Amplificationtechniquesinmicrobiology 090609205257-phpapp02

Nucleic Acid Amplification Nucleic Acid Amplification Techniques in Techniques in MicrobiologyMicrobiology

Dr.T.V.Rao MDDr.T.V.Rao MD

DNA replication Basis of DNA replication Basis of Biological EvolutionBiological Evolution

DNA replicationDNA replication, , the basis for the basis for biological biological inheritance, is a inheritance, is a fundamental fundamental process occurring process occurring in all living in all living organisms to copy organisms to copy their DNA. their DNA.

DNA Replication is the Basis of DNA Replication is the Basis of all Technologiesall Technologies

This process is "semi conservative" in This process is "semi conservative" in that each strand of the original double-that each strand of the original double-stranded DNA molecule serves as stranded DNA molecule serves as template for the reproduction of the template for the reproduction of the complementary strand. Hence, complementary strand. Hence, following DNA replication, two identical following DNA replication, two identical DNA molecules have been produced DNA molecules have been produced from a single double-stranded DNA from a single double-stranded DNA molecule molecule

Doctortvrao’s ‘e’ learning seriesDoctortvrao’s ‘e’ learning series

Understanding events in Understanding events in vivo Lead to vitro vivo Lead to vitro

applicationsapplications DNA replication can also be performed in DNA replication can also be performed in

vitro (outside a cell). DNA polymerases, vitro (outside a cell). DNA polymerases, isolated from cells, and artificial DNA isolated from cells, and artificial DNA primers are used to initiate DNA synthesis primers are used to initiate DNA synthesis at known sequences in a template at known sequences in a template molecule. The polymerase chain reaction molecule. The polymerase chain reaction (PCR), a common laboratory technique, (PCR), a common laboratory technique, employs such artificial synthesis in a cyclic employs such artificial synthesis in a cyclic manner to amplify a specific target DNA manner to amplify a specific target DNA fragment from a pool of DNA fragment from a pool of DNA


Har Gobind Khorana, Indian Har Gobind Khorana, Indian Scientist, Nobel Prize Scientist, Nobel Prize

WinnerWinner Polymerase Chain Polymerase Chain Reaction (PCR), a Reaction (PCR), a process first described process first described by Kjell Kleppe and by Kjell Kleppe and 1968 Nobel laureate 1968 Nobel laureate H. H. Gobind KhoranaGobind Khorana that that allows the amplification allows the amplification of specific of specific DNA DNA sequencessequences. The . The improvements provided improvements provided by Mullis have made by Mullis have made PCR a central technique PCR a central technique in biochemistry and in biochemistry and molecular biology.molecular biology.


Polymerase Chain Reaction Polymerase Chain Reaction Methodology A Mile stone in Methodology A Mile stone in

Medical HistoryMedical History He had the idea to use a He had the idea to use a

pair of primers to pair of primers to bracket the desired DNA bracket the desired DNA sequence and to copy it sequence and to copy it using DNA polymerase, using DNA polymerase, a technique which a technique which would allow a would allow a small small strand of DNA to be strand of DNA to be copied almost an copied almost an infinite number of infinite number of times.times. Cetus took Cetus took Mullis off his usual Mullis off his usual projects to concentrate projects to concentrate on PCR full-time on PCR full-time

Dr. Kary Mullis, wins Nobel Dr. Kary Mullis, wins Nobel PrizePrize in 1993in 1993

Kary received a Nobel Kary received a Nobel Prize in Prize in chemistry in chemistry in 19931993, for his invention , for his invention of the polymerase of the polymerase chain reaction (PCR). chain reaction (PCR). The process, which The process, which Kary Mullis Kary Mullis conceptualized in 1983, conceptualized in 1983, is hailed as one of the is hailed as one of the monumental scientific monumental scientific techniques of the techniques of the twentieth century.twentieth century.

How DNA WorksHow DNA Works DNA usually exists as DNA usually exists as

a double-stranded a double-stranded structure, with both structure, with both strands coiled strands coiled together to form the together to form the characteristic double-characteristic double-helix. Each single helix. Each single strand of DNA is a strand of DNA is a chain of four types of chain of four types of nucleotides: adenine, nucleotides: adenine, cytosine, guanine, and cytosine, guanine, and thymine. thymine.


DNA DNA – RNA - – RNA - DNADNA In Molecular biology, In Molecular biology,

the the polymerase polymerase chain reactionchain reaction ( (PCRPCR) ) is a technique to is a technique to amplify a single or few amplify a single or few copies of a piece of copies of a piece of DNA across several DNA across several orders of magnitude, orders of magnitude, generating millions or generating millions or more copies of a more copies of a particular DNA particular DNA sequence.sequence.


Create primersCreate primers To begin synthesis To begin synthesis

of a new strand, a of a new strand, a short fragment of short fragment of DNA or DNA or RNARNA, called , called a a primerprimer, must be , must be created and paired created and paired with the template with the template strand before DNA strand before DNA polymerase can polymerase can synthesize new synthesize new DNA. DNA.

