Embed Size (px)
Citation preview
Chapter 19
The general term for the manipulation of organisms to create products or cure disease is ________.gene cloning.
recombinant DNA technology.
biotechnology.
plasmid-mediated transformation.
Many identical copies of genes cloned in bacteria are produced as a result of ________.plasmid replication.
bacterial cell replication.
Southern blotting.
plasmid and bacterial cell replication.
plasmid and bacterial cell replication, together with Southern blotting.
Which of following sequences is most likely to be cut by a restriction enzyme?AATTCTTTAAGAAATCGTTTACGAAAAATTTTTTAAACTACTTGATGAAATATTTTATAA
Imagine that you've isolated the complete human growth hormone gene directly from the human genome.
After running through all the steps described in Chapter 19 for cloning and gene expression in bacteria,
you find that no human growth hormone is expressed. What is the most likely explanation?Bacteria cannot translate human mRNA coding sequences.
Human DNA can be maintained in cloned form only for brief periods in bacteria.
Human DNA cannot be cloned in a bacterium.
Bacteria lack a nucleus for proper transcription of eukaryotic genes.
Bacteria cannot carry out splicing.
If mRNAs could be ligated and replicated within plasmids, what enzyme commonly used in recombinant
DNA technology would no longer be needed?reverse transcriptase
DNA polymerase
restriction enzymes
Taq polymerase
DNA polymerase
How does a gene library differ from a gene clone?A gene library is sequence information stored in a computerized database; a gene clone is an actual sequence of DNA.
A gene library is a much longer DNA sequence than a gene clone.
A gene library contains many different cloned DNA sequences; a gene clone contains one type of DNA sequence.
A gene library is a much shorter DNA sequence than a gene clone.
A gene library contains one type of cloned DNA sequence; a gene clone contains many different DNA sequences
A bacterial cell that has taken up plasmid DNA is ________.a library.
a cDNA.
transformed.
ligated.
a vector.
Plasmids are used as cloning vectors in genetic engineering. This means that plasmids allow for
________.carrying of RNA into a cell and RNA replication.
infection of cells.
carrying of DNA into a cell and DNA replication.
DNA replication outside rather than inside cells.
Which of the following is a gene library?a collection of DNAs cut by a restriction enzyme
a collection of different DNA fragments ligated into plasmids
a collection of plasmids cut by a restriction enzyme
a collection of PCR-amplified DNAs
a collection of genes that have been sequenced from a particular organism
How can an amino acid sequence be used to design a gene-specific hybridization probe?A portion of a polypeptide chain can be synthesized based on the amino acid sequence of the full protein.A protein can be purified, digested with proteases that cleave it at specific sites, and one of the peptide fragments can be used as a probe.
All possible nucleotide sequences that could encode a portion of the polypeptide can be synthesized and used as probes.
What is a primary difference between PCR and traditional cloning procedures such as those used to
clone the human growth hormone gene?PCR is more time-consuming, but the purity of the obtained DNA clone is much higher than in traditional cloning.
PCR eliminates the need for restriction enzymes, vectors, and cells.
PCR and traditional cloning make use of different types of vectors.
PCR uses plasmid vectors, whereas traditional cloning uses bacteria.
PCR and traditional cloning make use of different types of bacteria.
What information is critical to the success of PCR itself?The complete DNA sequence of the DNA to be amplified must be known.
The DNA sequence of the ends of the DNA to be amplified must be known.
The sequence of restriction enzyme recognition sites in the DNA to be amplified must be known.
The sequence of restriction enzyme recognition sites in the DNA to be amplified and in the plasmid where the amplified DNA fragment will be cloned must be known.
Which of the following is in the correct order for one cycle of PCR?Extend primers; anneal primers; denature DNA.
Denature DNA; anneal primers; extend primers.
Denature DNA; add fresh enzyme; anneal primers; add dNTPs; extend primers.
Anneal primers; denature DNA; extend primers.
Add fresh enzyme; denature DNA; anneal primers; add dNTPs; extend primers.
In a single PCR cycle consisting of 15 seconds at 94°C, 30 seconds at 50°C, and 1 min at 72°C, what is
happening in the step run at 50°C?DNA polymerase is extending new DNA from the primers.
The DNA to be amplified is being denatured.
DNA polymerase is being inactivated.
Primers are annealing to the DNA to be amplified.
