Accepted Manuscript

Antimicrobial activity and spectroscopic characterization of surfactin class oflipopeptides from Bacillus amyloliquefaciens SR1

Nanjundan Jaivel, Rajesh Ramasamy, Uthandi Sivakumar, Ponnusamy Marimuthu

PII: S0882-4010(18)30844-1

DOI: https://doi.org/10.1016/j.micpath.2019.01.037

Reference: YMPAT 3379

To appear in: Microbial Pathogenesis

Received Date: 10 May 2018

Revised Date: 23 January 2019

Accepted Date: 23 January 2019

Please cite this article as: Jaivel N, Ramasamy R, Sivakumar U, Marimuthu P, Antimicrobial activity andspectroscopic characterization of surfactin class of lipopeptides from Bacillus amyloliquefaciens SR1,Microbial Pathogenesis (2019), doi: https://doi.org/10.1016/j.micpath.2019.01.037.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service toour customers we are providing this early version of the manuscript. The manuscript will undergocopyediting, typesetting, and review of the resulting proof before it is published in its final form. Pleasenote that during the production process errors may be discovered which could affect the content, and alllegal disclaimers that apply to the journal pertain.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1

Antimicrobial activity and Spectroscopic characterization of Surfactin class of

Lipopeptides from Bacillus amyloliquefaciens SR1

Nanjundan Jaivel*, Rajesh Ramasamy, Uthandi Sivakumar and Ponnusamy Marimuthu

Department of Agricultural Microbiology, Tamil Nadu Agricultural University, Coimbatore, 641

003, Tamil Nadu, India

*Corresponding author email: jaivelmicro@gmail.com

Abstract

A bacterial isolate screened from wet land soil sample, found to posses antimicrobial

activity against an array of fungal plant pathogens viz., Rhizoctonia solani, Sclerotium rolfsii

Alternaria solani, Fusarium oxysporium under in vitro dual culture plate assay. Further the

isolate was identified into Bacillus amyloliquefaciens based on 16S rRNA sequencing studies.

The antimicrobial fraction from the extracellular supernatant of the isolate comprises chiefly of

surfactin molecules and also iturin and fengycin group of compounds. The surfactins were

partially purified by tangential flow ultra-filtration and quantified with liquid chromatography

yielding 316.1 mg L-1. Further the surfactin molecules were characterized by HPLC separation,

FT-IR, LC-MS spectroscopy and PCR amplification of antibiotic genes. The surfactin molecule

with m/z 1022 performed for ms-ms fragmentation and produced two different patterns of ion

dissociation.

Key words: Antifungal, Bacillus amyloliquefaciens SR1, LC-MS, lipopeptides, surfactin, PCR

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

2

1. Introduction

Control of plant diseases by biological control agents is emerging as an alternative

strategy mainly depends on colonization of the microbe in the host phyllosphere or rhizosphere,

or by induction of induced resistance. Bacteria belonging to the genus Bacillus are known for

their widespread distribution in nature, ability to produce diverse secondary metabolites and

capable of endospore formation make them to survive under different adverse conditions [1,2,3].

Several strains of Bacillus adopt different mechanisms of action to cater plants from the plant

diseases. Synthesizing of antimicrobial secondary metabolites, induction of defense responses in

the host plant, and competition for nutrient sources and space are some of them [4,5,6].

The Bacillus strains are also known for production of several antimicrobial peptides

characterized by a wide antimicrobial spectrum and intense surfactant activities. In relation to

biocontrol of plant diseases, the three families of Bacillus lipopeptides - surfactins, iturins and

fengycins were at first mostly studied for their antagonistic activity for a wide range of potential

phytopathogens, including bacteria, fungi and oomycetes [7,8]. Antimicrobial peptides (AMPs)

are short sequence peptides with generally fewer than 50 amino acid residues, most of which

have antimicrobial activity against a broad spectrum of pathogens including Gram-positive and

Gram-negative bacteria and fungi [9]. AMPs produced by Bacillus spp. have been implicated in

the biocontrol of several plant pathogens causing aerial, soil, and postharvest diseases and in the

promotion of plant growth [10,11,12]. Recent investigations showed that these lipopeptides

influencing the colonization and persistence of Bacillus in rhizosphere and have a key role in the

beneficial interaction of Bacillus species with plants by stimulating host defense mechanisms [8].

