Automation for Genomics Discovery at the Oklahoma Genome Center

AACCGGTT

Automation for Genomics Discovery at the Oklahoma Genome Center

Bruce A. RoeDepartment of Chemistry and Biochemistry, University of Oklahoma, Norman, OK 73019

Working Innovation into the Drug Discovery PipelineJune 3, 2004Houston Marriott Medical Center

AACCGGTT

Each Chromosome Contains Hundreds of Genes

Gene

ChromosomeDNA

RNA

transcribe

mRNA

process/transport

Protein

translate

Central Dogma of Molecular Biology

StableRNAs

AACCGGTT

What is a GENOME?What is a GENOME?

For humans, is the complete set of 23 For humans, is the complete set of 23 chromosome pairs that we inherited from chromosome pairs that we inherited from our parents.our parents.

The human genome contains all the The human genome contains all the information needed to make a human.information needed to make a human.

Most bacteria have only a single Most bacteria have only a single chromosome that represents it’s genome chromosome that represents it’s genome and contains all the information needed to and contains all the information needed to make that bacteria.make that bacteria.

AACCGGTT

Human Genome Project Goals 1998-2003Human Genome Project Goals 1998-2003

• Achieve ~5-fold coverage of at least 90% of the genome in Achieve ~5-fold coverage of at least 90% of the genome in a “working draft” based on mapped clones and finish one-a “working draft” based on mapped clones and finish one-third of the 3 billion base paired human genomic DNA third of the 3 billion base paired human genomic DNA sequence by the end of 2000sequence by the end of 2000

• Finish the complete human genome sequence by the end Finish the complete human genome sequence by the end of April 2003, marking the 50th anniversary of the of April 2003, marking the 50th anniversary of the discovery of the double helix structure of DNA by Watson discovery of the double helix structure of DNA by Watson and Crickand Crick

• Make the sequence totally and freely accessibleMake the sequence totally and freely accessible

• Reduce the cost of DNA sequencing to 25 cents/base over Reduce the cost of DNA sequencing to 25 cents/base over this 5 year period by developing new technologiesthis 5 year period by developing new technologies

• Study human genome sequence variation by creating a Study human genome sequence variation by creating a Single Nucleotide Polymorphism (SNP) map with at least Single Nucleotide Polymorphism (SNP) map with at least 100,000 markers100,000 markers

AACCGGTT

How Far Have We Come as of June 2004? How Far Have We Come as of June 2004?

• Over 99% of the ~3.15 billion bases in the human genome Over 99% of the ~3.15 billion bases in the human genome have been sequenced to completion finished as of April, have been sequenced to completion finished as of April, 2003. All the data is publicly available in the public databases.2003. All the data is publicly available in the public databases.

• Ten human chromosomes (7,9,10,13,14,19,20,21,22,Y) have Ten human chromosomes (7,9,10,13,14,19,20,21,22,Y) have been annotated and published and the remaining 14 are in the been annotated and published and the remaining 14 are in the final phases of annotation.final phases of annotation.

• There are fewer than 400 gaps in the sequence of the 24 There are fewer than 400 gaps in the sequence of the 24 chromosomes (22 numbered chromosome pairs plus X and Y)chromosomes (22 numbered chromosome pairs plus X and Y)

• The cost of completed genomic DNA sequencing is slightly The cost of completed genomic DNA sequencing is slightly less than 8 cents/finished base with the development of less than 8 cents/finished base with the development of improved automation.improved automation.

• Had 3 quality checking exercises where two groups checked Had 3 quality checking exercises where two groups checked the quality of another both the quality of another both in silicoin silico and by re-sequencing. and by re-sequencing.

http://www.ncbi.nlm.nih.gov/genome/seq/HsHome.shtmlhttp://www.ncbi.nlm.nih.gov/genome/seq/HsHome.shtml

AACCGGTT

How do we sequence DNA?How do we sequence DNA?

