ASAM Nukleat

  • Published on
    21-Oct-2015

  • View
    13

  • Download
    1

Embed Size (px)

Transcript

  • NUCLEIC ACIDS

  • Nucleic acids are molecules that store information for cellular growth and reproduction

    A nucleotide consists of a nitrogenous base, a pentose sugar and a phosphate group:

  • The pyrimidines and purines found in DNA and RNA

    Nucleotides and Nucleic Acids

  • Structures of the four deoxyribonucleotidesNucleotides and Nucleic Acids

  • Structures of the four ribonucleotides

    Nucleotides and Nucleic Acids

  • Pentose SugarsThere are two related pentose sugars:- RNA contains ribose- DNA contains deoxyriboseThe sugars have their carbon atoms numbered with primes to distinguish them from the nitrogen bases

  • Ikatan nukleotida DNA dan RNA

  • Ikatan Hidrogen pada pasangan basa Watson dan Crick

  • Base Pairing in the DNA Double Helix

  • Avery-Macleod-McCarty

  • Difraksi Sinar XDNA

  • Watson-Crick model for the structure of DNA

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    Hydrogen bonds between bases hold the strands together: A and T, C and GFigure 10.3DRibbon modelPartial chemical structureComputer modelHydrogen bond

  • Central dogma of molecular geneticsThe function of DNA is to store information and pass it to RNAThe function of RNA is to read, decode, and use the information received from DNA to make proteinsThree fundamental processes take place:Replication process by which identical copies of DNA are made so the information can be preserved and handed down to offspringTranscription the process by which the genetic messages are read and carried out of the cell nucleus to ribosomes, where protein synthesis occursTranslation the process by which the genetic messages are decoded and used to synthesize proteinsBase Pairing in DNA: The Watson-Crick Model

  • A representation of semiconservative DNA replicationReplication of DNA

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    DNA replication begins at many specific sitesHow can entire chromosomes be replicated during S phase?Figure 10.5AParental strandOrigin of replicationBubbleTwo daughter DNA moleculesDaughter strand

  • Direction of ReplicationThe enzyme helicase unwinds several sections of parent DNA At each open DNA section, called a replication fork, DNA polymerase catalyzes the formation of 5-3ester bonds of the leading strandThe lagging strand, which grows in the 3-5 direction, is synthesized in short sections called Okazaki fragmentsThe Okazaki fragments are joined by DNA ligase to give a single 3-5 DNA strand

  • What sequence of bases on one strand of DNA is complementary to the sequence TATGCAT on another strand?

    Worked Example 24.1

    Predicting the Complementary Base Sequence in Double-Stranded DNA

  • StrategyRemember that A and G form complementary pairs with T and CGo through the sequence replacing A by T, G by C, T by A, and C by GRemember that the 5 end is on the left and the 3 end is on the right in the original strand

    Worked Example 24.1

    Predicting the Complementary Base Sequence in Double-Stranded DNA

  • SolutionOriginal: (5) TATGCAT (3)Compliment:(3) ATACGTA (5) or (5) ATGCATA (3)

    Worked Example 24.1

    Predicting the Complementary Base Sequence in Double-Stranded DNA

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    The DNA is transcribed into RNA, which is translated into the polypeptideFigure 10.6ADNARNAProteinTRANSCRIPTIONTRANSLATIONThe information constituting an organisms genotype is carried in its sequence of bases

  • DNA TRANSCRIPTION

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    An exercise in translating the genetic codeFigure 10.8BStart codonRNATranscribed strandStop codonTranslationTranscriptionDNAPolypeptide

  • UCAGUCAGGACUGACUGACUGACUUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGpheleuleuilemet (start)valUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGserprothralaUAUUACUAAUAGCAUCACCAACAGAAUAACAAGAAAGAUGACGAAGAGtyrstopstophisglnasnlysaspgluUGUUGCUGAUGGCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGcysstoptrpargserargglyFirst BaseThird BaseSecond BaseVirtually all organisms share the same genetic code unity of life

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the otherFigure 10.11B, CAnticodonAmino acid attachment site

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    Ribosomes build polypeptidesFigure 10.12A-CCodonstRNAmoleculesmRNAGrowing polypeptideLarge subunitSmall subunitmRNAmRNA binding siteP siteA sitePAGrowing polypeptidetRNANext amino acid to be added to polypeptide

  • What amino acid sequence is coded by the following segment of a DNA coding strand?

    (5) CTA-ACT-AGC-GGG-TCG-CCG (3)

    Worked Example 24.2

    Predicting the Amino Acid Sequence Transcribed from DNA

  • StrategyThe mRNA produced during translation is a copy of the DNA coding strandEach T replaced by UThe mRNA has the sequence(5) CUA-ACU-AGC-GGG-UCG-CCG (3)

    Worked Example 24.2

    Predicting the Amino Acid Sequence Transcribed from DNA

  • Solution Leu-Thr-Ser-Gly-Ser-Pro

    Worked Example 24.2

    Predicting the Amino Acid Sequence Transcribed from DNA

  • DNA Sequencing

  • Polymerase Chain Reaction

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

    Types of mutationsFigure 10.16BmRNANORMAL GENEBASE SUBSTITUTIONBASE DELETIONProteinMetLysPheGlyAlaMetLysPheSerAlaMetLysLeuAlaHisMissing

    Copyright 2003 Pearson Education, Inc. publishing as Benjamin Cummings

  • 11.8 Recombinant DNA Technology, Continued

  • 11.8 Recombinant DNA Technology, ContinuedTherapeutic Proteins

    The human insulin gene was the first application of recombinant DNA technology. It was incorporated into a bacteria called Escherichia coli.

    Insulin produced in this manner eliminated many of the side effects that occurred from the use of pig and cow insulin.

    Recombinant technology is used to insert genes into crop and food plants offering many growth advantages.

  • 11.8 Recombinant DNA Technology, ContinuedNuclear TransplantationCloning an Organism

    Clone means to make an exact copy.

    Cloning an organism creates a genetic copy of the original organism.

    Cloning involves taking nuclear DNA from an adult cell and transplanting it into an egg whose DNA has been removed.

  • 11.8 Recombinant DNA Technology, Continued

    50 bases per sec in mammals, 500 bases per sec in bacteria. About a dozen enz needed for DNA replication.only about 1 mistake per billion. Proofreading and repairs are done by DNA polymerase, DNA ligase. Figure: 14-07

    Title:The genetic code dictionary.

    Caption:If we know what a given mRNA codon is, how can we find out what amino acid it codes for? This dictionary of the genetic code offers a way. In Figure 14.5, you saw that the codon CGU coded for the amino acid arginine (arg). Looking that up here, C is the first base (go to the C row along the first base line), G is the second base (go to the G column under the second base line) and U is the third (go to the codon parallel with the U in the third base line).