In the present study a bacterium isolated from wet land soil is studied for their in vitro

antimicrobial activity against selected fungal pathogens. The antimicrobial fraction from

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

3

extracellular supernatant of the isolate was studied in detail by spectroscopic characterization and

the findings are presented in this paper.

2. Material and methods

2.1. Microbial culture

The SR1 isolate was grown in Nutrient agar slants for 48 hours and maintained under

refrigerated conditions. The fungal plant pathogens used in this study were obtained from the

Department of Plant Pathology, Tamil Nadu Agricultural University, Coimbatore, India.

2.2. Chemicals

The chemicals used in the present study were of analytical reagent grade. It was

purchased from Himedia, Sigma, Qualigens and SD Fine Chem., India.

2.3. Screening of antimicrobial activity

The bacterial isolate were evaluated for their antimicrobial activity under in vitro against

selected plant pathogens viz., Rhizoctonia solani, Sclerotium rolfsii, Fusarium oxysporum,

Alternaria solani using dual culture plate assay. Both the bacterial isolate and the test pathogen

were allowed to grow on a single petri plate and observations were taken based on the

suppression of the plant pathogen.

2.4. Identification of bacteria by 16S rRNA sequencing

The SR1 isolate were initially categorized by preliminary microscopic examination after

gram staining. Further grouping based on the results of various biochemical tests, the organisms

were identified up to generic level by referring to the Bergy’s manual.

The total genomic DNA from the Bacillus amyloliquefaciens SR1 strain was isolated

using the method given by [13] with slight modifications. The genomic DNA subjected to PCR

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

4

using the forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'-

ACGGCTACCTTGTTACGACTT-3' for the amplification of 16S rRNA gene.

PCR products were sequenced through single pass analysis from forward and reverse

direction [14]. Sequence data was compared with available data by BLAST analysis in NCBI

sequence data bank. Relevant sequences were collected and data was plotted with Mega 7.0

software and phylogenetic tree was constructed [15].

2.5. Multiplication of SR1 isolate in growth media

A seed culture of Bacillus amyloliquefaciens was prepared by inoculating a loop of

biomass into a 250 ml Erlenmeyer flask containing 100 ml of Luria-Bertani broth and then

incubating at 30 ºC for 24 hours. A 5 % level of this inoculum was transferred into 200 ml of

Landy’s broth contained in 500 ml Erlenmeyer flasks and then incubating at 30 ºC for 72 hours

for lipopeptide production.

2.6. Separation of extracellular lipopeptide fractions (ELFs)

The ELFs was isolated from the cell free broth of 72 h grown culture. The bacterial cells

were removed from surfactant containing culture broth by centrifugation at 10000 rpm at 4˚C for

10 min. The supernatant was precipitated overnight at 4˚C by adding 3N HCl to achieve a final

pH of 2.0, to precipitate lipopeptides. The pellets formed by precipitation were collected by

centrifugation at 10000 rpm at 4˚C for 20 min and used for bioactivity studies. The antimicrobial

activity of ELFs evaluated by agar well diffusion experiment and the surfactant property checked

by oil spreading technique.

2.7. Antimicrobial activity of ELFs

The antimicrobial activity of the ELFs against selected fungal plant pathogens was

studied by agar well diffusion method [16]. The sterilized medium was poured into the

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

5

petriplates and allowed to solidify. Then each petriplate was divided into four equal quarters.

Using a sterile cork borer, wells of 6 mm diameter were made in two quadrat of the plate

containing the media. For each organism, 40 µl of the prepared test sample was loaded in each

well. The test samples were prepared in the concentration of 1mg/ml. Three replications were

maintained for each treatment. For each test pathogen the negative control (three replications

each) were also loaded in a separate well. The fungal discs were kept in the petri plates using

cork borer. The plates were incubated for 72 h and the observations were taken. The

antimicrobial spectrum of the crude extract was determined in terms of zone of inhibition. The

observations were made by measuring the inhibition zone (or halo like area), which indicates the

absence of microbial growth around the well. The diameter of inhibition zone (DIZ) was

measured and the mean DIZ was calculated.

