Chapter-3

Screening, Identification and Optimization of Process Parameters of Fungi for Decolourization of Pulp

and Paper Mill Effluent

Screening, Identification and Optimization of Process

Parameters of Fungi for Decolourization of Effluent

Introduction

The pulp and paper mill is a major industrial sector utilizing huge amount of

natural resources, inorganic and organic materials along with large volume of water in

different stages of the paper manufacturing. The pulp and paper mill involves two

main processes i.e.; pulping and bleaching. Pulping involves cooking of wood pieces

at very high temperature and pressure in presence of chemicals. This separates the

cellulose from lignin and hemicelluloses. Cellulose is then used for making paper.

Lignin and hemicellulose becomes the part of effluent generated. In bleaching several

chemicals like chlorine, hydrogen peroxide, ozone etc are used to remove the residual

colour of pulp produced after pulping. In India kraft pulping is followed. Kraft

pulping uses sodium hydroxide and sodium sulphite as cooking chemicals (Pokhrel

and Viraraghavan, 2004). The effluent generated at the pulping stage is dark brown in

colour due to lignin, its degradation products, lignosulphonics, hemicelluloses, resin

acid and phenols. The effluent generated at bleaching stage has adsorb able organic

halogens, peroxides and other such derivatives of lignin and hemicellulose. Since the

effluents generated at the two stages are entirely different in nature, they need

customized treatment strategies (Chuphal et aI., 2005). This work focuses on the

treatment of effluent generated at the pulping stage.

Various physiochemical methods like application of acids to precipitate lignin

and then burning this lignin are in use, however, they are inefficient, costly and

produce large amount of sludge which are difficult to handle. As sludge is huge in

amount, landfilling is generally not feasible. On burning, large volume of volatile

organic toxic compounds are formed. One possible solution is use of biological

methods.

36 .

Biological treatment method involves the use of fungi and bacteria. Among

the two use of fungi is much more common as they produce extracellular enzymes

and can survive at higher effluent load than bacteria. Use of bacteria in

decolourization of effluent is not of much significance as the enzymes produced are

intracellular thus the compound need to be ingested in order to be broken down. The

pulp and paper mill effluent contains lignin, its breakdown products and resin acids.

These compounds are big in size and complex in nature. It is difficult for bacteria to

ingest them.

The decolourization of effluent by fungi involves two main mechanisms: use

of enzymatic system and adsorption. Enzymes involved in the treatment of effluent

are lignolytic enzymes like lignin peroxidase, manganese peroxidase, xylanase and

laccase. Different enzymes work by different mechanisms. However, all these

enzymes are involved in the breakdown of lignin and hemicelluloses, the main waste

products generated at the pulping stage (Tuor et aI., 1995). A large number of fungi

have been reported to produce these enzymes like Phanerochaete chrysosporium,

Ceriporiopsis subvermispora, Corio Ius versicolor var. antarcticus, Pycnoporus

sanguineus, Trametes elegans, Bjerkandera adusta, Pleurotus eryngii, Phlebia

radiata (Tuor et aI., 1995).

Second mechanism of decolourization involves adsorption of vanous

substances present in effluent by the mycelium of the fungi. The fungal mycelium has

phosphates, carboxyl, amino and other such groups attached to it. These groups help

the fungal mycelium in adsorption (Bayramoglu et aI., 2006). One of the most studied

genus for adsorption is Aspergillus (Srivastava and Thakur, 2006 a,b).

For the treatment of effluent at the industrial scale it is important to optimize

the various process parameters so that maximum colour reduction can be achieved by

minimum input. For this the process of decolourization was optimized and studied in

detail to understand the contribution of each individual parameter and the interactions

taking place among them. This was done using statistical software Qualitek-4 based

on Taguchi approach. Thus the focus of present work is to isolate and identify the

fungal strains having decolourization potential and to optimize the process of

decolourization.

37

Materials and Methods

Sites for sample collection

For isolation of fungal strains, sediment was collected from two different

places: Kaccha nala outside the Century Pulp and Paper Mill, Ghanshyam Dham,

Lallman, Nainital, Uttaranchal in February, 2005 and a drain near Anand Tissue Paper

Mill, Meerut, Uttar Pradesh in August, 2006. The sediments were collected in clean

plastic containers, immediately brought to the laboratory and stored at 4°C until

further use. The effluent was collected from Anand Tissue Paper Mill, Meerut, Uttar

Pradesh in June, 2007 and September, 2007 and stored at 4°C until further use. The

effluent collected was of pulping stage. This effluent was used for treatment studies.

Isolation of fungi from the sediments

Fungi were isolated from soil and sediments; they were mixed with sterilized

water in the ratio 1: 1 0 w/v and vortexed. It was kept standing at room temperature for

2 hrs. Then the supernatant was decanted. Same process was repeated with the

sediments of both the industry. The supernatant was serially diluted with autoclaved

double distilled water to 10-1, 10-3, 10-5 dilutions. Diluted sample (100IlI) was spread

on the potato dextrose agar plate and incubated at 30°C for 4 days. The microbial

colony (fungal) appeared on the PDA plates were then isolated and purified.

Morphological and anatomical study

The fungal strains isolated from the sediments were observed under a microscope,

Olympus and Magnus MLX-TR, at 40X and 100X having camera attached with it.

Fugal mycelium, spores and the spore attachment was observed.

