origin in lower vertebrates: evidence for two distinct globin families in

animals. Molecular Biology and Evolution, 22(1), 12–20.

https://doi.org/10.1093/molbev/msh258

Ronda, L., Bettati, S., Henry, E. R., Kashav, T., Sanders, J. M., Royer, W. E., & Mozzarelli,

A. (2013). Tertiary and quaternary allostery in tetrameric haemoglobin from Scapharca

inaequivalvis. Biochemistry, 52(12), 2108–2117. https://doi.org/10.1021/bi301620x

Royer, W. E., Zhu, H., Gorr, T. A., Flores, J. F., & Knapp, J. E. (2005). Allosteric

haemoglobin assembly: diversity and similarity. Journal of Biological Chemistry, 280(30),

27477–27480. https://doi.org/10.1074/jbc.R500006200

Royer Jr, W. E., Knapp, J. E., Strand, K., & Heaslet, H. A. (2001). Cooperative

haemoglobins: conserved fold, diverse quaternary assemblies and allosteric mechanisms.

References 89

Trends in Biochemical Sciences, 26(5), 297–304. https://doi.org/10.1016/S0968-

0004(01)01811-4

Royer, W. E., Strand, K., Heel, M. van, & Hendrickson, W. A. (2000). Structural hierarchy in

erythrocruorin, the giant respiratory assemblage of annelids. Proceedings of the National

Academy of Sciences, 97(13), 7107–7111. https://doi.org/10.1073/pnas.97.13.7107

Royer, W. E., Love, W. E., & Fenderson, F. F. (1985). Cooperative dimeric and tetrameric

clam haemoglobins are novel assemblages of myoglobin folds. Nature, 316(6025), 277–

280. https://doi.org/10.1038/316277a0

Sankaran, V. G., Menne, T. F., Xu, J., Akie, T. E., Lettre, G., Handel, B. V., … & Orkin, S.

H. (2008). Human fetal haemoglobin expression is regulated by the developmental stage-

specific repressor BCL11A. Science, 322(5909), 1839–1842.


Schindelmeiser, I., Kuhlmann, D., & Nolte, A. (1979). Localization and characterization of

hemoproteins in the central nervous tissue of some gastropods. Comparative Biochemistry

and Physiology Part B: Comparative Biochemistry, 64(2), 149–154.

https://doi.org/10.1016/0305-0491(79)90153-6

Schwarze, K., Campbell, K. L., Hankeln, T., Storz, J. F., Hoffmann, F. G., & Burmester, T.

(2014). The globin gene repertoire of lampreys: convergent evolution of haemoglobin and

myoglobin in jawed and jawless vertebrates. Molecular Biology and Evolution, 31(10),

2708–2721. https://doi.org/10.1093/molbev/msu216

Scott, K. M., & Fisher, C. R. (1995). Physiological ecology of sulfide metabolism in

hydrothermal vent and cold seep vesicomyid clams and vestimentiferan tube worms.

American Zoologist, 35(2), 102–111. https://doi.org/10.1093/icb/35.2.102

Shumway, S. E., & Parsons, G. J. (2011). Scallops: Biology, Ecology and Aquaculture.

Elsevier.

90 References

Sidell, B. D., & O’Brien, K. M. (2006). When bad things happen to good fish: the loss of

haemoglobin and myoglobin expression in Antarctic icefishes. Journal of Experimental

Biology, 209(10), 1791–1802. https://doi.org/10.1242/jeb.02091

Singh, S., Canseco, D. C., Manda, S. M., Shelton, J. M., Chirumamilla, R. R., Goetsch, S. C.,

… & Mammen, P. P. A. (2014). Cytoglobin modulates myogenic progenitor cell viability

and muscle regeneration. Proceedings of the National Academy of Sciences, 111(1),

E129–E138. https://doi.org/10.1073/pnas.1314962111

Smith, M. H. (1967). Occurrence of haemoglobin in some molluscs. Comparative

Biochemistry and Physiology, 20(1), 361–364. https://doi.org/10.1016/0010-

406X(67)90755-4

Souza, P. C. de, & Bonilla-Rodriguez, G. O. (2007). Fish haemoglobins. Brazilian Journal of

Medical and Biological Research, 40(6), 769–778. https://doi.org/10.1590/S0100-

879X2007000600004

Stapley, J., Reger, J., Feulner, P. G. D., Smadja, C., Galindo, J., Ekblom, R., … Slate, J.