The processes is similar to taking many copies a The processes is similar to taking many copies a newspaper, shreading it, then trying to put together newspaper, shreading it, then trying to put together a copy of the original newspapera copy of the original newspaper

This is accomplished by breaking many copies of This is accomplished by breaking many copies of the DNA into small pieces and determining the order the DNA into small pieces and determining the order of the four bases in each of these small piecesof the four bases in each of these small pieces

Then, we overlap the small sequenced pieces to Then, we overlap the small sequenced pieces to obtain the sequence of the original, larger DNAobtain the sequence of the original, larger DNA

AACCGGTT

AACCGGTT

Sequence Pipeline at the University of Oklahoma Genome Center, OU-ACGT

DNA GenBank

DNA shearing(HydroshearTM)

Colony Piking(QPixIITM)

Growing subclones(HiGroTM)

Subclone Isolation I(Mini-StaccatoTM)

Subclone isolation II(VPrepTM)

Thermocycling(ABI 9700)

Sequencing(ABI 3700)

Data assembly and Analysis

Primer Synthesis

Liquid Handling

Closure

AMS-90 for PCR Product Analysis

AACCGGTT

• GeneMachines, Inc. San Carlos, CA• Precision-drilled ruby orifice• 500 m l syringe pump• Pump retraction speed range 0 – 40• A 100 to 300 ml sample sheared at a retraction speed

setting of 10 produces DNA 1- 4 Kbp fragments

Hydroshear

AACCGGTT

Digitizes colonies and picks in batches of 96 into 384-well platesPins are sterilized after each set of 96 colonies are picked

Genetix QPixII Colony Picker

QuickTime™ and aYUV420 codec decompressor

are needed to see this picture.

AACCGGTT

• Capacity: 48 shallow, 384 well plates or 24 deep well plates.• Cells are grown into TB medium supplemented with salts and antibiotic• Cells are shaken at 520 rpm for 22 hours at 370C.• After 3.5 hours, oxygen is added @ 0.5 ft3/min for 0.5 second every 30

seconds.

Cell Growth in 384 well plates in a HiGro

AACCGGTT

Zymark SciClone with Twister II

384 tip pipettor4 built in shakers

Robotic 386 well plate loader and stacker

AACCGGTT

• This Zymark robot has 384 cannula array, four built in shakers, three attached storage racks, built-in barcoding and a Twister II robotic arm.

• This automation has allow us to perform the DNA isolation completely unattended from as many as 80 384 well plates of bacterial cells per day.

Subclone Isolation I (Mini-Staccato)



AACCGGTT

The initial lysis solution (NaOH and SDS) is added to each of four 384 well plates containing bacterial cells that were loaded onto the built-in shakers incorporated into the SciClone workspace deck.




AACCGGTT


The second solution, TE-RNase A, is added to each of the 384 well plates and again shaken on the four auto-centering magnetic shakers on the SciClone workspace deck.



AACCGGTT

Once all three lysis solutions are added and the plates are shaken after each addition, the plates are transferred from the SciClone workspace deck to a storage rack by the Twister II robotic arm.




AACCGGTT

Fluorescent DNA Sequencing

LaserDetector

The sequenceinformation isfed into a computer

Reaction products areapplied to a single gellane or capillary andelectrophoresed toseparate the nestedfragment set

Dye terminator-labelednested fragment set ofDNA copies from a templatewith unknown sequencein a single reaction tube

ACG

T

AG

CC

A C G T A C A C G T T C G G

AACCGGTT

• Liquid handling station with 384-channel pipettor head • Four movable shelves on either side of the pipettor head • Used for Subclone isolation, sequencing reactions set-up and

as shown here, the ethanol-acetate precipitation clean-up step.

Subclone Isolation and Sequencing Reaction Pipetting (Velocity 11 VPrep)



AACCGGTT

950C2:00

950C0:30

500C0:20

600C4:00

40C∞

Subclone sequencing conditions

60 cycles

Thermocycling (ABI 9700)

AACCGGTT

Capillary Electrophoresis DNA Sequencing

• Our present capacity is fourteen 96 ABI 3700 capillary electrophoresis-based DNA sequencing instruments that are capable of analyzing two 384-well thermocycle plates or eight 96-well thermocycle plates per day.