Precise Precise Oligonucleotide Oligonucleotide Matches the SequencesMatches the Sequences

ThermocyclerThermocycler is Back boneis Back bone ofof PCR methodologyPCR methodology

The method relies on The method relies on thermal cycling, thermal cycling, consisting of cycles of consisting of cycles of repeated heating and repeated heating and cooling of the cooling of the reaction for DNA reaction for DNA melting and melting and enzymatic replication enzymatic replication of the DNAof the DNA


PrimersPrimers Primers (short DNA Primers (short DNA

fragments) containing fragments) containing sequences sequences complementary to the complementary to the target region along target region along with a Primers after with a Primers after which the method is which the method is named) are key named) are key components to enable components to enable selective and repeated selective and repeated amplification. amplification.


PCR a Chain reactionPCR a Chain reaction

As PCR progresses, the As PCR progresses, the DNA generated is itself DNA generated is itself used as a template for used as a template for replication, setting in replication, setting in motion a motion a chain reactionchain reaction in which in which the DNA template is the DNA template is exponentiallyexponentially amplified. PCR can be amplified. PCR can be extensively modified to extensively modified to perform a wide array of perform a wide array of genetic manipulationsgenetic manipulations. .

Taq polymerase fuels the Taq polymerase fuels the ReactionReaction

T.aquaticusT.aquaticus is a bacterium that lives in hot is a bacterium that lives in hot springs and hydrothermal vents, and Taq springs and hydrothermal vents, and Taq polymerase was identified as an enzyme able to polymerase was identified as an enzyme able to withstand the protein-denaturing conditions (high withstand the protein-denaturing conditions (high temperature) required during PCR. It replaced temperature) required during PCR. It replaced the DNA polymerase from the DNA polymerase from E.coliE.coli originally used in originally used in PCR . Taq's optimum temperature for activity is PCR . Taq's optimum temperature for activity is 75-80°C, with a halflife of 9 minutes at 97.5°C, 75-80°C, with a halflife of 9 minutes at 97.5°C, and can replicate a 1000 base pair strand of DNA and can replicate a 1000 base pair strand of DNA in less than 10 seconds at 72°C.in less than 10 seconds at 72°C.


Bacteria Of Boiling Hot Bacteria Of Boiling Hot Springs In Yellowstone Springs In Yellowstone

National ParkNational Park

Boiling hot springs in Yellowstone National Boiling hot springs in Yellowstone National Park. The orange-red coloration is caused by Park. The orange-red coloration is caused by

thriving colonies of photosyntheticthriving colonies of photosynthetic

cyanobacteria.cyanobacteria.

Taq polymeraseTaq polymerase

Taq polymeraseTaq polymerase is a thermos table DNA is a thermos table DNA polymerase named after the thermophilic polymerase named after the thermophilic bacterium bacterium Thermus aquaticusThermus aquaticus from which it from which it was originally isolated by Thomas D. Brock was originally isolated by Thomas D. Brock in 1965. It is often abbreviated to "in 1965. It is often abbreviated to "Taq Taq PolPol" (or simply "" (or simply "TaqTaq"), and is frequently "), and is frequently used in polymerase chain reaction (PCR), used in polymerase chain reaction (PCR), methods for greatly amplifying short methods for greatly amplifying short segments of DNA segments of DNA


Drawbacks of Taq Drawbacks of Taq polymerasepolymerase

One of Taq's drawbacks is its relatively low One of Taq's drawbacks is its relatively low replication fidelity. It lacks a 3' to 5' replication fidelity. It lacks a 3' to 5' exonuclease proofreading activity, and has exonuclease proofreading activity, and has an error rate measured at about 1 in 9,000 an error rate measured at about 1 in 9,000 nucleotides. Some thermos table DNA nucleotides. Some thermos table DNA polymerases have been isolated from polymerases have been isolated from other thermophilic bacteria and archaea, other thermophilic bacteria and archaea, such as Pfu DNA polymerase, possessing a such as Pfu DNA polymerase, possessing a proofreading activity, and are being used proofreading activity, and are being used instead of (or in combination with) Taq for instead of (or in combination with) Taq for high-fidelity amplification. high-fidelity amplification.


Disadvantages of Taq PolDisadvantages of Taq Pol

Taq Pol lacks 3’ to 5’ exonuclease Taq Pol lacks 3’ to 5’ exonuclease proof reading activity, commonly proof reading activity, commonly present inpresent in

other polymerases.other polymerases. TaqTaq mis-incorporates 1 base in 10mis-incorporates 1 base in 1044.. A 400 bp target will contain an error A 400 bp target will contain an error

in 33% of molecules after 20 cycles.in 33% of molecules after 20 cycles. Error distribution will be random.Error distribution will be random.

PCR - PCR - Three basic StepsThree basic Steps

CutCut

PastePaste

AmplifyAmplify

What does PCR need?What does PCR need?