2.8. Oil spreading technique

In oil spreading assay [17], 10 µl of crude oil was added to the surface of 40 ml of

distilled water in a petri dish to form a thin oil layer. Then, 10 µl of ELF were gently placed on

the centre of the oil layer. The presence of biosurfactant would displace the oil and a clear zone

would form, which can be visualized under visible light indicate the surfactant activity.

2.9. Amplification of antibiotic genes in SR1 isolate

2.9.1. Surfactin

The forward primer SUR3F (5’ACAGTATGGAGGCATGGTC3’) and reverse primer

SUR3R (5’TTCCGCCACTTTTTCAGTTT3’) were used for amplification of surfactin gene

(441 bp) [18]. The 40 µl PCR reaction mixture contained DNA template 50 ng, 1X Taq buffer,

0.2 mM of each of dNTP mixture, 1 µM of each primers, 1.5 mM MgCl2 and 2U of Taq DNA

polymerase. PCR amplification was performed in a Mastercycler with the following conditions

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

6

of initial denaturation at 94°C for 3 min, 40 cycles consisting of 94°C for 1 min (denaturation),

57°C for 1 min (annealing), 72°C for 1 min (primer extension) and final extension 72°C for 10 min.

2.9.2. Iturin A

The forward primer ITUD1F (5’GATGCGATCTCCTTGGATGT3’) and reverse primer

ITUD1R (5’ATCGTCATGTGCTGCTTGAG3’) were used for amplification of iturin A gene

(647 bp) [18]. The 20 µl mixture contained approximately 50 ng of total DNA, 5 mM each dNTPs,

20 pmol of each forward and reverse primer and 0.5 U of Taq DNA polymerase. PCR

amplification was performed with the conditions of initial denaturation at 94°C for 3 min, 40

cycles consisting of 94°C for 1 min (denaturation), 60°C for 1 min (annealing), 72°C for 1 min

(primer extension) and final extension 72°C for 10 min.

2.10. Fourier Transform Infrared Spectroscopy

The FT-IR (Fourier Transform Infrared) spectroscopy of ELFs was performed in a

diffuse reflectance mode at a resolution of 4 cm-1 using JASCO FT-IR-6800 and the absorption

frequencies were expressed in reciprocal centimeters (cm-1). The spectral data were collected

over the range of 450-4500 cm-1. The data collected were the average of 50 scans over the entire

range. The collected data was used to infer the overall nature of chemical bonds and functional

groups in the extracellular fraction. The FT-IR spectrum of a standard lipopeptide biosurfactant,

surfactin (Sigma) was also obtained in parallel. The two spectra were compared in order to

confirm the chemical nature of the lipopeptide fraction from SR1 isolate.

2.11. Purification and quantification of surfactin

The crude ELFs collected from SR1 isolate subjected to ultrafilteration (UF) for partial

purification of surfactin molecules. The miniature Tangenetial Flow Filteration (TFF) module

from PALL Lifesciences was used for purification of surfactin. The UF memebranes with the

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

7

size of 1kDa and 3kDa were used for the filteration purpose. The partially purified surfactin

molecules from SR1 isolate subjected to LC detection along with standard surfactin (Sigma). The

concentration of surfactin derived from the standard graph plotted for the gradient of standard

surfactin molecule.

2.12. LC-MS characterization of ELFs from SR1 isolate

The lipopeptide molecules separated from the fermentation broth of Bacillus

amyloliquefaciens SR1 using acid precipitation technique were subjected to LC-MS

characterization in a Shimadzu LC-8040 system. The LC were carried out in Nexera X2 module

with SIL30AC autosampler injection volume of 10µl. The mobile phase methanol: water (90:10)

with 0.1% TFA enabled by LC30AD Pump were used for the LC separation of crude lipopeptide

fraction. The LC separation was carried out in Shimadzu Shim-pack GIST C18 reverse phase

column with the dimension of 2.1 x 150 mm. The flow rate was maintained at 0.3 ml per minute

and the detection wavelength set at 215 nm in a SPD-M20A prominence diode array detector.