(2010). Adaptation genomics: the next generation. Trends in Ecology & Evolution, 25(12),

705–712. https://doi.org/10.1016/j.tree.2010.09.002

Storz, J. F., Bridgham, J. T., Kelly, S. A., & Garland, T. (2015). Genetic approaches in

comparative and evolutionary physiology. American Journal of Physiology - Regulatory,

Integrative and Comparative Physiology, 309(3), R197–R214.

https://doi.org/10.1152/ajpregu.00100.2015

Storz, J. F., Hoffmann, F. G., Opazo, J. C., & Moriyama, H. (2008). Adaptive functional

divergence among triplicated α-globin genes in rodents. Genetics, 178(3), 1623–1638.

https://doi.org/10.1534/genetics.107.080903

References 91

Storz, J. F., Opazo, J. C., & Hoffmann, F. G. (2013). Gene duplication, genome duplication,

and the functional diversification of vertebrate globins. Molecular Phylogenetics and

Evolution, 66(2), 469–478. https://doi.org/10.1016/j.ympev.2012.07.013

Stothard, P. (2000). The sequence manipulation suite: JavaScript programs for analyzing and

formatting protein and DNA sequences. BioTechniques, 28(6), 1102, 1104.

Strand, K., Knapp, J. E., Bhyravbhatla, B., & Royer Jr, W. E. (2004). Crystal structure of the

haemoglobin dodecamer from Lumbricus erythrocruorin: allosteric core of giant annelid

respiratory complexes. Journal of Molecular Biology, 344(1), 119–134.

https://doi.org/10.1016/j.jmb.2004.08.094

Su, C.-Y., Kemp, H. A., & Moens, C. B. (2014). Cerebellar development in the absence of

GbX function in zebrafish. Developmental Biology, 386(1), 181–190.

https://doi.org/10.1016/j.ydbio.2013.10.026

Sullivan, G. (1961). Functional morphology, micro-anatomy, and histology of the “Sydney

cockle” Anadara trapezia (Deshayes )(Lamellibranchia: Arcidae). Australian Journal of

Zoology, 9(2), 219–257.

Surm, J. M., Prentis, P. J., & Pavasovic, A. (2015). Comparative analysis and distribution of

omega-3 lcPUFA biosynthesis genes in marine molluscs. PLoS one, 10(8), e0136301.


Suzuki, T., Kawamichi, H., Ohtsuki, R., Iwai, M., & Fujikura, K. (2000). Isolation and

cDNA-derived amino acid sequences of haemoglobin and myoglobin from the deep-sea

clam Calyptogena kaikoi. Biochimica et Biophysica Acta (BBA)-Protein Structure and

Molecular Enzymology, 1478(1), 152–158.

Suzuki, T., Kawasaki, Y., Arita, T., & Nakamura, A. (1996). Two-domain haemoglobin of

the blood clam Barbatia lima resulted from the recent gene duplication of the single-

domain delta chain. Biochemical Journal, 313, 561–566.

92 References

Suzuki, T., & Arita, T. (1995). Two-domain haemoglobin from the blood clam, Barbatia

lima. The cDNA-derived amino acid sequence. Journal of Protein Chemistry, 14(7), 499–

502.

Suzuki, T., Nakamura, A., Satoh, Y., Inai, C., Furukohri, T., & Arita, T. (1992). Primary

structure of chain I of the heterodimeric haemoglobin from the blood clam Barbatia

virescens. Journal of Protein Chemistry, 11(6): 629–633 .

https://doi.org/10.1007/BF01024963

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular

Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30(12),

2725–2729. https://doi.org/10.1093/molbev/mst197

Terwilliger, N. B. (1998). Functional adaptations of oxygen-transport proteins. Journal of

Experimental Biology, 201(8), 1085–1098.