• Template (the DNA you are exploring)Template (the DNA you are exploring)• Sequence-specific primers flanking the Sequence-specific primers flanking the target sequence, Forward & Reverse.target sequence, Forward & Reverse.• PolymerasesPolymerases• Nucleotides (dATP, dCTP, dGTP,Nucleotides (dATP, dCTP, dGTP, dTTP)dTTP)• Magnesium chloride (enzyme cofactor)Magnesium chloride (enzyme cofactor)• BufferBuffer• Water, mineral oilWater, mineral oil

Four Alphabets make what Four Alphabets make what we arewe are

DNA polymerasesDNA polymerases

DNA polymerases are DNA polymerases are a family of enzymes a family of enzymes that carry out all that carry out all forms of DNA forms of DNA replication. A DNA replication. A DNA polymerase can only polymerase can only extend an existing extend an existing DNA strand paired DNA strand paired with a template with a template strand; it cannot begin strand; it cannot begin the synthesis of a new the synthesis of a new strand. . strand. .

Create primersCreate primers To begin synthesis To begin synthesis

of a new strand, a of a new strand, a short fragment of short fragment of DNA or DNA or RNARNA, called , called a a primerprimer, must be , must be created and paired created and paired with the template with the template strand before DNA strand before DNA polymerase can polymerase can synthesize new synthesize new DNA. DNA.

PCR PrimersPCR Primers

TTTTAAAACCGGGGCCCCTTTTAAAA . . . . . . TTTTTTAAAAAACCCCGGGGTTTT

AAAATTTTGGCCCCGGGGAAAATTTT . . . . . . . . . .> . . . . . . . . . .>

andand

<. . . . . . . . . . <. . . . . . . . . . AAAAAATTTTTTGGGGCCCCAAAA

TTTTAAAACCGGGGCCCCTTTTAAAA . . . . . . TTTTTTAAAAAACCCCGGGGTTTT

Cutting, pasting and Cutting, pasting and amplifying is the basis of amplifying is the basis of

ReactionReaction

DNADNA

Example of bonding pattern.Example of bonding pattern. Primary strandPrimary strand

CCCCGGAAAATTGGGGGGAATTGGCC

GGGGCCTTTTAACCCCCCTTAACCGG

Complementary strandComplementary strand

What does PCR need?What does PCR need?

• Template (the DNA you are exploring)Template (the DNA you are exploring)• Sequence-specific primers flanking the Sequence-specific primers flanking the target sequence, Forward & Reverse.target sequence, Forward & Reverse.• PolymerasesPolymerases• Nucleotides (dATP, dCTP, dGTP,Nucleotides (dATP, dCTP, dGTP, dTTP)dTTP)• Magnesium chloride (enzyme cofactor)Magnesium chloride (enzyme cofactor)• BufferBuffer• Water, mineral oilWater, mineral oil

PCR RequirementsPCR Requirements

Magnesium chloride: .5-2.5mMMagnesium chloride: .5-2.5mM

Buffer: pH 8.3-8.8Buffer: pH 8.3-8.8

dNTPs: 20-200µMdNTPs: 20-200µM

Primers: 0.1-0.5µMPrimers: 0.1-0.5µM

DNA Polymerase: 1-2.5 unitsDNA Polymerase: 1-2.5 units

Target DNA: Target DNA: 1 µg 1 µg

Steps in PCRSteps in PCR

Denaturation 93 to 95°C 1minDenaturation 93 to 95°C 1min

Annealing 50 to 55°C 45secAnnealing 50 to 55°C 45sec

Elongation 70 to 75°C 1-2minElongation 70 to 75°C 1-2min

How does PCR work?How does PCR work?

• Heat (94Heat (94ooC) to denature DNA strandsC) to denature DNA strands• Cool (54Cool (54ooC) to anneal primers to templateC) to anneal primers to template• Warm (72Warm (72ooC) to activateC) to activateTaqTaq Polymerase, Polymerase, which extends primers and replicates DNAwhich extends primers and replicates DNA• Repeat multiple cyclesRepeat multiple cycles

Denaturation of DNADenaturation of DNA

Denaturation is the first Denaturation is the first step in PCR, in whichstep in PCR, in which

the DNA strands are the DNA strands are separated by heating toseparated by heating to

95°C. 95°C.

The Hydrogen bonds The Hydrogen bonds between the two between the two strandsstrands

breaks down and the two breaks down and the two strands separates.strands separates.


Annealing is the process Annealing is the process of allowing two of allowing two

sequences of DNA to sequences of DNA to form hydrogen bonds.form hydrogen bonds.

The annealing of the The annealing of the target sequences andtarget sequences and

primers is done by primers is done by cooling the DNA to cooling the DNA to 55°C.55°C.

Time taken to anneal is Time taken to anneal is 45 seconds45 seconds

AnnealingAnnealing

Taq polymerase binds ….Taq polymerase binds ….Taq polymerase binds to Taq polymerase binds to

the template DNAthe template DNA

and starts adding and starts adding nucleotides that are nucleotides that are

complementary to the complementary to the first strand.first strand.

This happens at 72°C as This happens at 72°C as it is the optimum it is the optimum

temperature for Taq temperature for Taq Polymerase.Polymerase.