The separated fractions were analyzed for their mass using LC8040 mass spectrometer via

Electrospray Ionization (ESI) Interface in both the positive and negative ion modes.

3. Results and Discussion

3.1. Screening and identification of SR1 isolate

Bacillus is a gram positive prokaryote known for synthesizing several bioactive

secondary metabolites including ribosomally synthesized peptides like bacteriocin and the non

ribosomally produced small molecular peptides comprising lipopeptides. These metabolites

exhibiting antimicrobial activity against an array of fungal plant pathogens [19]. Preliminary

screening of SR1 isolate purified from wet land paddy soil sample restricted the growth of

selected fungal plant pathogens in dual culture plate assay (Fig. 1). The elite bacterial isolate

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

8

SR1 observed as short rods under phase contrast microscope and showed gram positive reaction

in staining.

The SR1 isolate was identified into Bacillus amyloliquefaciens based on 16S rRNA

sequencing studies. The obtained gene sequence was analyzed using BLAST software in

GenBank website and the phylogenetic tree were constructed using Mega 7 software (Fig. S1).

The nucleotide sequence of 16S rRNA has been deposited in the NCBI GenBank database under

the accession number GenBank KY963962.

3.2. Characterization of the extracellular lipopeptide fractions (ELFs) from SR1 isolate

The lipopeptide compounds originating from biological samples are known for their

surfactant and antimicrobial properties. The bacterial genus Bacillus is known for production of

several kinds of extracellular lipopeptides. Hence, the extracellular lipopeptides isolated from

Bacillus amyloliquefaciens SR1 by acid precipitation subjected to different assays to analyze its

surfactant and antimicrobial properties. The culture grown in blood agar plates was found to

possess haemolytic activity indicating its surfactant property (Fig. S2).

The lipopeptide also exhibited the zone of inhibition of 2.23 cm in agar well diffusion

assay against Rhizoctonia solani at 1mg/ml concentration, while the inhibition zone varied

between 1.76-2.33 cm against the other tested fungal pathogens (Table 1). The extracellular

lipopeptides was subjected to oil spreading assay and it was found to possess surfactant property

as confirmed by its oil displacement activity i.e., the presence of halo zone formed in the layer of

oil whereas in the water and methanol control no such activity was observed.

The amplified product from the genomic DNA of Bacillus amyloliquefaciens SR1

showed positive results for amplification of surfactin and iturin genes at 441, 647 base pairs

respectively (Fig. 2). [20] reported the PCR based detection of surfactin production in B.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

9

amyloliquefaciens and B. circulans using sfp gene corresponding to standard B. subtilis sfp gene

(GenBank accession no. X63158) with the oligonucleotide primers sequence of sfp -f (5-ATG

AAG ATT TAC GGA ATT TA-3) and sfp-r (5-TTATAA AAG CTC TTC GTA CG-3).

3.3. HPLC separation of ELFs

The ELFs obtained from Bacillus amyloliquefaciens SR1 isolate through acid

precipitation were subjected to HPLC separation. The lipopeptide sample was dissolved in

methanol and eluted at optimum conditions and the detection was carried out using UV detector

at 215 nm. The retention time observed in the chromatogram indicated the presence of different

surfactin molecules which were compared with standard surfactin (Sigma) under similar

conditions. The distinct peaks obtained at retention times of 3.4, 4.3, 4.9, 7.1 min for C12, C13, C14

and C15 surfactin molecules respectively (Fig. 3). The iturin and fencycin group of compounds

normally got eluted in HPLC separation before to the surfactin molecules [21]. The iturin and

fengycin molecules from SR1 isolate eluted at the retention time between 1.5-2.0 min in LC and

subjected to mass detection. [22] reported the comparison of surfactin isoforms between

surfactin standard and the surfactin fraction from Bacillus subtilis BS5 by LC separation and

diode array detection. The multiple peaks observed for Bacillus subtilis BS5 denoted the

presence of newer isoforms of surfactin apart from standard surfactin. Thus the HPLC profile of

SR1 isolate indicated the presence of mixtures of surfactin and other lipopeptide molecules.