Characterization of effluent

The effluent was characterized for various physio-chemical parameters. pH

was estimated using pH Meter (Cyberscan 51), colour by 2120 C Cobalt-platinate

method (APHA, 2005), lignin by Pearl and Benson (1940), COD by 5220 B open

reflux method (APHA, 2005) Anions i.e. nitrate, phosphate and sulphate were

estimated by ion chromatohraphy using ICS-90 IC system DIONEX. The eluent used

was 2.7mM Sodium carbonate (NaC03) and 0.3mM Sodium bicarbonate (NaHC03).

Conductivity after chemical suppression was ca.14IlS/cm.The flow rate maintained

during the analysis was 1 mllmin. The anions were eluted out in order of nitrate,

38

phosphate and sulphate. It took 22 min for each run. Standards were prepared using

Dionex anion standards (Jha, 2004). Cations included estimation of sodium and

potassium by Flame photometer (Jha, 2004) and heavy metals including copper, zinc

and nickel by AAS, 3030 G acid digestion method (APHA, 2005).

Screening of potential fungal strains for biopulping and effluent treatment

The seven fungal strains isolated above were screened for their

decolourization and lignin reduction potential. MSM-effluent i.e. MSM (in gil:

Na2HP04.2H20, 7.8; KH2P04, 6.8; MgS04, 0.2; Fe (CH3COO)3 NH4, 0.01; Ca(N03h

4H20, 0.05) having 10% pulp and paper mill effluent, inoculated with individual

fungal isolates, were incubated at 30°C, pH 7 in a rotary shaker, rpm 125 for 10 days

(Thakur, 1995). The parameter colour and lignin were estimated at an interval of 0, 1,

2, 3, 5, 7 and 10 day. The experiments were conducted in triplicate and ANOV A

analysis was done at p:S0.05 level using Statistical Package for Social Sciences

(SPSS) 10.0. Further Duncan test was applied. On the basis of reduction in colour and

lignin, the four most potential strains were screened out. These strains were then

further tested for enzymes: Lignin Peroxidase, LiP (Tien and Kirk, 1983), Manganese

Peroxidase, MnP (Glenn et aI., 1986) and Laccase (Niku-Paavola et aI., 1988). The

molar extinction coefficient of Mn (III) malonate at 270nm is 11,590 M-1cm-1

(Wariishi et aI., 1992). The molar extinction coefficient for ABTS2+ ions at 436 is

29,300 M-1cm-1 (Mansur et aI, 2003). One D/ml of enzyme was defined as 1 f.lmol of

substrate oxidized to product per min by 1 ml of crude filtrate under assay conditions.

Further, the identity of two fungal strains (PF4 and PF7) showing maximum colour

and lignin reduction and good enzyme production was confirmed by 18S rDNA

analysis.

Identification of fungal strains by 18S rDNA sequencing

For identification of fungi its genomic DNA was extracted (Doyle and Doyle,

1987) and internal transcribed spacer (ITS) regions (Figure 3.1) were amplified using

primers ITSI having sequence 5' TCCGTAGGTGAACCTGCGG 3' and ITS4 having

sequence 5' TCCTCCGCTTATTGATATGC 3' (Hortal et aI., 2006).

39

'---____ 18_S ____ 1 ITS} 15.8s

1 ITS2 L...1 ___ 2_8_s ____ --1

.. ITS4

Figure 3.1. The location of ITS 1 and ITS 2 regions in ribosomal DNA gene amplified by

ITS 1 and ITS4 primers for phylogenie placement of fungi

The reaction mix (25).11) consisted of buffer with MgCh (2.5mM), dNTP-2.0).1l

(lmM each), ITS1 (forward)-0.7).1l (lOmM), ITS4 (reverse)-0.7).1l (lOmM), Taq

polymerase-0.5).1l (5U/).1l), DNA-20-50ng and volume was made up by water. The

programme for amplification is initial denaturation step of 95°C for 3 min, followed

by 35 cycles of amplification at 95°C for 1 min, 55°C for 1 min and 72°C for 1min

and a final extension of 5 min at 72°C. Amplified products were viewed after

electrophoresis in 0.7% agarose gels having 1).1g/ml of EtBr and sequenced. The

sequence was blasted using NCBI database and tools and phylogeny tree was

constructed using Mega 4.0 software (Tamura et aI., 2007; www.megasoftware.net).

Optimization of process parameters for decolourization of effluent

The two most efficient fungal strains (PF4-Emericella nidulans var. nidulans

and PF7- Cryptococcus albidus) were optimized for maximum reduction in colour

and lignin content of the effluent. The 10% effluent-MSM was used through out the

experiments. Experiments were conducted to choose the best carbon and nitrogen

source for both the fungi. Different carbon sources like sucrose, dextrose, sodium

acetate and sodium citrate and different nitrogen sources like yeast extract, tryptone,

peptone and sodium nitrate were tested.

After selecting the most appropriate carbon and nitrogen sources, seven

parameters at two levels were optimized (Table 3.1.) for both the fungi. Optimization

was done using Taguchi approach. Theoretical background about Taguchi approach is

given in chapter two.

The designing and analysis was done using Qualitek-4 software (Roy, 2007).

Table 3.4. gives the details of eight experiments to be conducted according to L-8

orthogonal array. The design of experiment was same for both the fungi. All the

experiments were done in triplicate.