Denaturing TemplateDenaturing Template

Heat causes DNA strands to separateHeat causes DNA strands to separate

3’

5’

5’

3’

Denature DNA strands 94Denature DNA strands 94ooCC

5’

3’

3’

5’

Annealing PrimersAnnealing Primers•Primers bind to the template sequencePrimers bind to the template sequence

•Taq Polymerase recognizes double-stranded substrateTaq Polymerase recognizes double-stranded substrate

3’

5’

5’

3’

Primers anneal 64Primers anneal 64ooCC3’

5’

5’

3’3’ 5’3’5’

Taq Polymerase ExtendsTaq Polymerase Extends

3’

5’3’ 5’3’5’

Extend 72Extend 72ooCC

3’

5’3’ 5’3’5’

5’

3’

5’

3’

•Taq Polymerase extends primerTaq Polymerase extends primer

•DNA is replicatedDNA is replicated

RepeatRepeat denaturing, annealing, and extending denaturing, annealing, and extending 30 cycles30 cycles

Taq Polymerase Taq Polymerase ExtendsExtends

3’

5’3’ 5’3’5’

Extend 72Extend 72ooCC

3’

5’3’ 5’3’5’

5’

3’

5’

3’

•Taq Polymerase extends primerTaq Polymerase extends primer

•DNA is replicatedDNA is replicated

RepeatRepeat denaturing, annealing, and extending denaturing, annealing, and extending 30 cycles30 cycles

The target product is The target product is made in the third cyclemade in the third cycle

3’

5’3’5’3’5’

5’

3’

3’

5’5’

3’

5’

3’

5’3’

Cycle 1

Cycle 2

Cycle 33’

3’

3’

3’5’

5’

5’

5’

PCR Cycles ReviewPCR Cycles Review

Denaturation: 94°- 95°CDenaturation: 94°- 95°C Primer Annealing: 55°- 65°CPrimer Annealing: 55°- 65°C Elongation of DNA: 72°Elongation of DNA: 72° Number of Cycles: 25-40Number of Cycles: 25-40 No target products are made until No target products are made until

the third cycle.the third cycle. At 30 cycles there are 1,073,741,764 At 30 cycles there are 1,073,741,764

target copies (~1×10target copies (~1×1099).).

Primers That Form Primers That Form HairpinsHairpins

Primers can have self-annealing regions within Primers can have self-annealing regions within each primer (i.e. hairpin and fold back loops)each primer (i.e. hairpin and fold back loops)

A primer may be self-complementary and be A primer may be self-complementary and be able to fold into a hairpin: able to fold into a hairpin:

5´-GTTGACTTGATA5´-GTTGACTTGATA ||||| T||||| T 3´-GAACTCT3´-GAACTCT The 3´ end of the primer is base-paired, The 3´ end of the primer is base-paired, preventing it annealing to the target DNA.preventing it annealing to the target DNA.


Applications of PCR Applications of PCR differentiates the results can differentiates the results can

be compared of Individual be compared of Individual specimensspecimens

Advantages of PCRAdvantages of PCR

Speed Speed Ease of useEase of useSensitivity Sensitivity RobustnessRobustness


Limitations of PCRLimitations of PCR

Need for target DNA sequence informationNeed for target DNA sequence information Primer Designing for unexplored ones.Primer Designing for unexplored ones. Boundary regions of DNA to be amplified must be Boundary regions of DNA to be amplified must be

known.known. Infidelity of DNA replication.Infidelity of DNA replication. Taq Pol – no Proof reading mech – Error 40% after 20 Taq Pol – no Proof reading mech – Error 40% after 20

cyclescycles Short size and limiting amounts of PCR product Short size and limiting amounts of PCR product Up to 5kb can be easily amplified .Up to 5kb can be easily amplified . Up to 40kb can be amplified with some modifications.Up to 40kb can be amplified with some modifications. Cannot amplify gene >100kbCannot amplify gene >100kb Cannot be used in genome sequencing projectsCannot be used in genome sequencing projects..

How to overcome How to overcome DifficultiesDifficulties??

• Pfu DNA Polymerase from Pfu DNA Polymerase from Pyrococcus Pyrococcus furiosusfuriosus possesses 3' to 5' exonuclease possesses 3' to 5' exonuclease proofreading activity.proofreading activity.

• The error rate is only 3.5% after 20 cycles The error rate is only 3.5% after 20 cycles • More amount of primer is added to avoidMore amount of primer is added to avoid primer dimering.primer dimering.• For unexplored genes, primers used in closely For unexplored genes, primers used in closely

related species are used.related species are used.

REAL TIME REAL TIME ASSAYSASSAYS

New Technologies – Real New Technologies – Real Time AssaysTime Assays

The Real Time assays are proving to better The Real Time assays are proving to better technologies technologies

1 Rapid1 Rapid 2 Quantitative measurement2 Quantitative measurement 3 Lower contamination rate3 Lower contamination rate 4 Higher sensitivity4 Higher sensitivity 5 Higher specificity5 Higher specificity 6 Easy standardization6 Easy standardization Now a new gold standard for rapid Now a new gold standard for rapid

diagnosis of virus infection in the acute diagnosis of virus infection in the acute phase samples.phase samples.