Primers are being denature
Since dideoxy sequencing is based on the chain termination, why are normal deoxynucleotides also
included in the reaction?to provide a substrate for DNA polymerase
to create DNA synthesis products long enough to allow running a gel
to enhance the chain termination ability of the deoxynucleotides
to produce a range of DNA synthesis products that terminate at every occurrence of a particular base
Why is it essential that genetic markers used in mapping disease genes be polymorphic?If the marker isn't polymorphic, it cannot be physically linked to a gene associated with human disease.
If the marker isn't polymorphic, its position cannot be known.
If the marker isn't polymorphic, then it will not be inherited in any predictable manner.
If the marker isn't polymorphic, then it's impossible to use genetic mapping techniques to establish an association between the marker and the disease gene.
Transgenic mice ________.often provide valuable animal models of human disease.
are now used in place of bacteria for cloning human genes.
were instrumental in pinpointing the location of the huntingtin gene.
are essential for mapping human genes.
For applications in gene therapy, what is the most favorable characteristic of retroviruses?Retroviruses have an RNA genome.
DNA copies of retroviral genomes become integrated into the genome of the infected cell.
Retroviruses cause many serious diseases, including AIDS and cancer.
Retroviruses possess reverse transcriptase.
To create a viral vector for delivery of genes into mammalian cells, the virus must be engineered to
________.remove viral coat proteins.
remove the viral genome and coat proteins and replace them with recombinant plasmids carrying the mammalian genes to be delivered.
remove all viral genes, replacing them with the mammalian genes to be delivered.
remove viral genes involved with virus replication and add mammalian genes to be delivered.
Genetically engineered crops in the United States ________.are the only types of crops now being planted.
have seen some limited commercial success.
are widespread for many major crop species.
are currently available only for rice.
may soon be ready for commercial planting.
Chapter 20
An early step in shotgun sequencing is to ________.randomly select DNA primers and hybridize these to random positions of chromosomes in preparation for sequencing.
map the position of cloned DNA fragments.
break genomic DNA at random sites.
The bulk of the sequence data in whole genome sequencing comes from ________.whole chromosomes obtained without cloning.
relatively small (~ 1000 base-pair) sequences cloned into plasmids.
whole chromosomes cloned into plasmids.
relatively large (~ 160 kb) sequences cloned into BACs.
The discipline that manages, analyzes, and interprets the vast amounts of sequence data generated from
whole genome sequencing is ________.evolutionary genomics.
functional genomics.
bioinformatics.
proteomics.
The goal of annotating a whole genome sequence is to ________.establish the nucleotide sequence.
learn how gene products interact to produce phenotypes.
learn the number of nucleotides contained within the genome.
identify genes and their positions within the genome.
Homologous DNA sequences are similar sequences in two organisms that ________.code for identical proteins.
are related by chance mutations.
are related by descent from a common ancestor.
code for identical RNAs.
are related because of convergent evolution
If the sequence of a cDNA matches a DNA sequence in the genome, then this genomic DNA is likely to
________.code for a tRNA.
code for a rRNA.
be part of an intron.
be a regulatory sequence.
code for a protein.
In what sense are studies by 19th-century naturalists and those by early 21st-century genomic biologists
similar?Both focus on observing and describing what exists in their realms of investigation.
Both constantly strive to create theoretical frameworks in which to understand their findings.
Both use evolutionary theory to guide their work.
Both focus narrowly on the underlying mechanisms of biology.
Both take a reductionist approach by studying only one small part of a complex system.
One surprising discovery from the analysis of bacterial genomes is that ________.there is only one copy of each gene present within a bacterial genome.
very few species contain plasmids.
there are many genes of unknown function.
there is almost no difference between the genomes of diverse bacteria.
bacterial genomes are always contained on a single circular chromosome.
Imagine that you've sequenced the genome of a human pathogenic bacterium. In the early stages of
analysis, you discover a stretch of DNA that has a significantly different GC content (the proportion of
bases that are G and C). Further examination of this region shows there are roughly one dozen protein-
coding regions. These are not found in the genome of a previously sequenced and related bacterium.
These sequences do, however, predict protein products strikingly similar to those of another bacterial
pathogen that is not closely related to the organism you're studying. You immediately suspect ________.convergent evolution.
a low rate of mutation.
lateral gene transfer.
that the DNA sequence analysis is in error.
a high rate of mutation.