40

Table 3.1. Seven process parameters and their two levels for optimizing decolourization of pulp and paper mill effluent by Emericella nidulans var. nidulans and Cryptococcus albidus

Emericella nidulans Cryptococcus S.No. Factors var. nidulans albidus

Levell Level 2 Levell Level 2 I Temperature 30°C 35°C 30°C 35°C 2 Rpm 125 150 125 150 3 Dextrose 0.25% 0.50% 0.50% 1.00% 4 Tryptone 0.05% 0.10% 0.05% 0.10% 5 Inoculum Size 5.0% 7.5% 5.0% 7.5% 6 pH 5 6 5 6 7 Duration 12 hrs 24 hrs 12 hrs 24 hrs

Since the optimization was carried out for reduction in colour and lignin

content, a combined index (overall evaluation criteria, OEC) was used. For

calculation Overall Evaluation Criteria (OEC) assume:

Xl = Numeric evaluation under criterion 1

X1ref= Highest numerical value Xl can assume

Wtl = Relative weighting of criterion 1

Then OEC is calculated as:

Xl X2 OEC= xWt1+ xWt2+ ............ . Xl ref X2ref ---------Eq. (3.1)

Analysis of the data

The optimum level for each factor (parameter) was derived by analyzing the

data of the above mentioned eight experiments using Qualitek-4 software (Roy,

2007). Apart from optimized conditions, the contribution of each individual factor in

colour and lignin reduction and the interactions among various factors was also

studied. The analysis was done with "bigger is better" quality characteristics. Same

process was repeated for the second fungus.

Confirmatory experiment

The effluent treatment was done at the optimum levels of process parameters

for both the fungi and the results were compared with the values predicted by the

Taguchi model. Experiments were repeated four times.

41

Results

Four fungal strains PF1, PF2 and PF3 were isolated from Anand Tissue Paper

Mill, Meerut and three fungal strains PF4, PF5, PF6 and PF7 were isolated from

Century Pulp and Paper Mill, Lalkuan. Plate 3.1.-3.7. shows the isolated and purified

fungal strains. The characteristics of these strains are given in the table 3.2.

Table 3.2: Isolation and characteristics of fungal strains isolated from Anand paper mill sediments and Century pulp and paper mill sediments

Fun2al Isolates Source Growth Characteristics PFI (Anand paper mill) Slow White mycelia, light green spores

White mycelium with dark colour PF2 (Anand paper mill) Slow spores, mycelia becomes dark

from behind

PF3 (Anand paper mill) Fast White cottony mycelia with green

spores Dirty white mycelia with green

PF4 (Anand paper mill) Slow spores. Gives purple colour on maturation

PFS (Century paper mill) Fast White mycelia with excess spores

production of green colour

PF6 (Century paper mill) Fast White mycelia with light brown

spores produced in excess

PF7 (Century paper mill) Medium White snowy cottony mycelia

with yellow-brown -.£.igmentation

Characterization of effluent

The effluent collected from Anand Tissue Paper Mill, Meerut, Uttar Pradesh

had following physio-chemical characteristics.

Table 3.3. Physico-chemical characterization of pulp and paper mill effluent

S.No. Parameter Value 1. pH 13 2. Colour (C.u.) 65475 3. Lignin (ppm) 163741 5. COD (ppm) 204358 6. Sulphate ions (ppm) 3746.3 7. Phosphate ions (ppm) BDL 8. Nitrate ions (Qpm) 58520 9. Copper ions (ppm) BDL 10. Zinc ions (ppm) BDL 11. Nickel ions{QQm) BDL 12. Sodium ions (ppm) 11650 13. Potassium ions (ppm) 7500

42

Plate 3.1 PF1 and 3.2 PF2 (a) Surface morphological features (b) mycelium and (c) spores of the fungi.

43

Plate 3.3. PF3 and 3.4 PF4 (a) Surface morphological features (b) mycelium and (c) spore attachment of the fungi.

44

Plate 3.5. PF5 and 3.6 PF6 (a) Surface morphological features (b) mycelium and ( c) spore attachment of the fungi .

45

Plate 3.7. PF7 (a) Upper surface view (b) lower surface view showing melanin deposits (c) mycelium and spore attachment of the fungus.

46

Screening of potential fungal strains for hiopulping and effluent treatment

The fungi (PF1 to PF7) were tested for their ability to remove colour and

lignin from the pulp and paper mill effluent (Figure 3.2.a and b). Initial colour was

6521 CU and lignin was 16161 ppm. Among seven fungi tested most efficient strain

was PF4 followed by PF7 > PF1 > PF6 > PF2 > PF3 and finally PF5. Maximum

efficiency was shown by PF4 30% (4565.6 CD) colour and 24% lignin (12282 ppm)

reduction on 3rd day. Second best strain was PF7 showing 27% colour reduction

(4757.6 CU) and 24% (12347 ppm) lignin reduction on 5th day.

50 (a) _ 1 day

2 day 3 day

... 40 _ 5 day

::I _7 day 0 0 _ 10 day u .5 30 c:: 0 ;: U ::I

"tS a CD 20 ... -c:: CD u ... CD Q. 10

PF1 PF2 PF3 PF4 PF5 PF6 PF7

w.------------------------------------------.=--===~

c:: 40 C ~ .5 c:: 30 o t; ::I

"tS e! 20 -c:: CD u ... CD

Q. 10

PF1 PF2 PF3

a

PF4 PF5 PF6

(b) _ 1 day

2 day c::J 3 day _ Sday _7 day

_ 10 day

PF7

Figure 3.2. Percent reduction in (a) colour (b) lignin by seven fungal isolates. Within each group, values not followed by the same letter are significantly different at p'5; 0.05, (Error bars

are standard deviations)

47

The production of lignolytic enzymes was studied for four most suitable

strains i.e. PFl , PF4, PF6 and PF7 (Figure 3.3a, b, c and d). Highest enzyme

production, especially in reference to laccase, was in PF7 (138 U/rnl) followed by PF4

(33 U/rnl). Lignin peroxidase production was insignificant in PFl, PF4 and PF6 while

PF7 did not produce it at all. In case of manganese peroxidase the maximum

production was 19 U/ml by PF6. Hence PF4 and PF7 were selected for effluent

treatment and PF7 was selected for biopulping.