Real-time polymerase chain Real-time polymerase chain reactionreaction

Real-time polymerase chain reactionReal-time polymerase chain reaction, , also called also called quantitative real time polymerase quantitative real time polymerase chain reactionchain reaction (Q-PCR/qPCR) or (Q-PCR/qPCR) or kinetic kinetic polymerase chain reactionpolymerase chain reaction, is a laboratory , is a laboratory technique based on the polymerase chain technique based on the polymerase chain reaction, which is used to amplify and reaction, which is used to amplify and simultaneously quantify a targeted DNA simultaneously quantify a targeted DNA molecule. It enables both detection and molecule. It enables both detection and quantification (as absolute number of copies quantification (as absolute number of copies or relative amount when normalized to DNA or relative amount when normalized to DNA input or additional normalizing genes) of a input or additional normalizing genes) of a specific sequence in a DNA sample. specific sequence in a DNA sample.

RT - PCRRT - PCR

Proving to beProving to be

AccurateAccurate

PrecisePrecise

Easy to performEasy to perform

RT PCR technologies are RT PCR technologies are easy to transfer easy to transfer research Laboratory research Laboratory protocols to protocols to Diagnostic Diagnostic LaboratoriesLaboratories


OVERVIEW of RT - PCROVERVIEW of RT - PCR

tissue

extract RNA

copy into cDNA(reverse transciptase)

do real-time PCR

analyze results

Real Time ReportersReal Time Reporters

All real time PCR systems rely upon All real time PCR systems rely upon the detection and quantization of the detection and quantization of fluorescent reporter, the signal of fluorescent reporter, the signal of which increases in direct proportion which increases in direct proportion of the amount of PCR product in a of the amount of PCR product in a reaction.reaction.

REAL TIME PCRREAL TIME PCRCyber GreenCyber Green

USING USING SYBER® SYBER® GREENGREEN

The simplest and The simplest and economical format economical format the reporter is the the reporter is the double strand DNA double strand DNA specific dye SYBR specific dye SYBR ® Green ® Green

Called as Molecular Called as Molecular Probe.Probe.

How SYBR Green worksHow SYBR Green works

SYBR green binds SYBR green binds to double stranded to double stranded DNA and upon DNA and upon excitation emits excitation emits light light

Thus as PCR Thus as PCR product product accumulates the accumulates the fluoresce increasesfluoresce increases

LimitationsLimitations of of SYBER®GreenSYBER®Green

AdvantagesAdvantages

InexpensiveInexpensive

Easy to UseEasy to Use

Sensitive Sensitive

DisadvantagesDisadvantages

SYBR green will bind SYBR green will bind to any double to any double stranded DNA in a stranded DNA in a reaction, may result reaction, may result in an overestimation in an overestimation of the target of the target concentrationconcentration

Reverse transcription Reverse transcription polymerase chain reactionpolymerase chain reaction

Reverse transcription polymerase Reverse transcription polymerase chain reactionchain reaction ( (RT-PCRRT-PCR) is a variant of ) is a variant of polymerase chain reaction (PCR), polymerase chain reaction (PCR), commonly used in molecular biology to commonly used in molecular biology to generate many copies of a DNA sequence, a generate many copies of a DNA sequence, a process termed "amplification". In RT-PCR, process termed "amplification". In RT-PCR, however, RNA strand is first reverse however, RNA strand is first reverse transcribed into its DNA complement using transcribed into its DNA complement using the enzyme reverse transcriptase, and the the enzyme reverse transcriptase, and the resulting cDNA is amplified using traditional resulting cDNA is amplified using traditional or real-time PCR.. or real-time PCR..

Not to be confused with RT- Not to be confused with RT- PCRPCR

Reverse Reverse transcription PCR is transcription PCR is not to be confused not to be confused with real-time with real-time polymerase chain polymerase chain reaction (Q-PCR), reaction (Q-PCR), which is also which is also sometimes sometimes (incorrectly) (incorrectly) abbreviated as RT-abbreviated as RT-PCR. PCR.

Other Emerging Other Emerging AlternativesAlternatives

Two most popular Two most popular alternatives to SYBR alternatives to SYBR green are green are TaqMan®TaqMan® and and Molecular Molecular BeaconsBeacons..

Both technologies Both technologies depend on depend on hybridization probes hybridization probes relying on fluorescence relying on fluorescence resonance energy resonance energy transfer.( FRET) and transfer.( FRET) and quantizationquantization

TaqMANTaqMAN®®

TaqMANTaqMAN® Sequencing® Sequencing

TaqMANTaqMAN® ® probesprobes

Documentation of Documentation of AmplificationAmplification

The light emitted from The light emitted from the dye in the excited the dye in the excited state is received by a state is received by a computer and shown computer and shown on a graph display, on a graph display, such as this, showing such as this, showing PCR cycles on the X-PCR cycles on the X-axis and a logarithmic axis and a logarithmic indication of intensity indication of intensity on the Y-axis. on the Y-axis.

Molecular BeaconsMolecular Beacons

Molecular BeaconsMolecular Beacons

Uses Uses FRET FRET Fluorescence Fluorescence Resonance Energy Resonance Energy TransferTransfer

Uses two sequence Uses two sequence specificspecific

Oligonucleotide Oligonucleotide labelled with labelled with fluorescent dyesfluorescent dyes

Molecular Beacons – RT Molecular Beacons – RT PCRPCR

Molecular beacons are Molecular beacons are designed to adopt a designed to adopt a hairpin structure while hairpin structure while free in solution, free in solution, brining the fluorescent brining the fluorescent dye and quencher in dye and quencher in close proximity. When close proximity. When a molecular beacon a molecular beacon hybridizes to a target hybridizes to a target the fluorescent dye the fluorescent dye emits light upon emits light upon irradiation, and rebind irradiation, and rebind to target in every to target in every cycle for signal cycle for signal measurement.measurement.