Further the surfactin molecules collected from crude ELFs by ultra-filtration using miniature

Tangential Flow Filtration module with 1kDa and 3kDa UF membranes produced a yield of

316.10 mg L-1 of growth medium.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

10

3.4. FT-IR spectrometric measurement

The spectroscopic analysis using FT-IR indicated the presence of lipopeptides which

were compared with standard surfactin (Sigma) and the chemical nature of the surfactin

molecules derived from the FT-IR spectrum. A broad signal at 3308cm-1 denotes the carbon and

amino group containing compounds. The other absorbance peaks observed at 2928, 2346, 1649

cm-1 indicated the stretching vibrations due to the long alkyl chains, amino, peptide group of

compounds respectively (Fig. 4). The obtained FT-IR spectrum for SR1 isolates resembles the

characteristic signals for surfactin and iturin molecules produced for Bacillus circulans and

Bacillus subtilis respectively [23, 24].

3.5. LC-MS characterization of surfactin molecules

Surfactin isomers from Bacillus genus and its structural characterization by spectroscopy

were extensively studied and reported in number of scientific literatures [25,26,27,28]. In the

present study the total ion chromatogram obtained for the lipopeptides from SR1 isolate showed

the presence of four kinds of surfactins with m/z value of 994, 1008, 1022 and 1036. The four

surfactin molecules produce their retention time at 4.4 to 5.0, 5.0-5.8, 6.0-7.0 and 7.2-8.0

respectively in the total ion chromatogram. They were respectively indicating C12, C13, C14 and

C15 surfactin molecules. The mass range were obtained both in positive and negative ionization

mode, which were depicting the occurrence of C12-C15 surfactin family molecules in the SR1

isolate (Fig. 5; Fig. S3). Apart from surfactin molecules the SR1 isolate also detected for lower

quantities of iturin and fengycin group compounds at the mass range of 1045 for iturin (Fig. S4)

and 1462 for fengycin (Fig. S5) respectively. The mass value for fengycin detected only under

positive ionization mode.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

11

The surfactin molecule from SR1 isolate with m/z value of 1022 were characterized for

their fragmentation pattern under ESI mode in Shimadzu LCMS 8040 system. The dissociation

of ions by the fragmentation of surfactin observed in two different patterns (Fig. 6; Table 2).

Pattern 1: The major fragment ions were observed at the m/z values of 909, 796, 685,

681, 582, 554, 469, 451, 360, 356, 227, 199. This is in accordance with the report of [29]

considering the fragmentation ions observed at m/z value of 685, 360 and 245 were also

produced in the fragmentation of surfactin molecule from SR1 isolate. The fragmentation pattern

indicates the sequential loss of aminoacid residues and producing the order of Glu-Leu-Leu-Val-

Asp-Leu-Leu. We were unable to distinguish the Leu from Ile with the available data since both

are having the same molecular weight. The molar ratio of aminoacid residues with 1:1:1:4 was

obtained for Glu:Asp:Val:Leu respectively. Whereas, [26] reported that the surfactin molecule

from Bacillus subtilis LSFM 05 produced an fragmentation pattern of Glu(O-Me)-Leu-Leu-Val-

Asp-Leu-Leu with an aminoacid molar ratio of 1:1:1:4 was obtained for Glu:Asp:Val:Leu

respectively.

Pattern 2: The predominant fragment ions were observed at the m/z values of 923, 810,

685, 667, 582, 554, 469, 441, 360, 356, 227 199. The fragmentation ions at m/z values of 685,

360 and 245 were observed similar to the reports of [29]. The fragmentation pattern indicates the

presence of seven aminoacid residues with the order of Glu-Leu-Leu-Val-Asp-Leu-Val. This

aminoacid sequence derived from the sequential loss of aminoacids

Val/Leu/Asp/Val/Leu/Leu/Glu during the fragmentation process. The molar ratio of aminoacid

residues with 1:1:2:3 was obtained for Glu:Asp:Val:Leu respectively. Further it is derived that

the aspartic acid is observed as ester form and produced a cleavage of 143 (810-667) during the

fragmentation process. The presence of methyl ester form of either aspartic acid or glutamate

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

12

was observed by [30] in the surfactin molecules from the culture filtrate of Bacillus subtilis

HSO121.