Why are transposable elements considered to be selfish genes?They produce products that prevent cooperation between cells.
They produce products toxic to the host.
They spread rapidly throughout the genome.
They replicate outside of the chromosome.
They replicate using the host's resources without direct benefit to the host.
Imagine that your goal is to isolate mouse mutants that stabilize microsatellite repeat sequences (i.e.,
lower the frequency at which their repeat number changes). Which of the following mutations would you
predict to have this stabilizing effect?a mutation that reduces the rate of transcription
a mutation that increases the rate of DNA synthesis
a mutation that reduces the rate of translation
a mutation that inactivates reverse transcriptase and/or integrase
a mutation that reduces the occurrence of homologous recombination
Although transposable elements and simple tandem repeats (STRs) are both repetitive DNAs, they differ
in that ________.the repeated unit in STRs is clustered one after another; transposable element repeats are scattered throughout the genome.
the repeated unit in STRs is much larger than the repeated unit of transposable elements.
STRs occur within exons; transposable elements occur within introns.
STRs occur within introns; transposable elements occur within exons.
variation in STR repeat number comes from STR movement in the genome; variation in transposable element repeat number comes from errors in DNA replication.
Forensic DNA fingerprinting often involves recovery of minute quantities of DNA from a crime scene.
What is a concern in analyzing this DNA?Suspects may not agree to provide a sample of their DNA.
Even with these tiny amounts of DNA, there may be too much DNA for efficient PCR.
There is seldom enough DNA to allow PCR amplification.
It is critical to avoid the introduction of contaminating human DNA unrelated to the crime.
Restriction enzymes may not work efficiently on the PCR-amplified DNA.
In eukaryotes, the major mechanism of introducing new genes into the genome is ________.pseudogene creation.
lateral gene transfer.
unequal crossing over at microsatellite repeats.
pseudogene restoration.
duplication and divergence.
The figure above compares the proportion of genes devoted to various functions in a set of model
organisms. Based on this figure, which one of the following statements is false?Drosophila is unusual in having so few genes devoted to protein folding and degradation.
Humans have the highest proportion of genes devoted to defense and immunity.
A relatively small but similar proportion of genes are devoted to transcription and translation in all these organisms.
The function of roughly half of eukaryotic genes is unknown.
The mustard plant and yeast have a small fraction of genes devoted to cell communication.
If one wished to test the hypothesis that humans and chimps differ due to differences in the expression of
a large set of shared genes, the technique to use would be ________.PCR.
DNA sequencing.
DNA microarray analysis.
Southern blotting.
protein-protein interaction assays
A DNA microarray is a tool that owes its existence to earlier genomics investigations. What essential
contribution of genomics makes microarrays possible?The concept that hybridization between single-stranded nucleic acids can be used as a means of identifying any DNA sequence.
recently improved RNA sequencing technologies
more efficient techniques for cDNA synthesis
continuously improving methods of gene cloning
knowledge of which DNA sequences to synthesize for the array
What is the main goal of obtaining a detailed human haplotype map?to locate genes associated with disease
to develop more effective vaccines
to locate regulatory elements
to locate virulence genes
to locate introns
Environmental genomics aims to learn the diversity of organisms, particularly microbes, that inhabit
natural environments. J. Craig Venter, a key figure in the race to obtain the human genome sequence,
and his colleagues pioneered this approach in a study that analyzed DNA obtained from microbes
collected from the Sargasso Sea, an intensively studied, nutrient-impoverished part of the Caribbean lying
to the southeast of Bermuda. (C. J. Venter, K. Remington, J. F. Heidelberg, A. L. Halpern, D. Rusch, J. A.
Eisen, D. Wu, I. Paulsen, K. E. Nelson, W. Nelson, D. E. Fouts, S. Levy, A. H. Knap, M. W. Lomas, K.
Nealson, O. White, J. Peterson, J. Hoffman, R. Parsons, H. Baden-Tillson, C. Pfannkock, Y.-H. Rogers,
and H. O. Smith. 2004. Environmental genome shotgun sequencing of the Sargasso
Sea. Science 304:66-74.)
The approach reported in this paper is bold in its technological reach but simple in concept: Collect
random samples of microbes from a particular environment; extract DNA; fragment and clone the DNA in
preparation for sequencing; sequence millions of randomly selected clones; store this information on
computer and apply algorithms to assemble overlapping sequences from single species; analyze such
features as the total number of genes and the number and identity of newly discovered genes; and
estimate the total number of microbial species. This method is also known as metagenomics.