200 (e) _LIP

_ MnP

E _lIIcc. ..

~ 150 E ~ c .2 1> 100 :0

l ...

f 50

w

3 10

Duration (days)

2OO ~----------------~----~

E ~ 150

!

3 7 Duration (days)

(e) _LIP _ WnP _lIICQ"

10

200

~ 150 E i ~ c 0

~ 100

l ... . E 50

~ W

•

(b) _LIP _ WnP _ Lace ...

3 10

Duration (days)

(d) I_"np _ LKcaM

• iii 3 7

Duration (days)

Figure 3.3. Production of enzyme by fungal isolates (a) PFI (b) PF4 (c) PF6 and (d) PF7

Identification of fungal strains by 18S rDNA sequencing

The identity of two most efficient fungal strains, PF4 and PF7 was further

established by 18S rDNA sequencing. The ITS sequence of PF4 (Accession no:

EU780786, NCB I) is as follows:

TCGCGGGTATCCCTACCTGATCCGAGGTCAACCTGAGAAAAATAAGGTTGGAGACGC

CGGCTGGCGCCCGGCCGGCCCTAATCGAGCGGGTGACAAAGCCCCATACGCTCGAGG

ACCGGACACGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGGGGGACGACGACC

CAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGG

AATGCCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAAT

48

TCACATTACTTATCGCAGTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATGC

ATTGTTGAAAGTTTTGACTGATTTGTATTCCGGCTCAGACTGCTTCACTCTCAGGCA

TGAAGTGCAGGGCTCCCCGG

This sequence was blasted usmg NCB I and the phylogeny tree was

constructed using Mega 4.0 software (Figure 3.4.). The fungal strain is closet to

Emericella nidulans var. nidulans having 98% homology.

,-------------- query .-----1

iEmericella conugata Aspergillus versicolor

1------ Aspergillus sp. M11S1 ~---------------~Pecic~umsp.JS2141

Emericella cidulans strain WM 06.103 Emericella rugulosa strain SRRC 1173

Aspergillus caespitosus isolate MI'CC 6326

Emericella quadriline ata strain ATCC 16816 Emeric ella striata

Emericella parvathecia

Emericella montenegroi

Aspergillus flavus AHS-S13-2S4

Emericella c1eistominuta Emeric ella acristata

L---Emencella foveolata

I----l 0.001

Emericella violacea

Asp ergillus cidulans

Aspergillus cidulans isolate wb260

Figure 3.4. Phylogenetic placement ofPF4, Emericella nidulans var. nidulans, based on 18 S rDNA analysis

The ITS sequence ofPF7 (Accession no: EU839451, NCBI) is as follows:

TAGTCGCGGGTAGTCCTACCTGATTTGAGGTCCAGATGTCAAGAGTATTAATCCGAA

GATCAATGGATTAGAAAGCGGTCTTTAGTCCTGCAACGCGGCCATCCGAAGATGTCC

TTAGCGAAATACTTATTACGCCAAGTCAAACCATGTCGCGAGACAGATCCAGCTATT

ACTTTTAAGACGAGCCGACTTATCATCGGCAAACGTCCAAATCCAAACCAAAGAAAG

GTTTTAACCAATCTAGGGTTGAGGGTTTTCATGACACTCAAACAGGCATGCTCCTCG

GAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAA

TTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATC

CGTTGTTGAAAGTTTTATTATGTTATAATAAGACTACTTTGTTACAAAAATTGTTAT

GTAAAAAAAGGAAAATTCCCCTGGGGCTTTAAAACCCCCCCAAAAAAAA

49

This sequence was blasted using NCB I and the phylogeny tree was

constructed using Mega 4.0 software (Figure 3.5.). The fungal strain is closet to

Cryptococcus albidus having 99% homology.

~querY

Cryptococcus albidus voucher MCCC2E00273

Cryptococcus kuetzingii strain CBS1926

Cryptococcus sp. NRRL Y-17490

'----- Cryptococcus adeliensis strain RKI 456/93

I----l 0.002

,---Cryptococcus vishniacii strain CBS 8146

Cryptococcus uzbekistanensis strain CBS 8683

Cryptococcus liquefaciens '--------i

Cryptococcus albidosirnilis

Cryptococcus randhawii

Cryptococcus antarcticus Cryptococcus saitoi strain CBS 5106

Cryptococcus sp. BC24

Cryptococcus friedmannii

Cryptococcus bhutanensis strain CBS6294

Figure 3.5. Phylogenetic placement ofPF7, Cryptococcus albidus, based on I8S rDNA analysis

Optimization of process parameters for decolourization of effluent

The 10% effluent-MSM was used through out the experiments having initial

colour 6543 CU and 16374 ppm lignin. For PF4, Emericella nidulans var. nidulans

the most suitable carbon source is dextrose, 42.7 % reduction in colour (3747.2 CU)

and 34% reduction in lignin (10810.7 ppm). The most suitable nitrogen source is

tryptone where reduction in colour was 44.8 % (3611.1 CU) and 24.5 % in lignin

(12960.3 ppm) (Figure 3.6a). For C. albidus also the most suitable carbon source is

dextrose and most suitable nitrogen source is tryptone (figure 4.22). The dextrose

leads to 33.1 % (4374 CU) reduction in colour and 28.7 % (11676 ppm) reduction in

lignin. Tryptone caused 30.4 % (4550.8 CU) reduction in colour and 26.2 % (12090.7

ppm) reduction in lignin (Figure 3.6b).