The antimicrobial activity of Bacillus amyloliquefaciens SR1 and corresponding

amplification of antibiotic genes, FT-IR spectrum, HPLC chromatogram and mass data from LC-

MS confirms the presence of lipopeptides. Among the lipopeptides the surfactin group of

molecules detected chiefly than iturin and fencycin. Thus, Bacillus amyloliquefaciens SR1

isolate can be commercially exploited for management of crop fungal diseases.

4. Conclusion

The bacteria isolated from the wet land soil exhibited potent antifungal activity against

selected phytopathogens. The extracellular supernatant of the isolate possessing molecules belongs to

lipopeptide family chiefly of surfactins confirmed by FT-IR and LC-MS techniques. The bacterial

isolate was identified into Bacillus amyloliquifaciens SR1 based on 16S rRNA sequencing. The

said bacteria can be efficiently used for phytoprotection against selected fungal diseases of crop

plants. This preliminary work will provide a database for further plant microbe interaction

studies.

Acknowledgement

The authors profusely thank GOI-MHRD (Government of India-Ministry of Human

Resources and Development), NewDelhi for the financial support provided under the scheme of

Centre of Excellence in Frontiers Areas of Science and Technology.

Declare

The authors declare no conflict of interest in this work.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

13

References

1. E.A.B. Emmert, J. Handelsman, Biocontrol of plant disease: a (Gram-) positive perspective.

FEMS Microbiol. Lett., (1999) 171 1-9.

2. J.W. Kloepper, C.M. Ryu, S. Zhang, Induced systemic resistance and promotion of plant

growth by Bacillus spp. Phytopathol., 94 (2004) 1259-1266.

3. Mora, J. Cabrefiga, E. Montesinos, Antimicrobial peptide genes in Bacillus strains from plant

environments. Intl. Microbiol., 14 (2011) 213-223.

4. D. Romero, A. de Vicente, R.H. Rakotoaly, S.E. Dufour, J.W. Veening, E. Arrebola, F.M.

Cazorla, O.P. Kuipers, M. Paquot, A. Perez-Garcia, The iturin and fengycin families of

lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca. Mol.

Plant-Microbe Interact., 20 (2007) 430-440.

5. S. Chung, H. Kong, J.S. Buyer, D.K. Lakshman, J. Lydon, S.D. Kim, D.P. Roberts, Isolation

and partial characterization of Bacillus subtilis ME488 for suppression of soilborne pathogens of

cucumber and pepper. Appl. Microbiol. Biotechnol., 80 (2008) 115-123.

6. J.M. Raaijmakers, I. de Bruijn, O. Nybroe, M. Ongena, Natural functions of lipopeptides from

Bacillus and Pseudomonas: more than surfactants and antibiotics. FEMS Microbiol. Rev., 34

(2010) 1037-1062.

7. T. Stein, Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol.

Microbiol., 56 (2005) 845-857.

8. M. Ongena, P. Jacques, Bacillus lipopeptides: versatile weapons for plant disease biocontrol.

Trends Microbiol., 16 (2008) 115-125.

9. E. Montesinos, Antimicrobial peptides and plant disease control. FEMS Microbiol. Lett., 270

(2007) 1-11.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

14

10. V. Leclere, R. Marti, M. Bechet, P. Fickers, P. Jacques, The lipopeptides mycosubtilin and

surfactin enhance spreading of Bacillus subtilis strains by their surface-active properties. Arch.

Microbiol., 186 (2006) 475-483.

11. X.H. Chen, A. Koumoutsi, R. Scholz, K. Schneider, J. Vater, R. Sussmuth, J. Piel, R. Borriss,

Genome analysis of Bacillus amyloliquefaciens FZB42 reveals its potential for biocontrol of

plant pathogens, J. Biotechnol., 140 (2009) 27-37.