Terwilliger, N. B., Terwilliger, R. C., Meyhöfer, E., & Morse, M. P. (1988). Bivalve

hemocyanins—a comparison with other molluscan hemocyanins. Comparative

Biochemistry and Physiology Part B: Comparative Biochemistry, 89(1), 189–195.

https://doi.org/10.1016/0305-0491(88)90282-9

Terwilliger, R. C., Terwilliger, N. B., & Arp, A. (1983). Thermal vent clam (Calyptogena

magnifica) haemoglobin. Science, 219(4587), 981–983.

https://doi.org/10.1126/science.219.4587.981

Terwilliger, R. C. (1980). Structures of invertebrate haemoglobins. American Zoologist,

20(1), 53–67. https://doi.org/10.1093/icb/20.1.53

Terwilliger, R. C., Terwilliger, N. B., & Schabtach, E. (1978). Extracellular haemoglobin of

the clam, Cardita borealis (conrad): An unusual polymeric haemoglobin. Comparative

Biochemistry and Physiology Part B: Comparative Biochemistry, 59(1), 9–14.

https://doi.org/10.1016/0305-0491(78)90262-6

References 93

Titchen, D. A., Glenn, W. K., Nassif, N., Thompson, A. R., & Thompson, E. O. P. (1991). A

minor globin gene of the bivalve mollusc Anadara trapezia. Biochimica et Biophysica

Acta (BBA) - Gene Structure and Expression, 1089(1), 61–67.

https://doi.org/10.1016/0167-4781(91)90085-Z

Torres-Mercado, E., Renta, J. Y., Rodríguez, Y., López-Garriga, J., & Cadilla, C. L. (2003).

The cDNA-derived amino acid sequence of haemoglobin II from Lucina pectinata.

Journal of Protein Chemistry, 22(7–8), 683–690.

https://doi.org/10.1023/B:JOPC.0000008734.44356.b7

Toulmond, A., & Tchernigovtzeff, C. (1984). Ventilation and respiratory gas exchanges of

the lugworm Arenicola marina (L.) as functions of ambient PO2 (20–700 torr).

Respiration Physiology, 57(3), 349–363. https://doi.org/10.1016/0034-5687(84)90083-5

Trent, R. J., Bowden, D. K., Old, J. M., Wainscoat, J. S., Clegg, J. B., & Weatherall, D. J.

(1981). A novel rearrangement of the human β-like globin gene cluster. Nucleic Acids

Research, 9(24), 6723–6734. https://doi.org/10.1093/nar/9.24.6723

van der Burg, C. A., Prentis, P. J., Surm, J. M., & Pavasovic, A. (2016). Insights into the

innate immunome of actiniarians using a comparative genomic approach. BMC Genomics,

17, 850. https://doi.org/10.1186/s12864-016-3204-2

Vernimmen, D. (2014). Uncovering enhancer functions using the α-globin locus. PLoS

Genetics, 10(10), e1004668. https://doi.org/10.1371/journal.pgen.1004668

Vinogradov, S. N. (1985). The structure of invertebrate extracellular haemoglobins

(erythrocruorins and chlorocruorins). Comparative Biochemistry and Physiology Part B:

Comparative Biochemistry, 82(1), 1–15. https://doi.org/10.1016/0305-0491(85)90120-8

Vinogradov, S. N., & Moens, L. (2008). Diversity of globin function: enzymatic, transport,

storage, and sensing. Journal of Biological Chemistry, 283(14), 8773–8777.

https://doi.org/10.1074/jbc.R700029200

94 References

Vogel, C., Teichmann, S. A., & Pereira-Leal, J. (2005). The relationship between domain

duplication and recombination. Journal of Molecular Biology, 346(1), 355–365.

https://doi.org/10.1016/j.jmb.2004.11.050

Vuddhakul, V., Soboon, S., Sunghiran, W., Kaewpiboon, S., Chowdhury, A., Ishibashi, M.,

... & Nishibuchi, M. (2006). Distribution of virulent and pandemic strains of Vibrio

parahaemolyticus in three molluscan shellfish species (Meretrix meretrix, Perna viridis,

and Anadara granosa) and their association with foodborne disease in southern

Thailand. Journal of food protection, 69(11), 2615-2620.

Wajcman, H., Kiger, L., & Marden, M. C. (2009). Structure and function evolution in the

superfamily of globins. Comptes Rendus Biologies, 332(2–3), 273–282.

https://doi.org/10.1016/j.crvi.2008.07.026

Wang, Y., Coleman-Derr, D., Chen, G., & Gu, Y. Q. (2015). OrthoVenn: a web server for

genome wide comparison and annotation of orthologous clusters across multiple species.