50

60 Control Carbon Nitrogen

50 A a A

A a a

Q) 40 (/) C1I ~

c B a I, b

U Q) 0 30 C Q)

~ Q)

20 a..

b c A A

b A C B r d B

, .. , "

10

0 1+

(a)

60 Control Carbon Nitrogen

40 a B a bA

A A

Q) (/) a ctl ~ 20 (J c

B

Q) 0 D

c: Q)

0 (J .... Q) c..

-20 c

D -40~----.-~-.----.-----~---.'-~-.----.-----r----.----~

(b)

Figure 3.6. Screening of carbon and nitrogen sources (a) Emericella nidulans var. nidulans and (b) Cryptococcus albidus for decolourization of pulp and paper mill effluent. Within each group, values not followed by the same letter are significantly different at p-:::' 0.05, (Error bars

are standard deviations)

After screening the most suitable carbon and nitrogen sources for both the

fungi, optimization experiment was done as per L-8 orthogonal array. The results of

51

colour and lignin reduction were converted to OEe values (Table 3.4) and analyzed

by Qualitek-4.

Table 3.4. Experimental details along with OEC values for optimization of Emericella nidulans var. nidulans and Cryptococcus albidus

~ OEC - e = ~ ~

== ..... ~

== .: ~ = == = e = = = .- ~ ~ U ~ = - - ..... = N

..... ~ c.. ..... c.. = -oS -:::

~ ~ ~ .- c.. -c.. - ~ >. = ~ = -.:t" ::: r---~ e - ~:S ~ Eo-< == ~ ~~ ~ ~ e::,~

Eo-<

1 1 1 1 1 1 1 1 45.0 37.5 2 1 1 1 2 2 2 2 39.0 33.0 3 1 2 2 1 1 2 2 23.0 23.0 4 1 2 2 2 2 1 1 40.0 36.5 5 2 1 2 1 2 1 2 48.5 44.5 6 2 1 2 2 1 2 1 29.0 26.5 7 2 2 1 1 2 2 1 23.0 19.0 8 2 2 1 2 1 1 2 44.5 38.0

Analysis of the data

The results of ANOV A analysis for Emericella nidulans var. nidulans and

Cryptococcus albidus are given in table 3.5 and 3.6.

Table 3.5. ANOVA for optimization of effluent treatment process by Emericella nidulans var. nidulans (PF4)

Col # / Factor DOF Sum of Variance F-Ratio Pure Percent (f) Sqrs. (S) (V) (F) Sum (S') P(%)

1 Temperature (1) (5.) P ;:>OLED (C L= *NC*)

2 rpm 1 120.125 120.125 240.25 119.625 16.626

3 Dextrose 1 15.125 15.125 30.25 14.625 2.032

4 Tryptone 1 21.125 21.125 42.25 20.625 2.866

5 Inoculum 1 10.125 10.125 20.25 9.625 1.337

Size 6pH

1 512.000 512.000 1024.00 511.500 71.091 1 40.500 40.500 81.00 40.000 5.559

7 Duration Other/Error 1 5 5 0.489 Total 7 719.500 100.00%

Figure 3.7a shows the effect of different levels on each parameter. (z') shows the

average performance while line a-g shows temperature, rpm, dextrose, tryptone,

inoculum size, pH and duration respectively for Emericella nidulans var. nidulans

(PF4). The decolourization of the effluent decreased with increasing temperature,

though the decrease was negligible. High rpm and high carbon content also reduced

the decolourization of the effluent. Effluent seems to be deficient in nitrogen as

52

increasing nitrogen content increased the colour and lignin reduction. Deco10urization

was also favoured by high inoculum size and longer duration but at lower pH. Among

all the factors the most influential is pH (71 %) followed by rpm (17%) (Figure 3.7b).

Temperature had insignificant effect hence it was dropped from the analysis. Figure

3.7c gives the contribution of each individual factor in effluent treatment in terms of

OEC values.

Table 3.6. ANOV A for optimization of effluent treatment process by Cryptococcus albidus (PF7)

Col # / Factor DOF Sum of Variance F-Ratio Pure Percent

(f) Sqrs. (S) (V) (F) Sum (S') P(%) 1 Temperature

(1) (0.5) POO LED (CL= *NC*) 0.000 2 rpm

1 78.125 78.125 156.25 77.625 14.828 3 Dextrose

1 1.125 1.125 2.25 3.125 0.119 4 Tryptone

1 12.500 12.500 25.00 12.000 2.292 5 Inoculum

1 8.000 8.000 16.00 7.500 1.432 Size

1 378.125 378.125 756.25 377.625 72.134 6pH

1 45.125 45.125 90.25 44.625 8.524 7 Duration Other/Error 1 0.5 0.5 0.671 Total 7 523.500 100.00%

Figure 3.8a shows the effect of different levels on each parameter. (z') shows

the average performance while line a-g shows temperature, rpm, dextrose, tryptone,

inoculum size, pH and duration respectively. C. albidus also showed trend quite

similar to E. nidulans var. nidu1ans. There was improvement in colour and lignin

reduction with decreasing temperature, rpm and pH. Deco10urization was favoured by

increased dextrose, tryptone, inoculum size and duration. For C. albidus also pH

(72%) was most significant followed by rpm (15%) (Figure 3.8b). Temperature had

insignificant effect hence it was dropped from the analysis. Figure 3.8c gives the

contribution of each individual factor in effluent treatment in terms of OEC values.