12. P.I. Kim, J. Ryu, Y.H. Kim, Y.T. Chi, Production of biosurfactant lipopeptides iturin A,

fengycin and surfactin A from Bacillus subtilis CMB32 for control of Colletotrichum

gloeosporioides. J. Microbiol. Biotechnol., 20 (2010) 138-145.

13. J. Marmur, A procedure for the isolation of desoxyribonucleic acid from microorganisms. J.

Mol. Biol., 3(1961) 208.

14. F. Sanger, S. Nicklen, A.R. Coulson, DNA sequencing with chain-terminating inhibitors.

Proc. Nat. Acad. Sci. USA, 74 (1977) 5463-5467.

15. S. Kumar, G. Stecher, K. Tamura, MEGA7: Molecular Evolutionary Genetics Analysis

version 7.0 for bigger datasets. Mol. Biol. Evol., 33 (2016) 1870-1874.

16. C. Perez, M. Paul, P. Bazerque, An antibiotic assay by the agar well diffusion method. Acta

Biol. Med. Exp., 15 (1990) 113-115.

17. M. Morikawa, H. Daido, T. Takao, S. Murata, Y. Shimonishi, T. Imanaka, A new lipopeptide

biosurfactant produced by Arthrobacter sp. strain MIS 38. J. Bacteriol., 175 (1993) 6459-6466.

18. R. Ramarathnam, B.S.Y. Chen, W.G.D. Fernando, G. Xuewen, T. de Kievit, Molecular and

biochemical detection of fengycin and bacillomycin D producing Bacillus spp., antagonistic to

fungal pathogens of canola and wheat. Can. J. Microbiol., 53 (2007) 901-911.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

15

19. M. Ongena, P. Jacques, Y. Toure, J. Destain, A. Jabrane, P. Thonart, Involvement of

fengycin-type lipopeptides in the multifaceted biocontrol potential of Bacillus subtilis. Appl.

Microbiol. Biotechnol., 69 (2005) 29-38.

20. F.C. Hsieh, M.C. Li, T.C. Lin, S.S. Kao, Rapid detection and characterization of surfactin-

producing Bacillus subtilis and closely related species based on PCR. Curr. Microbiol., 49

(2004) 186-191.

21. Y.K. Rao, H.Y. Lin, W.S. Wu, Y.M. Tzeng, Evaluation of HPLC and MEKC methods for

the analysis of lipopeptide antibiotic iturin A produced by Bacillus amyloliquefaciens. Intl. J.

Appl. Sci. Engg., 6 (2008) 85-96.

22. A.M. Abdel-Mawgoud, M.M. Aboulwafa, N.A.H. Hassouna, Characterization of surfactin

produced by Bacillus subtilis isolate BS5, Appl. Biochem. Biotechnol., 150 (2008) 289-303.

23. S.J. Cho, S.K. Lee, B.J. Cha, Y.H. Kim, K.S. Shin, Detection and characterization of the

Gloeosporium gloeosporioides growth inhibitory compound iturin A from Bacillus subtilis strain

KS03. FEMS Microbiol. Lett., 223 (2003) 47-51.

24. P. Das, S. Mukherjee, R. Sen, Antimicrobial potential of a lipopeptide biosurfactant derived

from a marine Bacillus circulans, J. Appl. Microbiol., 104 (2008) 1675-1684.

25. J.S. Tang, F. Zhao, H. Gao, Y. Dai, Z.H. Yao, K. Hong, J. Li, W.C. Ye, X.S. Yao,

Characterization and online detection of surfactin isomers based on HPLC-MSn analyses and

their inhibitory effects on the overproduction of nitric oxide and the release of TNF-α and IL-6 in

LPS-induced macrophages. Marine Drugs, 82 (2010) 605-618.