• The DNA sequencing data is transferred to the Sun computer workgroup for base calling (Phred), assembly (Phrap) and analysis (Consed).

AACCGGTT

AACCGGTT

• Standard phosphoramidite chemistry in an argon- filled reaction chamber.• 192 primers synthesized at 2.5 nmole scale. Twice each day.• 2.5 nanomole synthesis (50 cents/oligo) typically is used for either PCR or

DNA sequencing primers, but can be scaled to 10 nanomole.

Primer synthesis (Mermade IV) for PCR-based closure and finishing

AACCGGTT

Data assembly and Analysis

32 GB RAM running Solaris 8 OS and 3 TB of data stored on RAID-5 arrays with autoloader tape backup

Also:• 12 workstations each with 1 GB RAM

Sun V880 server Phred/Phrap/Consed

Exgap

AACCGGTT

Sanger, Keio,

Wash U, OU

AACCGGTT

Human Chromosome 22 Human Chromosome 22 Sequence FeaturesSequence Features

• 39 % of the sequence is occupied by genes including 39 % of the sequence is occupied by genes including their introns, 5’ and 3’ non-translated regions.their introns, 5’ and 3’ non-translated regions.

• 3 % of the complete sequence encodes the protein 3 % of the complete sequence encodes the protein products of these genes. products of these genes.

• 42 % of the sequence is composed of repetitive 42 % of the sequence is composed of repetitive sequences, compared to 46 % sequences, compared to 46 % for the entire genomefor the entire genome..

• Only slightly over half of the genes predicted for Only slightly over half of the genes predicted for human chromosome 22 can be experimentally human chromosome 22 can be experimentally validated.*validated.*

* Shoemaker DD., et al. Experimental annotation of the human genome using microarray technology. Nature. 409, 922-7 (2001).

AACCGGTT

An Individual’s Genome Differs from the DNA of:

• Siblings by 1 to 2 million bases, ~99.98% identical, with coding regions 99.99999% identical

• Unrelated humans by 6 million bases, ~99.8% identical overall, with coding regions 99.9999% identical

• Chimpanzees by about 100 million base pairs ~98% identical

• Baboons by about 300 million base pairs ~92% identical• Mice by about 2.8 billion bases, but coding regions are

~90% identical• Leaf spinach by about 2.9 billion bases, but coding

regions are ~40% identical

AACCGGTT

AGCCACACAGTGTCCACCGGATGGTTGATTTTGAAGCAGAGTAGCCACACAGTGTCCACCGGATGGTTGATTTTGAAGCAGAGTTAGCTTGTCACCTGCCTCCCTTTCCCGGGACAACAGAAGCTGATAGCTTGTCACCTGCCTCCCTTTCCCGGGACAACAGAAGCTGACCTCTTTGCCTCTTTGNNTCTCTTGCGCAGTCTCTTGCGCAGATGATGAGTCTCCGGGGCTCTAATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGTGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAACAGAGTTCAAGTAAGTACTGGTTTGGGGAGGTAAGTACTGGTTTGGGGAGNNAGGGTTGCAGCGAGGGTTGCAGCGGCGCNNGAGCCAGGGTCTCCACCCAGGAAGGACTGAGCCAGGGTCTCCACCCAGGAAGGACTNNATCGGGCAGGGATCGGGCAGGGTGTGGGGAAACAGGGAGGTTGTTCAGATGACCTGTGGGGAAACAGGGAGGTTGTTCAGATGACCACGGGACACCTACGGGACACCTTTGACCCTGGCCGCTGTGGAGTGTTTGTGCTGGTTGATGCCTTTTGACCCTGGCCGCTGTGGAGTGTTTGTGCTGGTTGATGCCTTCTGGGTGTGGAATTGTTTTTCCCGGAGTGGCCTCTGCCCTCTCCTGGGTGTGGAATTGTTTTTCCCGGAGTGGCCTCTGCCCTCTCCCCTAGCCTGTCTCAGATCCTGGGAGCTGGTGAGCTGCCCCCTCCCTAGCCTGTCTCAGATCCTGGGAGCTGGTGAGCTGCCCCCTGCAGGTGGATCGAGTAATTGCAGGGGTTTGGCAAGGACTTTGAGCAGGTGGATCGAGTAATTGCAGGGGTTTGGCAAGGACTTTGACAGACATCCCCAGGGGTGCCCGGGAGTGTGGGGTCCCAGACATCCCCAGGGGTGCCCGGGAGTGTGGGGTCCNNAGCCAGAGCCAG

