2. Principles of Inheritance

Embed Size (px)

Citation preview

  • 7/29/2019 2. Principles of Inheritance

    1/52

    Most slide were adapted directly from various sources in the internet

  • 7/29/2019 2. Principles of Inheritance

    2/52

    Native Hybrid

    S

    EL

    E

    C

    T

    I

    V

    E

    breeding

  • 7/29/2019 2. Principles of Inheritance

    3/52

    8000-3000 BC. Egyptian domestication of animals

  • 7/29/2019 2. Principles of Inheritance

    4/52

    How are traits passed on from

    parents to children?

    The study of how traits are inherited or

    how genetic information is passed from

    one generation to the next is called

    GENETICS

    Genetics also explains biological variation

  • 7/29/2019 2. Principles of Inheritance

    5/52

    1. Pre-Mendelian blending theory

    2. Gene theory (which traces back to

    Mendel)

    How are traits passed on from

    parents to children?

  • 7/29/2019 2. Principles of Inheritance

    6/52

    1. 19th Century Hypothesis(before Mendel)

    inheritance was the blending ofcharacteristics

    We look somewhat like our parents characteristics were merely added together:

    the next generation is a blend

    How would the population look like

    after many generations?

  • 7/29/2019 2. Principles of Inheritance

    7/52

    Blending in Parakeet:

    Yellow x Green = Blue?

    Several shades!!!

  • 7/29/2019 2. Principles of Inheritance

    8/52

    Fact: There is tremendous diversity of life forms

    About 8.8 million species; onlya quarter has been discovered!!!

  • 7/29/2019 2. Principles of Inheritance

    9/52

    inheritance as the blending ofcharacteristics was incorrect

    No one studied theproblem systematicallyuntil Gregor Mendel

    (1822-1884)

    1. 19th Century Hypothesis(before Mendel)

  • 7/29/2019 2. Principles of Inheritance

    10/52

    Gregor Mendel (1822-1884)

    A little known Austrian monk (flunked out ofcollege twice but became a mathematician)

    Spent adult life in relative obscurity doing

    basic genetics research and teaching highschool mathematics, physics, and Greek inBrno, Czech Republic

    Published his ideas in 1866; work largely wentunrecognized until 1900, which was long afterhis death.

  • 7/29/2019 2. Principles of Inheritance

    11/52

    Why study Mendel

    He was the first to demonstrate the principles

    of inheritance

    He used a systematic scheme based upon an

    understanding of mathematics and statistics

    before formal statistics was developed

    He applied his knowledge of mathematics

    with an excellent scientific method

  • 7/29/2019 2. Principles of Inheritance

    12/52

    2. Today: The gene theory

    An alternative idea to blending is the

    gene idea.

    Parents pass on discrete individualheritable units called genes

    Genes are segments of DNA in a

    chromosome A gene has different forms/variations

    called alleles

  • 7/29/2019 2. Principles of Inheritance

    13/52

  • 7/29/2019 2. Principles of Inheritance

    14/52

    What is a gene?

    A gene is a stretch of DNA whose sequencedetermines the structure and function of a

    specific functional molecule (usually a protein)

    DNA

    Protein

    GAATTCTAATCTCCCTCTC

    AACCCTACAGTCACCCATTT

    GGTATATTAAAGATGTGTTG

    TCTACTGTCTAGTATCC

    Computer program

    Specific function

    functionsf(){document.

    f.q.focus()}

    Working copymRNA

  • 7/29/2019 2. Principles of Inheritance

    15/52

    Homologous chromosomes bear the two

    alleles for each characteristic

    Alternative forms of a gene reside at the samelocus on homologous chromosomes

  • 7/29/2019 2. Principles of Inheritance

    16/52

    DNA

    (deoxyribonucleic acid)

    mRNA

    Protein

  • 7/29/2019 2. Principles of Inheritance

    17/52

    Karyotyping

    is matching

    the paired

    chromosomes

  • 7/29/2019 2. Principles of Inheritance

    18/52

    Down syndrome karyotype

    (trisomy 21)

  • 7/29/2019 2. Principles of Inheritance

    19/52

    Mendels experiments

  • 7/29/2019 2. Principles of Inheritance

    20/52

    Mendels

    data

  • 7/29/2019 2. Principles of Inheritance

    21/52

    Mendel deduced the underlying principles of

    genetics from these patterns

    1. Segregation

    2. Dominance

    3. Independent

    assortment

  • 7/29/2019 2. Principles of Inheritance

    22/52

    1. Mendels Law of Segregation

    A normal (somatic) cell has two variants (alleles) for aMendelian trait.

    A gamete (sperm, egg, pollen, ovule) contains one allele,

    randomly chosen from the two somatic alleles.