In the Venter et al. paper, slightly more than 1 billion base pairs of nonredundant sequence was analyzed.
The authors reported the identification of 1800 microbial species in their samples, including 148 unknown
species. Additionally, 1.2 million formerly unknown genes were discovered - all from an area of ocean that
is an "oceanic desert."
It's not hard to imagine that there were significant technical problems in this study. One was in sequence
assembly. This task involves identifying which of the millions of randomly generated sequences come
from the same organism. The first step of this procedure involves searching for sequence overlaps from
different clones. The algorithms typically used for sequence assembly ignore repeated sequences.
However, this turns out to be a problem in environmental genomics.
Why would any sequence assembly program be written so as to ignore repeated sequences?
These sequences are too short to be useful for assembly.
These sequences are too unreliable to consider.
These sequences are difficult to place within an assembly.
These sequences are too hard to obtain to justify the effort.
Use the following information when answering the corresponding question.
Environmental genomics aims to learn the diversity of organisms, particularly microbes, that inhabit
natural environments. J. Craig Venter, a key figure in the race to obtain the human genome sequence,
and his colleagues pioneered this approach in a study that analyzed DNA obtained from microbes
collected from the Sargasso Sea, an intensively studied, nutrient-impoverished part of the Caribbean lying
to the southeast of Bermuda. (C. J. Venter, K. Remington, J. F. Heidelberg, A. L. Halpern, D. Rusch, J. A.
Eisen, D. Wu, I. Paulsen, K. E. Nelson, W. Nelson, D. E. Fouts, S. Levy, A. H. Knap, M. W. Lomas, K.
Nealson, O. White, J. Peterson, J. Hoffman, R. Parsons, H. Baden-Tillson, C. Pfannkock, Y.-H. Rogers,
and H. O. Smith. 2004. Environmental genome shotgun sequencing of the Sargasso
Sea. Science 304:66-74.)
The approach reported in this paper is bold in its technological reach but simple in concept: Collect
random samples of microbes from a particular environment; extract DNA; fragment and clone the DNA in
preparation for sequencing; sequence millions of randomly selected clones; store this information on
computer and apply algorithms to assemble overlapping sequences from single species; analyze such
features as the total number of genes and the number and identity of newly discovered genes; and
estimate the total number of microbial species. This method is also known as metagenomics.
In the Venter et al. paper, slightly more than 1 billion base pairs of nonredundant sequence was analyzed.
The authors reported the identification of 1800 microbial species in their samples, including 148 unknown
species. Additionally, 1.2 million formerly unknown genes were discovered - all from an area of ocean that
is an "oceanic desert."
It's not hard to imagine that there were significant technical problems in this study. One was in sequence
assembly. This task involves identifying which of the millions of randomly generated sequences come
from the same organism. The first step of this procedure involves searching for sequence overlaps from
different clones. The algorithms typically used for sequence assembly ignore repeated sequences.
However, this turns out to be a problem in environmental genomics.
The following table from the Venter et al. paper presents the numbers of different types of genes
discovered in this study.
TIGR Role Category Total GenesAmino acid biosynthesis 37,118Biosynthesis of cofactors, prosthetic groups, and carriers 25,905Cell envelope 27,883Cellular processes 17,260Central intermediary metabolism 13,639DNA metabolism 25,346Energy metabolism 69,718Fatty acid and phospholipid metabolism 18,558Mobile and extrachromosomal element functions 1,061Protein fate 28,768Protein synthesis 48,012Purines, pyrimidines, nucleosides, and nucleotides 19,912Regulatory functions 8,392Signal transduction 4,817Transcription 12,756Transport and binding proteins 49,185Unknown function 38,067Miscellaneous 1,864Conserved hypothetical 794,061Total number of roles assigned 1,242,230TOTAL NUMBER OF GEN 1,214,207
If practical applications arise from this or similar metagenomic studies, what might these be?Species discovered in the Sargasso Sea may also be found to inhabit less-remote waters.
New genes with useful properties may be identified and ultimately put to use.
An increased knowledge of the diversity of marine ecosystems could lead to increased appreciation of diversity in all ecosystems.
New microbial species could be isolated from seawater.