Differences between individuals

The yellow underlined sequence is the first exon of the BCR gene involved in leukemia. Only 5 bases (NN) differ in non-gene regions.

AACCGGTT

Human Chromosome 22Single Nucleotide Polymorphisms*

Number of overlaps 335Size of overlaps 13,203,147 bpNumber of SNPs 11,116 (~1/1000 bp)Number of substitutions 9,123 (82%)Number of ins/del 1,193 (18%)

Only 48 of the 11,116 SNPs were in coding regions ~ 10 fold lower than in non-coding

* E. Dawson, et al. A SNP Resource For Human Chromosome 22: Extracting Dense Clusters of SNPs from the Genomic Sequence. Genome Research, 11, 170-178 (2001).

AACCGGTT

““We each are like a different symphony orchestra”We each are like a different symphony orchestra”

““All playing the same instruments slightly differently”All playing the same instruments slightly differently”

AACCGGTT

Good news and Bad newsGood news and Bad news

• Good news <40,000 genes (counting dark space?)Good news <40,000 genes (counting dark space?)

• Bad newsBad news

• 2-4 times as many proteins as other 2-4 times as many proteins as other species due to extensive alternative species due to extensive alternative splicing in humans.splicing in humans.

• We only know the function of about We only know the function of about half the predicted genes.half the predicted genes.

• Likely > 1 million different gene Likely > 1 million different gene products based on alternative splicing products based on alternative splicing and post-translational modifications.and post-translational modifications.

AACCGGTT

Where we stand now

• We essentially have the ‘dictionary’ with all the words We essentially have the ‘dictionary’ with all the words (genes) spelled correctly, but only slightly more than (genes) spelled correctly, but only slightly more than half of the words (genes) have definitions.half of the words (genes) have definitions.

• Through comparative genomic sequencing we can Through comparative genomic sequencing we can annotate the human genome based on evolutionary annotate the human genome based on evolutionary conserved gene sequences and use model systems to conserved gene sequences and use model systems to study gene expression.study gene expression.

• Slightly over half of the 936 genes predicted for human Slightly over half of the 936 genes predicted for human chromosome 22 have been experimentally validated.chromosome 22 have been experimentally validated. • 223 have a known function and expression223 have a known function and expression• 172 have no known function but evidence for expression172 have no known function but evidence for expression• 182 have no known function and no evidence for expression182 have no known function and no evidence for expression• 228 pseudogenes228 pseudogenes

AACCGGTT

If a genomic region is conserved in evolutionary distant organisms, it is present because the region is maintained through selective pressure over evolutionary time likely because it performs necessary function.

AACCGGTT

AACCGGTT

Chimpanzee and Baboon Genomic Sequencing

• Medically important model eukaryotic organisms

• The chimpanzee is our nearest evolutionary relative with a genome that has ~98 % sequence identity with the human genome

• The baboon genome has ~92 % sequence identity with the human genome

AACCGGTT

PIP Plot of a region of

human chr22

compared to syntenic regions of

baboon and mouse

human-specificrepeatregions

Questionable gene present in primates but not in rodents

AACCGGTT

34 Kbp deletio

n in baboon

AACCGGTT

Exons in one copy of a zebrafish

duplicated gene with

75% homology to human but

greatly diverged,

<50% homology, in

the other copy

AACCGGTT

A complementary approach is to determine if the predicted protein coding conserved elements are functional by investigating their expression profiles during development.