26. A.F. de Faria, D.S. Teodoro-Martinez G.N. de Oliveira Barbosaa, B.G. Vaz, I.S. Silva, J.S.

Garcia, M.R. Totola, M.N. Eberlin, M. Grossman, O.L. Alves, L.R. Durrant, Production and

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

16

structural characterization of surfactin (C14/Leu7) produced by Bacillus subtilis isolate LSFM-

05 grown on raw glycerol from the biodiesel industry. Process Biochem., 46 (2011) 1951-1957.

27. N. Malfanova, L. Franzil, B. Lugtenberg, V. Chebotar, M. Ongena, Cyclic lipopeptide profile

of the plant-beneficial endophytic bacterium Bacillus subtilis HC8. Arch. Microbiol., 194 (2012)

893-899.

28. Y. Ma, Q. Kong, C. Qin, Y. Chen, Y. Chen, R. Lv, G. Zhou, Identification of lipopeptides

in Bacillus megaterium by two-step ultrafiltration and LC-ESI-MS/MS. AMB Exp., 6 (2016) 79-

94.

29. N. Hue, L. Serani, O. Laprevote, Structural investigation of cyclic peptidolipids from

Bacillus subtilis by high-energy tandem mass Spectrometry. Rapid Comm. Mass Spec., 15

(2001) 203-209.

30. X.Y. Liu, S.Z. Yang, B.Z. Mu, Production and characterization of a C15-surfactin-O-methyl

ester by a lipopeptide producing strain Bacillus subtilis HSO121. Process Biochem., 44 (2009)

1144-1151.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

17

Figures

Sclerotium rolfsii Alternaria solani Fusarium oxysporum Rhizoctonia solani

Figure 1. Dual culture plating of SR1 isolate with test pathogens

Figure 2. Detection of antibiotic genes in Bacillus amyloliquefaciens SR1 strain

Surfactin, 441 bp

Iturin, 647 bp

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

18

Figure 3. HPLC separation of ELFs from SR1 isolate

Figure 4. FT-IR spectrum of ELFs from SR1 isolate

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

19

TIC of surfactin

C12 surfactin

C13 surfactin

C14 surfactin

C15 surfactin

Figure 5. Total Ion Chromatogram and mass spectrum of surfactin molecules from

Bacillus amyloliquefaciens SR1

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

20

a. Mass fragmentation Pattern 1

b. Mass fragmentation Pattern 2

Figure 6. Mass fragmentation of Surfactin molecule from Bacillus amyloliquefaciens SR1

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

21

Tables

Table 1. Antimicrobial activity of ELFs from SR1 isolate

Organism DIZ (cm)

Rhizoctonia solani 2.33

Fusarium oxysporum 1.90

Sclerotium rolfsii 2.06

Alternaria solani 2.23

Macrophomina phaseolina 1.80

Aspergillus niger 2.30

Average of three replications

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

22

Table 2. The major fragmentation ions observed for the surfactin molecule (m/z 1022) from

SR1 isolate

Sl.

No.

Fragment ion

Pattern 1

Particulars Fragment ion

Pattern 2

Particulars

1 199 Fatty acyl side chain 199 Fatty acyl side chain

2 227 Fatty acyl chain + CO 227 Fatty acyl chain + CO

3 338 (356-H2O) 328 (356-CO)

4 356 Glutamate (356-227) 338 (356-H2O)

5 451 (469-H2O) 356 Glutamate (356-227)

6 469 Leucine (469-356) 441 (469-CO)

7 554 (582-CO) 451 (469-H2O)

8 582 Leucine (582-469) 469 Leucine (469-356)

9 681 Valine (681-582) 554 (582-CO)

10 685 Fragment ion observed in

all the isomers of surfactin

582 Leucine (582-469)

11 796 Aspartic acid (796-681) 667 Valine

12 909 Leucine (909-796) 685 Fragment ion observed in all

the isomers of surfactin

13 1022 Leucine (1022-909) 810 Aspartic acid + CO (810-

667)

14 923 Leucine (923-810)

15 1022 Valine (1022-923)

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Highlights

• SR1 isolate exhibited potential antifungal activity against fungal plant pathogens.

• Surfactin class of lipopeptides were chiefly produced by SR1 isolate.

• Biosynthesis of lipopeptides by SR1 isolate were supported with spectroscopic data.