    E.g. if you have one allele forbrown eyes (B) and one for

    blue eyes (b), somatic cells

    have Bb and each gamete

    will carry one of B or b

    chosen randomly.

    B b

    B BB Bb

    b Bb bb

    Eggs

    Sperm

  • 7/29/2019 2. Principles of Inheritance

    23/52

    Two types of cell division

    Mitosis Meiosis

    All body cells Sex cells:

    egg/sperm

    2 daughter cells 4 d-cells

    Equal # of

    chromosome/s

    Half of the number

  • 7/29/2019 2. Principles of Inheritance

    24/52

    1. Mitosis: by all body cells

    Cell cycle:

    G Growth

    S - Synthesis

    M - Mitosis

    Homologoue = pair of the same type of chromatids

    Diploid = paired state

    Haploid = unpaired

  • 7/29/2019 2. Principles of Inheritance

    25/52

    2. Meiosis: in gametes (sperm or egg) only

    Gametes are either egg or spermChiasma point of crossing over (recombination)

  • 7/29/2019 2. Principles of Inheritance

    26/52

    Meiosis in a Nutshell

    Meiosis is a special type of cell division that

    occurs in sexually reproducing organisms.

    It reduces the chromosome number by half,enabling sexual recombination to occur.

    Itensures that an organism has the samenumberof chromosomes in each generation.

  • 7/29/2019 2. Principles of Inheritance

    27/52

    Terminology

    Haploid:

    containing one

    copy of each

    chromosome

    (n=23)

    B b

    B BB Bb

    b Bb bbEggs

    Sperm

    Diploid:

    containing two

    copies of eachchromosome

    (2n=46)

    Punnett Square of a Monohybrid Cross

  • 7/29/2019 2. Principles of Inheritance

    28/52

    Terminology

    Genotype: the states of the two alleles at one

    or more locus associated with a trait

    Phenotype: the state of the observable trait

    Genotype Phenotype

    BB (homozygous) Brown eyes

    Bb (heterozygous) Brown eyes

    bb (homozygous) Blue eyes

  • 7/29/2019 2. Principles of Inheritance

    29/52

    2. Mendels Law of Dominance

    If your two alleles are different (heterozygous,e.g. Bb), the trait associated with only one of

    these will be visible (dominant) while the

    other will be hidden (recessive).E.g. B is dominant

    b is recessive

    B b

    B BB Bb

    b Bb bb

    Eggs

    Sperm

  • 7/29/2019 2. Principles of Inheritance

    30/52

    2. Law of Dominance...

    If your two alleles are different (heterozygous, e.g. Bb),the trait associated with only one of these will be visible

    (dominant) while the other will be hidden (recessive).

    E.g. B is dominant, b is recessive.

    B b

    B BB Bb

    b Bb bb

    Eggs

    Sperm

  • 7/29/2019 2. Principles of Inheritance

    31/52

    3. Mendels Law ofIndependent

    Assortment

    Knowledge of which allele has been inherited at one

    locus gives no information on the allele that has been

    inherited at the other locus

    S/s Y/y

    SY Sy sY sy

    25% 25% 25% 25%

  • 7/29/2019 2. Principles of Inheritance

    32/52

    S Y

    s y

    Gametophytes

    (gamete-

    producing

    cells)

    S Y

    s yGametes

    S y

    s YRecombinants

    Recombination

    Segregation

    3. Law ofIndependent Assortment.

    Red father

    Blue - mother

  • 7/29/2019 2. Principles of Inheritance

    33/52

    Simplified view of eye colour inheritance: bi-

    allelic Mendelian trait

    - Brown dominant: BB, Bb

    Blue recessive: bb

    Human eye colour

    B b

    B BB Bb

    b Bb bbEggs

    Sperm

  • 7/29/2019 2. Principles of Inheritance

    34/52

    Human eye colour

    ?

    B?

    B?B?B? bb

    bb B?

    BB, Bb (Brown, dominant) Bb (blue, recessive)

    What are the possible eye color/s of this child?

  • 7/29/2019 2. Principles of Inheritance

    35/52

    Non-Mendelian Inheritance:

    Incomplete Dominance

    Some alleles for a

    gene are not

    completely

    dominant over the

    others. Thisresults in partially

    masked

    phenotypes which

    are intermediate tothe two extremes.

  • 7/29/2019 2. Principles of Inheritance

    36/52

    Non-Mendelian : Sex Linkage

    All chromosomes are homologous except on

    sex chromosomes.

    Sex chromosomes are eitherX orY.

    If an organism is XX, it is a female, if XY it ismale.

    If a recessive allele exists on the X

    chromosome. It will not have a corresponding

    allele on the Y chromosome, and will therefore

    always be expressed

  • 7/29/2019 2. Principles of Inheritance

    37/52

    The 23rd pair of chromosome during

    fertilization

    Possible

    combinations

    Sex: F F M M 1 female: 1 male

  • 7/29/2019 2. Principles of Inheritance

    38/52

    Human Sex Linkage

    Hemophilia (X-linked): Disorder of the blood

    where clotting does notoccur properly due to afaulty protein.