Chapter 21
Gastrulation is an important event in early embryonic development. Which of the following is not a result
of this process?movement and alignment of many embryonic cells
determination of cell types as a result of cell - cell interactions
formation of three embryonic cell layers
formation of specialized plant tissues
When is a cell considered differentiated?when a cell first becomes irreversibly committed to a particular fate
when a cell manufactures proteins that are specific to a particular cell type
when a cell is part of recognizable tissues or organs
when a cell begins its pattern formation
Cellular differentiation is usually produced by ________.differences in gene expression.
differences in gene copy numbers.
differences in DNA sequences.
morphogenesis.
Communication within and between cells of an embryo can include all of the following except ________.increased concentration of signaling molecules.
changes in gene transcription.
changes in binding to regulatory sequences.
changes in gene sequences.
Which of the following would constitute evidence that differentiated cells retain all the genes of developing
cells?Nuclei from mature cells can direct the development of an entire individual.
Developing cells have many mRNA transcripts that can hybridize with DNA from mature cells.
Differentiated cells lose their polarity if removed from the organism.
Differentiated cells generally synthesize a specific group of proteins.
Cloning of plants from cuttings demonstrates that ________.genetic information is retained in mature plant cells.
plants can reverse the differentiation process.
genetic information is lost during plant development.
differentiated cells may contain embryonic mRNAs.
Modern cloning techniques have demonstrated that the vast majority of differentiated cells are genetically
equivalent to developing cells in the embryo. What is an exception to this finding?In the immune system, sequences of DNA may rearrange to permit response to new pathogens.
In the brain, DNA sequences may change with learned behavior.
Nerve cells are often limited in their mitotic activity.
The lining of the digestive system is frequently replaced. Some of these cells may show repeats of certain DNA sequences
Gene expression in developing organisms is regulated on several different levels. In many developing
animals, regulation of gene expression is influenced by the action of Hox genes. Which of the following
regulatory elements are produced by many Hox genes?cell surface molecules for cell-cell interactions
signals from maternal cytoplasm, such as bicoid
mRNA processing factors
transcriptional factors
When the Bicoid protein is expressed in Drosophila, the embryo is still syncytial (divisions between cells
are not yet fully developed). This helps to explain which observation by Nüsslein-Volhard and
Wieschaus?Bicoid protein determines the dorsoventral axis of the embryo.
Bicoid protein diffuses throughout the embryo in a concentration gradient.
Bicoid protein serves as a transcription regulator.
mRNA from the egg is translated into the Bicoid protein.
The protein of the bicoid gene in Drosophila determines ________.the number of segments in the embryo.
the ventral-lateral axis of the embryo.
the anterior-posterior axis of the embryo.
the medial-lateral axis of the embryo.
In combination, what do the products of gap genes, pair-rule genes, and segmentation polarity genes of
fruit flies do?They direct cell movements during differentiation.
They set up the back-to-belly axis of the larval body.
They trigger the reorganization of the larval body into an adult body.
They define the segmented body plan of the embryo
During Drosophila development, there is a regulatory cascade of gene activation. The proper sequence
for this cascade is ________.bicoid, segment-polarity genes, gap genes, and pair-rule genes.
bicoid, pair-rule genes, gap genes, and segment polarity genes.
bicoid, gap genes, pair-rule genes, and segment polarity genes.
bicoid, gap genes, segment polarity genes, and pair-rule genes.
What is common to gap genes, segment-polarity genes, and homeotic genes?They are unique to Drosophila embryos.
They can be activated at any time during development.
They code for transcription regulatory factors.
They act independently of one another.
Suppose you found several Drosophila mutants that possessed additional legs growing out of the head
segments. The probable mutation would be found in ________.pair-rule genes.
segment-polarity genes.
gap genes.
homeotic genes.
Suppose there was a mutation in the segment-polarity genes of Drosophila. What do you suppose might
be the outcome?Legs will appear in the place of antennae.
Several segments of the embryo will be missing.
Every other segment of the embryo will be missing.
Antennae will appear in a different part of their usual segment
Suppose the protein specified by bicoid were injected into Drosophila embryos, so that a high
concentration was present everywhere in the embryo. What might be the result of such an experiment?The embryos would halt their development.
The embryos would grow larger than normal.
The embryos would show no development of posterior regions.
The embryos would show no development of anterior regions.