AACCGGTT

Whole mount in situ hybridization using zebra fish as the model organism

Small people that swim in the water and breath through gills… Han Wang, OU

AACCGGTT

• Have a short, ~ 3 month to reproductive maturity.• Can be easily bred in the lab in large numbers.• Are small in size - an adult is just a few centimeters long. • Have an ~ 5 day embryonic development period from

fertilized egg to a swimming fish. • The embryos are transparent making it easy to see internal

organs during development.• Is well established as a resource for genetic studies.• The Sanger Institute is completing the genome sequence,

which presently is ~50% complete and publicly available.• More than 90 % of the predicted human genes have a zebra

fish ortholog.

Zebrafish as a model system

AACCGGTT

P

P

P

DIG-labeled ssDNA or RNA probe

Digoxigenin label uridine

mRNA

Wash Wash

1. Add digoxigenin-labeled probe complementary to RNA of interest

2. Add alkaline phosphatase-conjugated antibody that binds to digoxigenin

3. Add BCIP + NBT that turns dark purple dye when dephosphorylated by the alkaline phosphatase thereby coloring the cell

Whole mount in situ hybridization

Alkaline phosphatase-conjugated anti-DIG antibody BCIP* + NBT**

*BCIP = 5 bromo-4-chloro-indoxyl phosphate **NBT = nitro-blue-tetrazolium

AACCGGTT

Mermade synthesis of unique exon specific primers of the gene of interest

PCR off zebra fish genomic DNA

Followed by unidirectional amplification with either forward or reverse (nested) primers in the presence of

DIG-labeled dUTP

ssDNA (sense and antisense probes)

Exon-specific ssDNA primers

These steps now have been automated in a 96 well format

AACCGGTT

PCR F R PCR F R PCR F R PCR F R PCR F R

SizeMarkers

1078603310

Ethidium bromide stained 1% agarose gel of dsPCR off genomic DNA and subsequently unidirectional

amplified single stranded DNA probes

• These studies clearly demonstrate that, contrary to popular belief, single stranded DNA contains regions that fold into sufficient double stranded secondary structures that ethidium bromide can bind.

• However, agarose gel electrophoresis is labor intensive (slab gel preparation and loading), electrophoresis is time consuming, and detection typically requires the use of carcinogenic ethidium bromide

AACCGGTT

AMS-90 for ssPCR primer, dsPCR and single strand unidirectional exon amplification

AACCGGTT

PCR and Unidirectional Single Primer Amplification on the AMS-90

Both double and single stranded DNA rapidly can be resolved, detected and archived on the AMS-90

ds PCR product

single stranduni-directional

productsF R

ds PCR product


productsF R

ds PCR product


productsF R

ds PCR product


productsF R

70004900290019001100

700500

300

100

15

Bases

AACCGGTT

Custom MerMade Synthesized 20-mer DNA Primers Rapidly Analyzed on the AMS-90

Rapid, 30 seconds/lane run time vs over an hour/samplevia capillary electrophoresis, of single stranded oligonucleotides

Decreasing 20-mer Concentration Increasing 20-mer Concentration

70004900290019001100

700500

300

100

15

Bases

ug/ul 2.0 1.0 0.5 0.25 0.12 0.06 0.06 0.12 0.25 0.5 1.0 2,0

AACCGGTT

AMS-90 vs Ethidium Bromide Stained Agarose Gels or Capillary Electrophoresis

• Both can be used to resolve and view both double stranded and single stranded DNAs

• However, analysis on the AMS-90 requires:• minimal human interaction, • no separate photography, • much less technician time, • eliminates the use of carcinogenic

ethidium bromide • is less error prone and• takes much less time.