Interactions among various factors for Emericella nidulans var. nidu1ans are

given in Table 3.7 .. Most significant interaction is in between dextrose and inoculum

size (S.L = 85%). And the least significant interaction is in between pH and duration

(0.8%). Table 3.8. gives the interactions among various factors for C. albidus. Most

significant interaction is in between temperature and dextrose (S.L = 89%). And the

least significant interaction is in between pH and duration (2.7%). After analysis the

optimized conditions for both the fungi are given in table 3.9. Before optimization the

53

~ 0 b J! C ! ~ '6 ... 0

b ~ GO c 'ii 2!

:TI------------------------.~P----------~ UUlatlon

~

~

35

(z'). • ....

!: r--- (f) 0 ... . pH 40 ".

(Z') • .... • 35 .....

30 ·· ·· .. 0

~.O i

(g) o ·

37.5 .0 Inoculum Size 37.0 .... ~.5 (z') • • ~.O

35.5 (e) 0 ···

3180 ~

37

Tryptone .... ..........

.0

~

35

(z')· . • . ........ ........ Average value

(d) 0 ·· ·· ·0 ·· Moln olfoct

~ 38.0 37.5 (c) o ...... . Dextrose

37.0 38.5 (z') • .. ... • 38.0 35.5 35.0 ·0

40 (b) 0 .. rpm 38

38 (z') • .... •

34

3Sle ·0

37.5 Temperature 37.0 (a) 38.5

0 ··.. • (z')· · ....... 0

36.0

35.5

35.0

Level 1 Level 2

(a) (b)

_ rpm - Dextrose

Tryptone _ Inoculum Size _ pH - Duration

100 " _ Current Grand Average ( )

CoI6-pH · C _ Col2-rpm

80 _ Col 7 -Duration _ Col4-Tryptone _ Col 3-Dextrose _ Col 5-lnoculum SizefTotal Contribution

60

40

20

o Avg Col 6 Col 2 Col 7 Col 4 Col 3 Col 5

Figure 3,7, (a) Effect of seven factors at two different levels on effluent treatment by Emericella nidulans var, nidulans (PF4), (b) Percent contribution of different factors, (c) The individual contribution of each factor in effluent treatment (colour and lignin reduction) at optimized conditions.

S4

35 rl------------------~---------­

~

U U ~

Duration I (a) (z')

~ II (::~'-' .. ---::--- pH I 26

3j?~

33.0

32.5

J 32.0

31 .5

3110

I 33

32

't5 11 3:.~ '1 32.8 C 32.6 I 32.4

32.2 32.0 31 .8

(e)

(z')

(z')

(d)

(z')

Inoculum Size

Tryptone

1-- Average value .. . 0- .. Main effect

Dextrose

(c) 'i I (b) rpm I 31 (z') 30 29

3~· r'------------------------------­I "' j T.mpe"'~ (z') 32.2

~ - 00 31 .8

Level 1 Level 2

80

60

40

20

o Avg Col6 Col2

(b)

- rpm _ Dextrose

Tryptone - Inoculum Size _ pH

_ Current Grand Average _ Co16-pH

Co12- RPM _ Col7-Duration _ Col 4-Tryptone _ Col 5-lnoculum Size

(c)

_ Col 3-Dextrose/Total Contribution

Col7 Col4 Col5 Col3

Figure 3.8 (a) the effect of seven factors at two different levels on effluent treatment by Cryptococcus albidus (PF7), (b) Percent contribution of different factors. (C) The individual contribution of each factor in effluent treatment (colour and lignin reduction) at optimized conditions,

55

Table 3.7. Interactions in between different factors along with significance index (Sn for E. nidulans var. nidulans

S.No. Interactin2 Factor Pairs Columns SI(%) Col. Opt. 1 Dextrose x Inoculum Size 3x5 84.54 6 [1,1] 2 Temperature x Duration 1 x 7 83.75 2 [2,2] 3 Temperature x Dextrose 1 x 3 75.00 6 [2,2] 4 rpm x Tryptone 2x4 68.36 2 [2,2] 5 Inoculum Size x Duration 5x7 64.58 4 [2,1] 6 Temperature x Inoculum Size 1 x 5 58.12 6 [1,1] 7 Dextrose x Tryptone 3x4 50.00 7 [1,2] 8 Dextrose x Duration 3 x 7 50.00 4 [1,2] 9 Temperature x Tryptone 1 x 4 41.87 2 [1,1] 10 rpm x Inoculum Size 2 x 5 35.41 5 [2,2] 11 Tryptone x Duration 4x7 31.63 7 [1,2] 12 Tryptone x pH 4x6 25.00 7 [2,1] 13 Temperature x rpm 1 x 2 20.96 3 [2,2] 14 Temperature x pH 1 x 6 19.37 4 [1,1] 15 rpm x Duration 2x7 17.34 5 [1,2] 16 Inoculum Size x pH 5 x 6 16.25 3 [2,1] 17 rpm x pH 2x6 15.45 5 [1,1] 18 Dextrose x pH 3x6 11.81 3 [1,1] 19 Tryptone x Inoculum Size 4x5 2.08 1 [2,1] 20 rpm x Dextrose 2x3 1.25 1 [1,2] 21 pH x Duration 6x7 0.8 1 [1,2]