Evolutionary theory has until recently stressed genetic mutations that alter protein amino acid sequences
as the major source of variation that leads to speciation. Evo-devo (evolutionary developmental biology)
offers a different understanding of the role of genetic change in evolution. Which of the following
statements best summarizes this understanding?Genetic mutations are not as important in evolutionary change as the environment in which the organism develops.Similar genes are found in most developing animal bodies; changes in the times and places they are expressed can lead to phenotypic variation.Greater numbers of genes, rather than the ways in which they are regulated, leads to the development of more complex animals over time.
Changes in cell - cell interactions in a parent's body can lead to phenotypic change in offspring.
In snake populations, rare individuals are found that have well-developed hind limbs. They are normal in
all other respects. This finding shows that ________.snakes retain the genes for hindlimb pattern formation, even though the genes are usually not activated during development.
some snakes may lack the regulatory inhibitors necessary for normal limbless development.
some snakes have mutations in Hox genes that permit development of limbs.
all of the above might explain this rare condition.
Many different lineages of animals share similar pattern-formation gene complexes. The study of how
these shared complexes function in evolution is termed ________.conservative evolution.
regulatory evolution.
evo-devo (evolutionary developmental biology).
convergent evolution.
All of the following are true of embryonic stem cells except ________.they retain the potential to become different types of cells.
they can be found in human blastocysts.
they are terminally differentiated.
they continue to undergo mitosis when most cells have stopped dividing.
Chapter 22
Which of the following directors of embryonic development can be found in the unfertilized egg?proteins in the organizer region
mRNAs from embryonic genome
tissue-specific proteins
proteins in the gray crescent
cytoplasmic determinants
Many amphibian species release their sperm and eggs directly into a watery environment. All of the
following mechanisms might ensure species-specific fertilization in these populations except ________.specific protein binding between sperm and egg.
complex coverings of the egg.
fertilization envelopes.
blocking of non-species-specific mRNA sequences.
acrosomal complexes in sperm.
The function of the acrosomal complex during fertilization is ________.to nourish the sperm mitochondria.
to dissolve the coating of the egg.
to permit maximum sperm motility.
to block polyspermy.
The allele D codes for right-handed coiling in a species of snail. The allele d codes for left-handed coiling.
Assuming a maternal effect in phenotype, if a ddfemale mates with a Dd male, what percentage of
offspring will show left-handed coiling?0%
25%
50%
75%
100%
One difference between early development in humans and in Xenopus is that ________.in humans, blastocysts implant into the uterine wall; there is no implantation in Xenopus.
in humans, neurulation occurs immediately after cleavage; in Xenopus, neurulation is delayed until after gastrulation.in humans, there is no formation of the blastula; in Xenopus, the blastula is a critical stage in early embryogenesis.
in humans, the yolk sac is much smaller than that seen in Xenopus.
in humans, gastrulation is delayed as the egg moves along the fallopian tube; in Xenopus, gastrulation takes place immediately after blastula formation
What is a major difference between the development of Drosophila or Xenopus and that of humans?In Drosophila and Xenopus the notochord remains; in humans, it disappears.
Drosophila and Xenopus do not undergo blastula formation; humans do.
Drosophila and Xenopus do not undergo gastrulation; humans do.
Drosophila and Xenopus undergo metamorphosis; humans do not.
Drosophila and Xenopus do not show development of germ layers; humans do
What happens during gastrulation?Massive movements of cells make the primary body axes visible and organize the three embryonic tissues.
The neural tube - precursor of the spinal cord and brain - forms.
Basal and apical cells - precursors of the suspensor and embryo, respectively - form.
The fertilized egg divides without growth occurring, forming a ball of cells
What happens during cleavage?The neural tube - precursor of the spinal cord and brain - forms.
Basal and apical cells - precursors of the suspensor and embryo, respectively - form.
Massive movements of cells make the primary body axes visible and organize the three embryonic tissues.
The fertilized egg divides without growth occurring, forming a ball of cells.