Loop Mediated Isothermal Loop Mediated Isothermal Amplification (LAMP)Amplification (LAMP)

Loop mediated isothermal amplification is Loop mediated isothermal amplification is a simple, rapid, specific and cost effective a simple, rapid, specific and cost effective nucleic acid amplification method nucleic acid amplification method characterized by use of 8 distinct regions characterized by use of 8 distinct regions on the target gene.on the target gene.

The amplification proceeds at a constant The amplification proceeds at a constant temperature using strand displacement temperature using strand displacement reaction.reaction.


LAMPLAMP Amplification and Amplification and

detection of gene can detection of gene can be completed in a be completed in a single step, by single step, by incubating the mixture incubating the mixture of samples, primers of samples, primers DNA polymerase with DNA polymerase with strand displacement strand displacement activity and substrates activity and substrates at a constant at a constant temperature of 63temperature of 6300c.c.

LAMPLAMP Compared with PCR, Compared with PCR,

and real time PCR, the and real time PCR, the LAMP has advantages LAMP has advantages of reaction simplicity of reaction simplicity and detection and detection sensitivity.sensitivity.

The higher sensitivity The higher sensitivity and specificity of LAMP and specificity of LAMP reaction is attributed to reaction is attributed to continuous continuous amplification under amplification under isothermal condition isothermal condition employing six primers employing six primers recognizing eight recognizing eight distinct regions of the distinct regions of the target.target.

Advantages of LAMPAdvantages of LAMP

LAMP functions on isothermal LAMP functions on isothermal amplification.amplification.

LAMP does not require any thermal LAMP does not require any thermal cycler and thus cane be performed cycler and thus cane be performed even with water bath/heating blockeven with water bath/heating block

LAMP method do not require LAMP method do not require sophisticated temperature control sophisticated temperature control devicesdevices

Cost effectiveCost effective

Lesser False Positives in Lesser False Positives in LAMPLAMP

In LAMP both In LAMP both amplification and amplification and detection occur detection occur simultaneously during simultaneously during the exponential phase the exponential phase without going through without going through the plateau phase the plateau phase where the non spurious where the non spurious amplification leads to amplification leads to lower sensitivity and lower sensitivity and false positivity.false positivity.


Loop Mediated Isothermal Loop Mediated Isothermal Amplification in Clinical DiagnosisAmplification in Clinical Diagnosis

LAMP technology LAMP technology proving to be ideal in proving to be ideal in detection of DNA or detection of DNA or RNA of the pathogenic RNA of the pathogenic organisms organisms

Proving to be highly Proving to be highly efficient in diagnosis of efficient in diagnosis of Viral and Bacterial Viral and Bacterial infections,infections,

LAMP is capable of LAMP is capable of detecting the presence detecting the presence of pathogenic agents of pathogenic agents earlier than PCRearlier than PCR


LAMP proving an efficient LAMP proving an efficient TechnologyTechnology

A one step single tube real A one step single tube real time accelerated reverse time accelerated reverse transcription loop transcription loop mediated isothermal mediated isothermal amplification amplification (RT-LAMP(RT-LAMP) ) assays for rapid detection assays for rapid detection of some recently emerged of some recently emerged viral pathogen eg West viral pathogen eg West Nile, SARS, Dengue, Nile, SARS, Dengue, Japanese encephalitis Japanese encephalitis Chikungunya Norwalk, Chikungunya Norwalk, H5N1 highly pathogenic H5N1 highly pathogenic avian influenza., and avian influenza., and CMV,HPV,VZVCMV,HPV,VZV


Multiplex PCRMultiplex PCR TaqMan probes and TaqMan probes and

Molecular beacons Molecular beacons allow multiple DNA allow multiple DNA species to be species to be measured in the measured in the same sample same sample ( Multiplex PCR) ( Multiplex PCR) since fluorescent since fluorescent dyes with different dyes with different emission spectra emission spectra may be attached to may be attached to different probesdifferent probes

Uses of Automated RT - Uses of Automated RT - PCRPCR

Several viral infections can be detected Several viral infections can be detected in acute phase serum samples.in acute phase serum samples.

Increasing used in for early and Increasing used in for early and accurate detection of all most human accurate detection of all most human viruses includingviruses including

Measles, Mumps, Herpes simplex viruses, Measles, Mumps, Herpes simplex viruses, Rota viruses Noro virus,Influenzae virus Rota viruses Noro virus,Influenzae virus type A and B, Respiratory Syncitical type A and B, Respiratory Syncitical virus, SARS, Dengue Japanese virus, SARS, Dengue Japanese Encephalitis, Hepatitis B and C, West Encephalitis, Hepatitis B and C, West Nile, Chikungunya,HIV, Avian flu virus,Nile, Chikungunya,HIV, Avian flu virus,

Multiplex PCR in Real Multiplex PCR in Real TimeTime

Multiplex real time Multiplex real time quantitative RT-PCR quantitative RT-PCR assays have been assays have been developed for developed for simultaneous simultaneous detection detection identification and identification and quantification of HBV, quantification of HBV, HCV and HIV-! In HCV and HIV-! In plasma and Serum plasma and Serum samples.samples.