    Occurs on the Xchromosome, and isrecessive.

    Thus a vast majority ofthose affected are males.

    First known person knownto carry the disorder was

    Queen Victoria of England.Thus all those affected arerelated to Europeanroyalty.

    P f di i h i k f 1000 f

  • 7/29/2019 2. Principles of Inheritance

    39/52

    Patterns of disease inheritance known for 1000s of

    years, e.g. haemophilia

  • 7/29/2019 2. Principles of Inheritance

    40/52

    Colour blindness is usually passed down from

    mother to son on the 23rd chromosome (X-linked)

  • 7/29/2019 2. Principles of Inheritance

    41/52

  • 7/29/2019 2. Principles of Inheritance

    42/52

  • 7/29/2019 2. Principles of Inheritance

    43/52

    Y-linked inheritance

    baldness hairy ear lobes

  • 7/29/2019 2. Principles of Inheritance

    44/52

    Phenotypes are controlled by more than 1 allele. Eg. Blood types

    are regulated by 3 separate genes.

    ABO Blood typing Humans have multiple types of surface antigens on RBC's

    The nature of these surface proteins determines a person'sBlood Type.

    There are 3 alleles which determine blood type IA, IB, or IO. Thisis referred to as having multiple alleles

    Human blood types are designated as A, B or O. Type A denotes having the A surface antigen, and is denoted by IA

    Type B denotes having the B surface antigen, and is denoted by IB

    Type O denotes having neither A or B surface antigen, and isdenoted by IO

    There are several blood type combinations possibleA , B, AB (Universal recipient) , O (Universal donor)

    Non-Mendelian: Multiple Alleles

  • 7/29/2019 2. Principles of Inheritance

    45/52

    Non-Mendellian: Continuous Variation

    Many traits

    may have a

    wide range of

    continuous

    values. Eg.Human height

    can vary

    considerably.

    There are notjust "tall" or

    "short" humans

  • 7/29/2019 2. Principles of Inheritance

    46/52

    Non-Mendelian: mtDNA

    Mitochondrial DNA point mutations are maternally inherited and can

    occur in rRNA or tRNA genes, or in genes coding for proteins of

    respiratory chain complexes.

  • 7/29/2019 2. Principles of Inheritance

    47/52

    Phenotypes associated with mtDNA

    mutations

    Longevity

    Stroke

    Seizures Reduced sperm motility

    Common migraine

    Bipolar disorder Exercise intolerance,

    fatigability

  • 7/29/2019 2. Principles of Inheritance

    48/52

    Non-Mendellian:

    Gene interaction: Many biological pathways are governed by multiple

    enzymes, involving multiple steps. If any one of thesesteps are altered. The end product of the pathway

    may be disrupted.

    Environmental effects: Sometimes genes will not be fully expressed owing to

    external factors. Example: Human height may not befully expressed if individuals experience poornutrition.

  • 7/29/2019 2. Principles of Inheritance

    49/52

    Summary

    Mendel deduced three simple laws ofinheritance:

    Segregation

    Dominance Random assortment

    The majority of traits dont follow these

    rules but Mendels laws are neverthelesscrucial to understanding almost all genetic

    inheritance

  • 7/29/2019 2. Principles of Inheritance

    50/52

    Levels of biological diversity:

    Species diversity

    Ecosystem diversity

    Genetic diversity Molecular diversity

  • 7/29/2019 2. Principles of Inheritance

    51/52

    Watch

    http://highered.mcgraw-

    hill.com/sites/0072495855/student_view0/ch

    apter2/animation__mitosis_and_cytokinesis.h

    tml

    http://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.html
  • 7/29/2019 2. Principles of Inheritance

    52/52

    Web sites to check

    http://gslc.genetics.utah.edu/units/basics/tour/inheritance.swf

    http://science.nhmccd.edu/biol/genetics.html

    http://library.thinkquest.org/20465/games.html

    http://gslc.genetics.utah.edu/units/basics/tour/inheritance.swfhttp://gslc.genetics.utah.edu/units/basics/tour/inheritance.swfhttp://science.nhmccd.edu/biol/genetics.htmlhttp://library.thinkquest.org/20465/games.htmlhttp://library.thinkquest.org/20465/games.htmlhttp://library.thinkquest.org/20465/games.htmlhttp://library.thinkquest.org/20465/games.htmlhttp://science.nhmccd.edu/biol/genetics.htmlhttp://gslc.genetics.utah.edu/units/basics/tour/inheritance.swfhttp://gslc.genetics.utah.edu/units/basics/tour/inheritance.swf