AACCGGTT

Human hypothetical protein-KIAA0819One gene with 11 exons on Hu Chr 22

This one gene is split into 2 genesin zebra fish

• ZF1 - Genomic location:307,280-316,461 bp on Sanger Institute chromosome fragment ctg14067

• With the first 4 exons

• ZF2 - Genomic location:107,344-119,287 on Sanger Institute chromosome fragment ctg11065

• With the remaining 7 exons

Note: 4 + 7 = 11

AACCGGTT

A multiPIP analysis of the predicted genes from human, rat, mouse, fugu and zebra fish (ZF1 and ZF2) with homology to cDNA probe KIAA0819

100%50%

AACCGGTT

Orthologous duplicated copies of a single copy human KIAA0819 gene in zebra fish

ZF1 ZF2

Single human kiaa0819 gene

Two zebra fish kiaa0819 gene orthologs

AACCGGTT

No probeSense probeAntisense probe

48hpf

24hpf

120hpf

Whole mount in situ hybridization of ssDNA probes for the ZF1 gene

Only antisense probe hybridization to the Otic Placode

AACCGGTT

Expression of ZF1 Gene in the Otic Placode

Five sensory patches develop from the embryonic ear in three cristae associated with a semicircular canal and two maculae associated with an otolith.

AACCGGTT

Sense probeAntiSense probe

24 hpf

48 hpf

forebrain

hindbrain

Otic placodehindbrainPectoral fin

Whole mount in situ hybridization of a ssDNA probe unique to the ZF2 gene at 24 and 48 hpf

Only antisense probe hybridization to the hindbrain, forebrain, Otic Placode and pectoral fin

AACCGGTT

ZF2, 48 hpf

Otic placodes Pectoral fin

Expression of ZF2 is seen in the edge of the otic placode with no defined sensory patches, and in the budding pectoral fin.

hindbrain

AACCGGTT

Expression analysis show functional divergence after duplication in zf1and zf2

• ZF1 is expressed only in the Otic Placode seen at 24-120 hpf

• ZF2 is expressed in the hindbrain, otic placode and the pectoral fin, with the expression in the otic placode differing from that of ZF1

• It is highly likely that the one gene in humans is expressed in the developing ear, brain and involved in early limb development

AACCGGTT

Whole mount in situ hybridization of a ssDNA probe for Human Gene: NM_032775-ENSG00000185214

On Hu Chr 22 at positions 19,120,360 - 19,174,676(no expression confirming ESTs)

120hpf

160hpfSwim bladder

Otic placode

Otic placodeSwim bladder

Antisense probe Sense probe



Only antisense probe hybridization to the Otic Placode and swim bladder

AACCGGTT

Summary of in situ hybridization studies:

Gene Antisense probe Sense probe ESTs

Dj508I15.c22.5 Brain - +Phf5a-like gene Brain - -KIAA0819-ZF1 Otic placode - +KIAA0819-ZF2 Hind brain, Otic placode, - +

and pectoral finNM_032775 Otic placode and - -

swim bladder DGCR8 Hind brain, Hind brain and +

Branchial arches, pectoral finHeart, and pectoral fin

AP000553.6 Notochord, liver Notochord -Hind brain, andOtic placode

3 out of 7 predicted genes but with no previous evidence for expression

AACCGGTT

• It now is clear that there are large conserved sequence regions from evolutionary distant organisms ranging from humans to fish. If these regions are conserved, the function of the encoded genes also likely is conserved.

• The zebra fish is an ideal system in which to investigate protein expression profiles for genes that are human orthologs.

• All aspects of this work have been and will continue to be improved by automation.