Real-Time PCR MethodReal-Time PCR MethodMolecular BeaconsMolecular Beacons

Molecular beacons Molecular beacons are short segments are short segments of single-stranded of single-stranded DNA . The DNA . The sequence of each sequence of each molecular beacon molecular beacon must be must be customized to customized to detect the PCR detect the PCR product of interest. product of interest.

Molecular methods are necessary Molecular methods are necessary if the traditional methods provide if the traditional methods provide

poor resultspoor results Microscopy gives false positive results - Microscopy gives false positive results -

- - T.vaginalis, T.vaginalis, N.gonorrhoeaeN.gonorrhoeae

Intracellular pathogens – Intracellular pathogens – viruses, viruses, M.genitalium M.genitalium

Low sensitivityLow sensitivity – – Chlamydia Chlamydia sp.,Neisseria sp.sp.,Neisseria sp.

Seropositivity is common – Seropositivity is common – Chlamydia spChlamydia sp.. Subtyping is mandatory – Subtyping is mandatory – HSV, HPV, HCVHSV, HPV, HCV Microbial growth is slow – Microbial growth is slow – M. M.

tuberculosistuberculosis

How are you going to How are you going to measure the PCR measure the PCR

productproduct DirectlyDirectly– Sybr green Sybr green – Quality of primers criticalQuality of primers critical

IndirectlyIndirectly– In addition to primers, add a In addition to primers, add a

fluorescently labeled fluorescently labeled hybridization probehybridization probe

Importance of controlsImportance of controls

Negative control (no DNA)Negative control (no DNA)– checks reagents for contaminationchecks reagents for contamination

No reverse transcriptase controlNo reverse transcriptase control– detects if signal from contaminating detects if signal from contaminating

DNADNA Positive controlPositive control

– checks that reagents and primers workchecks that reagents and primers work– especially importance if trying to show especially importance if trying to show

absence of expression of a geneabsence of expression of a gene Doctortvrao’s ‘e’ learning seriesDoctortvrao’s ‘e’ learning series

StandardsStandards

Same copy number in all cellsSame copy number in all cells Expressed in all cellsExpressed in all cells Medium copy number advantageous Medium copy number advantageous

– correction more accuratecorrection more accurate Reasonably large intronsReasonably large introns No pseudo geneNo pseudo gene No alternate splicing in region you want No alternate splicing in region you want

to PCRto PCR Doctortvrao’s ‘e’ learning seriesDoctortvrao’s ‘e’ learning series

Real-time PCR Real-time PCR applicationsapplications

Quantitation of gene expressionQuantitation of gene expression Pathogen detectionPathogen detection Viral quantitationViral quantitation Array verificationArray verification Drug therapy efficacyDrug therapy efficacy DNA damage measurementDNA damage measurement Quality control and assay validationQuality control and assay validation GenotypingGenotyping

Emerging Emerging Technologies in Technologies in

Molecular Molecular DiagnosisDiagnosis

QIAGEN One Step RT-PCR QIAGEN One Step RT-PCR KitKit

The QIAGEN One Step The QIAGEN One Step RT-PCR Kit is designed RT-PCR Kit is designed for easy and sensitive for easy and sensitive one-step RT-PCR using one-step RT-PCR using any RNA template. A any RNA template. A unique enzyme unique enzyme combination and combination and specially developed specially developed reaction buffer ensure reaction buffer ensure efficient reverse efficient reverse transcription and PCR transcription and PCR in one tube. in one tube.

RT-PCR in one step RT-PCR in one step The Robus™ T I Kit is baseThe Robus™ T I Kit is base

RobusT RT-PCR RobusT RT-PCR Kits perform Kits perform cDNA synthesis cDNA synthesis and PCR and PCR amplification of amplification of cDNA cDNA successively in a successively in a single tube single tube during a during a continuous continuous thermal cyclingthermal cycling

Uses and Advantages in Uses and Advantages in Testing by PCR MethodsTesting by PCR Methods

Clinical diagnostics: detection and Clinical diagnostics: detection and quantification of infectious microorganisms, quantification of infectious microorganisms, cancer cells and genetic disorders cancer cells and genetic disorders

Capable of amplifying long targets, up to Capable of amplifying long targets, up to 6.0 kb 6.0 kb

One-tube system allows rapid, sensitive and One-tube system allows rapid, sensitive and reproducible analysis of RNA with minimal reproducible analysis of RNA with minimal risk of sample contamination risk of sample contamination

Amplifies products from a wide variety of Amplifies products from a wide variety of total RNA or mRNA sources total RNA or mRNA sources

AdvantagesMolecular methods

•High sensitivity and specificity•Detects pathogen, not immune response•Quick results•High transport toleration