Table 3.8. Interactions in between different factors along with significance index (Sn for C. albidus

8.No. Interactin2 Factor Pairs Columns 81(%) Col. Opt. 1 Temperature x Dextrose 1 x 3 89.28 2 [2,2] 2 Dextrose x Inoculum Size 3 x 5 87.30 6 [2,2] 3 Temperature x Duration 1 x 7 74.32 6 [2,2] 4 rpm x Tryptone 2x4 68.75 6 [1,1] 5 Dextrose x Tryptone 3x4 65.51 7 [1,2] 6 Inoculum Size x Duration 5 x 7 56.81 2 [2,2] 7 Temperature x Inoculum Size 1 x 5 55.55 4 [1,2] 8 Temperature x Tryptone 1 x 4 44.44 5 [1,2] 9 rpm x Inoculum Size 2x5 43.18 7 [1,2] 10 Dextrose x Duration 3x7 34.48 4 [1,2] 11 Tryptone x pH 4x6 31.25 2 [1,1] 12 Temperature x pH 1 x 6 25.67 7 [2,1] 13 rpm x Duration 2x7 18.18 5 [1,2] 14 Dextrose x pH 3 x 6 12.69 5 [2,1] 15 rpm x pH 2x6 12.50 4 [1,1] 16 Tryptone x Inoculum Size 4x5 11.11 1 [2,2] 17 Temperature x rpm 1 x 2 10.71 3 [2,1] 18 Tryptone x Duration 4x7 10.34 3 [2,2] 19 rpm x Dextrose 2x3 7.14 1 [1,2] 20 Inoculum Size x pH 5 x 6 4.76 3 [2,1] 21 pH x Duration 6x7 2.7 1 [1,2]

56

average performance (OEC value) of E. nidulans var. nidulans was 36.50 which

increased to 54.75 and for C. albidus was 32.25 which increased to 47.25.

Table 3.9. Optimized conditions and contribution of each individual parameter in decolourization by Emericella nidulans var. nidulans and Cryptococcus albidus

Emericella nidulans var. Cryptococcus albidus Col # I Factor nidulans

Level Contribution Level Contribution 2 RPM 125 3.875 125 3.125 3 Dextrose 0.25 1.375 1.00 0.375 4 Tryptone 0.10 1.625 0.10 1.250 5 Inoculum Size 7.5 1.125 7.5 1.000 6pH 5 8.000 5 6.875 7 Duration 24 2.250 24 2.375 Total contribution from all factors 18.250 15.000 Current grand average of performance 36.500 32.250 Expected results at optimum conditions 54.750 47.250

Confirmatory experiment

The expected results predicted by Taguchi model were tested using MSM­

effluent 10% having initial colour of 6533CU and 16319ppm. The colour and lignin

concentration reduced to 2025.2-2351.9CU (64-69%) and 9954.6-10607.4ppm (35-

39%) giving an OEC value of 51.8 ± 2.25 for Emericella nidulans var. nidulans and

3070.5-3266.5CU (50-53%) and 9791.4-10607.4ppm (35-40-%) respectively with

Cryptococcus albidus at optimized conditions, giving an OEC value of 44.6 ± 2.02.

Discussion

The effluent collected at Anand tissue paper mill was highly alkaline. The

industry uses kraft pulping process, where wood pieces are heated with sodium

hydroxide and sodium sulphite. Use of sodium hydroxide makes the effluent highly

alkaline in nature. It was deep brown in colour due to the presence of lignin and its

degradation product. The COD values are high because of various organic compounds

present in it. The source of sulphate ions in effluent is sodium sulphite and for nitrate

ions it is the nitrogen present in the lignin. Metals tested were below detection limit as

bagasse (raw material used in the Anand paper mill) has negligible metal

concentration and during the industrial process also metals are not required (Table

3.3).

Seven fungal species isolated, four from Anand paper mill and three from

Century paper mill, were screened for decolourization. Most efficient fungal strain

57

was PF4 followed by PF7. ANOVA analysis shows that after day three there is no

significant reduction in colour or lignin in any of the fungi tested (Figure 3.2a and b.).

This may be due to the effect of shaking and inhibition of growth of fungi in absence

of proper carbon source (Mehna et aI., 1995).

The reduction in colour and lignin content of the effluent is due to the

breakdown of various organic compounds present in it. This breakdown of organic

compounds is brought by enzymes. Lignolytic enzymes like lignin peroxidase,

manganese peroxidase and laccase play an important role in this process (Tuor et aI.,

1995). It was found that maximum enzyme production especially in reference to

laccase was found in PF7 followed by PF4 (Figure 3.3b and d.). The results of colour

and lignin degradation also shows that these two strains has maximum

decolourization potential. On comparing the two fungi, effluent treatment is more

efficient by PF4 than PF7. However, enzyme production was more in PF7. This

implies that apart from enzymatic degradation there are other processes that are

facilitating effluent treatment. It was observed that the mycelium of PF4 becomes

deep brown in colour after treatment. Probably the phenomenon of adsorption is also

taking place along with enzyme production. To test this hypothesis, adsorption

isotherm and kinetics studies were taken up for PF7 which are discussed in detail in

chapter 5.