Nucleic Acids Research, 43(W1), W78–W84. https://doi.org/10.1093/nar/gkv487

Wang, W. X., & Widdows, J. (1991). Physiological responses of mussel larvae Mytilus edulis

to environmental hypoxia and anoxia., (70), 223–236.

Watanabe, S., Takahashi, N., Uchida, H., & Wakasugi, K. (2012). Human neuroglobin

functions as an oxidative stress-responsive sensor for neuroprotection. Journal of

Biological Chemistry, 287(36), 30128–30138. https://doi.org/10.1074/jbc.M112.373381

Wawrowski, A., Gerlach, F., Hankeln, T., & Burmester, T. (2011). Changes of globin

expression in the Japanese medaka (Oryzias latipes) in response to acute and chronic

hypoxia. Journal of Comparative Physiology. B, Biochemical, Systemic, and

Environmental Physiology, 181(2), 199–208. https://doi.org/10.1007/s00360-010-0518-2

References 95

Weatherall, D. J. (2001). Phenotype—genotype relationships in monogenic disease: lessons

from the thalassaemias. Nature Reviews Genetics, 2(4), 245–255.

https://doi.org/10.1038/35066048

Weber, R. E., & Vinogradov, S. N. (2001). Nonvertebrate haemoglobins: functions and

molecular adaptations. Physiological Reviews, 81(2), 569–628.

Weber, R. E. (1980). Functions of invertebrate haemoglobins with special reference to

adaptations to environmental hypoxia. American Zoologist, 20(1), 79–101.

https://doi.org/10.1093/icb/20.1.79

Widdows, J., Bayne, B. L., Livingstone, D. R., Newell, R. I. E., & Donkin, P. (1979).

Physiological and biochemical responses of bivalve molluscs to exposure to air.

Comparative Biochemistry and Physiology Part A: Physiology, 62(2), 301–308.

https://doi.org/10.1016/0300-9629(79)90060-4

Witeska, M. (2013). Erythrocytes in teleost fishes: a review. Zoology and Ecology, 23(4),

275–281. https://doi.org/10.1080/21658005.2013.846963

Wittenberg, J. B., & Wittenberg, B. A. (2003). Myoglobin function reassessed. Journal of

Experimental Biology, 206(12), 2011–2020. https://doi.org/10.1242/jeb.00243

Wray, G. A., Hahn, M. W., Abouheif, E., Balhoff, J. P., Pizer, M., Rockman, M. V., &

Romano, L. A. (2003). The evolution of transcriptional regulation in eukaryotes.


https://doi.org/10.1093/molbev/msg140

Wray, G. A., Levinton, J. S., & Shapiro, L. H. (1996). Molecular evidence for deep

precambrian divergences among metazoan phyla. Science, 274(5287), 568–573.

Yagil, C., Hubner, N., Monti, J., Schulz, H., Sapojnikov, M., Luft, F. C., … & Yagil, Y.

(2005). Identification of hypertension-related genes through an integrated genomic-

96 References

transcriptomic approach. Circulation Research, 96(6), 617–625.

https://doi.org/10.1161/01.RES.0000160556.52369.61

Ye, J., Fang, L., Zheng, H., Zhang, Y., Chen, J., Zhang, Z., … Wang, J. (2006). WEGO: a

web tool for plotting GO annotations. Nucleic Acids Research, 34(Web Server issue),

W293–W297. https://doi.org/10.1093/nar/gkl031

Zhang, G., Li, C., Li, Q., Li, B., Larkin, D. M., Lee, C., … & Wang, J.(2014). Comparative

genomics reveals insights into avian genome evolution and adaptation. Science,

346(6215), 1311–1320. https://doi.org/10.1126/science.1251385

Zhang, J. (2003). Evolution by gene duplication: an update. Trends in Ecology & Evolution,

18(6), 292–298. https://doi.org/10.1016/S0169-5347(03)00033-8

References 97

Appendices

Appendix A: Poster presented at the annual Lorne Genome conference 2015

98 Appendix

Documents

CHARACTERISATION OF DUPLICATED HAEMOGLOBIN GENES IN … · 2017. 6. 9. · CHARACTERISATION OF DUPLICATED HAEMOGLOBIN GENES IN BIVALVES. Mathilde Klein . Bachelor of Medical Laboratory