In-house (home-brew) PCR methods•Cost effective•High sensitivity•High quality•Fast implementation of scientific discoveries•Customer friendly

R&D is absolutely necessary

AdvantagesMolecular methods

•High sensitivity and specificity•Detects pathogen, not immune response•Quick results•High transport toleration

In-house (home-brew) PCR methods•Cost effective•High sensitivity•High quality•Fast implementation of scientific discoveries•Customer friendlyDoctortvrao’s ‘e’ learning seriesDoctortvrao’s ‘e’ learning series

R&D is absolutely necessary

ESTABLISHMENT OF A PCR ESTABLISHMENT OF A PCR LABORATORYLABORATORY

To perform PCR for To perform PCR for the repetitive the repetitive detection of a specific detection of a specific sequence, three sequence, three distinct laboratory distinct laboratory areas are required. areas are required. The The specific specific technical technical operations,operations, reagentsreagents ,and ,and personnel personnel considerationsconsiderations

Prevention of Prevention of Contamination in PCR Contamination in PCR

LaboratoryLaboratory PCR contamination be considered as PCR contamination be considered as

a form ofa form of infectioninfection. If standard . If standard sterile techniques that would be sterile techniques that would be applied to tissue culture or applied to tissue culture or microbiological manipulations are microbiological manipulations are applied to PCR, then the risk of applied to PCR, then the risk of contamination will be greatly contamination will be greatly reduced. Above all else, common reduced. Above all else, common sense should prevail.sense should prevail.

Avoiding contaminationAvoiding contamination The single most important source of PCR The single most important source of PCR

product contamination is the generation of product contamination is the generation of aerosols of PCR amplicons that is aerosols of PCR amplicons that is associated with the post-PCR analysis. associated with the post-PCR analysis. Methods for eliminating this aerosol range Methods for eliminating this aerosol range from physical design of laboratories and use from physical design of laboratories and use of specific pipettes to chemical and of specific pipettes to chemical and enzymatic approaches. The choice of enzymatic approaches. The choice of method is often dependent on the method is often dependent on the frequency of amplification of a target frequency of amplification of a target amplicon and the relative amounts and amplicon and the relative amounts and concentrations of the amplicons created by concentrations of the amplicons created by the PCR.the PCR.


PCR laboratory

Sample handling

DNA preparation

Clean room

Stock solutions

Laboratory

Mixing site

Thermocycler

Amplification

Detection

Documentation

QC & QAQuality control & assurance

R & D(Research and development)

Alternatives: - commercial kits - robots + kits

No alternative

Aseptic Handling of Aseptic Handling of Specimen a Top PrioritySpecimen a Top Priority

Machines can be Operated Machines can be Operated in limited Spacein limited Space

ContaminationContamination

PCR allows the PCR allows the production of more production of more than 10 million copies than 10 million copies of a target DNA of a target DNA sequence from only a sequence from only a few molecules of few molecules of DNA. The sensitivity DNA. The sensitivity of PCR means that of PCR means that the sample used for the sample used for PCR should not be PCR should not be contaminated with contaminated with any other any other DNA’s that DNA’s that may reside in the may reside in the laboratory laboratory environment. environment.


CCan we do betteran we do better ? ?

Create networking between laboratoriesCreate networking between laboratories Take second opinionTake second opinion

Honest dialogue with doctorsHonest dialogue with doctors EducationEducation

Concentration into specialized laboratoriesConcentration into specialized laboratories QC + QC + QC – to build up the trustQC + QC + QC – to build up the trust

A Drop of Blood decides A Drop of Blood decides Human DestinyHuman Destiny

ConclusionConclusionPCR is not only vital in the clinical PCR is not only vital in the clinical

laboratory by amplifying small amounts laboratory by amplifying small amounts of DNA in infectious diseases, but it is of DNA in infectious diseases, but it is also important for genetic predisposing also important for genetic predisposing for defects in Genetic disorders. for defects in Genetic disorders.

The PCR technology can also be employed The PCR technology can also be employed in law enforcement, genetic testing of in law enforcement, genetic testing of animal stocks and vegetable hybrids, animal stocks and vegetable hybrids, and drug screening along with many and drug screening along with many more areas. more areas.

Dr. Kary Banks Mullis on Dr. Kary Banks Mullis on Wisdom of Creative NatureWisdom of Creative Nature

Science, like nothing else Science, like nothing else among the institutions of among the institutions of mankind, grows like a mankind, grows like a weed every year.weed every year.

We not only can luxuriate We not only can luxuriate in its weed-like growth, but in its weed-like growth, but we can each of us be a we can each of us be a creative and active part of creative and active part of it if we so desire. it if we so desire.

There is no stopping it, There is no stopping it, nor can there be any end nor can there be any end to it." to it."


Playing well with Genes Playing well with Genes Can Change Life ?Can Change Life ?

Created for Awareness Created for Awareness in Developing World on in Developing World on Emerging Technologies Emerging Technologies

in Microbiologyin Microbiology

Dr.T.V.Rao MDDr.T.V.Rao MD

EmailEmail

[email protected]@gmail.com

Documents

Amplificationtechniquesinmicrobiology 090609205257-phpapp02