Scientists using RNA hybridization techniques found that a transcription factor called macho-1 localized to
some cells during early cleavage, but not others. Descendents of these cells produce mesodermal
derivatives. Which structures might not be found in embryos depleted of macho-1?digestive system
somites
neural tube
skin
During gastrulation in amphibians, the presumptive mesoderm moves into the interior of the embryo by
following fibrils of fibronectin. The fibronectin is probably secreted by which cells?mesodermal cells that develop on the inside of the blastocyst
ectodermal cells that line the inside of the blastocoel
endodermal cells on the exterior of the embryo
endodermal cells that migrate to the inside of the blastoceol
Chordin is an organizer protein found only in the dorsal regions of Xenopus laevis embryos. An antibody
to chordin might disrupt the determination of which structure?kidneys
digestive system
lungs
central nervous system
Use the following information when answering the corresponding question.
During rotation of the fertilized frog egg, there is a major shift in the cytoplasmic contents of the zygote.
This shift is immediately preceded by the formation of microtubule networks. Microtubules begin to
coalesce shortly after fertilization; they arise from a single "aster" formation (E. Houliston and R. P.
Elinson. 1991. Patterns of microtubule polymerization relating to cortical rotation in Xenopus
laevis eggs. Development 112:107-17).
Cytoplasmic contents in the fertilized egg move along microtubule networks. What kinds of proteins would
you predict would facilitate these movements?enzymes
kinesins
tubulins
keratins
collagens
Use the following information when answering the corresponding question.
During rotation of the fertilized frog egg, there is a major shift in the cytoplasmic contents of the zygote.
This shift is immediately preceded by the formation of microtubule networks. Microtubules begin to
coalesce shortly after fertilization; they arise from a single "aster" formation (E. Houliston and R. P.
Elinson. 1991. Patterns of microtubule polymerization relating to cortical rotation in Xenopus
laevis eggs. Development 112:107-17).
If microtubule formation were disrupted experimentally by the use of drugs, the effects might include all of
the following except ________.failure of organizer formation in the fertilized egg.
failure of cytoplasmic RNAs to be translated into zygote proteins.
failure of transcription of tissue-specific mRNAs.
failure of gastrulation of the embryo.
During organogenesis, the first organ system to begin forming in animal embryos is ________.the nervous system.
the digestive system.
the circulatory system.
the excretory system.
the endocrine system.
Sperm-egg interactions are species-specific in sea urchins, but not in mammals. What might be one
reason for this difference?Sperm have evolved to become more selective in mammals.
Other kinds of signals serve similar functions in mammals.
Sperm-egg recognition relies on egg cytoplasmic components in mammals.
Sea urchin fertilization occurs in open ocean.
Which of the following is the correct sequence in the development of specialized cells?pattern formation, morphogenesis, determination, differentiation
differentiation, pattern formation, morphogenesis, determination
differentiation, determination, morphogenesis, pattern formation
pattern formation, determination, morphogenesis, differentiation
pattern formation, morphogenesis, differentiation, determination
The cells of the somites are determined to become all of the following tissues except ________.skin tissue.
muscle tissue.
connective tissue.
bone tissue.
nervous tissue.
During early cleavage in animal embryos, minimal growth of the embryo is observed, even though rapid
cell division is taking place. How might this lack of growth be most easily measured without destroying the
embryo?vital dye uptake measurements
oxygen uptake measurements
measurements of embryo movement
counting the number of nuclei in the embryo
The allele D codes for right-handed coiling in a species of snail. Assuming no material effect, what
percentage of offspring from the cross of a dd female with aDd male will show left-handed coiling?0%
25%
50%
75%
100%
Chapter 23
One unique feature of fertilization in flowering plants compared with animals is that ________.multiple ovules exist in the ovary.
the process involves double fertilization.
the gametes are diploid, not haploid.
plant sperm are motile.
nuclear fusion does not take place.
All of the following statements are true of the endosperm except that ________.it may be likened to the yolk of an animal egg.
it is formed from equal contributions of both parents.
it is used as a food source by the embryo.
it is the major energy source for germination.
it is a triploid tissue.
Of the following developmental processes, which is not undergone by plant embryos?fertilization
organogenesis
cleavage
embryogenesis
gastrulation
Many flowering plant species have elaborate mechanisms to prevent an individual's pollen from fertilizing
its own egg cells. Why?to prevent cross-species fertilization and the production of dysfunctional hybrid offspring
to prevent double fertilization and the formation of endosperm
to prevent inbreeding
to prevent polyspermy
In flowering plants, an event known as double fertilization occurs when ________.Two eggs are simultaneously fertilized by two sperm nuclei.