Strain PF4 was identified as Emericella nidulans var. nidulans (Figure 3.4.).

Emericella is the sexual stage of Aspergillus (Geiser et aI., 1996). Emericella belongs

to Ascomycota. In India it was first reported by Sarbhoy et al. (1971). Aspergillus has

been reported in association of bagasse (Aboellil and Geweely, 2005). This explains

the presence of Emericella nidulans var. nidulans in the sediments of Anand pulp and

paper mill which uses bagasse as raw material. Strain PF7 was identified as

Cryptococcus albidus, a yeast (Figure 3.5.). It is a common plant pathogen and

generally do not attack animals and humans. The dark pigment formed by the C.

albidus is melanin. This strain is well established for melanin and laccase production.

Melanin and laccase are supposed to help in virulence (Ikeda et aI., 2002; Mayer and

Staples, 2002). During the screening of the fungal strains it was found that C. albidus

is indeed a good producer of laccase enzyme. Genus Cryptococcus is widely

distributed in nature. The association of genus Cryptococcus and eucalyptus is well

58

established and is reported in India (Chakrabarti et aI., 1997). Century pulp and paper

mill uses eucalyptus as a raw material.

Emericella nidulans var. nidulans and C. albidus were selected for effluent

treatment. The various process parameters were optimized for both the fungal species.

They need additional carbon and nitrogen sources for efficient treatment of the

effluent. The amount of carbon and nitrogen in available form are generally limiting

in effluent. For both the fungi the most suitable carbon source was dextrose and most

suitable nitrogen source was tryptone (Fungi 3.6a and b). A study by Belsare and

Prasad (1988) reports the use of sucrose and ammonium chloride for treatment of

paper mill effluent by Schizophyllum commune. In another study Pleurotus

ostreatoroseus was used for the treatment of pulp and paper mill effluent and used

glucose as additional carbon source (Santos et aI., 2002). Thus the use of cosubstrates

had improved the decolourization potential of fungi (Mehna et aI., 1995).

The treatment of pulp and paper mill effluent has been studied using a number

of fungi from quite some time. However, very few studies have optimized the process.

Studies related to the interaction of various factors among them are lacking. For both

the fungi there was no significant effect of temperature variation (30°C-35°C) on

effluent treatment. Hence, temperature was dropped from the analysis (Figure 3.14a

and 3.15a). The most suitable rpm for both the fungi is 125rpm (Malaviya and

Rathore, 2007; Taseli and Gokcay, 1999). This shows that fungus prefers slow

agitation. One possible reason is very rapid movement leads to the shear and tear of

fungal mycelium.

The additional carbon requirement for both the fungi is different. The C.

albidus require four times more carbon (1.0%) than E. nidulans var. nidulans (0.25%).

One possible reason is C. albidus decolorize effluent by production of enzymes and

more energy is required for sustaining enzyme production. E. nidulans var. nidulans

mainly works by the process of adsorption which is a physio-chemical phenomenon

and hence require less energy (Figure 3.7a.). The requirement of nitrogen by both the

fungi is very less (0.1 %). In C. albidus it is ten times less than carbon requirement

(Figure 3.8a.). There was an increase in decolourization with increase in inoculum

size for both the fungi. In case E. nidulans var. nidulans increase in inoculum size

translates into more adsorbent available. In C. albidus increased inoculum size

probably increased the enzyme production.

59

The suitable pH for effluent treatment is slightly acidic for both the fungi. The

phenomenon of adsorption is greatly influenced by pH. Organic compounds having

different aromatic rings and functional groups are present in the effluent. These

compounds have different ionization potentials at different pH and therefore their

interaction with microbial biomass depends on the chemistry of a particular

compound and the specific chemistry of the biosorbents. The fungal cell wall is

composed of polysaccharides (i.e., chitin and chitosan), proteins, lipids and melanin

with several functional groups (such as amino, carboxyl, thiol and phosphate groups)

that give fungi its adsorption capabilities. The ionic forms of the chemicals in solution

and the surface electrical charge of the biomass depend on the solution pH. Thus pH

assumes great importance (Bayramoglu et aI., 2006). This fact is also evident from

figures 3.7b and c. pH alone contributes 71 % in the process of decolourization. In

case of C. albidus also pH is the single most important factor with 72% contribution

(Figure 3.8b and c.). This is because the pH range for the activity of lignolytic

enzymes, LiP, MnP and laccase is slightly acidic (Aken et aI., 2000). Most of the

studies report the pH range of 4-6 for effluent treatment (Belsare and Prasad, 1988;

Lara et aI., 2003).

The interactions taking place in between various factors are also important.

For both E. nidulans var. nidulans (Table 3.7.) and C. albidus (Table 3.8.) most

significant interaction took place in between two least significant factors. If the

significance level of the factor is low does not implies it is not important. It simply

stresses that while varying the conditions from level 1 to level 2 for that factor there is

no significant effect on decolourization while the factor in itself can be very

important.

The treatment of effluent at the optimum conditions lead to an increase in

decolourization potential by 31 % for E. nidulans var. nidulans and 28% for C.

albidus. Further the treatment of pulp and paper mill effluent was scaled up from

shake flask to 2L and 15L bioreactor. Bioreactor studies are discussed in detail in

chapter four.

60