Conclusions:

AACCGGTT

What’s next for our Genome Center?• Participate in sParticipate in sequencequencinging the mouse, chimp, baboon, the mouse, chimp, baboon,

lemur, bovine, dog, cat, chicken and zebra fish lemur, bovine, dog, cat, chicken and zebra fish genomes concentrating on:genomes concentrating on:• Regions of high biological interest andRegions of high biological interest and• Regions orthologous to human chromosome 22Regions orthologous to human chromosome 22

• SeqSequence the uence the Medicago truncatulaMedicago truncatula (alfalfa) genome (alfalfa) genome using a mapped BAC-based approach concentrating using a mapped BAC-based approach concentrating on coding regionson coding regions

• Continued seqContinued sequencing of selected pathogenic bacteriauencing of selected pathogenic bacteria• Investigate the function of the predicted genes with Investigate the function of the predicted genes with

unknown function in the zebrafish system first by unknown function in the zebrafish system first by whole mount whole mount in situin situ and then expression knock down and then expression knock down experiments with morpholino oligos, once robust, experiments with morpholino oligos, once robust, automated methods have been developed.automated methods have been developed.

AACCGGTT

Laboratory OrganizationLaboratory OrganizationBruce Roe, PIBruce Roe, PI

InformaticsInformatics

Support TeamsSupport Teams

ProductionProduction AdministrationAdministration

Jim WhiteJim WhiteSteve KentonSteve KentonHongshing LaiHongshing LaiSean Qian***Sean Qian***

Rose Morales-Diaz*Rose Morales-Diaz*Mounir Elharam*Mounir Elharam*Steve Shaull**Steve Shaull**Doug WhiteDoug WhiteWork-study Undergraduate students**Work-study Undergraduate students**

KayLynn HaleKayLynn HaleDixie WishnuckDixie WishnuckTami WomackTami WomackMary Catherine WilliamsMary Catherine Williams

DNA SynthesisDNA Synthesis

Phoebe Loh*Phoebe Loh*Sulan QiSulan QiBart Ford*Bart Ford*

Reagents &Reagents &Equip. Maint.Equip. Maint.

Mounir Elharam*Mounir Elharam*Doug WhiteDoug WhiteClayton Powell**Clayton Powell**

Axin Hua***Axin Hua***Weihong Xu****Weihong Xu****Yanhong LiYanhong Li

Jami Milam****Jami Milam**** Sara Downard**Sara Downard**Ging Sobhraksha**Ging Sobhraksha**

Limei YangLimei YangAngie Prescott*Angie Prescott*Audra Wendt**Audra Wendt**Mandi Aycock**Mandi Aycock**

Ziyun Yao***Ziyun Yao***Steve Shaull*Steve Shaull*Youngju Yoon****Youngju Yoon****

Trang DoTrang Do Anh DoAnh DoLily FuLily FuYang Ye**Yang Ye**Tessa Manning**Tessa Manning**

Fu Ying Fu Ying Liping ZhouLiping ZhouRuihua Shi****Ruihua Shi****Junjie Wu****Junjie Wu****

Stephan Deschamps***Stephan Deschamps***Shelly Oommen****Shelly Oommen****Christopher Lau****Christopher Lau****

Research TeamsResearch TeamsDoris KupferDoris KupferJulia Kim*Julia Kim*Sun SoSun SoGraham Wiley**Graham Wiley**

Lin Song****Lin Song**** Ying NiYing NiHuarong JiangHuarong Jiang

ShaoPing Lin***ShaoPing Lin***Honggui JiaHonggui JiaHongming WuHongming WuBaifang QinBaifang QinPeng Zhang Peng Zhang

Shuling LiShuling Li

Fares Najar***Fares Najar*** Chunmei QuChunmei QuKeqin WangKeqin Wang

Funding from the NHGRI, Noble Foundation, DOE, NSF - Collaborators at Sanger, CWRU, CHOP, Keio, UIUC and Riken

Pheobe LohPheobe Loh * *Sulan QiSulan QiBart Ford*Bart Ford*

* Previous undergraduate res. student* Previous undergraduate res. student** Present undergraduate res. student** Present undergraduate res. student*** Previous graduate student*** Previous graduate student**** Present graduate student**** Present graduate student

AACCGGTT

The AACCGGTT Team

AACCGGTT

Peggy and Charles Stephenson CenterPeggy and Charles Stephenson Center

AACCGGTT

Documents

Automation for Genomics Discovery at the Oklahoma Genome Center