Two sperm enter the ovule; one fertilizes the egg, and the other fertilizes a 2n cell to generate endosperm.Two sperm cells fertilize one normal egg cell to make a 3n embryo, and the embryo later becomes 2n during a unique mitotic division.
None of the above apply.
Plant embryos cannot undergo gastrulation. What ensures the correct positioning of cells during plant
embryogenesis?cell movements inside the seed coat
genetic differences among the cells
expansion of the cotyledons
cytoplasmic determinants in the cells
different cell sizes and planes of mitosis
The monopterous gene in Arabidopsis encodes a protein that is similar in its function to which animal
protein?keratin in human embryos
Bicoid in fruit-fly embryos
MyoD in frog embryos
Auxin has an effect on plant embryos much like the Bicoid protein in Drosophila. If auxin were added to a
culture of embryonic root cells, what would be the likely result?Root cells would change into meristem cells.
Root cells would elongate and mature.
Root cells would halt their development.
Root cells would not respond to auxin.
The auxin produced in Arabidopsis embryos and Bicoid protein produced in Drosophila embryos have
what similar function?Both establish a concentration gradient that demarcates the anterior-posterior axis.
Both are regulatory transcription factors that serve as cell-to-cell signals.
Both trigger the transcription of homeotic loci - genes that specify the types of structures produced at a certain position.Both are cytoplasmic determinants - they are loaded into eggs by cells in the mother or by female reproductive tissues.
The basal cell in a plant embryo ________.forms the suspensor that anchors the embryo.
develops from the root of the embryo.
differentiates after gastrulation.
divides to form cotyledons.
divides to form hypocotyls.
Meristematic tissue cells in plants are most similar to which kind of cells in animals?somite cells
ectodermal cells
mesodermal cells
embryonic stem cells
If the expression of the PHAN gene is blocked in plants, what will be the likely result?Plants will develop leaves in inappropriate places.
Plants will develop more leaves than usual.
Plants will develop leaves in very simple shapes.
Plants will fail to develop leaves.
Organs in developing flowers include all of the following except ________.stamens.
carpels.
sepals.
whorls.
petals.
The floral meristem in flowering plants develops from the shoot apical meristem, which usually produces
leaves. Which floral part is not a modified leaf?receptacle
carpel
petal
sepal
stamen
The ABC model of flower development suggests that ________.each of the three genes codes for the formation of a different flower organ.
genes may work alone or together to form different flower organs.
inactivation of genes may transform one organ into another.
genes may work alone or together to form different flower organs; inactivation of genes may transform one organ into another.each of the three genes codes for the formation of a different flower organ; genes may work alone or together to form different flower organs, and inactivation of genes may transform one organ into another.
The ABC genes in Arabidopsis are considered homeotic genes. What could be a reason for this
classification?Each gene codes for proteins similar to Hox genes in mice.
Each of the three genes codes for a different flower organ.
Each gene codes for regulatory transcription factors.
Each gene directs different kinds of morphogenesis.
Each gene is similar in sequence to homeotic genes in Drosophila.
What does the ABC model of flower development attempt to explain?why petals are found on the inside of the whorl of sepals instead of on the outside
why apical meristems are converted to floral meristems in response to specific cell-to-cell signals
how different combinations of gene products trigger the formation of different floral organs
why the four types of floral organs occur in whorls
Yolk and endosperm share a number of functions. Which of the following does not describe a similarity
between them?Yolk and endosperm are both cellular products.
Yolk and endosperm both provide nutrition for embryos.
Yolk and endosperm both contain proteins.
Yolk and endosperm are both the result of a second fertilization process.
Plant and animal development share a number of features, but differ in major ways as well. Which of the
following best summarizes the similarities between the two forms of development?Both plants and animals produce specialized tissues through irreversible processes of determination and differentiation.
Both plants and animals produce gametes via meiosis followed by mitosis of haploid cells.
Both plants and animals develop from a process of single fertilization.
Both plant and animal development depends on precise control of gene expression in time and in space.
Plant and animal development share a number of features, but differ in major ways as well. Which of the
following best summarizes the differences between the two forms of development?Animal gametes are produced only after maturity is reached; plant gametes can be produced throughout a plant's lifetime.Animal development is controlled by regulatory gene sets such as Hox genes; plants have no similar control systems.
Animal tissues are irreversibly differentiated; plant tissues retain plasticity throughout life.
Animal cells frequently undergo programmed cell death; plant cells do not.
